CHO cell gene copy number detection method
By pretreating CHO cell genomic DNA with enzyme digestion or thermal denaturation, the supercoiled structure inhibition caused by UCOE elements is relieved. Combined with qPCR probe method, the accuracy problem of CHO cell gene copy number detection is solved, the accuracy and stability of detection are improved, and the genetic stability assessment needs of drug production are met.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHANGCHUN GENESCIENCE PHARM CO LTD
- Filing Date
- 2026-01-14
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies exhibit an inhibitory effect on qPCR detection in CHO cells due to the supercoiled structure of the genome caused by UCOE elements, leading to inaccurate gene copy number detection and affecting the assessment of genetic stability.
Genomic DNA was pretreated by enzyme digestion or thermal denaturation to unwind supercoiled structures. The gene copy number in CHO cells was detected using qPCR probe method. Enzymatic digestion with non-specific endonucleases such as dsDNA fragmentase or rapid cooling after thermal denaturation at high temperature was performed, followed by quantification using TaqMan probe method.
This improves the accuracy and stability of gene copy number detection in CHO cells, especially the detection of low-abundance target nucleic acid copy numbers, ensuring the reliability of genetic stability assessment and meeting regulatory requirements for drug production.
Smart Images

Figure CN122012678A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene detection technology, and in particular to a method for detecting the genetic stability of CHO cell lines. More specifically, it relates to detecting the gene copy number of CHO cells by pretreating the genome with enzyme digestion or thermal denaturation, thereby eliminating the interference or inhibition of the genome's supercoiled structure on qPCR (Real-time Fluorescent Quantitative Polymerase Chain Reaction) detection. Background Technology
[0002] CHO cells (Chinese Hamster Ovary cells) offer significant advantages in the production of biotherapeutic recombinant proteins, including adaptability to serum-free suspension culture, ease of gene manipulation, high-yield monoclonal screening capability, and post-translational modification functions similar to those of human cells, while exhibiting low sensitivity to human viruses. However, these cells also pose risks of genetic instability, such as gene rearrangement, mutation, epigenetic silencing, and multicopy expression pressure. Therefore, regulatory agencies have imposed explicit requirements on their genetic stability to ensure the consistency and safety of drug production.
[0003] UCOEs (Ubiquitous Chromatin Opening Elements) are a class of unmethylated CpG-rich sequences derived from the promoter regions of housekeeping genes. They can effectively suppress epigenetic silencing mechanisms such as DNA methylation and repressive histone modifications by regulating chromatin structure. When placed upstream of the gene expression cassette, they enable long-term, stable, and high-level expression of transgenes in mammalian cells (Neville, Jonathan J et al. "Ubiquitous Chromatin-opening Elements (UCOEs): Applications in biomanufacturing and gene therapy." Biotechnology advances vol. 35,5 (2017):557-564.). In biopharmaceutical applications, UCOE elements can significantly enhance the expression stability and yield of recombinant proteins, accelerate the development of high-yield cell lines, reduce production variability and the risk of gene silencing during long-term culture, thereby improving the efficiency and economy of upstream biomanufacturing processes. In CHO cell line construction, accurate quantification of UCOE vector copy number is particularly crucial for screening "low copy-high expression" clones.
[0004] The copy number of a foreign gene refers to the number of target genes integrated into the host cell genome through genetic engineering. When UCOE is inserted into a transgenic vector, it establishes a local, open topological domain near the integration site, characterized by a higher level of negative supercoiling. This further facilitates the sustained and high-level expression of downstream transgenes. However, it is important to note that the amplification efficiency of supercoiled DNA in qPCR is significantly lower than that of relaxed DNA (Chen, Jinsong et al. “DNA supercoiling suppresses real-time PCR: a new approach to the quantification of mitochondrial DNA damage and repair.” Nucleic acidsresearch vol. 35,4 (2007): 1377-88.). Therefore, the unique open chromatin structure of UCOE may significantly affect the absolute quantitative detection value based on qPCR. Repressor elements enhance chromatin openness and simultaneously form structural modifications in exogenous gene regions. The pre-denaturation step of qPCR is insufficient to unwind highly stable supercoiled structures, significantly reducing primer binding efficiency. This results in an inability to accurately reflect the copy number of transgenes within the genome, which in turn affects the assessment of the genetic stability of cell lines or cell banks.
[0005] Both Chinese and American regulations and guidelines stipulate requirements for genetic stability (CHO recombinant expression). For cell lines containing DNA expression constructs, the consistency of these constructs across the MCB (Master Cell Bank), WCB (Working Cell Bank), and EOPC (End-of-Production Cells) must be determined, including the copy number of the inserted foreign gene, the insertion site on the chromosome, and the sequence of the target gene. The copy number of the foreign gene plays a crucial bridging role between genetic engineering, cell phenotype, and final product quality, and is the scientific basis for ensuring the efficient, stable, safe, and compliant production of therapeutic proteins. Accurate determination of the foreign gene copy number can effectively guide the screening of high-yield cell lines, assess the genetic stability of cell lines, and ensure product quality consistency to meet regulatory requirements. In the CHO cell line construction and related biopharmaceutical application process, using qPCR probes to detect the copy number of the target gene is a mature and widely recognized analytical method by regulatory agencies. This method is particularly suitable for high-throughput screening in the early stages of cell line construction and provides crucial data support for genetic stability assessment throughout the entire product development cycle. Genetic stability, being the fundamental genetic information of gene expression, is not controlled by process conditions and thus directly affects the yield, quality, and safety of recombinant proteins, as well as drug approval and clinical application.
[0006] Therefore, in the process of evaluating the genetic stability of CHO cell lines, removing the inhibition of qPCR detection values caused by the supercoiled structure of the genome, such as UCOE, which may affect the higher-order structure of chromosomes, helps to obtain detection results that are closer to the true values, which is of great significance for accurately assessing the genetic stability of cell lines. Summary of the Invention
[0007] The technical problem to be solved by the present invention is to provide a method for quantitative detection of gene copy number in CHO cells containing UCOE elements near the target gene using real-time quantitative PCR technology, so as to improve the sensitivity and accuracy of quantitative detection of gene copy number in cell lines.
[0008] In one aspect, this invention provides a method for detecting the copy number of a target gene in recombinant cells, comprising: Genomic DNA extracted from recombinant cells is pretreated, including heat denaturation or enzyme digestion. The copy number of the target gene was determined by qPCR detection of the pretreated genomic DNA. The recombinant cells contain repressor sub-elements.
[0009] In one embodiment of the present invention, the repressor sub-element is located near the target gene and can cause the genomic DNA to form a supercoiled structure, thereby inhibiting the qPCR signal of untreated genomic DNA.
[0010] In one embodiment of the present invention, the recombinant cells are recombinant mammalian cells, preferably Chinese hamster ovary (CHO) cells.
[0011] In one embodiment of the present invention, the temperature of the heat denaturation treatment is 80-100°C, preferably 85-99°C, and more preferably 95-98°C; and / or the time of the heat denaturation treatment is 5-30 minutes, preferably 5-20 minutes, and more preferably 5-10 minutes.
[0012] In one embodiment of the present invention, the genomic DNA is cooled after the heat denaturation treatment, preferably to 0-10°C, and more preferably in an ice bath or at 4°C.
[0013] In one embodiment of the present invention, the enzyme digestion treatment is performed at a temperature of 37°C for a time of 5-60 minutes, preferably 5-15 minutes, and more preferably 10 minutes.
[0014] In one embodiment of the present invention, the enzyme digestion process uses a non-specific endonuclease to cut genomic DNA to unwind the supercoiled structure; the thermal denaturation process denatures the genomic DNA by heating to unwind the supercoiled structure, and the pretreatment does not destroy the target gene sequence.
[0015] In one embodiment of the present invention, the enzyme digestion process uses a tool enzyme that utilizes non-specific endonuclease activity to randomly fragment DNA.
[0016] In one embodiment of the present invention, the anti-restriction sub-element is a UCOE element.
[0017] In one embodiment of the present invention, the enzyme digestion process uses the following enzyme digestion system: 10×FragmentaseReaction Buffer v2, dsDNA Fragmentase, genomic DNA, and water.
[0018] In one embodiment of the present invention, a 20 μl enzyme digestion system is used, comprising 2 μl of 10×Fragmentase Reaction Buffer v2, 2 μl of dsDNA Fragmentase, 3 μg of genomic DNA, and double-distilled water to a total volume of 20 μl. The final concentration of genomic DNA is 100-200 ng / μL, preferably 120-180 ng / μL, and more preferably 150 ng / μL.
[0019] In one embodiment of the present invention, the enzyme is inactivated by heating or purification after the enzymatic digestion treatment.
[0020] In one embodiment of the present invention, the qPCR detection uses the TaqMan probe method.
[0021] In one embodiment of the present invention, the qPCR reaction procedure is as follows: Initial denaturation: 95℃, 30s; Cyclic reaction (40 times): 95℃, 5s; 60℃, 35s.
[0022] In one embodiment of the present invention, the pretreatment is performed before the qPCR reaction system is prepared, preferably after the extracted genomic DNA is diluted.
[0023] In one embodiment of the present invention, the gene copy number determination includes relative quantification or absolute quantification, preferably by calculating the copy number ratio of the target gene to the internal reference gene using the standard curve method.
[0024] In one embodiment of the present invention, the method further includes setting up a control cell line group without repressor elements and performing the same qPCR detection to verify that the pretreatment does not destroy the target gene sequence.
[0025] In one embodiment of the present invention, the method is used to evaluate the genetic stability of cell lines, preferably at the master cell bank (MCB), working cell bank (WCB), and end-production cell (EOPC) stages of CHO cells.
[0026] In one embodiment of the present invention, the method is applied to high-throughput screening of recombinant cell lines, preferably for screening CHO cell lines containing UCOE elements.
[0027] In one embodiment of the present invention, the method is used for evaluating the genetic stability of recombinant protein drugs.
[0028] In one embodiment of the present invention, the pretreatment increases the number of exogenous gene copies detected by qPCR by at least 10%, preferably at least 20%, more preferably at least 30%, and even more preferably at least 50% compared to the unpretreated group.
[0029] In one embodiment of the present invention, the pretreatment can effectively reduce detection fluctuations caused by the UCOE supercoil structure, improving the reliability and stability of copy number determination. Preferably, the coefficient of variation (CV) is significantly reduced in CHO cells containing UCOE elements. In a specific embodiment of the present invention, in CHO cell lines containing UCOE elements, the qPCR detection copy number variation (CV) is high (up to 13.99%) without pretreatment, while after using the pretreatment method of the present invention, the CV is significantly reduced (mostly reduced to 3%–6%).
[0030] In a second aspect, the present invention provides a kit for determining the copy number of a foreign gene in recombinant cells containing an anti-repressor element, comprising: a genomic DNA extraction reagent, a reagent or buffer for heat denaturation or enzyme digestion; and qPCR primers and probes, wherein the primers and probes are specifically designed for the target gene. Optionally, it may include internal reference gene primers and probes.
[0031] In one embodiment of the present invention, the kit further includes a nonspecific endonuclease and a corresponding reaction buffer, preferably including dsDNA Fragmentase and its 10×Reaction Buffer v2.
[0032] In one embodiment of the present invention, the kit is suitable for detecting the copy number of exogenous genes and assessing the genetic stability of CHO cell lines containing UCOE elements.
[0033] In a third aspect, the present invention provides the use of the above-described method or kit in the assessment of genetic stability of recombinant cells.
[0034] In one embodiment of the present invention, the use includes accurately determining the copy number of exogenous genes in CHO cells containing UCOE elements. Preferably, the detection is performed at the master cell bank (MCB), working cell bank (WCB), and end-production cell (EOPC) stages of CHO cells.
[0035] In one embodiment of the present invention, the use includes high-throughput screening of recombinant cell lines, preferably for screening CHO cell lines containing UCOE elements.
[0036] In one embodiment of the present invention, the use includes evaluation of genetic stability for the development of recombinant protein drugs.
[0037] Compared with the prior art, the present invention has the following beneficial effects: This invention utilizes a non-biased, time-dependent fragmentation enzyme with random nicking activity to pretreat the genome, or to pretreat the genome by rapid cooling after denaturation at 95°C. The genome is then analyzed using qPCR probes to detect gene copy numbers in CHO cells, thus eliminating the inhibitory effect of DNA higher-order structures (supercoiling) on qPCR quantification. This improves the accuracy, stability, and sensitivity of detecting gene copy numbers in production-grade CHO cells, particularly providing a method for detecting low-abundance target nucleic acid copy numbers containing higher-order structures in the genome. It also provides a more reliable evaluation basis for cell line construction and screening in drug development, and for the production and quality control of pharmaceutical proteins. Attached Figure Description
[0038] Figure 1Schematic diagram of plasmid element design for monoclonal antibody and biclonal antibody stable transfer vector (MH-ML: monoclonal antibody without UCOE element; MUH-MUL: monoclonal antibody with UCOE element; BUH1-BUL2 & BUH2-BUL1: biclonal antibody with UCOE element).
[0039] Figure 2 This figure illustrates the impact of untreated genomes (without UCOE elements) versus genomes pretreated with enzyme digestion and thermal denaturation on gene copy number detection results. The gene copy number values in the figure represent the relative mean ± standard error of the ratio of the target gene copy number to the internal control gene copy number. Each sample was tested in triplicate.
[0040] Figure 3 This figure illustrates the impact of untreated genomes containing UCOE elements and genomes pretreated with enzyme digestion and thermal denaturation on gene copy number detection results. The gene copy number values in the figure represent the relative mean ± standard error of the ratio of the target gene copy number to the internal control gene copy number. Each sample was tested in triplicate.
[0041] Figure 4 This figure illustrates the impact of untreated genomes containing UCOE elements in bispecific antibodies versus genomes pretreated with enzyme digestion and thermal denaturation on gene copy number detection results. The gene copy number values in the figure represent the relative mean ± standard error of the ratio of the target gene copy number to the internal control gene copy number. Each sample was tested in triplicate.
[0042] Figure 5 This study investigates the impact of untreated genomes containing UCOE elements in bispecific antibodies versus genomes pretreated with enzyme digestion and thermal denaturation on gene copy number assays for genetic stability in cell banks. Cell banks tested were approximately 15 generations PDL (Population Doubling Level) for MCB, 30 generations PDL for WCB, and 60 generations PDL for EOPC. The coefficient of variation (CV) in the figure represents the relative gene copy number variation among cell banks. Gene copy number values are the relative mean ± standard error of the ratio of target gene to internal control gene copy number for each cell bank sample. Each sample was tested three times. Detailed Implementation
[0043] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention, and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.
[0044] Unless otherwise stated, the raw materials and reagents used in the following examples are commercially available products or can be prepared by known methods.
[0045] Recombinant cells: Cells into which exogenous genes (typically encoding therapeutic proteins such as monoclonal antibodies or bispecific antibodies) are introduced and stably integrated into the genome of a host cell through genetic engineering techniques. In this invention, recombinant cells are preferably recombinant mammalian cells, and more preferably recombinant CHO cells.
[0046] Exogenous genes, also known as target genes, are genes that are not inherent to the cell itself and are artificially introduced through transfection. They usually encode target recombinant proteins (such as monoclonal antibodies or bispecific antibodies) and are often accompanied by regulatory elements that enhance expression.
[0047] Antirepressor sub-elements: DNA regulatory sequences that counteract chromatin repression and maintain the open state of transcription, reducing position effects and the risk of gene silencing, and improving the stable high expression of exogenous genes. A preferred example is UCOE, derived from the mouse Rps3 or human HNRPA2B1-CBX3 locus, which promotes stable high-level expression but induces local supercoiling at the integration site.
[0048] Supercoiled structure: A higher-order topological structure formed by excessive twisting of the DNA double helix around its own axis. Near the transgenic site containing UCOE, a transcriptionally active, DNA-demethylated open chromatin environment is established and maintained, thereby continuously altering the local supercoiled structure (generating negative supercoils) and affecting the binding efficiency of primers / probes to the template.
[0049] Thermal denaturation: A process that uses high-temperature heating (usually 80-100℃) to separate the DNA double strands and relax the supercoil. Rapid cooling after treatment prevents renaturation and the formation of the original supercoiled conformation.
[0050] Enzymatic digestion: Non-specific endonucleases are used to introduce random nicks into genomic DNA, thereby relaxing supercoil tension. The DNA random fragmentation enzyme selected in this invention has no sequence bias, ensuring accurate copy number detection. In one embodiment of this invention, the non-specific endonuclease is dsDNA fragmentase, a commercially available double-stranded DNA fragmentation enzyme from NEB, which can randomly generate nicks in genomic DNA and is a commonly used enzymatic alternative to physical fragmentation (such as sonication) in next-generation sequencing library preparation.
[0051] qPCR: Quantitative polymerase chain reaction, used for real-time monitoring of PCR amplification product quantity. This invention primarily employs the TaqMan probe method to quantify the copy number of exogenous genes using fluorescence signals.
[0052] TaqMan probe method: A specific detection technique in qPCR that uses a dual-labeled probe with a fluorescent reporter group and a quencher group. It generates a fluorescent signal only when the probe specifically binds to the template and is degraded by the 5'→3' exonuclease activity of Taq polymerase, resulting in high specificity.
[0053] Internal reference genes: conserved genes in the host cell genome with a single copy or a known copy number (such as B2M in CHO cells), used for normalization, correcting for differences in DNA extraction amount and qPCR amplification efficiency, and calculating the relative copy number of exogenous genes.
[0054] Genetic stability: The ability of recombinant cell lines to maintain stable copy number and expression levels of exogenous genes during long-term passage or production. Regulatory agencies (such as NMPA, FDA, EMA) require demonstration of genetic stability at the master cell bank (MCB), working cell bank (WCB), and end-of-production cell (EOPC) stages.
[0055] Master Cell Bank (MCB): A batch of homogeneous cryopreserved cells that have passed full release testing and are used for production; it is the source of all subsequent working cell banks.
[0056] Working Cell Bank (WCB): A cell bank prepared by amplification of MCBs for use in actual production.
[0057] End-of-production cells (EOPC): Cells at the end of production-scale culture, used to verify that there are no significant changes in genetic stability throughout the entire production cycle.
[0058] CV value: Coefficient of variation, equal to the standard deviation divided by the mean, is used to measure the relative fluctuation of data. When the lack of preprocessing leads to lower test values, the CV value is often high, affecting the reliability of genetic stability assessment.
[0059] Example: Method for detecting gene copy number in CHO cells using genome pretreatment via enzyme digestion or heat denaturation 1. Genomic extraction of the cell line to be tested The three cell lines to be tested expressed the following molecules: a monoclonal antibody without the UCOE element, a monoclonal antibody containing the UCOE element, and a bispecific antibody containing the UCOE element. These were named M, MU, and BU, respectively. The vector plasmid element design diagram is shown below. Figure 1As shown. The host cell used for cell line M, which does not contain the UCOE element, was CHOK1, paired with a dual-expression-frame expression vector that does not contain the UCOE element. Both the host cell and the expression vector were purchased from Shenzhen Taili Biotechnology Co., Ltd. The host cell used for cell lines MU and BU, which contain the UCOE element, was CHOGS, and the highly efficient expression system pCGS3UCOE, matched to this host cell, was used as the expression vector. The promoter of this dual-expression-frame expression vector contains approximately 3 kb of UCOE fragment derived from mouse Rps3 and approximately 1.5 kb of UCOE fragment derived from human HNRPA2B1-CBX3, respectively. Both the host cell and the expression vector were purchased from Merck. Genomic DNA was extracted using the Dneasy Blood and Tissue Kit (QIAGEN, catalog number: 69506) and quantified using NanoDrop OneC (Thermoscientific).
[0060] 2. Genomic enzyme digestion or thermal denaturation pretreatment The genome to be tested was digested using NEBNext dsDNA Fragmentase (NEB, catalog number: M0348) at 37°C for 10 min, followed by purification using the FastPure Gel DNA Extraction Mini Kit (Vazyme, catalog number: DC301-01). Alternatively, the genome to be tested was subjected to heat denaturation in a PCR instrument using the following PCR program: 95°C for 5 min; 4°C.
[0061] It is worth noting that if the genome is not digested thoroughly for too short a time, the denaturation will be incomplete. However, it should not be too long either. The denaturation should be completed to eliminate the supercoiled structure. If the time is too long, it may damage the genome and have a negative impact on qPCR detection (experiments have shown that there is no significant difference in copy number detection results after 10 min and 20 min of enzyme digestion and 5 min and 10 min of heat denaturation).
[0062] 3. Design and synthesis of primers and probes Specific primers and probes for the target gene and internal control gene were designed using Primer Express 3.0 software and synthesized by Sangon Biotech Co., Ltd. Before the experiment, they were diluted with RNase-free water as needed. The sequences of the primers and probes for the target gene (heavy chain gene and light chain gene) and internal control gene are as follows: The primer and probe sequences for the monoclonal antibody molecular heavy chain gene are as follows: Forward primer (SEQ ID NO:1): CCGAAACCAAAAGATACCCTGAT Reverse primer (SEQ ID NO:2): CGACCACGCAGGTCACTTC Probe sequence (SEQ ID NO:3): ATCTCCAGAACCCC The primer and probe sequences for the monoclonal antibody light chain gene are as follows: Forward primer (SEQ ID NO:4): GCTGCTCCTTCTGTGTTCATCTT Reverse primer (SEQ ID NO:5): GCGGTGCCCGACTTCAG Probe sequence (SEQ ID NO:6): CTCCAAGCGACGAGCA The primer and probe sequences for the bispecific antibody heavy chain gene 1 (H1) are as follows: Forward primer (SEQ ID NO:7): AGGCTCTCTGCGGCTGTCT Reverse primer (SEQ ID NO:8): GCACCCACTGCATCCAGAA Probe sequence (SEQ ID NO:9): TGCCGCCTCTGGCTA The primer and probe sequences for the bispecific antibody heavy chain gene 2 (H2) are as follows: Forward primer (SEQ ID NO:10): CCTTGGCTTCACCTTCTCCAA Reverse primer (SEQ ID NO:11): TTAGAGCCGTCGTACCAGATGA Probe sequence (SEQ ID NO:12): TACGTGATGCACTGGGT The primer and probe sequences for the bispecific antibody molecular light chain gene 1 (L1) are as follows: Forward primer (SEQ ID NO:13): CCAGGGCATCACCAACTACCT Reverse primer (SEQ ID NO:14): AGGAGGCGGCGTAGATCAG Probe sequence (SEQ ID NO:15): CCTGGTTCCAGCAGAA The primer and probe sequences for the dual-antibody molecular light chain gene 2 (L2) are as follows: Forward primer (SEQ ID NO:16): CCGAGTACACCCTGACCATCTC Reverse primer (SEQ ID NO:17): AGTGCTGCTGGCAGTAGTACACA Probe sequence (SEQ ID NO:18): CCCTGCAGTCCGAGGA The primer and probe sequences for the internal reference gene B2M are as follows: Forward primer (SEQ ID NO:19): TTGGGCCCTTGGTGCTT Reverse primer (SEQ ID NO:20): AAACCGAAAGTAGATGCTTGGAA Probe sequence (SEQ ID NO:21): CCTTGTTGGCCCGCTG 4. Preparation of standard quality particles Based on the target gene and internal reference gene sequences, standard plasmids were synthesized by Nanjing GenScript Biotech Co., Ltd. Before the experiment, serial dilutions were performed using RNase-free water as needed. The copy number of the extracted standard was calculated using the following formula:
[0063] 5. qPCR reaction conditions The qPCR reaction used Premix Ex Tag reagent (Takara, catalog number: RR390A) and was detected using QuantStudio5 (Thermo Scientific).
[0064] The qPCR reaction system is shown in the table below:
[0065] The qPCR reaction procedure is shown in the table below:
[0066] 6. Data processing and gene copy number analysis Using β2-microglobulin (B2M) as the internal reference gene, standards containing both the target gene and the internal reference gene were constructed. Standard curves for the target gene and the internal reference gene B2M were established separately. Untreated genomic DNA served as the control group, enzyme-digested pretreated genomic DNA served as experimental group 1, and heat-denatured pretreated genomic DNA served as experimental group 2. The target gene and internal reference gene in cell lines M, MU, and BU were simultaneously detected by qPCR. Based on the principle of qPCR, the logarithmic value of the DNA copy number of the standard or each cell line was plotted on the x-axis, and the Ct value of the DNA amplification reaction was plotted on the y-axis. A standard curve was established based on the linear relationship between the Ct value of the DNA amplification reaction and the logarithmic value of its copy number. The copy number of each target gene and the internal reference gene in the cell line and their copy number ratio were calculated to obtain the relative copy number of the target gene.
[0067] The results showed that the amplification efficiency of the standard curves was between 90% and 100%, the correlation coefficients were all above 0.99, and the reproducibility was good.
[0068] The results of cell line M detection are as follows Figure 2 The relative copy number detection results of each target gene in the control group, experimental group 1, and experimental group 2 were as follows: MH / B2M = 0.88 ± 0.01, 0.87 ± 0.02, and 0.86 ± 0.02, respectively; ML / B2M = 0.82 ± 0.01, 0.81 ± 0.01, and 0.82 ± 0.02, respectively. There were no significant differences among the three groups.
[0069] Cell line MU detection results are as follows Figure 3 The relative copy numbers of each target gene in the control group, experimental group 1, and experimental group 2 were as follows: MUH / B2M = 0.58 ± 0.00, 2.42 ± 0.03, and 2.32 ± 0.02, respectively; MUL / B2M = 0.26 ± 0.01, 2.59 ± 0.04, and 2.57 ± 0.04, respectively. The data in the experimental groups were significantly higher than those in the control group, while there were no significant differences among the experimental groups.
[0070] Cell line BU test results are as follows Figure 4 The relative copy numbers of each target gene in the control group, experimental group 1, and experimental group 2 were as follows: BUH1 / B2M = 0.50 ± 0.01, 1.43 ± 0.02, 1.39 ± 0.02; BUH2 / B2M = 0.69 ± 0.02, 1.57 ± 0.10, 1.61 ± 0.08; BUL1 / B2M = 0.31 ± 0.01, 1.43 ± 0.07, 1.45 ± 0.04; and BUL2 / B2M = 0.26 ± 0.00, 1.57 ± 0.04, 1.57 ± 0.03. The data in the experimental groups were all significantly higher than those in the control group, while there were no significant differences between the experimental groups.
[0071] The results of the BU cell bank cell line test are as follows: Figure 5 The relative copy number detection results of each target gene in the cell bank samples MCB, WCB, and EOPC are as follows: Control group -BUH1 / B2M = 0.44 ± 0.01, 0.36 ± 0.00, 0.33 ± 0.00; Experimental group 1 -BUH1 / B2M = 1.12 ± 0.01, 1.05 ± 0.01, 0.99 ± 0.00; Experimental group 2 -BUH1 / B2M = 1.02 ± 0.01, 1.02 ± 0.01, 0.96 ± 0.01. The control group had -BUH2 / B2M values of 0.64 ± 0.00, 0.57 ± 0.01, and 0.53 ± 0.01; the experimental group 1 had -BUH2 / B2M values of 1.32 ± 0.01, 1.22 ± 0.01, and 1.16 ± 0.00; and the experimental group 2 had -BUH2 / B2M values of 1.26 ± 0.01, 1.26 ± 0.01, and 1.12 ± 0.01. Control group - BUL1 / B2M = 0.27 ± 0.00, 0.25 ± 0.01, 0.23 ± 0.00; Experimental group 1 - BUL1 / B2M = 1.10 ± 0.01, 1.10 ± 0.02, 1.04 ± 0.01; Experimental group 2 - BUL1 / B2M = 1.05 ± 0.01, 1.09 ± 0.01, 0.96 ± 0.01. Control group - BUL2 / B2M = 0.24 ± 0.01, 0.22 ± 0.01, 0.21 ± 0.00; Experimental group 1 - BUL2 / B2M = 1.10 ± 0.01, 1.21 ± 0.01, 1.11 ± 0.00; Experimental group 2 - BUL2 / B2M = 1.00 ± 0.01, 1.10 ± 0.01, 1.01 ± 0.01. The copy number variation coefficients (CVs) of the target genes MCB, WCB, and EOPC among the control group, experimental group 1, and experimental group 2 were as follows: BUH1 / B2M -CV = 13.99%, 6.08%, and 3.11%; BUH2 / B2M -CV = 8.95%, 6.27%, and 6.47%; BUL1 / B2M -CV = 8.47%, 3.38%, and 6.41%; and BUL2 / B2M -CV = 6.65%, 5.61%, and 5.70%.
[0072] 7. Results Analysis: The results of cell line M assays showed no significant difference between the experimental and control groups when qPCR was performed on cell line M containing the UCOE element. This demonstrates that, on the one hand, the absence of the UCOE element means that the higher-order genomic structure does not inhibit primer-probe binding. On the other hand, it shows that enzyme digestion and heat denaturation pretreatment only uncoiled the supercoiled structure and did not damage the target gene sequence.
[0073] The results of qPCR detection of cell lines MU and BU containing the UCOE element in monoclonal or bispecific antibodies showed that the untreated detection values were significantly lower than those after enzyme digestion or heat denaturation pretreatment. This indicates that the supercoiled higher-order structure can significantly inhibit primer-probe binding and affect the qPCR signal. Enzyme digestion or heat denaturation pretreatment can alter the DNA conformation, thereby relieving this inhibition and enabling accurate measurement of gene copy number. Furthermore, there was no significant difference in the detection values obtained by the two pretreatment methods, indicating that they achieve the same effect.
[0074] When detecting MCB, WCB, and EOPC in the BU cell line library, the untreated genome showed lower copy number results and higher CV values due to the suppression effect. CV values measure relative fluctuation, i.e., the magnitude of variation relative to the average level of the data itself; a smaller value indicates a higher degree of variation. Therefore, removing the masking effect of UCOE elements to obtain the true gene copy number is of great significance when evaluating the genetic stability of the cell line.
[0075] No significant differences were found in the structures detected by qPCR after enzyme digestion and heat denaturation pretreatment of the three cell lines. The increased copy number after enzyme digestion may be due to multiple copy tandem, while the increased copy number after heat denaturation is attributed to the inhibition of supercoiled structures caused by UCOE elements. The two genome pretreatment methods mutually validate and complement each other, both achieving the goal of accurately detecting the true copy number by eliminating only the supercoiled structure without destroying the target gene.
[0076] The above studies revealed conformational biases in qPCR DNA quantification, suggesting that when using stable vectors containing repressor elements such as UCOE, attention should be paid to the impact of the resulting higher-order structures on detection. This study is the first to systematically reveal the inhibitory effect of DNA supercoiled structures on qPCR quantification in CHO cell copy number assays commonly used in biopharmaceuticals. Based on this, several genomic denaturation pretreatment methods were developed, providing new insights for cell line screening, production monitoring, and product quality evaluation in the CMC process. This research provides data support for global biopharmaceutical companies and better meets the requirements of regulations and regulatory agencies regarding genetic stability.
[0077] In summary, the above embodiments are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention. The scope of protection of the present invention is not limited to fragmentation enzyme digestion or thermal denaturation pretreatment, but covers all technical methods for removing the higher-order structure of DNA; the scope of protection of the present invention is not limited to UCOE elements, but covers all elements that affect the higher-order structure of DNA; the scope of protection of the present invention is not limited to CHO cells, but covers all cell lines used in biopharmaceutical production.
[0078] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A method for detecting the copy number of a target gene in recombinant cells, characterized in that, include: Genomic DNA extracted from recombinant cells is pretreated, including heat denaturation or enzyme digestion. The copy number of the target gene was determined by qPCR detection of the pretreated genomic DNA. The recombinant cells contain repressor sub-elements.
2. The method for detecting the copy number of a target gene in recombinant cells as described in claim 1, characterized in that, The repressor sub-element is located near the target gene and can induce the formation of a supercoiled structure in genomic DNA, thereby inhibiting the qPCR signal of untreated genomic DNA.
3. The method for detecting the copy number of a target gene in recombinant cells as described in claim 1, characterized in that, The recombinant cells are recombinant mammalian cells, preferably Chinese hamster ovary (CHO) cells.
4. The method for detecting the copy number of a target gene in recombinant cells as described in claim 1, characterized in that, The temperature of the heat denaturation treatment is 80-100℃, preferably 85-99℃, and more preferably 95-98℃; and / or the time of the heat denaturation treatment is 5-30 minutes, preferably 5-20 minutes, and more preferably 5-10 minutes; Preferably, the genomic DNA is cooled after the heat denaturation treatment, preferably to 0-10°C, and more preferably in an ice bath or at 4°C. Alternatively, the enzyme digestion treatment can be performed at a temperature of 37°C for a time of 5-60 minutes, preferably 5-15 minutes, and more preferably 10 minutes. Preferably, the enzymatic digestion process uses a non-specific endonuclease to cut the genomic DNA to unwind the supercoiled structure; or the thermal denaturation process denatures the genomic DNA by heating to unwind the supercoiled structure, and the pretreatment does not destroy the target gene sequence. Preferably, the enzyme digestion process uses a tool enzyme that utilizes non-specific endonuclease activity to randomly fragment DNA.
5. The method for detecting the copy number of a target gene in recombinant cells as described in claim 1, characterized in that, The inhibiting sub-element is a UCOE element.
6. The method for detecting the copy number of a target gene in recombinant cells as described in claim 1, characterized in that, The enzyme digestion process used the following digestion system: 10×Fragmentase Reaction Buffer v2, dsDNAFragmentase, genomic DNA, and water; Preferably, the enzyme is inactivated by heating or purification after the enzymatic digestion treatment; Preferably, the qPCR detection uses the TaqMan probe method; Preferably, the qPCR reaction procedure is as follows: Initial denaturation: 95℃, 30s; Cyclic reaction (40 times): 95℃, 5s; 60℃, 35s. Preferably, the pretreatment is performed before the qPCR reaction system is prepared, and more preferably after the extracted genomic DNA is diluted.
7. The method for detecting the copy number of a target gene in recombinant cells as described in claim 1, characterized in that, The gene copy number determination includes relative quantification or absolute quantification, preferably by calculating the copy number ratio of the target gene to the internal reference gene using the standard curve method; Preferably, the method further includes setting up a control cell line group without repressor elements and performing the same qPCR detection to verify that the pretreatment does not destroy the target gene sequence; Preferably, the method is used to assess the genetic stability of cell lines, and is preferably performed at the master cell bank (MCB), working cell bank (WCB), and end-production cell (EOPC) stages of CHO cells; Preferably, the method is applied to high-throughput screening of recombinant cell lines, and more preferably to screening CHO cell lines containing UCOE elements; Preferably, the method is used for evaluating the genetic stability of recombinant protein drugs.
8. A kit for determining the copy number of a foreign gene in recombinant cells containing repressor elements, comprising: Genomic DNA extraction reagents, reagents or buffers for heat denaturation or enzyme digestion; qPCR primers and probes, wherein the primers and probes are specifically designed for the target gene; Optionally, it may include internal reference gene primers and probes.
9. The reagent kit as described in claim 8, characterized in that, The kit further includes a nonspecific endonuclease and a corresponding reaction buffer, preferably including dsDNA Fragmentase and its 10×Reaction Buffer v2; Optionally, the kit is suitable for detecting the copy number of exogenous genes and assessing genetic stability in CHO cell lines containing UCOE elements.
10. Use of the method according to any one of claims 1-7, or the kit according to claim 8 or 9, in the assessment of genetic stability of recombinant cells; Preferably, the use includes accurately determining the copy number of exogenous genes in CHO cells containing UCOE elements; The detection is preferably performed at the master cell bank (MCB), working cell bank (WCB), and end-of-life cell production (EOPC) stages of CHO cells; Preferably, the use includes high-throughput screening of recombinant cell lines, and more preferably for screening CHO cell lines containing UCOE elements; Preferably, the use includes evaluating the genetic stability of recombinant protein drugs.