Engineered yeast for producing chondroitin sulfate A and application of engineered yeast

Abstract

The invention discloses yeast engineering bacteria for producing chondroitin sulfate A and application of the yeast engineering bacteria. The yeast engineering bacteria are firstly integrated with a chondroitin synthesis module, then integrated with a chondroitin-4-O-sulfate transferase gene, further subjected to glycosylation modification and finally subjected to enhancement of a PAPS supply module. According to the engineering strain and the production method provided by the invention, high-efficiency synthesis of chondroitin sulfate A can be realized. More importantly, the problem that yield and sulfation degree are difficult to obtain at the same time is solved, the sulfation degree is increased to 70% or above while high yield is guaranteed, and a reliable microbial approach is provided for obtaining high-sulfation-degree CSA products.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an engineered yeast strain for producing chondroitin sulfate A and its applications. Background Technology

[0002] Chondroitin sulfate (CS) is an important sulfated glycosaminoglycan and a major structural component of cartilage matrix, widely found in animal connective tissue. Its basic structure consists of repeating disaccharide units linked by β(1→3) bonds between D-glucuronic acid and N-acetyl-D-galactosamine, with sulfated groups at specific positions. Based on the position and number of sulfate groups, CS can be classified into several isotypes, among which chondroitin sulfate A (CSA) refers to the isotype with sulfated group at the C4 position of GalNAc.

[0003] CSA plays a crucial role in regulating various physiological and pathological processes, including cell differentiation, proliferation, recognition, and neural development. Due to its anti-inflammatory properties, it has become a key active ingredient in drugs for treating osteoarthritis and cardiovascular diseases, as well as in functional foods. Recent studies have further revealed its pharmacological activities, including anticancer, anticoagulant, antidiabetic, and anti-obesity effects, broadening its application prospects in the pharmaceutical and health product fields.

[0004] Currently, commercially available CS (cartilage synthesizer) relies entirely on extraction from animal tissues such as bovine, swine, and shark cartilage. This traditional production method faces numerous challenges, including the risk of zoonotic disease transmission, batch-to-batch quality inconsistencies, and supply chain instability. Therefore, there is an urgent need to develop safer and more sustainable sources of CS.

[0005] In recent years, significant progress has been made in the synthesis of chondroitin sulfate precursors using microbial cell factories (such as Escherichia coli and Bacillus subtilis), with yields reaching several grams per liter.

[0006] For example, invention application with publication number WO2021077581A1 discloses engineered yeast strains for the fermentation production of chondroitin sulfate and their applications, using Pichia pastoris GS115 and Saccharomyces cerevisiae. S.cerevisiae CEN.PK2-1C was the starting strain, which heterologously expressed genes related to the chondroitin sulfate synthesis pathway within the cells: genes derived from Escherichia coli K4. kfoC , kfoA Chondroitin sulfate transferase gene from mice C4ST , C6ST UDP-glucose dehydrogenase gene from Bacillus subtilis tuaD ATP sulfate enzyme gene from Saccharomyces cerevisiae MET13Production strains for chondroitin sulfate A (CSA), chondroitin sulfate C (CSC), and chondroitin sulfate E (CSE) were obtained. The yield of chondroitin sulfate A from the genetically engineered strain GS115 / CADMC4 was 125 mg / L, and the yield from the genetically engineered strain S-CADMC4 was 75 mg / L. Furthermore, this prior art did not address the degree of sulfation of the products.

[0007] However, the biosynthesis of complete chondroitin sulfate A (CSA) still faces severe challenges. The bottlenecks are mainly: (i) the expression level of heterologous sulfate transferase in microbial hosts is low, the activity is insufficient, and the stability is poor; (ii) the intracellular supply and regeneration efficiency of the sulfate donor PAPS is limited; and (iii) it is difficult to coordinate and optimize multiple modules such as precursor synthesis, sulfation modification, and cofactor supply, which often makes it difficult to achieve both product yield and degree of sulfation, thus restricting its industrialization process. Summary of the Invention

[0008] To address the challenge of synergistically increasing yield and sulfation degree when synthesizing chondroitin sulfate A (CSA) in existing technologies, this invention provides an engineered Pichia pastoris strain capable of efficiently producing both high yield and high sulfation degree CSA, its construction method, applications, and the resulting high sulfation degree CSA product.

[0009] This invention first provides a yeast strain for producing chondroitin sulfate A, obtained by genetically modifying yeast through any of the following methods: Modification 1: Integrating the chondroitin synthesis module, including the chondroitin polymerase gene. kfoC Epimerase gene kfoA and UDP-glucose dehydrogenase gene tuaD Gene; Modification 2: Based on Modification 1, the chondroitin-4-O-sulfate transferase gene is further integrated; Modification 3: Based on modification 1 or 2, further glycosylation modification is performed, wherein the glycosylation modification involves knocking out the OCH1 gene and / or integrating it. MnsⅠ , Mnn2 , GnT I At least one of the glycosylation-modified genes; Modification 4: Based on any one of modifications 1 to 3, further enhance the PAPS supply module, wherein the enhancement of the PAPS supply module is the knockout of the PAPS reductase gene. MET16 and / or overexpression of ATP sulfate enzyme MET3 and adenosylsulfate kinase MET14 At least one of the genes.

[0010] Preferably, the chondroitin-4-O-sulfatase gene in modification 2 is a wild-type human gene. HsCHST11 or human gene Hs The mutant gene of CHST11 encodes a mutant protein containing a combination of mutations at the following sites: I67D, E114D, E117R, A127E, L134V, A159N, P170E, I206T, K218R, E238Y, I245G, S286A, S297D, Y298S, Y304S, A305G, and T316A. Mutants containing these multiple mutation sites are beneficial for increasing the sulfation degree of the product chondroitin sulfate A.

[0011] Preferably, in modification 2, the integrated copy number of the chondroitin-4-O-sulfatyltransferase gene is one or more, preferably one to six, and more preferably two to six copies. Different copies are integrated at different sites. This application has found, particularly when using human genes, that… Hs When the CHST11 mutant gene is used, the yield and sulfation degree can be increased simultaneously with the increase in the number of integrated copies.

[0012] Preferably, in modification 2, the chondroitin-4-O-sulfate transferase gene further includes a coding sequence for a soluble tag for fusion expression with chondroitin-4-O-sulfate transferase; The preferred soluble tag is thioredoxin TrxA or small ubiquitin-modified protein SUMO. More preferably, the soluble tag is TrxA.

[0013] By adding a soluble tag, chondroitin-4-O-sulfate transferase can be expressed in a soluble manner, ensuring enzyme activity.

[0014] Preferably, in modification 4, the enhancement of the PAPS supply module further includes overexpression of the polyphosphate kinase PPK and the bisphosphonate-3′-nucleotide enzyme BPNT gene.

[0015] Preferably, the yeast is Pichia pastoris. For example, the starting strain is Pichia pastoris GS115-Cas9.

[0016] The promoters used in the construction process include compositional strong promoters such as ADH2 promoter, TEF1 promoter, and GAP promoter; the terminators include AOX1 terminator and 0547 terminator.

[0017] The present invention further provides the application of the yeast engineered strain for producing chondroitin sulfate A in the fermentation production of chondroitin sulfate A.

[0018] The present invention also provides a method for producing chondroitin sulfate A, comprising fermenting and culturing the engineered yeast strain for producing chondroitin sulfate A, and extracting chondroitin sulfate A.

[0019] The engineered yeast strain for producing chondroitin sulfate A was inoculated into YPG medium containing glycerol and subjected to shake-flask fermentation or fed-batch fermentation in a bioreactor. The glycerol concentration was controlled by a carbon-limiting feeding strategy, and the dissolved oxygen was maintained above 20%, while the pH was maintained at 5.4-5.6.

[0020] Beneficial effects of this invention: (1) The engineered strain and production method provided by the present invention can achieve efficient synthesis of chondroitin sulfate A. More importantly, the present invention overcomes the problem of achieving both high yield and high sulfation degree, and increases the sulfation degree to more than 70% while ensuring a high yield, providing a reliable microbial route for obtaining high sulfation degree CSA products.

[0021] (2) This invention is the first to construct a complete CSA biosynthesis pathway in Pichia pastoris by designing and integrating multiple copies of the key enzyme mutant SMp, and by coordinating glycosylation modification and PAPS supply module optimization, effectively solving the core rate-limiting step of low sulfate transferase activity.

[0022] (3) This invention utilizes a safe strain of Pichia pastoris to efficiently generate non-animal CSA, featuring a short production cycle, controllable process, uniform product quality, and environmental friendliness. The high-yield Pichia pastoris engineered strain of this invention has broad prospects for industrial application. Attached Figure Description

[0023] Figure 1 This is an overview of the metabolic pathways and engineering strategies for the biosynthesis of CSA. Among them, Fru-6-P is fructose-6-phosphate; UDP-Glc is UDP-glucose; UDP-GlcA is UDP-glucuronic acid; UDP-GlcNAc is UDP-N-acetylglucosamine; UDP-GalNAc is UDP-N-acetylgalactosamine; PAPS is 3′-adenosine-5′-phosphate; PAP is 3'-adenosine-5'-phosphate; AMP is adenosine monophosphate; ADP is adenosine diphosphate; ATP is adenosine triphosphate; and ATPS is ATP thioacyltransferase.

[0024] Figure 2 This is a schematic diagram of the plasmid site integration backbone, with Int- ADH2p - BamH I- AOX1t For example.

[0025] Figure 3 To modify the key enzyme expression cassette map, with Int1- ADH2p-TrxA-SMp-AOX1t For example.

[0026] This is a schematic diagram of plasmid guide RNA, using HZP-sgRNA as an example.

[0027] Figure 4 This is a comparison chart of strain yields during the multicopy integration process of human wild-type sulfate transferase Sw in Example 3.

[0028] Figure 5 This is a comparison chart of strain yields during the multicopy integration process of the sulfate transferase mutant SMp in Example 3.

[0029] Figure 6 The fermentation results of the engineered strain PM06NP in Example 6 in a 5L fermenter are shown.

[0030] Figure 7 This is a comparison chart of the yields of different strains cultured in shake flasks in Example 5.

[0031] Figure 8 This is the HPLC-MS mass spectrum of CSA. Detailed Implementation

[0032] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings and specific examples. It should be understood that these embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention.

[0033] The term "helper plasmid" as used in this specification refers to a plasmid containing an sgRNA expression cassette and selection markers used in CRISPR / Cas9-mediated gene editing systems. It guides the Cas9 protein to cleave at specific sites in the genome, thereby promoting the integration of exogenous fragments into the genome via homologous recombination. The term "universal backbone" refers to the basic structural unit of this type of plasmid, typically containing a prokaryotic replication origin (ori), an antibiotic resistance gene (such as an ampicillin resistance gene), and a multiple cloning site or restriction enzyme site for inserting the sgRNA sequence. Those skilled in the art can construct or obtain such plasmids using conventional molecular cloning techniques.

[0034] Unless otherwise specified, the techniques or conditions used in the following examples were performed in accordance with the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. The metabolic flow diagram of CSA biosynthesis is shown below. Figure 9 As shown, the pathway modification key enzyme expression cassette is as follows: Figure 1 As shown, the detailed synthesis route is detailed in the examples.

[0035] Gene sequences involved in the examples: Chondroitin polymerase Figure 3 Gene: SEQ ID No. 1; UDP-N-acetylglucosamine-4-epomerase kfoC Gene: SEQ ID No. 2; UDP-glucose-6-dehydrogenase kfoA Gene: SEQ ID No. 3; Human sulfatase tuaD CHST11 gene: SEQ ID No. 4; The gene encoding the chondroitin-4-O-sulfate transferase mutant SMp: SEQ ID No. 5; Thioredoxin TrxA: SEQ ID No. 6; The gene encoding α-1,2-mannosidase MnsⅠ is SEQ ID No. 7. The gene encoding mannosyltransferase Mnn2: SEQ ID No. 8; The gene encoding N-acetylglucosamine transferase GnT I: SEQ ID No. 9; The gene encoding ATP sulfatedase MET3: SEQ ID No. 10; The gene encoding adenosine sulfate kinase MET14: SEQ ID No. 11; The gene encoding polyphosphate kinase PPK: SEQ ID No. 12; The gene encoding the bisphosphonate-3′-nucleotidase BPNT: SEQ ID No. 13; Gene encoding the alcohol dehydrogenase (ADH) promoter: SEQ ID No. 14; The gene encoding the glyceraldehyde-3-phosphate dehydrogenase promoter (GAPp) is SEQ ID No. 15. The gene encoding the translation elongation factor 1-α promoter (TEFp) is SEQ ID No. 16. The gene encoding the alcohol oxidase-1 terminator (AOX1t) is SEQ ID No. 17. The gene encoding the peroxisome terminator (0547t) is SEQ ID No. 18.

[0036] Example 1: Construction of a chondroitin synthesis module The insertion site Int refers to the Pichia pastoris GS115 genome insertion site, and the helper plasmid Int- used is... Hs Int- ADH2p-AOX1t Int- GAPp-tAOX1 It consists of a universal backbone (ampicillin resistance gene expression cassette plus the replication origin site ori of a prokaryotic gene plasmid), 500 bp homologous arms upstream and downstream of the site, and TEF1p-t0547 I- ADH2p-BamH , AOX1t II- GAPp-Aat or AOX1t II-t0547 composition( TEF1p-Aat ),in, Figure 2 , ADH2p and GAPp These three are promoters. TEF1p and t0547 It is a terminator. AOX I and ​ II represents the restriction endonuclease recognition site. Helper plasmids HZP-sgRNA, HHP-sgRNA, and HGP-sgRNA consist of a universal backbone, an resistance gene expression cassette, the corresponding sgRNA site, and... ​ I. Enzyme cleavage site composition ( ​ In this formula, the first H stands for Helper plasmid; the middle Z, H, and G represent the bleomycin resistance gene, hygromycin resistance gene, and G418 resistance gene, respectively; and P stands for plasmid.

[0037] ​ - ​ Construction and integration of gene expression cassettes: using helper plasmid Int1- ​ This is a backbone vector containing an ampicillin resistance gene, a prokaryotic replication origin (ori), and left and right homologous arms for site-specific integration into the Pichia pastoris genome. The left homologous arm corresponds to the upstream sequence of gene PAS_FragB_0066, and the right homologous arm corresponds to the downstream sequence of gene PAS_FragB_0067 (e.g., ...). ​ (As shown). Using the pre-defined restriction endonuclease sites in the vector, the chondroitin polymerase encoding gene kfoC, the epimerase encoding gene kfoA, and the UDP-glucose dehydrogenase encoding gene tuaD were sequentially inserted between the promoter ADH2p and the terminator AOX1t to construct the recombinant vector Int1-ADH2p-kfoC-kfoA-tuaD-AOX1t.

[0038] Using the sgRNA expression vector HZP-sgRNA as the backbone, an sgRNA sequence targeting the Int1 site was inserted into its BsaI restriction site to construct the guide RNA vector HZP-sgRNA-Int1.

[0039] With recombinant vector Int1- ​ Using a template, a linear donor fragment, Int1-donor, containing left and right homologous arms and the target expression cassette, was obtained by primer amplification. This donor fragment, along with the corresponding guide RNA vector HZP-sgRNA-Int1, was co-transformed into the Pichia pastoris host strain GS115-Cas9, which expresses Cas9 protein. Through CRISPR / Cas9-mediated homologous recombination, the kfoC-kfoA-tuaD expression cassette was specifically integrated into the Int1 site of the Pichia pastoris genome, resulting in the recombinant strain P01.

[0040] The GS115-Cas9 strain was obtained by stably integrating the Cas9-encoding gene expression cassette into the His4 site of the Pichia pastoris GS115 genome. Cas9 expression is driven by a constitutive promoter and is used to achieve targeted genome editing. The specific implementation is as follows: (1) Construction of recombinant expression vector for chondroitin synthesis pathway Chondroitin synthesis gene ​ , ​ , ​ Synthesized by GenScript Biotech Co., Ltd. Using gene sequences as templates, overlapping primers were designed, and a seamless cloning method was employed to... ​ , ​ , ​ In sequence with the scriptures ​ I and ​ II enzyme digestion of the vector Int1- ​ The recombinant vector Int1- was assembled and transformed into Escherichia coli DH5α strain. ​ .

[0041] The primer sequences used are as follows (partial examples): KfoC-F: cgaaGAATTCGCCACCATGTCAATTTTGAATCAAGCT; KfoC-R: GATTGAAAACGATTTGGGATCCGGA; KfoA-F: GTCCAATGAATATTTTGGTTACTGGTGGTG; KfoA-R: AAAATCCAAATGGTTACATTGGATCC; TuaD-F: ATGAAGAAAATTGCTGTTATT; TuaD-R: AAGATTTGGGTTCTGTTAATTTGTAGGACGTC.

[0042] (2) Construction of guide RNA recombinant expression vector HZP-sgRNA-Int1 Using plasmid HZP-sgRNA as a template, primers Int1-sgRNA-F and Int1-sgRNA-R were designed, utilizing the restriction enzyme sites in the vector HZP-sgRNA. ​ I introduced Int1-sgRNA, which was then ligated using T4 DNA ligase to obtain the recombinant vector HZP-sgRNA-Int1.

[0043] The primer sequences used are as follows: Int1-sgRNA-F: acgctatctgaagtatttactggg; Int1-sgRNA-R: AAACcccagtaaatacttcagata.

[0044] (3) Transformation of Pichia pastoris recombinant strain P01 with chondroitin With recombinant vector Int1- ​ Primers Int1-donor-F and Int1-donor-R were designed as templates. PCR was performed to obtain the corresponding linearized integrated fragment Int1-donor. This fragment, along with the corresponding recombinant guide plasmid HZP-sgRNA-Int1, was co-transformed into Pichia pastoris GS115-Cas9 cells via electroporation. The transformed cells were then plated on YPD plates containing the appropriate antibiotics for selection, yielding the recombinant strain P01. Correct transformants were verified by colony PCR and then passaged in YPD liquid medium to remove the antibiotic plasmid.

[0045] The primer sequences used are as follows: Int1-donor-F: agaaggcaaagaatcttctgac; Int1-donor-R: taggctaaaccaagtgatttttc.

[0046] Example 2: Introduction of sulfatase and fusion with a soluble tag Human wild-type sulfatase (Sw, ​ CHST11 was synthesized by Genscript Biotech. To enhance the soluble expression of the heterologous protein, a soluble tag, thioredoxin (TrxA), was added to the N-terminus of Sw. Using strain P01 as the starting strain, the tagged sulfotransferase encoding gene was integrated into genomic sites Int15 and Int18 (achieving double-copy integration), constructing strains Pp01F1 and Pp01F2 expressing TrxA-Sw. Construction of the TrxA-Sw recombinant expression vector Primers TrxA-F and TrxA-R were designed to amplify the target gene from the E. coli genome. ​ Primers Sw-F and Sw-R were designed to amplify the target gene. ​ Using a seamless cloning method, it was combined with... ​ The vector Int15- after I enzyme digestion ​ ​ (Int15: left gene PAS_chr3_0987, right gene PAS_chr3_0989) was assembled and transformed into E. coli DH5α strain to obtain the recombinant vector Int15-​ .

[0047] The primer sequences used are as follows: TrxA-F: ttatcttatttactttacgaaacaaacgatgagcgataaaattattcacctg; TrxA-R:ccttccctcgatcatatggc; Sw-F: agtccgttgcaggaactttataa; Sw-R: tggcattctgacatcctcttgagacgtctcactctaatttcaaataagagg.

[0048] (2) Construction of guide RNA recombinant expression vector HZP-sgRNA-Int15 Using plasmid HZP-sgRNA as a template, primers Int15-sgRNA-F and Int15-sgRNA-R were designed, utilizing the restriction enzyme sites in the vector HZP-sgRNA. ​ I introduced Int1-sgRNA, which was then ligated using T4 DNA ligase to obtain the recombinant vector HZP-sgRNA-Int1.

[0049] The primer sequences used are as follows: Int15-sgRNA-F: acgcgactctccacaagttaacca; Int15-sgRNA-R: AAACtggttaacttgtggagagtc.

[0050] (3) Transformation of Pichia pastoris recombinant strain P01 with chondroitin With recombinant vector Int15- ​ Primers Int15-donor-F and Int15-donor-R were designed as templates. PCR was performed to obtain the corresponding linearized integrated fragment Int15-donor. This fragment, along with the corresponding recombinant guide plasmid HZP-sgRNA-Int1, was co-transformed into Pichia pastoris GS115-Cas9 cells via electroporation. The transformed cells were then screened on YPD plates containing the appropriate antibiotics to obtain the recombinant strain Pp01F1. After verification by colony PCR, the correctly transformed strains were passaged in YPD liquid medium to remove the antibiotic plasmid.

[0051] The primer sequences used are as follows: Int15-donor-F: aatagtcatgatcaacttctgc; Int15-donor-R: cctcagactttgtgtcttttg.

[0052] Using the same strategy, based on strain Pp01F1, the second ​ The expression cassette was integrated into Int18 (Int18: left gene PAS_chr4_0363, right gene PAS_chr4_0361), ultimately yielding the double-copy strain Pp01F2.

[0053] The primer sequences used are as follows: TrxA-F: ttatcttatttactttacgaaacaaacgatgagcgataaaattattcacctg; Sw-R: tggcattctgacatcctcttgagacgtctcactctaatttcaaataagagg; Int18-sgRNA-F: acgctacatggaatagggtcacgt; Int18-sgRNA-R: AAACacgtgaccctattccatgta; Int18-donor-F: cgtacactgaaaagtttacag; Int18-donor-R: acccaccttgtttctctaag.

[0054] Example 3: Synergistic Optimization of Sulfate Transferase Protein Engineering and Multicopy Integration Preliminary exploration of the influence of sulfatyltransferase gene copy number First, in the basic strain P01, the effect of increasing the copy number of the wild-type sulfatase gene (Sw) on the sulfation degree of the product was evaluated. The ADH2p-TrxA-Sw-AOX1t expression cassette was sequentially integrated into pre-selected specific sites in the genome using CRISPR / Cas9-mediated site-specific integration technology. These sites (Int42, Int32, Int37, Int18, Int85, Int84) are all located in intergenic regions to minimize interference with host gene function. Specifically, the locus Int42 is located between genes PAS_chr1-4_0183 and PAS_chr1-4_0182; Int32 is located between genes PAS_chr2-2_0142 and PAS_chr2-2_0143; Int37 is located between genes PAS_chr2-1_0506 and PAS_chr2-1_0505; Int18 is located between genes PAS_chr4_0363 and PAS_chr4_0361; Int85 is located between genes PAS_chr1-1_0085 and PAS_chr1-1_0086; and Int84 is located between genes PAS_chr1-1_0074 and PAS_chr1-1_0076.

[0055] Based on the existing one natural copy of the P01 genome, the expression cassette was first integrated at the Int42 site to obtain strain PF0101 containing one copy of the Sw gene. Subsequently, using this strain as the starting strain, the third copy was integrated at the Int32 site to obtain PF0102; based on PF0102, the fourth copy was integrated at the Int37 site to obtain PF0103; subsequent copies (the fourth, fifth, and sixth) were integrated in a similar strategy, in the order of Int18, Int85, and Int84, to construct a series of strains containing 1 to 6 copies of the Sw gene (PF0101 to PF0106).

[0056] Fermentation results showed that simply increasing the copy number of wild-type Sw had limited effect on improving the sulfation degree of the product. When the copy number increased to 6 (strain PF0106), the sulfation degree of the target product CSA only reached 5.3%. ​ This indicates that the inherently low catalytic efficiency of wild-type sulfate transferase relative to enzyme expression level is the main bottleneck limiting the improvement of sulfation degree.

[0057] Construction and performance validation of protein engineered mutant SMp To fundamentally improve the activity of sulfatyltransferase, a protein engineering strategy based on rational design was adopted. Based on literature reports and structural analysis, multi-site site-directed mutagenesis was performed on wild-type Sw to obtain a performance-optimized mutant, named SMp. The mutant sequence was synthesized by Genscript Biotech Co., Ltd., and the specific mutated amino acids are (I67D / E114D / E117R / A127E / L134V / A159N / P170E / I206T / K218R / E238Y / I245G / S286A / S297D / Y298S / Y304S / A305G / T316A).

[0058] To include ​ Using the synthetic gene fragment of the coding sequence as a template, and employing the same method as in Example 2, a synthesis was constructed. ​ Expression cassette. A single copy of the expression cassette was integrated into the Int42 site of strain Pp01 to obtain strain PM01.

[0059] Shake-flask fermentation results showed that the CSA sulfation degree of strain PM01 (single-copy SMp) was as high as 12.1%, which was approximately 4.6 times higher than that of the single-copy wild-type control strain PF0101 (sulfation degree 2.6%). The experimental results indicate that this mutant has higher catalytic efficiency than the wild type.

[0060] Multicopy integration and synergistic effect of SMp Based on the verification of the superiority of SMp, its gene dosage effect will be further studied. ​ ​ Expression cassettes were sequentially integrated into multiple other genomic loci (Int32, Int37, Int18, Int85, Int84) of the PM01 strain, constructing cassettes containing 2 to 6 copies. ​ The gene series of strains PM02 to PM06.

[0061] Fermentation performance tests showed that the degree of sulfation of CSA was related to ​ The copy number showed a significant positive correlation, and the yield remained at a high level. When the copy number increased to 6, the final strain PM06 produced a CSA titer of 564 mg / L in shake flasks, with a sulfation degree as high as 45.0%. ​ This resulted in a significant simultaneous increase in both yield and sulfation degree.

[0062] Example 4: Construction of human glycosylation-modified strain PM06N Construct knockout genes separately ​ and highly expressed genes ​ I. ​ , ​The expression cassette I and the corresponding guide plasmid were sequentially transformed into the aforementioned multi-copy strain PM06. After successive rounds of transformation, recombinant Pichia pastoris strains PM06-1, PM06-2, PM06-3, and PM06N were obtained, as detailed below: (1) Mannose transferase gene ​ Construction of knockout expression vectors Using the Pichia pastoris genome as a template, donor primers OCH1-arm1-F / OCH1-arm1-R / OCH1-arm2-F / OCH1-arm2-R were designed on both sides of the OCH1 fragment (PAS_chr1-3_0251) to amplify gene fragments OCH1-arm1 and OCH1-arm2, respectively. The two fragments were then ligated into ΔOCH1-donor using overlap PCR amplification. This fragment was then homologously recombined into the Pichia pastoris genome to achieve knockout.

[0063] The primer sequences used are as follows: OCH1-arm1-F:cagcgagaatcggattgacgg; OCH1-arm1-R:ctatatctattttactctagctttctggctgatgatatttgctac; OCH1-arm2-F: cagtgttcgtagcaaatatcatcagccagaaagctagagtaaaatag; OCH1-arm2-R:aactgagaccggtcagacttc.

[0064] (2) Construction of guide RNA recombinant expression vector HZP-sgRNA-ΔOCH1 Starting with the helper plasmid HZP-sgRNA, primers ΔOCH1-sgRNA-F and ΔOCH1-sgRNA-R were designed, utilizing the restriction enzyme sites in the vector HZP-sgRNA. ​ I introduced ΔOCH1-sgRNA, which was then ligated using the T4 enzyme to obtain the recombinant vector HZP-sgRNA-ΔOCH1.

[0065] The primer sequences used are as follows: ΔOCH1-sgRNA-F:acgctgggcaattcagtccaaacg; ΔOCH1-sgRNA-R:aaaccgtttggactgaattgccca.

[0066] (3) Construction of Pichia pastoris recombinant strain PM06-1 The linearized fragment ΔOCH1-donor was simultaneously transformed into Pichia pastoris cells PM06 along with the corresponding recombinant guide plasmid HZP-sgRNA-ΔOCH1 to obtain the recombinant strain PM06-1. The antibiotic plasmid was discarded after several passages.

[0067] (4) Construction of a recombinant expression vector encoding the mannosidase MNSⅠ gene Primers MNS I-F / MNS I-R were designed to amplify the target gene from the Pichia pastoris GS115 genome. ​ Using a seamless cloning method, it was combined with... ​ The vector Int12- after I enzyme digestion ​ (Int1: left gene PAS_chr3_1202, right gene PAS_chr3_0618) was assembled and transformed into E. coli DH5α strain to obtain the recombinant vector Int12- ​ Ⅰ ​ .

[0068] The primer sequences used are as follows: MNS Ⅰ-F: aatcaattgaacaactatcaaaacacagaacccgcggatgcaacg; MNS I-R: gcaaatggcattctgacatcctcttgatcatttttcttttccgtctatctctt.

[0069] (5) Construction of guide RNA recombinant expression vector HHP-sgRNA-Int1 Starting with the helper plasmid HHP-sgRNA, primers Int12-sgRNA-F and Int12-sgRNA-R were designed, utilizing the restriction enzyme sites in the vector HHP-sgRNA. ​ I introduced Int12-sgRNA and ligated it with T4 enzyme to obtain the recombinant vector HHP-sgRNA-Int12.

[0070] The primer sequences used are as follows: Int12-sgRNA-F: acgcggggtttgaataacagacac; Int12-sgRNA-R:aaacgtgtctgttattcaaacccc.

[0071] (6) Construction of Pichia pastoris recombinant strain PM06-2 With recombinant vector Int12- ​ Ⅰ ​Primers Int12-donor-F and Int12-donor-R were designed for the template. PCR was performed to obtain the corresponding linearized fragment Int12-donor. This fragment, along with the corresponding recombinant guide plasmid HHP-sgRNA-Int1, was simultaneously transformed into Pichia pastoris cells PM06-1 to obtain the recombinant strain PM06-2. The antibiotic plasmid was discarded after several passages.

[0072] The primer sequences used are as follows: Int12-donor-F:gatactacaagaaaggttgttgatg; Int12-donor-R:aatgtttctttactattgaatcttcag.

[0073] (7) Construction of strains PM06-3, PM06-4, and PM06N Using a similar strategy to that used to build PM06-2, the following was constructed: strain PM06-3: Mannosyltransferase gene ​ Synthesized by Genscript Biotech Co., Ltd. Recombinant vector Int34 was constructed. - ​ (Int34: left gene PAS_chr3_0053, right gene PAS_chr3_0054). Primers were designed using this template to obtain the corresponding linearized fragment Int34-donor. This fragment, along with the corresponding recombinant guide plasmid HHP-sgRNA-Int34, was simultaneously transformed into Pichia pastoris cells PM06-2 to obtain recombinant strain PM06-3. The antibiotic plasmid was discarded after several passages.

[0074] The primer sequences used are as follows: MNN2-F: atcaattagctagtacacaacactcgagatgagttttgtattgattt; MNN2-R: aggcaaatggcattctgacatcctcttgaagatcttcagcgaggcag; Int34-sgRNA-F: acgcgatcagttcattgatagaca; Int34-sgRNA-R:aaactgtctatcaatgaactgatc; Int34-donor-F:tccgatcattgcatagatacc; Int34-donor-R:ttggtcagaattacttcacac.

[0075] Strain PM06N: N-acetylglucosamine transferase gene ​ The recombinant vector Int32 was synthesized by Genscript Biotech Co., Ltd. ​ (Int32: left gene PAS_chr2-2_0142, right gene PAS_chr2-2_0143). Primers were designed using this template to obtain the corresponding linearized fragment Int32-donor. This fragment, along with the corresponding recombinant guide plasmid HHP-sgRNA-Int32, was simultaneously transformed into Pichia pastoris cells PM06-3 to obtain the recombinant strain PM06N. The antibiotic plasmid was discarded after several passages.

[0076] The primer sequences used are as follows: GnT IF: caatcaattgaacaactatcaaaacacagcctcagtgagcgctctt; GnT IR:aaatggcattctgacatcctcttgatcagttccagctaggatcat; Int32-sgRNA-F: acgcgtgacgaaagagatgaggtg; Int32-sgRNA-R:aaaccacctcatctctttcgtcac; Int32-donor-F:tcgtaagaagggtctgtgatagac; Int32-donor-R: gactggtgccttgattttcgaa.

[0077] Example 5: Enhancement of the PAPS Supply Module Based on strain PM06N, the supply of intracellular sulfated donor 3′-phosphoadenosine-5′-phosphate was further enhanced by knocking out PAPS competitive pathway genes and overexpressing PAPS synthesis and regeneration-related genes.

[0078] In this article, gene names prefixed with "Kp" (such as KpMET3, KpMET14, KpPPK, KpBPNT) specifically refer to genes derived from... ​ The genes of Pichia pastoris encode proteins whose functions correspond to the common names ATP sulfate kinase (MET3), adenosine sulfate kinase (MET14), polyphosphate kinase (PPK), and bisphosphonate-3′-nucleotidase (BPNT).

[0079] The specific implementation steps are as follows: (1) Knockout of PAPS reductase gene MET16 Using the Pichia pastoris genome as a template, primers MET16-arm1-F / MET16-arm1-R and MET16-arm2-F / MET16-arm2-R were designed to amplify the upstream and downstream homologous arm fragments MET16-arm1 and MET16-arm2 of the MET16 gene (PAS_chr2-1_0298), respectively. The two fragments were then ligated into a ΔMET16-donor using overlap PCR.

[0080] The primer sequences used are as follows: MET16-arm1-F:gatcgctcctgattgctactg; MET16-arm1-R:ctggaagtttcttctccagatcttgtcgtagtcgtacgctg; MET16-arm2-F: cagaagatctggagaagaaacttccagacgaagcaacagctaaac; MET16-arm2-R: cggtcaatcttgtccttgtg.

[0081] (2) Constructing the guide RNA plasmid HHP-sgRNA-ΔMET16 Using the helper plasmid HHP-sgRNA as a template, primers MET16-sgRNA-F and MET16-sgRNA-R were designed. The sgRNA sequence targeting MET16 was introduced using the BsaI restriction site, and the recombinant plasmid HHP-sgRNA-ΔMET16 was obtained by ligation with T4 DNA ligase.

[0082] The primer sequences used are as follows: MET16-sgRNA-F: acgcGTGAGGGTTCAACTTTTACG; MET16-sgRNA-R: AAACCGTAAAAGTTGAACCCTCAC.

[0083] (3) Construction of recombinant strain PM06NP1 The linearized fragment ΔMET16-donor and the recombinant plasmid HHP-sgRNA-ΔMET16 were co-electrotransformed into Pichia pastoris strain PM06N. The transformed strains were screened on YPD plates containing hygromycin, and the correct transformants, namely recombinant strain PM06NP1, were obtained by colony PCR verification. Subsequently, the resistance plasmid was eliminated through subculture.

[0084] (4) Overexpression of ATP sulfate kinase (MET3) and adenosine sulfate kinase (MET14) Primers KpMET3-F / KpMET3-R and KpMET14-F / KpMET14-R were designed to amplify the coding sequences of KpMET3 and KpMET14 from the Pichia pastoris GS115 genome, namely the coding genes for ATP sulfatedase MET3 and adenylate sulfatase MET14, respectively. These two genes, along with the strong promoters GAPp and TEF1p and the terminators AOX1t and 0547t, were assembled into the integration vector Int21 (upstream gene PAS_chr4_0575, downstream gene PAS_chr4_0576) using a seamless cloning method, constructing the recombinant expression cassette Int21-( ​ )-( ​ ).

[0085] The primer sequences used are as follows: KpMET3-F: gaacaactatcaaaacacactcgagatgccttctcctcacggtggtgtg; KpMET3-R:cattctgacatcctcttgaagatctctgaactggaagaacccctgttc; KpMET14-F:aacaagctTatggctactaatatcacatggcatg; KpMET14-R:acGCATATGctatttgattagtttcttctccaataaataatc.

[0086] (5) Constructing the guide RNA plasmid HZP-sgRNA-Int21 Using HZP-sgRNA as the backbone, primers Int21-sgRNA-F and Int21-sgRNA-R were designed and inserted into sgRNA sequences targeting the Int21 site to construct HZP-sgRNA-Int21.

[0087] The primer sequences used are as follows: Int21-sgRNA-F: acgcgcaccatctggatagcattg; Int21-sgRNA-R:AAACcaatgctatccagatggtgc.

[0088] (6) Construction of recombinant strain PM06NP2 With recombinant vector Int21-( ​ )-( ​Using a template, primers Int21-donor-F / Int21-donor-R were designed to amplify the linear integration fragment Int21-donor. This fragment was then co-transformed with HZP-sgRNA-Int21 into strain PM06NP1. After screening and verification, recombinant strain PM06NP2 was obtained.

[0089] The primer sequences used are as follows: Int21-donor-F:gtatgtacgtacgtactacgtac; Int21-donor-R: catacgtacgtacgtacgtacgt.

[0090] (7) Overexpression of polyphosphate kinase (PPK) and bisphosphonate-3′-nucleotidase (BPNT) Primers KpPPK-F / KpPPK-R and KpBPNT-F / KpBPNT-R were designed to amplify the KpPPK and KpBPNT genes, respectively, which encode polyphosphate kinase PPK and bisphosphonate-3′-nucleotidase BPNT. These two genes, along with the promoters TEF1p and GAPp and their corresponding terminators, were assembled into the integration site Int20 (upstream gene PAS_chr4_0467, downstream gene PAS_chr4_0465) to construct the expression cassette Int20-( ​ )-( ​ ).

[0091] The primer sequences used are as follows: KpPPK-F: gcagactttaactaatactgattagtcaagaggatgtcagaatgc; KpPPK-R: taaggtctagaaacttggagatcttggacatgttggcgaataactaaaatgtatg; KpBPNT-F:ctatatatacttctccaaatcttggcc; KpBPNT-R:gcttaacttccctgctgaacat.

[0092] (8) Constructing the guide RNA plasmid HHP-sgRNA-Int20 Using HZP-sgRNA as the backbone, primers Int20-sgRNA-F and Int20-sgRNA-R were designed, and sgRNA sequences targeting the Int20 site were inserted to construct HZP-sgRNA-Int20.

[0093] The primer sequences used are as follows: Int20-sgRNA-F: acgcagaagaaaatgcgaaacagg; Int20-sgRNA-R:AAACcctgtttcgcattttcttct.

[0094] (9) Construction of recombinant strain PM06NP With recombinant vector Int20-( ​ )-( ​ Using ) as a template, primers Int20-donor-F / Int20-donor-R were designed to amplify the linear integration fragment Int20-donor, which was then co-transformed with HHP-sgRNA-Int20 into strain PM06NP2. After screening and verification, the recombinant strain PM06NP was obtained.

[0095] The primer sequences used are as follows: Int20-donor-F:tccgatcattgcatagatacc; Int20-donor-R:ttggtcagaattacttcacac.

[0096] Example 6: Validation of the fermentation performance of engineered strain PM06NP After enhancing the PAPS supply module, the finally constructed engineered strain PM06NP was validated through shake flask and fermenter fermentation, and its yield and sulfation degree were compared with those of the previously constructed key strains. The specific implementation steps are as follows: (1) Shake flask culture of recombinant strains Single colonies of activated GS115-Cas9, PM06, PM06N, and PM06NP from the plate were inoculated into 5 mL YPD (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract) tubes and incubated at 30°C and 250 rpm for 24 h. Subsequently, 2% inoculum was transferred to 250 mL shake flasks and cultured in YPG (20 g / L glycerol, 20 g / L peptone, 10 g / L yeast extract) medium (30 mL volume), with three replicates for each strain. Incubation was continued at 30°C and 250 rpm for 96 h, with 2% glycerol added every 24 h.

[0097] (2) 5 L fermenter feeding and batch fermentation A single colony of PM06NP activated on YPD plates was inoculated into a 5 mL YPD tube and cultured at 30°C and 220 rpm for 24 h. Then, a 2% inoculum was transferred to 50 mL YPG liquid medium and cultured at 30°C and 250 rpm for 24 h as the seed culture. Subsequently, a 10% inoculum was inoculated into a 5 L fermenter containing 2.5 L of YPG medium. The initial glycerol concentration was 40 g / L, and the fermentation temperature was 30°C. Dissolved oxygen (DO) was maintained above 20% by adjusting the stirring speed (600-900 rpm) and aeration rate (1-3 vvm). The pH was maintained at 5.4-5.6 by automatically adding ammonia (25%) and acetic acid (36%). When the glycerol concentration fell below 1 g / L, a limiting glycerol feed (containing 500 g / L glycerol and 20 g / L yeast extract) was initiated to maintain the glycerol concentration between 0.1-3 g / L. Samples were taken periodically during fermentation to determine the OD. 600 The concentrations of glycerol and ethanol, as well as the yield and degree of CSA, were measured, and fermentation was terminated after 168 h.

[0098] (3) Product extraction and detection Sample preparation: The purified polysaccharide sample was prepared into a 0.5-2 mg / mL solution using 20 mM Tris-HCl buffer (pH 7.4). Chondroitin sulfate ABCI (final concentration 10 U / mL) was added, and the sample was incubated at 30 ℃ for 24 h to completely hydrolyze the polysaccharide into disaccharide units. After hydrolysis, the enzyme was inactivated by heating at 80 ℃ for 10 min. The sample was then filtered through a 0.22 μm PES filter, and the filtrate was collected for subsequent analysis.

[0099] Detection conditions: Qualitative and quantitative analysis was performed using high-performance liquid chromatography-mass spectrometry (HPLC-MS). A HILIC column was used, with gradient separation employing a mobile phase of 10 mM ammonium acetate aqueous solution and 90% acetonitrile solution containing 10 mM ammonium acetate. Mass spectrometry was performed in negative ion electrospray ionization mode, with a scan range of m / z 50-800. Qualitative and quantitative analysis was performed by comparing the retention times of standards and characteristic ions (Di-OS: m / z 378.1042; Di-4S: m / z 458.0606). The degree of sulfation was defined as the percentage of the disaccharide unit Di-4S in the total amount of Di-4S and Di-OS.

[0100] (4) Fermentation results The shake-flask fermentation results (Table 1) showed that the sulfation degree of strain PM06NP was 72.9%, which was higher than that of PM06 (45.0%) and PM06N (62.5%), indicating that the enhancement of the PAPS supply module effectively promoted the sulfation efficiency.

[0101] Fermentation results from a 5 L fermenter showed (​ At the end of 168 h fermentation, strain PM06NP produced 3.85 g / L of CSA, with a stable sulfation degree of 74.2%, consistent with the shake flask results. No significant ethanol accumulation (<1 g / L) was observed during fermentation, and cell growth was good (OD). 600 The highest value reached 182.8.

[0102] Table 1 The Pichia pastoris engineered strain was cultured according to the culture method described in step (1), and the Pichia pastoris engineered strain PM06NP was subjected to fed-batch fermentation according to the method shown in step (2). The CSA yield and sulfation degree were determined using the detection method described in step (3), and the mass spectra are shown below. ​ As shown in Table 1, the yields in the shake flasks are as follows: ​ As shown in the figure. Fermentation results indicate that, using the engineered strain PM06NP constructed according to this invention and the described fermentation process, after 168 h of cultivation in a 5 L fermenter, the CSA yield reached 3.85 g / L, while the product sulfation degree remained stable at 74.2%. This result demonstrates that this invention, through key enzyme design, multi-copy integration, and multi-module synergistic adaptation strategies, successfully achieved an effective balance and simultaneous increase in CSA yield and sulfation degree in Pichia pastoris, providing a potentially industrial-scale technical solution for the green and efficient microbial production of CSA.

Claims

1. A yeast strain for producing chondroitin sulfate A, characterized in that, Obtained from yeast through any of the following genetic engineering modifications: Modification 1: Integrating the chondroitin synthesis module, including the chondroitin polymerase gene. kfoC Epimerase gene kfoA and UDP-glucose dehydrogenase gene tuaD Gene; Modification 2: Based on Modification 1, the chondroitin-4-O-sulfate transferase gene is further integrated; Modification 3: Based on modification 1 or 2, further glycosylation modification is performed, wherein the glycosylation modification involves knocking out the OCH1 gene and / or integrating it. MnsⅠ , Mnn2 , GnT I At least one of the glycosylation-modified genes; Modification 4: Based on any one of modifications 1 to 3, further enhance the PAPS supply module, wherein the enhancement of the PAPS supply module is the knockout of the PAPS reductase gene. MET16 and / or overexpression of ATP sulfate enzyme MET3 and adenosylsulfate kinase MET14 At least one of the genes.

2. The engineered yeast strain for producing chondroitin sulfate A according to claim 1, characterized in that, In modification 2, the chondroitin-4-O-sulfate transferase gene was converted to a wild-type human gene. Hs CHST11 or human gene Hs The mutant gene of CHST11, wherein the mutant protein encoded by the mutant gene contains a combination of mutation sites of I67D, E114D, E117R, A127E, L134V, A159N, P170E, I206T, K218R, E238Y, I245G, S286A, S297D, Y298S, Y304S, A305G and T316A.

3. The engineered yeast strain for producing chondroitin sulfate A according to claim 1, characterized in that, In Modification 2, the number of integrated copies of the chondroitin-4-O-sulfate transferase gene is one or more.

4. The engineered yeast strain for producing chondroitin sulfate A according to claim 3, characterized in that, In Modification 2, the number of integrated copies of the chondroitin-4-O-sulfatase gene ranges from 1 to 6, with different copies integrated at different sites.

5. The engineered yeast strain for producing chondroitin sulfate A according to claim 1, characterized in that, In Modification 2, the chondroitin-4-O-sulfate transferase gene also includes a coding sequence for a soluble tag for fusion expression with chondroitin-4-O-sulfate transferase, wherein the soluble tag is thioredoxin TrxA.

6. The engineered yeast strain for producing chondroitin sulfate A according to claim 1, characterized in that, In Modification 4, the enhancement of the PAPS supply module also includes overexpression of the polyphosphate kinase PPK and the bisphosphonate-3′-nucleotidase BPNT gene.

7. The engineered yeast strain for producing chondroitin sulfate A according to claim 1, characterized in that, The yeast in question is Pichia pastoris.

8. The use of the engineered yeast strain for producing chondroitin sulfate A according to any one of claims 1 to 7 in the fermentation production of chondroitin sulfate A.

9. A method for producing chondroitin sulfate A, characterized in that, The yeast engineered strain for producing chondroitin sulfate A according to any one of claims 1 to 7 is fermented and cultured, and chondroitin sulfate A is extracted and obtained.

10. The method for producing chondroitin sulfate A according to claim 9, characterized in that, The engineered yeast strain for producing chondroitin sulfate A was inoculated into YPG medium containing glycerol and subjected to shake-flask fermentation or fed-batch fermentation in a bioreactor. The glycerol concentration was controlled by a carbon-limiting feeding strategy, and the dissolved oxygen was maintained above 20%, while the pH was maintained at 5.4-5.6.

Images