Sorghum aphid MsGld65 gene, encoded protein, dsRNA and application thereof

By silencing the MsGld65 gene of the sorghum aphid using RNA interference technology, and preparing products using dsRNA to inhibit the growth and reproduction of the sorghum aphid, the problem of sorghum aphid damage to sorghum and the environmental pollution caused by chemical control were solved, achieving a highly efficient and environmentally friendly control effect.

CN122012516BActive Publication Date: 2026-08-25ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610475733.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-04-13
Publication Date
2026-08-25
Estimated Expiration
2046-04-13

AI Technical Summary

Technical Problem

Sorghum aphids cause serious damage to sorghum, and traditional chemical control methods have problems such as environmental pollution and pesticide resistance. There is a need for an efficient and environmentally friendly control method.

Method used

Using RNA interference technology, dsRNA of the MsGld65 gene of sorghum aphid was designed. Sorghum aphids were artificially fed to silence the expression of the MsGld65 gene. Related products were prepared using recombinant DNA, expression cassettes, plasmid vectors or engineered bacteria to inhibit the growth and reproduction of sorghum aphids.

Benefits of technology

It significantly reduces the survival and reproduction rate of sorghum aphids, regulates the content of salicylic acid and reactive oxygen species in sorghum, reduces pesticide use, and maintains ecological balance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012516B_ABST
    Figure CN122012516B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of biological control, and particularly relates to a highland brome aphid MsGld65 gene, its encoded protein, dsRNA and application thereof. The present application screens a highland brome aphid protein capable of being secreted into highland brome cells MsGld65 , the protein and its encoding gene can inhibit the content of salicylic acid and active oxygen in highland brome. According to the cDNA sequence of the highland brome aphid MsGld65 gene, a dsRNA against the gene is designed, and the dsRNA is introduced into the highland brome aphid body through artificial feeding, and it is found that the dsRNA can significantly inhibit the highland brome aphid MsGld65 gene, and further affect the survival rate and reproduction rate of the highland brome aphid, therefore, MsGld65 the gene can be used as an RNAi target gene for aphid control, which is beneficial to reduce the use of pesticides and maintain the ecological balance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological control technology, specifically relating to sorghum aphids. MsGld65 Genes, their encoded proteins, dsRNAs, and their applications. Background Technology

[0002] Sorghum is the world's fifth largest food crop and one of the earliest cultivated cereal crops in China, holding an extremely important position in agricultural production. Sorghum possesses strong resistance to drought, flooding, salinity, poor soil, and high temperatures, making it suitable for food, feed, brewing, bioenergy, and chemical materials. It is one of the most promising dual-purpose crops for both food and feed, as well as an energy plant. However, sorghum seedlings are susceptible to sorghum aphids (… Melanaphis sacchari The sorghum aphid is a major pest of sorghum production in my country, with a single plant potentially infested with up to 30,000 aphids. Using their piercing-sucking mouthparts, the aphid penetrates the plant, feeding on the sap from the underside of leaves and the phloem of stems, and excreting honeydew, a high-sugar substance. This not only promotes fungal growth but also causes nutrient loss, leading to reduced yields and even the death of the entire plant. Furthermore, the sorghum aphid acts as a vector for plant viral diseases such as red leaf disease in cereals, yellow leaf disease in sugarcane, and sugarcane mosaic virus, indirectly harming crops. If insecticides are used, yield losses caused by sorghum aphids can reach 46%-78%, and the aphids severely impact various economic traits of sorghum, such as reducing grain protein content, significantly decreasing stem sugar content, and causing damaged stems to be unsuitable for storage, resulting in devastating damage. Therefore, effective control of sorghum aphids is crucial for ensuring sorghum yield and quality.

[0003] Traditional methods for controlling sorghum aphids include the use of chemical pesticides. Chemical control is fast-acting, highly effective, and not limited by region or time. However, the large-scale use of chemical pesticides can cause environmental pollution, which is inconsistent with the theme of green development. Furthermore, pesticide residues in sorghum can harm humans and livestock. Long-term use of chemical pesticides can also cause aphids to develop resistance, thus losing their control effect.

[0004] RNA interference (RNAi) refers to the entry of double-stranded RNA (dsRNA) into cells to guide the efficient and specific degradation of homologous mRNA, thereby inhibiting and downregulating the expression of target genes. Currently, RNAi technology has been widely studied and applied in modern agriculture. Silenting target genes through artificial feeding, microinjection of dsRNA, and nanoparticle-mediated methods has been widely used in the identification and analysis of insect gene function. Therefore, identifying key genes in sorghum aphids that enable RNAi biocontrol is of great significance for ensuring my country's food security and environmental safety.

[0005] The information disclosed in this background section is intended only to enhance the understanding of the background technology of this disclosure and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0006] To address the problems existing in the prior art, the purpose of this invention is to design and provide a sorghum aphid MsGld65 Technical solutions for genes, their encoded proteins, dsRNA, and their applications.

[0007] This invention is specifically achieved through the following technical solutions: The first aspect of this invention provides a sorghum aphid gene. MsGld65 Its nucleotide sequence is shown in SEQ ID NO.1.

[0008] The second aspect of this invention provides the aforementioned sorghum aphid gene. MsGld65 The encoded protein has the amino acid sequence shown in SEQ ID NO.2.

[0009] A third aspect of the present invention provides a method for inhibiting the above-mentioned sorghum aphid gene. MsGld65 The expressed dsRNA is a double-stranded RNA composed of nucleotides of the sequence shown in SEQ ID NO.3 and its reverse complementary sequence.

[0010] The fourth aspect of this invention provides a biological material having the aforementioned sorghum aphid gene. MsGld65 , encoding proteins or dsRNA.

[0011] Furthermore, the biological materials include recombinant DNA, expression cassettes, plasmid vectors, viral vectors, or engineered bacteria.

[0012] The fifth aspect of this invention provides the aforementioned sorghum aphid gene. MsGld65 The application of proteins, dsRNAs, or biological materials in the preparation of the following products, specifically including: (1) Controlling sorghum aphids or preparing products for controlling sorghum aphids; (2) Reduce the survival rate of sorghum aphids or prepare products that reduce the survival rate of sorghum aphids; (3) Suppressing the sorghum aphid gene MsGld65 Expressing or preparing genes that inhibit sorghum aphids MsGld65 The product being expressed; (4) Adjust the content of salicylic acid and reactive oxygen species in sorghum or prepare products that adjust the content of salicylic acid and reactive oxygen species in sorghum; (5) Inhibit the reproduction and / or growth of sorghum aphids or prepare products that inhibit the reproduction and / or growth of sorghum aphids.

[0013] A sixth aspect of the present invention provides a product containing an active ingredient, said active ingredient including the aforementioned sorghum aphid gene. MsGld65 , encoding proteins, dsRNA, or biological materials.

[0014] Furthermore, the product has at least one of the following functions: (1) Control of sorghum aphids; (2) Reduce the survival rate of sorghum aphids; (3) Suppressing the sorghum aphid gene MsGld65 Express; (4) Regulate the immune response of sorghum and / or the hydrogen peroxide content of sorghum; (5) Inhibit the reproduction and / or growth of sorghum aphids.

[0015] The seventh aspect of this invention provides the application of the above-mentioned product in the biological control of sorghum aphids.

[0016] The present invention has the following beneficial effects: The sorghum aphid protein MsGld65, which can be secreted into sorghum cells, was screened out. This protein and its encoding gene can inhibit the content of salicylic acid and reactive oxygen species in sorghum.

[0017] According to sorghum aphids MsGld65 The cDNA sequence of the gene was obtained, and a dsRNA targeting this gene was designed. This dsRNA was introduced into sorghum aphids via artificial feeding, and it was found to significantly inhibit sorghum aphid growth. MsGld65 Genes, which in turn affect the survival and reproductive rates of sorghum aphids, therefore, MsGld65 The gene can be used as an RNAi target gene for aphid control, which helps reduce pesticide use and maintain ecological balance. Attached Figure Description

[0018] Figure 1 Agarose gel electrophoresis image to detect whether the sorghum aphid salivary protein MsGld65 can be secreted onto sorghum; Figure 2 For ds MsGld65 and ds GFP Agarose gel electrophoresis image; Figure 3 After dripping dsRNA MsGld65 Results of relative gene expression level analysis; among which, ds GFP Feeding ds GFP sorghum aphid; ds MsGld65 Feeding ds MsGld65 sorghum aphids; ns indicates no significant difference; * indicates a significant difference ( P <0.05); ** indicates a significant difference ( P <0.01); Figure 4 The results show the reproduction rate and survival time of sorghum aphids after artificial feeding; where A: the reproduction rate of sorghum aphids after drip feeding, and B: the survival time of sorghum aphids after drip feeding. Figure 5 For silence MsGld65 The results of changes in salicylic acid content in sorghum sorghum caused by sorghum aphid feeding; ns indicates no significant difference; * indicates a significant difference. P <0.05); ** indicates a significant difference ( P <0.01); Figure 6 For silence MsGld65 Results of changes in reactive oxygen species content in sorghum sorghum caused by sorghum aphid feeding; ns indicates no significant difference; * indicates a significant difference ( P <0.05); ** indicates a significant difference ( P <0.01). Detailed Implementation

[0019] The specific implementation of this application will be described below with reference to the embodiments. However, the following embodiments are only used to illustrate this application in detail and do not limit the scope of this application in any way.

[0020] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; unless otherwise specified, the reagents involved are all commercially available conventional reagents; unless otherwise specified, the detection methods involved are all conventional methods.

[0021] Example 1: The difference between leaves fed on and those not fed on by sorghum aphids MsGld65 Gene identification This example uses PCR to compare the sorghum leaves fed on and those not fed by sorghum aphids. MsGld65 Genetic analysis identified a sorghum aphid protein, MsGld65, that can be secreted into sorghum cells. Its amino acid sequence is shown in SEQ ID NO.2. Primers were designed based on the coding sequence of this protein. MsGld65 -F: 5'-GGTGGTGGTAATGCGGGATG-3' (SEQ ID NO.4); MsGld65 -R: 5'-CGGTCGCCTTCATTGCTGTT-3' (SEQ ID NO. 5).

[0022] The amino acid sequence of the sorghum aphid protein MsGld65 is shown in SEQ ID NO.2, and the sorghum aphid gene encoding this protein is also shown. MsGld65 The nucleotide sequence is shown in SEQ ID NO.1.

[0023] PCR amplification was performed using cDNA from sorghum leaves after aphid infestation and from uninfested sorghum leaves as templates, employing a 25 μL reaction mixture of 2XTap PCR Mix enzyme. The PCR conditions were: 94℃ pre-denaturation for 3 min; 98℃ denaturation for 30 s; 60℃ annealing for 30 s / kb; and 72℃ extension for 30 cycles. The PCR reaction system is shown in Table 1.

[0024] Table 1 PCR reaction system Double distilled water 9.5 μL 2Xtap PCR Mix enzyme 12.5 μL upstream primer F 1 μL Downstream primer R 1 μL cDNA 1 μL .

[0025] After PCR amplification, the amplification products were subjected to electrophoresis to detect the bands. The results are as follows: Figure 1 As shown in the figure. The results indicate that the target gene can be detected in leaves fed by sorghum aphids, but not in non-fed leaves. This suggests that the protein gene can be secreted into sorghum leaves.

[0026] Example 2: ds MsGld65 and its control ds GFP Preparation Using cDNA from the sorghum aphid as a template, ds MsGld65 -F, ds MsGld65 -R is the primer (the underlined region is the T7 RNA polymerase promoter sequence) for PCR amplification to obtain the PCR amplification product.

[0027] F: 5'- TAATACGACTCACTATAGGG GCTCAGATATTGTTGGCTTC-3' (SEQ ID NO. 6); R: 5'- TAATACGACTCACTATAGGG GTATTTGAATGGCTTCAAGG-3' (SEQ ID NO. 7).

[0028] Using a GFP-containing plasmid as a template, PCR amplification was performed using dsGFP-F and dsGFP-R primers (the underlined region is the T7 RNA polymerase promoter sequence) to obtain the PCR amplification product.

[0029] F: 5'- TAATACGACTCACTATAGGG TCCATGGCCAACACTTGTCA-3' (SEQ ID NO. 8); R: 5'- TAATACGACTCACTATAGGG AGGGCAGATTGTGTGGACAG-3' (SEQ ID NO. 9).

[0030] The amplification product was purified and recovered to a concentration of 1 μg / μL, and used as a template for dsRNA synthesis.

[0031] dsRNA was prepared using the T7 RNAi Transcription Kit (Nanjing Novizan Biotechnology Co., Ltd., Nanjing, China), and the concentration was adjusted to 1000 ng / μL. The preparation method was as follows: NTP Mix: 8 μL, 10×Transcription Buffer: 2 μL, T7 Enzyme Mix: 2 μL, DNA template: 1-4 μL, RNase-free H2O: up to 20 μL. The reaction was carried out at 37℃ for 2 h in a PCR instrument. 100 U / μL RNase Ti was diluted to 10 U / μL with RNase T1 Dilution Buffer. The double-enzyme digestion system was prepared as follows: Transcription Product (first step product): 20 μL; RNase-free H2O: 17 μL; DNase I: 1 μL; RNase T1 (10 U / μL): 2 μL; Total: 40 μL. After mixing, gently pipette to mix thoroughly and briefly centrifuge the reagent to the bottom of the tube; incubate at 37°C for 30 min; detect the transcription product by electrophoresis; purify the product by adding 200 μL of chloroform, vortexing vigorously, and incubating on ice for 10 min; centrifuge at 12000 rpm for 15 min at 4°C; carefully aspirate 400 μL of supernatant into a new 1.5 mL RNase-free centrifuge tube, add an equal volume of isopropanol solution, invert to mix thoroughly, and incubate at room temperature for 10 min; centrifuge at 12000 rpm for 10 min at 4°C; discard the supernatant, add 1 mL of 75% ethanol solution to the precipitate, and centrifuge at 12000 rpm for 5 min at 4°C; repeat 2-3 times; discard the supernatant, and air-dry the centrifuge tube to remove residual ethanol solution; dissolve dsRNA in 20 μL - 60 μL of RNase-free H2O, and transfer the dsRNA sample to a Nano Drop 2000... The concentration was determined using a spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA). RNase-free H₂O was added in small, repeated additions until the concentration reached 1000 ng / μL. The solution was then stored at -80°C for later use. (Note: ds...) MsGld65 The nucleotide sequence is shown in SEQ ID NO.3. Figure 2 The results of agarose gel electrophoresis of double-stranded RNA (dsRNA) synthesized using the T7 RNAi transcription kit are presented, used to verify the synthesis quality and integrity of the target and control dsRNAs in the RNA interference (RNAi) experiment. A clear, single band appeared at approximately 513 bp, consistent with the theoretically designed target fragment size, indicating... MsGld65The dsRNA of the gene was successfully synthesized without significant nonspecific amplification or degradation. A clear, single band appeared at approximately 496 bp, consistent with the control gene. GFP The theoretical amplified fragments were the same size, indicating that the control dsRNA was also successfully synthesized and can serve as a valid negative control for subsequent RNAi experiments. All bands were single, sharp, without obvious tailing, diffusion, or stray bands, indicating that the dsRNA was synthesized efficiently and with good purity, without serious degradation, meeting the requirements for subsequent RNAi experiments.

[0032] Example 3: ds MsGld65 and ds GFP Drip and effect detection Prepare a dsRNA-nanomaterial SPc-surfactant APG mixed solution (the nanomaterial SPc and surfactant APG were provided by the laboratory of China Agricultural University): Mix the SPc solution with dsRNA at a mass ratio of 1:1 and incubate for 15 min before use; add the surfactant (APG, 10%) to the above mixture to a final concentration of 1%.

[0033] Drip aphids: Drip 0.5 μL of a mixed solution of dsRNA-nanomaterial SPc-surfactant APG onto the back of each sorghum aphid.

[0034] Sampling was initiated 6 h, 12 h, 24 h, and 48 h after dripping sorghum aphids. Each replicate consisted of 20 aphids, and the results were repeated three times. Sorghum aphids dripping dsGFP were used as a control. Changes in gene expression levels were verified by qRT-PCR.

[0035] The specific operation is as follows: After sampling, RNA was extracted, and (7) cDNA was obtained by reverse transcription using the Polestar 1st cDNA Synthesis Kit (gDNA removal) (Beijing Baoying Tonghui Biotechnology Co., Ltd., Beijing, China). The reaction system was as follows: Total RNA: 2 μg; 5×Polestar RT MasterMix (with dsDNase): 4 μL; 20×Oligo dT (25) & Random Primer: 1 μL; LRNase Free H2O: Up to 20 μL. The reaction program was as follows: 25℃: 10 min (primer pairing); 55℃: 0-60 min (cDNA synthesis); 85℃: 5 min (MLV inactivation). The obtained cDNA was stored in a -20℃ freezer for subsequent use.

[0036] Internal reference gene EF1α Primers: EF1α-F: 5'-TCATTGACGCACCTGGAC-3' (SEQ ID NO. 10); EF1α- R: 5'-AAGACCACACCATACCG-3' (SEQ ID NO. 11).

[0037] MsGld65 quantitative primers: QMsGld65-F: 5'-TGGCAATATGTTGACGGAGA-3' (SEQ ID NO. 12); QMsGld65-R: 5'-ATTCCCAGTGCTCATCATGGTC-3' (SEQ ID NO. 13).

[0038] The results are as follows Figure 3 As shown, with droplets ds GFP Compared with the control group, intravenous ds MsGld65 6 h and 12 h sorghum aphids in body MsGld65 The relative expression level of the gene was significantly reduced, showing a highly significant difference compared to the control. P <0.01). This indicates that through droplet ds MsGld65 Can induce sorghum aphids MsGld65 RNA interference with genes leads to a significant decrease in gene expression levels.

[0039] Example 4: Detection of growth and development of sorghum aphids after drip irrigation Experiment on the reproduction rate of sorghum aphids: Sorghum aphids were divided into two groups, with 60 adult sorghum aphids in each group treated with ds. GFP and drops of ds MsGld65 Place them in a petri dish and record the daily reproduction rate of sorghum aphids until they die. Results are as follows: Figure 4 As shown in part A of the diagram, droplets ds MsGld65 The number of sorghum aphids laid afterward decreased significantly. This indicates that ds MsGld65 By inhibiting MsGld65 The level of gene expression, in turn, affects the reproduction of sorghum aphids.

[0040] Experiment on the survival time of sorghum aphids: Sorghum aphids were divided into two groups, with 60 adult sorghum aphids in each group being dripped with ds GFP and drops of ds MsGld65 Place them in petri dishes and record the survival rate of each group of sorghum aphids until all aphids die. The results are as follows: Figure 4 As shown in part B, droplets ds MsGld65 The survival time of sorghum aphids was significantly reduced after the control group (ds GFP Compared to silence Gld65 Gene treatment group (ds Gld65The survival rate of sorghum aphids decreased significantly faster, and their survival time was markedly shortened. The survival rate of aphids in the control group decreased relatively slowly in the early stages of the experiment, only approaching zero around day 25; however, the survival rate of aphids in the treatment group decreased rapidly from the beginning, with only about 40% survival on day 5, and almost all dying by day 20. This result indicates that... Gld65 This gene is crucial for the survival of the sorghum aphid, and its functional silencing can significantly reduce the aphid's survival ability, providing important evidence for its potential role as a target for sorghum aphid control. MsGld65 By inhibiting MsGld65 The level of gene expression, in turn, affects the survival of sorghum aphids.

[0041] Example 5: Detection of sorghum aphids MsGld65 After gene silencing, the salicylic acid and reactive oxygen species content of sorghum consumed were measured using ds GFP For comparison sorghum aphids MsGld65 Genes and GFP The content of salicylic acid and reactive oxygen species in sorghum consumed after gene silencing.

[0042] In the drip ds GFP and drops of ds MsGld65 Sorghum aphids were fed on sorghum leaves at (0 h, 6 h, 12 h, 24 h), with 3 replicates at each time point and 30 sorghum aphids per replicate. The content of phytosalicylic acid (SA) and reactive oxygen species (ROS) in sorghum after feeding by sorghum aphids was measured using an ELISA kit.

[0043] Determination of sorghum salicylic acid content: The levels of plant salicylic acid (SA) and reactive oxygen species (ROS) in the samples were determined using a double-antibody sandwich method. Purified plant salicylic acid (SA) antibody was coated onto microplates to prepare a solid-phase antibody. Salicylic acid (SA) was added sequentially to the microplates coated with monoclonal antibody, followed by binding with HRP-labeled salicylic acid (SA) antibody to form an antibody-antigen-enzyme-labeled antibody complex. After thorough washing, the substrate TMB was added for color development. TMB was converted to blue under the catalysis of HRP enzyme, and then to yellow under acidic conditions. The color intensity was positively correlated with the salicylic acid (SA) content in the sample. The absorbance (OD value) was measured at 450 nm using a microplate reader, and the concentration of plant salicylic acid (SA) in the sample was calculated using a standard curve. Figure 5 The droplet ds shown MsGld65 The aphids then fed on the sorghum leaves compared to the drip irrigation method. GFP, The salicylic acid content decreased significantly after 24 hours.

[0044] Determination of Reactive Oxygen Species (ROS) Content in Sorghum Samples: The level of plant reactive oxygen species (ROS) in the samples was determined using a double-antibody sandwich method. Purified plant ROS antibodies were coated onto microplates to prepare a solid-phase antibody. ROS was added sequentially to the microplates coated with monoclonal antibodies, followed by binding with HRP-labeled ROS antibodies to form an antibody-antigen-enzyme-labeled antibody complex. After thorough washing, the substrate TMB was added for color development. TMB was converted to blue under the catalysis of HRP enzyme, and then to yellow under acidic conditions. The color intensity was positively correlated with the ROS content in the sample. The absorbance (OD value) was measured at 450 nm using a microplate reader, and the concentration of plant ROS in the sample was calculated using a standard curve. Figure 6 The droplet ds shown MsGld65 The aphids then fed on the sorghum leaves compared to the drip irrigation method. GFP, The content of plant reactive oxygen species (ROS) decreased significantly at 6h and 24h.

[0045] Although some preferred embodiments of this invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0046] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from the spirit and scope of its inventive concept. Therefore, if these modifications and variations fall within the scope of the claims of this application and their equivalents, this application also intends to include these modifications and variations.

Claims

1. Suppressing the sorghum aphid gene MsGld65 The applications of dsRNA in the preparation of the following products include: (1) Controlling sorghum aphids or preparing products for controlling sorghum aphids; (2) Reduce the survival rate of sorghum aphids or prepare products that reduce the survival rate of sorghum aphids; (3) Suppressing the sorghum aphid gene MsGld65 Expressing or preparing genes that inhibit sorghum aphids MsGld65 The product being expressed; (4) Inhibit the reproduction and / or growth of sorghum aphids or prepare products that inhibit the reproduction and / or growth of sorghum aphids; The dsRNA is a double-stranded RNA composed of nucleotides of the sequence shown in SEQ ID NO.3 and its reverse complementary sequence.

2. A gene that inhibits sorghum aphids MsGld65 The expressed dsRNA, the sorghum aphid gene MsGld65 The nucleotide sequence is shown in SEQ ID NO.1, characterized in that, The dsRNA is a double-stranded RNA composed of nucleotides of the sequence shown in SEQ ID NO.3 and its reverse complementary sequence.

3. A biomaterial, characterized in that, It contains genes that inhibit sorghum aphids. MsGld65 The dsRNA is a double-stranded RNA composed of nucleotides of the sequence shown in SEQ ID NO.3 and its reverse complementary sequence; the biomaterial is used to control sorghum aphids.

4. The biomaterial as described in claim 3, characterized in that, The biomaterials include recombinant DNA, expression cassettes, plasmid vectors, viral vectors, or engineered bacteria.

5. A product containing an active ingredient, characterized in that, Including the gene that inhibits sorghum aphids MsGld65 The dsRNA or the biological material according to any one of claims 3-4; the product has at least one of the following functions: (1) Control of sorghum aphids; (2) Reduce the survival rate of sorghum aphids; (3) Suppressing the sorghum aphid gene MsGld65 Express; (4) Inhibit the reproduction and / or growth of sorghum aphids.

6. The application of the product as described in claim 5 in the biological control of sorghum aphids.