Nucleic acid molecule, primer group and application thereof
By introducing glyphosate and glufosinate resistance genes into rapeseed, a dual-resistant transgenic rapeseed was bred, which solved the shortcomings of herbicide use in rapeseed production and achieved efficient weed control and germplasm resource enhancement.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHANGSHA JIEMEIAO BIOTECHNOLOGY CO LTD
- Filing Date
- 2026-03-24
- Publication Date
- 2026-05-15
AI Technical Summary
Currently, selective herbicides are the main method for weed control in rapeseed production in China. However, they have drawbacks such as poor weed control, high price, and easy herbicide damage. Furthermore, there is a lack of glufosinate-resistant gene transformation events with independent intellectual property rights.
By transferring the glyphosate resistance gene cp4 epsps and the glufosinate resistance gene bar into rapeseed Westar using Agrobacterium-mediated transformation, a transgenic rapeseed resistant to both glyphosate and glufosinate was bred. This provided nucleic acid molecules and primer sets for detection and application, achieving tolerance to herbicides.
New herbicide-resistant germplasm has been created, and the industrialization of glyphosate and glufosinate-resistant transgenic rapeseed has been realized, which has greater economic, social and environmental benefits and provides high-quality germplasm resources for agricultural production.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of transgenic plant technology, specifically to nucleic acid molecules, primer sets, and their applications. Background Technology
[0002] Rapeseed (Brassica napus L.) is my country's most important source of edible oil and feed protein, and the world's second largest oilseed crop after soybean. Especially since the 1960s and 70s, the planting area of low-erucic acid rapeseed has been continuously increasing, making it one of the primary edible oilseed crops. Rapeseed belongs to the Brassicaceae family and the Brassica genus. It originated from the natural hybridization of turnip and Chinese cabbage genomes within a very limited geographical area, and is currently one of the plants most extensively studied for transgenic purposes.
[0003] Weeds are a significant factor affecting rapeseed yield, making weed control essential for rapeseed production. The emergence of herbicide-resistant rapeseed has greatly facilitated cultivation for farmers. After planting herbicide-resistant rapeseed, herbicides can be sprayed directly during the rapeseed's growing season, eliminating the need for tilling and promoting soil and water conservation. Currently, herbicide-resistant rapeseed is widely cultivated in countries such as Canada, the United States, and Australia.
[0004] Glyphosate is an important herbicide with good systemic absorption and low toxicity, posing virtually no toxicity to humans and animals (Williams, Kroes et al. 2000). It decomposes readily in the environment and binds tightly to soil, thus minimizing its risk of water pollution (Giesy, Dobson et al. 2000). Furthermore, its simple structure and low cost make it an ideal herbicide. Unlike other herbicides, glyphosate has a unique mechanism of action and target. It is a competitive inhibitor of 5-enolpyruvate-3-phosphate synthase (EPSPS) in the shikimic acid pathway (Holländer and Amrhein 1980). EPSPS is widely distributed in the chloroplasts of fungi, bacteria, algae, and higher plants, participating in the biosynthesis of aromatic amino acids (Dill. 2005). Under the action of glyphosate, the feedback inhibition of the shikimic acid pathway is blocked, leading to a large accumulation of shikimic acid and a significant reduction in the synthesis of aromatic amino acids, ultimately resulting in the death of the organism (Duke and Powles 2008). However, glyphosate is a non-selective herbicide, a characteristic that greatly limits its application time and scope. Therefore, researchers have been dedicated to the research and breeding of glyphosate-resistant crops, and since the 1980s, recombinant DNA technology has been used to develop glyphosate-resistant crops.
[0005] The principles and mechanisms of glyphosate resistance genes mainly involve three aspects: First, promoting the overexpression of the epsps gene. For example, Shah et al. cloned the epsps gene cDNA sequence from morning glory, constructed an expression vector, and transferred it into morning glory to induce glyphosate resistance. However, this resistance is relatively weak and cannot meet commercial requirements (Shah, Horsch et al. 1986). Second, introducing an epsps gene with low affinity for glyphosate. For example, Monsanto used the cp4 gene cloned from Agrobacterium (Peñaloza-Vazquez, Mena et al. 1995), and Bayer obtained glyphosate-resistant transgenic maize GA21 by expressing a mutant epsps gene in maize (US Patent 6,566,587). These types of genes are the main genes used for commercial breeding. Third, a glyphosate-degrading gene was introduced. In 1995, Penaloza-Vazquez et al. cloned the glyphosate-degrading genes glpA and glpB and introduced them into glyphosate-sensitive E. coli, giving them the ability to degrade glyphosate (Peñaloza-Vazquez, Mena et al. 1995).
[0006] The earliest patent for the epsps gene was filed in the United States by Calgene on January 1, 1983 (patent number: US4769061). Currently, almost all commercially available glyphosate-resistant transgenic crops are modified with the cp4 gene, which was cloned by Monsanto and patented in 1994 (patent number: US5633435), expiring in 2014. Currently, more than 30 glyphosate-resistant genes have been developed globally, but only a few are truly applied commercially. The main reason is that practical genes not only need to have high resistance to glyphosate, but also stable gene expression and prevent cross-influence when multiple genes are combined.
[0007] Glufosinate is also an important herbicide, characterized by its broad spectrum of weed control, low toxicity, high activity, easy degradation in soil, crop safety, low drift, low dosage, good environmental compatibility, and rapid weed control. Currently, internationally, glufosinate-resistant transgenic products include: Bayer Crop Science's glufosinate-resistant transgenic cotton LLCotton25, transgenic soybeans A2704-12, A2704-21, A5547-127, A5547-35, W62, and W98, and transgenic rapeseed HCN28(T45). Transformation events involving dual or multiple herbicides, with one trait being resistance to glufosinate, include: Monsanto's glufosinate and dicamba-resistant transgenic cotton MON88701 and transgenic corn MON87419; Dow AgroSciences' glufosinate and 2,4-D-resistant transgenic cotton 81910 and transgenic soybean DAS68416-4, and glufosinate, glyphosate, and 2,4-D-resistant transgenic soybean DAS44406-6; Bayer Crop Science and Syngenta's glufosinate and mesotrione-resistant transgenic soybean SYHTØH2; and Syngenta's glyphosate and glufosinate-resistant transgenic corn MZHG0JG. Transformation events involving glufosinate resistance and insect resistance include: Bayer CropScience's glufosinate-resistant and lepidopteran transgenic cotton GHB119, T303-3, and T304-40; glufosinate-resistant and antibiotic-resistant transgenic soybean GU262; glufosinate-resistant and male-sterile transgenic rapeseed MS1 (B91-4) and MS8; glufosinate-resistant and fertility-restoring transgenic rapeseed RF1 (B93-101), RF2 (B94-2), and RF3; glufosinate-resistant and antibiotic-resistant transgenic rapeseed HCN10 and HCN92; glufosinate-resistant, male-sterile, and fertility-restoring transgenic rapeseed PHY14, PHY23, PHY35, and PHY36; DuPont's glufosinate-resistant and insect-resistant transgenic maize 4114; and Dow AgroScience and DuPont's glufosinate-resistant and insect-resistant transgenic maize 59122.
[0008] In addition to independent transformation events, glufosinate-resistant transgenic events bred through artificial hybridization include: Bayer CropScience's glyphosate and glufosinate-resistant transgenic cotton GHB614×LLCotton25; glyphosate, glufosinate, and isoxaflutole transgenic soybean FG72×A5547-127; glufosinate-resistant, male-sterile, and fertility-restoring transgenic rapeseed MS1×RF1(PGS1), MS1×RF2(PGS2), MS1×RF3, and MS8×RF3; glufosinate-resistant, glyphosate-resistant, and fertility-restoring transgenic rapeseed MON88302×RF3, RF1×MON88302, and RF2×MON88302; and Monsanto's glyphosate, glufosinate, and wheatgrass resistant transgenic rapeseed. Genetically modified cotton MON88701×MON88913 resistant to glyphosate, glufosinate, and lepidopteran insects; genetically modified cotton 3006-210-23×281-24-236×MON1445 resistant to glufosinate, glufosinate, and lepidopteran insects; genetically modified rapeseed MON88701×MON88913×MON15985 resistant to glufosinate, glufosinate, and lepidopteran pests; genetically modified rapeseed MON88302×MS8×RF3 resistant to glyphosate, glufosinate, male sterility, and fertility restoration; etc.; Bayer Crop Science; Dow AgroSciences' DAS68416-4×MON89788 resistant to glyphosate, glufosinate, and 2,4-D; DuPont's genetically modified rapeseed 73496×RF3 resistant to glyphosate, glufosinate, and fertility restoration, etc.
[0009] According to statistics compiled by Wang Yuanyuan and Wang Min et al. (Wang Yuanyuan, 2018), there are currently 18, 13, 21, and 169 glufosinate-resistant transformation events in cotton, soybean, rapeseed, and corn internationally, accounting for 46.15%, 46.42%, 65.62%, and 84.08% of herbicide resistance transformation events in these crops, respectively. However, in my country, no glufosinate-resistant gene transformation events with independent intellectual property rights have been reported. Therefore, efforts should be strengthened to cultivate glufosinate-resistant transformation events. Currently, selective herbicides are mainly used for weed control in rapeseed production in China, which have disadvantages such as poor weed control effect, high price, high residue, and easy herbicide damage. Summary of the Invention
[0010] In view of this, the technical problem to be solved by this invention is to provide nucleic acid molecules, primer sets, and their applications. This invention provides a method for transferring the glyphosate resistance gene cp4 epsps and the glufosinate resistance gene bar into rapeseed Westar via Agrobacterium-mediated transformation, thereby endowing it with glyphosate and glufosinate resistance characteristics, creating a new herbicide-resistant germplasm (new variety), and providing high-quality germplasm resources for commercial herbicide-resistant breeding. The industrialization of glyphosate and glufosinate-resistant transgenic rapeseed will generate greater economic, social, and environmental benefits, making a new and significant contribution to my country's agricultural production.
[0011] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0012] This invention provides a nucleic acid molecule having:
[0013] (1) Any nucleotide sequence as shown in SEQ ID NO:21~23;
[0014] (2) A nucleotide sequence obtained by modifying, substituting, deleting and / or adding one or more bases to the nucleotide sequence shown in (1);
[0015] (3) A sequence that has at least 80% homology with the nucleotide sequence shown in (1);
[0016] (4) Complementary sequences to sequences shown in (1), (2) or (3).
[0017] In some embodiments, the above-mentioned nucleic acid molecules are derived from transgenic plants, seeds, or cells containing the transgenic rapeseed event WYN296;
[0018] The accession number for the genetically modified rapeseed event WYN296 is CGMCC No. 30708.
[0019] This invention provides a primer set, comprising at least one set of primer pair 1 to primer pair 4;
[0020] The primer pair 1 has:
[0021] (5) The forward primer as shown in SEQ ID NO:13 and the downstream primer with the nucleotide sequence shown in SEQ ID NO:14;
[0022] (6) A nucleotide sequence obtained by modifying, substituting, deleting and / or adding one or more bases to the nucleotide sequence shown in (5);
[0023] (7) A sequence that has at least 80% homology with the nucleotide sequence shown in (5);
[0024] (8) A complementary sequence to the sequence shown in (5), (6) or (7); and / or
[0025] The primer pair 2 has:
[0026] (9) The forward primer as shown in SEQ ID NO:15 and the downstream primer with the nucleotide sequence shown in SEQ ID NO:16;
[0027] (10) A nucleotide sequence obtained by modifying, substituting, deleting and / or adding one or more bases to the nucleotide sequence shown in (9);
[0028] (11) A sequence that has at least 80% homology with the nucleotide sequence shown in (9);
[0029] (12) A complementary sequence to the sequence shown in (9), (10) or (11); and / or
[0030] The primer pair 3 has:
[0031] (13) The forward primer as shown in SEQ ID NO:17 and the downstream primer with the nucleotide sequence shown in SEQ ID NO:18;
[0032] (14) A nucleotide sequence obtained by modifying, substituting, deleting and / or adding one or more bases to the nucleotide sequence shown in (13);
[0033] (15) A sequence that has at least 80% homology with the nucleotide sequence shown in (13);
[0034] (16) A complementary sequence to the sequence shown in (13), (14) or (15); and / or
[0035] The primer pair 4 has:
[0036] (17) The forward primer as shown in SEQ ID NO:19 and the downstream primer with the nucleotide sequence shown in SEQ ID NO:20;
[0037] (18) A nucleotide sequence obtained by modifying, substituting, deleting and / or adding one or more bases to the nucleotide sequence shown in (17);
[0038] (19) A sequence that has at least 80% homology with the nucleotide sequence shown in (17);
[0039] (20) Complementary sequences to sequences shown in (17), (18) or (19).
[0040] The present invention provides a kit comprising: the primer set described herein, and acceptable auxiliaries, carriers, and / or devices.
[0041] The present invention provides the use of the primer set and / or the kit described herein in (a) and / or (b) below;
[0042] (a) Detection of nucleic acid molecules in the genetically modified rapeseed event WYN296;
[0043] (b) Detect the presence of nucleic acid molecules of the genetically modified rapeseed event WYN296 in the sample.
[0044] This invention provides a method for detecting the presence of nucleic acid molecules of the transgenic rapeseed event WYN296 in a sample, using the primer set and / or the kit described above to detect the nucleic acid molecules.
[0045] This invention provides a method for protecting rapeseed plants from damage caused by herbicides, comprising planting transgenic rapeseed plants containing the nucleic acid molecules and applying herbicides;
[0046] The accession number for the genetically modified rapeseed event WYN296 is CGMCC No. 30708.
[0047] In some embodiments, the herbicide is glyphosate herbicide and / or glufosinate herbicide.
[0048] This invention provides a method for controlling weeds in fields where rapeseed is grown, by applying a herbicide to fields where transgenic rapeseed is grown, the transgenic rapeseed containing the aforementioned nucleic acid molecules.
[0049] In some embodiments, the herbicide is glyphosate herbicide and / or glufosinate herbicide.
[0050] This invention provides a method for cultivating rapeseed plants tolerant to glyphosate and / or glufosinate herbicides, comprising the following steps:
[0051] Step 1: Plant rapeseed seeds containing the nucleic acid molecules and let them grow and develop into rapeseed plants, which serve as the first parent rapeseed plants;
[0052] Step 2: Take the first parent rapeseed plant and sexually cross it with the second parent rapeseed plant that lacks tolerance to glyphosate herbicide and / or glufosinate herbicide, thereby producing a large number of offspring plants;
[0053] Step 3: Spray the progeny plants with an effective dose of glyphosate herbicide and / or glufosinate herbicide, and harvest plants with reduced plant damage compared to other plants that do not have the transgenic rapeseed event WYN296.
[0054] In some embodiments, in step 1, the rapeseed seeds are the seeds of the transgenic rapeseed event WYN296.
[0055] This invention provides exogenous flanking sequences and full-length sequences of the transformation event of glyphosate- and glufosinate-tolerant rapeseed WYN296, and their application in detecting transgenic rapeseed. By designing specific primer pairs, PCR can be used to detect whether the rapeseed to be tested is WYN296, a herbicide-tolerant rapeseed transgenic with the cp4 epsps and bar genes. This method has high accuracy, strong specificity, and high sensitivity, and can quickly, efficiently, and specifically detect whether the sample to be tested originates from the above-mentioned transgenic components. At the same time, it provides technical support for market identification and recognition after the commercialization and industrialization of this product, and has important significance and broad prospects for promoting the identification of rapeseed germplasm resources in my country.
[0056] Biological Preservation Instructions
[0057] Biological material: WYN296; Classification and nomenclature: Brassica napus; Deposited on June 23, 2025 at the China General Microbiological Culture Collection Center (CGMCC); Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Accession number: CGMCC No. 30708. Attached Figure Description
[0058] Figure 1 This is the full-length insertion sequence for the herbicide-resistant rapeseed WYN296 transformed with the cp4 epsps and bar genes;
[0059] Figure 2 A schematic diagram of the structure of the recombinant expression vector for herbicide-resistant rapeseed WYN296 containing the cp4 epsps and bar genes;
[0060] Figure 3 The results show the 5' end specificity of the cp4 epsps and bar gene-modified herbicide-resistant rapeseed WYN296. In the data, M represents molecular weight standards, from top to bottom: 2kb, 1kb, 750bp, 500bp, 250bp, 100bp; CK1: water control; CK2: plasmid control; CK3: negative control (wild-type Westar); 1-3: WYN296T3 generation transformants; 4-6: WYN296T4 generation transformants; 7-9: WYN296T5 generation transformants.
[0061] Figure 4The results show the 3' end specificity of the herbicide-resistant rapeseed WYN296 transformed with the cp4 epsps and bar genes. In the figures, M represents molecular weight standards, from top to bottom: 2kb, 1kb, 750bp, 500bp, 250bp, 100bp; CK1: water control; CK2: plasmid control; CK3: negative control (wild-type Westar); 1-3: WYN296T3 generation transformants; 4-6: WYN296T4 generation transformants; 7-9: WYN296T5 generation transformants.
[0062] Figure 5 This is a Southern hybridization map of the cp4 epsps gene probe of transgenic rapeseed containing the transgenic rapeseed event WYN296, as presented in this invention. In the map, M: DNA Marker III, DIG-labeled (Roche), with band size indicated in bp; P: positive control bar-cp4 epsps-pC3301 plasmid; WYN296 T3, T4, and T5: representing WYN296 T3, T4, and T5 generation transformants, respectively; WT: representing the non-transgenic negative control material Westar; the restriction enzyme sequence is BstXI and XhoI. Southern blot hybridization was performed after digestion with these two restriction enzymes individually.
[0063] Figure 6 This is a Southern blot diagram of the bar gene probe of the transgenic rapeseed containing the transgenic rapeseed event WYN296 of the present invention. In the diagram, M: DNA Marker III, DIG-labeled (Roche), with band size indicated in bp; P: positive control bar-cp4 epsps-pC3301 plasmid; WYN296 T3, T4, T5: represent WYN296 T3, T4, and T5 generation transformants, respectively; WT: represents the non-transgenic negative control material Westar; the restriction enzyme sequence is HindIII and NcoI. Southern blot hybridization was performed after digestion with these two restriction enzymes individually.
[0064] Figure 7 The field effect diagram of the transgenic rapeseed containing the transgenic rapeseed event WYN296 of the present invention at the recommended field concentration of glyphosate herbicide at 4 times the dose;
[0065] Figure 8 This is a field effect diagram of the genetically modified rapeseed containing the WYN296 genetically modified rapeseed of the present invention, when sprayed with 4 times the recommended spray concentration of glufosinate herbicide. Detailed Implementation
[0066] This invention provides nucleic acid molecules, primer sets, and their applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.
[0067] One object of the present invention is to provide a method for cultivating transgenic rapeseed resistant to glyphosate and glufosinate herbicides, comprising: inserting exogenous DNA molecules into the genome of the target rapeseed to obtain transgenic rapeseed resistant to glyphosate and glufosinate herbicides.
[0068] The exogenous DNA molecule contains DNA molecules containing the glyphosate resistance gene cp4 epsps and the glufosinate resistance gene bar.
[0069] The upstream flanking sequence of the exogenous DNA molecule in the glyphosate- and glufosinate-resistant transgenic rapeseed is any DNA fragment obtained by extending upstream from the upstream insertion site.
[0070] The downstream flanking sequence of the exogenous DNA molecule in the glyphosate- and glufosinate-resistant transgenic rapeseed is any DNA fragment obtained by extending downstream from the downstream insertion site.
[0071] The glyphosate- and glufosinate-tolerant transgenic rapeseed contains a specific DNA fragment; the specific DNA fragment is composed of the upstream flanking sequence, the exogenous DNA molecule, and the downstream flanking sequence in sequence;
[0072] The exogenous DNA molecule is shown in SEQ ID NO:23;
[0073] The glyphosate- and glufosinate-tolerant transgenic rapeseed mentioned is the T1 generation positive line WYN296 (transgenic rapeseed event WYN296), which was deposited at the China General Microbiological Culture Collection Center on June 26, 2025, and classified as European rapeseed (Brassica napus), with the accession number CGMCC No. 30708.
[0074] 2. This invention also provides a method for cultivating transgenic rapeseed resistant to glyphosate and glufosinate herbicides.
[0075] The glyphosate- and glufosinate-tolerant transgenic rapeseed or its offspring prepared according to the above method are used as parent materials to be crossed with other rapeseed varieties that do not have tolerance to glyphosate and glufosinate to obtain glyphosate- and glufosinate-tolerant transgenic rapeseed; the glyphosate- and glufosinate-tolerant transgenic rapeseed contains the above-mentioned specific DNA fragment.
[0076] 3. One object of the present invention is to provide a primer pair or primer set for detecting or assisting in the detection of whether the rapeseed to be tested is herbicide-resistant rapeseed WYN296 transgenic cp4epsps and bar genes.
[0077] The primer pairs provided by this invention are specifically primer pair 1 or primer pair 2.
[0078] The primer pair set provided by the present invention specifically consists of primer pair 1 and primer pair 2.
[0079] The upstream primer in primer pair 1 was designed based on positions 1-559 of sequence 21 in the sequence listing, and the downstream primer was designed based on positions 585-905 of sequence 21 in the sequence listing. In sequence 21, positions 1-559 bp are the rapeseed genome sequence flanking the 5' end of the inserted sequence, and positions 585-905 bp are the components of the inserted sequence.
[0080] The upstream primer in primer pair 2 was designed based on positions 1-634 of sequence 22 in the sequence listing, and the downstream primer was designed based on positions 635-1011 of sequence 22 in the sequence listing. Positions 1-634 bp in sequence 22 are components of the insert sequence, and positions 635-1011 bp are the rapeseed genome sequence flanking the 3' end of the insert sequence.
[0081] 4. More specifically, primer pair 1 is any one of the primer pairs shown in (1)-(2) below; primer pair 2 is any one of the primer pairs shown in (3)-(4) below:
[0082] (1) Primer pair consisting of two single-stranded DNA molecules shown in sequences 13 and 14 in the sequence listing;
[0083] (2) Primer pair consisting of two single-stranded DNA molecules shown in sequences 17 and 18 in the sequence listing;
[0084] (3) Primer pair consisting of two single-stranded DNA molecules shown in sequences 15 and 16 in the sequence listing;
[0085] (4) Primer pair consisting of two single-stranded DNA molecules shown in sequences 19 and 20 in the sequence listing;
[0086] In this invention, the two single-stranded DNA molecules in the primer pair can be packaged individually or in equimolar mixtures. Similarly, the two single-stranded DNA molecules in each primer pair within the primer pair set can be packaged individually or in equimolar mixtures.
[0087] 5. The application of the primer pair or primer pair set in the preparation of a kit for detecting or assisting in the detection of whether the rapeseed to be tested is herbicide-resistant rapeseed WYN296 with the cp4epsps and bar genes is also within the scope of protection of this invention.
[0088] 6. Another objective of this invention is to provide a kit for detecting or assisting in the detection of whether the rapeseed to be tested is herbicide-resistant rapeseed WYN296 with the cp4epsps and bar genes.
[0089] The kit provided by this invention specifically includes the primer pair or the primer pair set.
[0090] The kit may also contain conventional reagents required for PCR reactions, such as DNA polymerase and dNTPs.
[0091] The preparation method of the reagent kit is also within the scope of protection of this invention.
[0092] 7. The preparation method of the kit may be as follows (a1) or (a2):
[0093] (a1) includes the following steps: packaging the two single-stranded DNA molecules in the primer pair separately;
[0094] (a2) includes the following steps: packaging the two single-stranded DNA molecules of each primer pair in the primer pair set separately.
[0095] 8. The application of the primer pair or primer pair set, or the kit, in detecting or assisting in the detection of whether the rapeseed to be tested is herbicide-resistant rapeseed WYN296 with the cp4 epsps and bar gene is also within the scope of protection of this invention.
[0096] 9. Another object of the present invention is to provide a method for detecting or assisting in the detection of whether the rapeseed to be tested is herbicide-resistant rapeseed WYN296 with the cp4 epsps and bar genes.
[0097] The method provided by this invention for detecting or assisting in the detection of whether the rapeseed to be tested is the herbicide-resistant rapeseed WYN296 transgenic cp4 epsps and bar gene can be as follows (A) or (B):
[0098] (A) includes the following steps:
[0099] (a1) Using the genomic DNA of the rapeseed to be tested as a template, PCR amplification was performed using primer pair 1 to obtain PCR products;
[0100] (a2) Based on the size of the PCR product, determine whether the rapeseed to be tested is herbicide-resistant rapeseed WYN296 transgenic with the cp4 epsps and bar gene according to the following method: if the PCR product contains a DNA fragment of the expected size, then the rapeseed to be tested is or is a candidate for rapeseed WYN296 transgenic with the cp4 epsps and bar gene; if the PCR product does not contain a DNA fragment of the expected size, then the rapeseed to be tested is not or is not a candidate for rapeseed WYN296 transgenic with the cp4 epsps and bar gene.
[0101] The expected size of the DNA fragment is as follows: if primer pair 1 is a primer pair composed of two single-stranded DNA molecules shown in sequences 13 and 14 of the sequence listing, then the expected size of the DNA fragment is a DNA fragment of 387 bp; if primer pair 1 is a primer pair composed of two single-stranded DNA molecules shown in sequences 17 and 18 of the sequence listing, then the expected size of the DNA fragment is a DNA fragment of 813 bp.
[0102] (B) includes the following steps:
[0103] (b1) Using the genomic DNA of the rapeseed to be tested as a template, PCR amplification was performed using primer pair 2 to obtain PCR products;
[0104] (b2) Based on the size of the PCR product, determine whether the rapeseed to be tested is herbicide-resistant rapeseed WYN296 transgenic with the cp4 epsps and bar gene as follows: if the PCR product contains a DNA fragment of the expected size, then the rapeseed to be tested is or is a candidate for herbicide-resistant rapeseed WYN296 transgenic with the cp4 epsps and bar gene; if the PCR product does not contain a DNA fragment of the expected size, then the rapeseed to be tested is not or is not a candidate for herbicide-resistant rapeseed WYN296 transgenic with the cp4 epsps and bar gene.
[0105] The expected size of the DNA fragment is as follows: if primer pair 2 is a primer pair composed of two single-stranded DNA molecules shown in sequences 15 and 16 of the sequence listing, then the expected size of the DNA fragment is a DNA fragment of 293 bp; if primer pair 2 is a primer pair composed of two single-stranded DNA molecules shown in sequences 19 and 20 of the sequence listing, then the expected size of the DNA fragment is a DNA fragment of 656 bp.
[0106] In the above method (a2), the 387bp DNA fragment is specifically the DNA fragment shown at positions 238-624 of sequence 21 in the sequence listing; the 813bp DNA fragment is specifically the DNA fragment shown at positions 99-911 of sequence 23 in the sequence listing.
[0107] In the above method (b2), the 293bp DNA fragment is specifically the DNA fragment shown at positions 445-737 of sequence 22 in the sequence listing; the 656bp DNA fragment is specifically the DNA fragment shown at positions 5226-5881 of sequence 23 in the sequence listing.
[0108] In the above method, the annealing temperature for PCR amplification with primer pair 1 is 58°C; the annealing temperature for PCR amplification with primer pair 2 is 58°C.
[0109] More specifically, the PCR amplification conditions using primer pair 1 are as follows: 95℃ for 5 min; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 15 s, 32 cycles; 72℃ for 5 min; hold at 4℃. The PCR amplification conditions using primer pair 2 are as follows: 95℃ for 5 min; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 15 s, 32 cycles; 72℃ for 5 min; hold at 4℃.
[0110] In addition, when performing PCR amplification with primer pair 1 or primer pair 2, the upstream and downstream primers in primer pair 1 and primer pair 2 are used in equal molar amounts (e.g., the final concentration of both upstream and downstream primers in the reaction system is 0.25 μM).
[0111] 10. Another object of the present invention is to provide flanking sequences of exogenous insert fragments of herbicide-tolerant rapeseed WYN296 transgenic cp4 epsps and bar genes.
[0112] The flanking sequences of the exogenous insertion fragment of the cp4 epsps and bar gene herbicide-resistant rapeseed WYN296 provided by this invention can be as follows (I), (II), or (III):
[0113] (I) 5' flank sequence;
[0114] (II) 3' Flanking Sequence;
[0115] (III) It consists of the 5' flanking sequence and the 3' flanking sequence;
[0116] The nucleotide sequence of the 5' flanking sequence is sequence 21 in the sequence listing; the 3' flanking sequence is sequence 22 in the sequence listing.
[0117] 11. The application of the flanking sequence in detecting or assisting in the detection of whether the rapeseed to be tested is herbicide-resistant rapeseed WYN296 with the cp4 epsps and bar gene is also within the scope of protection of this invention.
[0118] Primer pair 1 and primer pair 2 were designed using the WYN296 insert sequence and flanking genome sequences. Primer pair 1 and primer pair 2 are just two examples of primers designed using the WYN296 insert sequence and flanking genome sequences. Professionals can design a variety of primer sequences using sequences 21 and 22 disclosed in this invention for the specific detection of WYN296 transformants. Primer pairs designed using sequences 21 and 22 disclosed in this invention are also within the scope of protection of this invention.
[0119] 12. The exogenous insertion sequence of the cp4 epsps and bar gene-transformed herbicide-resistant rapeseed WYN296 also falls within the scope of protection of this invention.
[0120] The nucleotide sequence of the exogenous insertion sequence is positions 632-5541 of sequence 23 in the sequence listing.
[0121] The following uses of the exogenous insertion sequence also fall within the scope of protection of this invention: the use is to introduce the exogenous insertion sequence into non-transgenic rapeseed through inter-rapeseed hybridization, thereby obtaining herbicide-resistant rapeseed.
[0122] 13. The application of positive plants detected using the primer pairs in the cultivation of herbicide-tolerant transgenic rapeseed also falls within the scope of protection of this invention.
[0123] The herbicide may specifically be glyphosate and / or glufosinate.
[0124] The test materials used in this invention are all commercially available products. The invention will be further illustrated below with reference to specific embodiments.
[0125] Example 1 Cloning and Transformation
[0126] 1.1 Vector Cloning
[0127] The recombinant expression vector bar-cp4 epsps-pC3301 was constructed using standard gene cloning techniques. Figure 2(As shown). The vector bar-cp4 epsps-pC3301 contains two tandem transgenic expression cassettes. The first cassette consists of the ubiquitin promoter from the Arabidopsis ubiquitin gene and the sp regulatory sequence of the Osctp chloroplast transport peptide from rice, operably linked to the -cp4 epsps gene and operably linked to the terminator (tNos) of the carmine synthase gene. The second expression cassette consists of the cauliflower mosaic virus (CaMV) 35S promoter, operably linked to the BAR gene and operably linked to the CaMV 3'UTR (polyA signal). The vector bar-cp4 epsps-pC3301 was transformed into Agrobacterium EHA105 by electroporation, and the transformed cells were screened using 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) as a selection marker.
[0128] 1.2 Plant Transformation
[0129] The study employed the Agrobacterium-mediated hypocotyl infection method. The bar-cp4 epsps-pC3301 plasmid was transformed into Agrobacterium EHA105 via electroporation and identified for later use. Seeds harvested from the self-pollination of the rapeseed inbred line Westar were soaked in 70% ethanol for 1 minute on a clean bench, then disinfected with 8% sodium hypochlorite for 5 minutes before being sown into a culture medium and cultured in the dark. After 7 days, the well-grown hypocotyls were cut into 1 cm pieces and placed in a pre-culture medium for dark culture. Two days later, they were infected with Agrobacterium-mediated inoculum, transferred to a co-culture medium, and cultured in the dark at 26°C for 2 days. Then, they were transferred to a recovery medium and cultured in the dark at 28°C for 7 days. Finally, they were transferred to a selection medium containing 1 mM glyphosate (glyphosate technical material from Xin'an Chemical Group Technology Center) for callus screening. The screening conditions were 28°C, light intensity 2000-2300 lx, and 14-18 h of light per day. After the tolerant callus emerged, select callus in good condition and transfer them to differentiation medium. Differentiation culture conditions were 28℃, light intensity 2000-2300 lx, and 14-18 h light per day until seedlings appeared. Strong seedlings were cultured under the same conditions as the differentiation culture. The regenerated seedlings were then transferred to rooting medium. Once the seedlings had 3-5 roots, they were transplanted into small pots mixed with nutrient soil and vermiculite (1:3). Simultaneously, leaf samples were taken for DNA extraction, and PCR testing was used to identify positive plants, which were then transplanted into larger pots. T0 generation seeds were obtained through self-pollination.
[0130] 1.3 Identification and Screening of Genetically Modified Events
[0131] By performing molecular testing (including target gene copy number, insertion location, etc.), target traits (herbicide tolerance), and agronomic traits assessment on all T0 plants, abnormal transformant plants were removed, and WYN296 was obtained through screening.
[0132] Example 2: Flanking sequence cloning of herbicide-tolerant rapeseed WYN296 transgenic cp4 epsps and bar genes.
[0133] 2.1 Full-length cloning of the insert fragment from the herbicide-tolerant rapeseed WYN296 with the cp4 epsps and bar genes.
[0134] The insert sequence of transformant WYN296 and partial flanking sequences were isolated using Tail-PCR. Further analysis of the flanking sequences, using the Brassica napus genome database BnIR (https: / / yanglab.hzau.edu.cn / BnIR / jbrowse) from Huazhong Agricultural University, with Westar.v0 as the alignment reference genome, confirmed that the insert sequence was integrated into the C06 chromosome genome of Brassica napus (Chr C06: 36025711-36025726). Primers were designed to clone the entire T-DNA region in segments, and the PCR products were sequenced. A schematic diagram of the PCR amplification is shown below. Figure 1 As shown, the primers are detailed in Table 1 (Sequences 1-12).
[0135] Table 1
[0136]
[0137] 2.2 Full-length splicing analysis of the insertion sequences of herbicide-tolerant rapeseed WYN296 with cp4-transformed epsps and bar genes
[0138] The sequencing results of the cloned fragments obtained in step two were assembled using snapGene software. The assembled result conformed to the expected insertion map, as shown below. Figure 1 As shown, the resulting sequence is sequence 23 in the sequence list.
[0139] PCR nucleic acid sequencing yielded a 5881 bp nucleic acid sequence of rapeseed WYN296, including the T-DNA insertion sequence of rapeseed WYN296 and some flanking genomic sequences:
[0140] The 5' flanking sequence of the rapeseed genome is 631 bp in total (including 606 bp of genome sequence and 25 bp of rearranged sequence);
[0141] The exogenous T-DNA insertion sequence totaled 4910 bp;
[0142] The 3' flanking sequence of the rapeseed genome is 340 bp in total;
[0143] The actual T-DNA sequence obtained by PCR sequencing was compared with the theoretical T-DNA sequence. Analysis revealed that the actual T-DNA insertion sequence had a 42 bp deletion in the left T-Border (right) region (including a 16 bp spacer sequence and a 26 bp right border sequence). Simultaneously, a 25 bp rearrangement occurred at the 5' end of the genome during T-DNA insertion. The right T-Border (left) region of the T-DNA insertion sequence also had a 33 bp deletion (including a 7 bp spacer sequence and a 26 bp left border sequence). All other nucleotide sequences were identical to the theoretical sequence.
[0144] Sequence 23 contains a 4910bp full-length sequence integrated into the genome. The specific information of the sequence is described below from 5' to 3', as shown in Table 2.
[0145] Table 2
[0146]
[0147] Example 3: Transformant-specific PCR detection
[0148] 3.1 Primer pair design and synthesis for converting cp4 epsps and bar genes into herbicide-tolerant rapeseed WYN296
[0149] Based on the 5' flanking sequence (sequence 21) of the transgenic cp4 epsps and bar gene herbicide-resistant rapeseed WYN296 obtained in Example 2, primer pair 1 with specific screening was designed; based on the 3' flanking sequence (sequence 22) of the transgenic cp4 epsps and bar gene herbicide-resistant rapeseed WYN296 obtained in Example 2, primer pair 2 with specific screening was designed.
[0150] Primer pair 1 designed for the 5' flanking sequence (sequence 21):
[0151] WYN296LB-F1: 5'-TTCAACTGACATGGTATAGGCCC-3' (Sequence 13, SEQ ID NO: 13);
[0152] WYN296LB-R1: 5'-TTGTCGTTTCCCGCCTTCAGT-3' (Sequence 14, SEQ ID NO: 14).
[0153] Target fragment size: 387bp.
[0154] Theoretically, using this specific primer pair (WYN296LB-F1 / WYN296LB-R1) to amplify the genomic DNA of herbicide-resistant rapeseed WYN296 transgenic cp4 epsps and bar genes by PCR will yield a target band of 387 bp, which is the DNA fragment shown at positions 238-624 of sequence 21 in the sequence listing.
[0155] Primer pair 2 designed for the 3' flanking sequence (sequence 22):
[0156] WYN296RB-F1: 5'-TATAGGGTTTCGCTCATGTGTTG-3' (Sequence 15, SEQ ID NO: 15);
[0157] WYN296RB-R1: 5'-AGTGATGTAGGAAGTGGGCAA-3' (Sequence 16, SEQ ID NO: 16).
[0158] Target fragment size: 293bp.
[0159] Theoretically, using this specific primer pair (WYN296RB-F1 / WYN296RB-R1) to amplify the genomic DNA of herbicide-resistant rapeseed WYN296 transgenic cp4 epsps and bar genes by PCR will yield a target band of 293 bp, which is the DNA fragment shown at positions 445-737 of sequence 22 in the sequence listing.
[0160] The two primer pairs mentioned above are just two examples of primers designed using the flanking and insertion sequences of WYN296. Many different primer pairs can be designed based on the flanking and insertion sequences. Therefore, other primers designed using the flanking and insertion sequences of WYN296 should also be within the scope of protection of this patent.
[0161] For example, based on the full-length spliced sequence (sequence 23) of the herbicide-tolerant rapeseed WYN296 transgenic cp4 epsps and bar gene obtained in Example 2, primer pairs 3 and 4 were designed to screen for specificity.
[0162] Primer pair 3 designed for integration into the 5' end of the full-length rapeseed genome sequence (sequence 23):
[0163] WYN296LB-F2: 5'-TAGCTCGTCTGCTGCGTTCA-3' (Sequence 17, SEQ ID NO: 17);
[0164] WYN296LB-R2: 5'-CGGTGTCATCTATGTTACTAG-3' (Sequence 18, SEQ ID NO:18);
[0165] Target fragment size: 813bp.
[0166] Theoretically, using this specific primer pair (WYN296LB-F2 / WYN296LB-R2) to amplify the genomic DNA of herbicide-resistant rapeseed WYN296 transgenic cp4 epsps and bar genes will yield a target band of 813 bp, which is the DNA fragment shown at positions 99-911 of sequence 23 in the sequence listing.
[0167] Primer pair 4 was designed to target the 3' end of the full-length rapeseed genome sequence (sequence 23):
[0168] WYN296RB-F2: 5'-TTCTGGCAGCTGGACTTCAG-3' (Sequence 19, SEQ ID NO: 19);
[0169] WYN296RB-R2: 5'-TTGGACTTCCTGAGAGCAGAAG-3' (Sequence 20, SEQ ID NO: 20);
[0170] Target fragment size: 656bp.
[0171] Theoretically, using this specific primer pair (WYN296RB-F2 / WYN296RB-R2) to amplify the genomic DNA of herbicide-tolerant rapeseed WYN296 transgenic cp4 epsps and bar genes by PCR will yield a target band of 656 bp, which is the DNA fragment shown at positions 5226-5881 of sequence 23 in the sequence listing.
[0172] The nucleotide sequence of sequence 21 (SEQ ID NO:21) is shown below:
[0173] GGTCCTAAAGCCATAAACAAAACAGTCACCTATTGAGTCCCAGTACAAATATAGCTCGTCTGCTGCGTTCAGGAGTCAGAACCTAGCATCTGACACAGCCCTTTTCCAGAAGGGCAAAATCGTGTCTCTTGGCCCAAAATCATACTCTGTTTACCTCTTTCGATTTTTCAAGGGCAGTCCTCTAATCTAATCGGTGTCTGATATTGGTATATTACCCTGAATCTCTATGTAAAGTCCTTCAACTGACATGGTATAGGCCCAATACACCAGTTAGCGTTGTTTTCATGGTTAAATAAATTTGTCGAACCATGAACCCAAAACCATTCCGGTCCAGTTCGGTTATCTCTGAATCCACAACTCAAATGGTGCAAGGCGTGACAATGCCTTGTACAAGCTTTCTCAGAAACACGATGAAATTGGCGTCGAGCTTGTTTCCCAATCAATGGCGACTCTTAGCATCATCACCACAGCTTTATCTACAATCTTTCATCTTCTCGTCAGGTACCTCTTCAATCGCTTCCTCAAATCCTTGTCTTTTCATCCTCCTCTTACCTCCTCAATCGCTTCCTCAAATCCTTGTCTTTTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCCAAGCTCAAGCTGCTCTAGCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGGTACCTCAAGCTGGGGATATCCCCGATCTAGTAACATAGATGACACCGCGCGCGATAATTTATCCTAGTTTGCGCGCTATATTTTGTTT
[0174] Among them, the nucleotide sequence of Sequence 22 (SEQ ID NO:22) is shown as follows:
[0175]
[0176] Among them, the nucleotide sequence of SEQ ID NO:23 is shown as follows:
[0177] CTGCACATTTCGTCGTTCGATAAACATTTTTACCGAAAATAATTTGTGGTCCTAAAGCCATAAACAAAACAGTCACCTATTGAGTCCCAGTACAAATATAGCTCGTCTGCTGCGTTCAGGAGTCAGAACCTAGCATCTGACACAGCCCTTTTCCAGAAGGGCAAAATCGTGTCTCTTGGCCCAAAATCATACTCTGTTTACCTCTTTCGATTTTTCAAGGGCAGTCCTCTAATCTAATCGGTGTCTGATATTGGTATATTACCCTGAATCTCTATGTAAAGTCC TTCAACTGACATGGTA TAGGCCC AATACACCAGTTAGCGTTGTTTTCATGGTTAAATAAATTTGTCGAACCATGAACCCAAAACCATTCCGGTCCAGTTCGGTTATCTCTGAATCCACAACTCAAATGGTGCAAGGCGTGACAATGCCTTGTACAAGCTTTCTCAGAAACACGATGAAATTGGCGTCGAGCTTGTTTCCCAATCAATGGCGACTCTTAGCATCATCACCACAGCTTTATCTACAATCTTTCATCTTCTCGTCAGGTACCTCTTCAATCGCTTCCTCAAATCCTTGTCTTTTCATCCTCCTCTTACCTCCTCAATCGCTTCCTCAAATCCTTGTCTTTTCAAACACTGATAGTTTAA ACTGAAGGCGGGAAACGACAA TATAGGGTTTCGCTCATGTGTTG AGCATATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAGTACTAAAATCCAGATCCCCCGAATTAATTCGGCGTTAATTCAGTACATTAAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCCTCCACTTCAAAGTCTCCAACTTTGCGTCAATATCGGAATCTTCAGACAGCTGTTTCTCCAGTCGTCACTTCGAGTTAC TTGCCCACTTCCTACATCACT CAGAAGCAGATTGAAACCCCTACCTCCCCGGTAAAAAGTTCCCACCTTTGGATCCCTTTTTTACTTACAAAAGTCTCGAGCTTTGGGTTAGGTAAAGTTTTTGACTTTTAACGAAAACGAATGTTGGGTTTTGCAGGAAAAGCAAGGGGCTCCAGTGCAGGAGAGTTTGGGGGCTTTTCAAAAACTCCCCATGGTGATGCCATCTATTGATTTGTACTCTTCTGCTCTCAGGAAGTCCAA
[0178] 3.2 Specificity Detection
[0179] (1) Experimental materials: Three plants each from the T3, T4 and T5 generations of the glyphosate-sprayed transformant WYN296 were randomly selected as test samples. The bar-cp4 epsps-pC3301 plasmid was used as a vector control, the receptor Westar was used as a negative control, and water was used as a blank control. PCR detection was performed using the 5' end specific detection primers WYN296LB-F1 (SEQ ID NO:13) and WYN296LB-R1 (SEQ ID NO:14) and the 3' end specific detection primers WYN296RB-F1 (SEQ ID NO:15) and WYN296RB-R1 (SEQ ID NO:16).
[0180] (2) Extraction of rapeseed genomic DNA
[0181] Leaves of transgenic rapeseed WYN296 grown in a greenhouse were collected, and the high-efficiency plant genomic DNA extraction kit (DP350) from Tiangen Biotech (Beijing) Co., Ltd. was used. The extracted rapeseed genomic DNA was dissolved in 200 μL / μL LTE, and 5 μL was taken for 0.7% agarose gel electrophoresis. The A260 / A280 value and DNA concentration of the DNA solution were determined using a UV spectrophotometer.
[0182] (3) PCR reaction system
[0183] Table 3
[0184]
[0185] (4) PCR reaction procedure
[0186]
[0187] (5) Test results
[0188] like Figure 3-4 The results showed that the target fragments of consistent size (387bp and 293bp) could be detected in three randomly selected plants from each of the T3, T4, and T5 generations, consistent with expectations. No bands were amplified in any of the other controls, indicating that both the 5' end-specific PCR and 3' end-specific PCR detection systems for the transformant were effective in specifically detecting the WYN296 transformant. The results also showed that the integration of the exogenous gene of WYN296 into chromosome 2 (Chr C06: 36025711-36025726) is stably inherited.
[0189] Example 4: Detection of the WYN296 transgenic rapeseed event by Southern blot hybridization
[0190] Using the vector plasmid bar-cp4 epsps-pC3301 as a positive control and the non-transgenic rapeseed receptor Westar as a negative control, Southern hybridization was performed on different generations of the transformant WYN296 to obtain transformant-specific molecular hybridization maps. The copy number of the exogenous inserted sequence in the transgenic rapeseed WYN296 and the stability of this event across different generations were analyzed using Southern hybridization.
[0191] 1. Extraction of plant genomic DNA
[0192] Plant genomic DNA was extracted using the CTAB method, as detailed below:
[0193] 1) Place 3 g of leaves in a pre-cooled mortar, add liquid nitrogen and grind the leaves into powder quickly. Pour the powder into a 50 mL centrifuge tube. Add 8 mL of preheated (65℃) 1.5% CTAB extraction solution and shake well. Incubate in a 65℃ water bath for 60-90 min, shaking several times during the process.
[0194] 2) After cooling to room temperature, add 8 mL of chloroform, mix well, shake on a decolorizing shaker for 10 min, and centrifuge at 12000 rpm for 15 min at 4℃;
[0195] 3) Transfer the supernatant to a new centrifuge tube, add an equal volume of chloroform, mix well, and then shake on a decolorizing shaker for 10 min. Centrifuge at 12,000 rpm for 15 min at 4°C.
[0196] 4) Transfer the supernatant to a new centrifuge tube, add an equal volume of isopropanol, shake gently, and use a toothpick to pick up the precipitated flocculent material, transfer it to a 2 mL centrifuge tube, and remove the remaining liquid.
[0197] 5) Add 1 mL of 75% ethanol to rinse, centrifuge at 12000 rpm for 5 min, discard the supernatant, and air dry at room temperature for 5-10 min;
[0198] 6) Add 700 μL ddH2O to completely dissolve the DNA. Add 10 μL RNase (10 mg / L) and incubate at 37°C for 30 min; add 10 μL proteinase K and incubate at 37°C for 30 min.
[0199] 7) Add 0.1 volume of 3M sodium acetate and 2 volumes of anhydrous ethanol, and shake well;
[0200] 8) Centrifuge at 12000 rpm for 15 min at 4℃, discard the supernatant, add 600 μL ethanol (75%) to wash 2-3 times, air dry and dissolve in 500 μL ddH2O;
[0201] 9) Take 1 μL of the solution and standard concentration of λDNA together and electrophoretically examine the DNA quality in a 0.8% agarose gel. Store the remainder at -20℃ for later use.
[0202] 2. Plant genomic DNA digestion and purification
[0203] 1) Enzyme digestion system:
[0204]
[0205] 2) Digest the enzyme at 37℃ for 12-18 h, and take 10 μL of the digested sample for agarose gel electrophoresis to detect the digestion efficiency during the process;
[0206] 3) If the enzyme digestion sample does not have obvious bands and appears diffuse, it indicates that the genomic enzyme digestion is complete. Add 0.1 volume of 3M sodium acetate solution and 2 volume of pre-cooled anhydrous ethanol to each sample tube and place at -20℃ for more than 30 min.
[0207] 4) Centrifuge at 12000 rpm for 10 min, then discard the supernatant;
[0208] 5) Add 75% ethanol to wash the precipitate, centrifuge at 12000 rpm for 5 min, discard the supernatant, and invert to air dry;
[0209] 6) Add 50 μL of ultrapure water to dissolve the DNA precipitate.
[0210] 3. Genomic DNA enzyme digestion product electrophoresis
[0211] 1) Clean the electrophoresis tank, gel casting plate, and other instruments to ensure that there are no residues of nucleic acid and organic reagents, and let them dry for later use;
[0212] 2) Take 30 μg of enzyme digestion sample, add 5 μL of loading buffer, mix well, load 0.05-0.3 ng of positive control plasmid, and load 1.5 μL of digoxigenin marker;
[0213] 3) 1×TAE electrophoresis buffer, 0.7% agarose gel, 18V constant voltage electrophoresis overnight.
[0214] 4. Transfer membrane
[0215] 1) Wearing disposable gloves, remove the gel, cut off the excess gel, and cut off a piece from the upper right corner of the gel as a marker;
[0216] 2) Immerse the gel in 0.25 mM HCl solution for 15 min to depurinate the nucleic acids;
[0217] 3) Soak the gel in denaturing buffer (0.5 M NaOH + 1.5 M NaCl) for denaturation, shake on a shaker at 80 rpm for 15 min, change the buffer, and repeat once;
[0218] 4) Wash twice with double-distilled water, then place in an appropriate amount of neutralization buffer, shake on a shaker at 80 rpm for 15 min, change the buffer, and repeat once;
[0219] 5) Wash once with double-distilled water, then place in 20×SSC buffer and shake on a shaker at 80 rpm for 10 min;
[0220] 6) During steps 3 and 4, the nylon membrane and filter paper are soaked in 20×SSC buffer solution for later use;
[0221] 7) Transfer membrane using the downward siphon method. Ensure there are no air bubbles between the filter paper, nylon membrane, and gel. If necessary, seal the nylon membrane with a plastic sheet to prevent short circuits during siphoning. Transfer membrane usually takes about 4 hours.
[0222] 8) After the transfer is complete, gently wash the nylon membrane in 2×SSC buffer. Place the nylon membrane with the nucleic acid side facing up on moistened filter paper and place it in a UV crosslinking chamber at 1.2 J / cm. 2 3 min, then air dry for later use.
[0223] 5 pre-hybridization
[0224] 1) Digoxigenin-labeled probe preparation was performed using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche).
[0225] Add the following to the 25 μl mixture:
[0226]
[0227] 2) The reaction conditions are the same as those for a standard PCR procedure;
[0228] Tips: The ratio of reagents ② and ④ used should be determined according to the actual situation. For shorter fragments and higher GC content, only reagent ② can be used. The amplification system can be changed as appropriate according to the actual situation.
[0229] 3) Add 64 mL of sterile ultrapure water to a Roche DIG Easy Hyb Granules bottle to prepare the prehybridization solution. The prehybridization solution can be reused 3-5 times and stored at -20℃.
[0230] 4) Hybridization solution preparation: Denature 7 μL of probe at 98℃ for 10 min, then immediately place on ice. Add the probe to 10-15 mL of pre-hybridization solution (preheated at 42℃) to prepare the hybridization solution. The hybridization solution can be reused 3-5 times and stored at -20℃.
[0231] 6. Hybridization and Washing
[0232] 1) Place the nylon membrane with the nucleic acid side facing up into the hybridization tube, pour in an appropriate amount of pre-hybridization solution preheated to 42℃, and place it in a 42℃ hybridization incubator at 80 rpm for 30-60 min for pre-hybridization.
[0233] 2) Recover the pre-hybridization solution, pour in the hybridization solution (preheated at 42℃), hybridize in a 42℃ hybridization oven at 80 rpm for 12-16 h;
[0234] 3) Recover the hybridization solution, add 2×SSC (0.3 M NaCl, 30 mM sodium citrate, pH 7.0), 0.1% SDS, shake at 80 rpm for 15 min at room temperature, and repeat the operation once;
[0235] 4) Discard the solution, add 0.50×SSC (0.075 M NaCl, 7.5 mM sodium citrate, pH 7.0), 0.1% SDS (preheated at 68℃), shake at 68℃ and 80 rpm for 10 min, and repeat the operation once;
[0236] 5) Discard the solution, add an appropriate amount of washing buffer (48.5 mL maleic acid, 1.5 mL 10% Tween), and shake on a shaker at 80 rpm for 5 min at room temperature;
[0237] 6) Add approximately 10-15 mL of 1× blocking buffer and shake on a shaker at 80 rpm for 30-60 min at room temperature;
[0238] 7) Recover the blocking buffer, add 10 mL of blocking solution containing antibody (10 mL blocking buffer: 1 μL digoxigenin antibody), and shake on a shaker at 80 rpm for 30-40 min at room temperature;
[0239] 8) Discard the blocking solution, add the washing buffer, shake on a shaker at 80 rpm for 15 min, and repeat the operation once;
[0240] 9) Discard the washing buffer, add the detection buffer (0.1 M Tris-HCl, 0.1 M NaCl, pH 9.5), and shake on a shaker at 80 rpm for 1-5 min.
[0241] 7. Tableting and Development
[0242] 1) Cut a piece of plastic wrap, slightly larger than twice the area of the nylon film, lay it flat, and evenly drop the colorimetric reagent (3 μL CDP-Star: 300 μL detection buffer, preheated at 37℃ for more than 1 h) in the center of the plastic wrap (the area the size of the nylon film). Cover the colorimetric reagent area with the nucleic acid side of the nylon film facing down, fold the plastic wrap in half, wrap the nylon film, remove any air bubbles, and cut off the excess plastic wrap.
[0243] 2) Lay the plastic wrap flat on the tablet press, right side up, and press the tablets in a dark room for 15 minutes to 2 hours;
[0244] 3) Darkroom development and fixing.
[0245] 8. Probe elution
[0246] 1) Soak the nylon membrane in double-distilled water for 30 minutes;
[0247] 2) Add an appropriate amount of elution buffer (0.2 M NaOH + 0.1% SDS), shake at 37°C and 80 rpm for 15 min, and repeat the operation once;
[0248] 3) 2×SSC buffer, shake on a shaker at 80 rpm for 5 min;
[0249] 4) Remove the nylon membrane, place it on moist filter paper, and store at 4°C.
[0250] 9 Imaging
[0251] Place the membrane in a Southern luminescence imaging system and adjust the exposure time to 1-15 minutes to obtain the best Southern hybridization image.
[0252] 10. Test Results
[0253] 1) Analysis of specific probe hybridization results of cp4 epsps gene
[0254] BstXI has only one restriction site in the T-DNA region. The marker band obtained after BstXI digestion and probe hybridization of the genomic DNA from the WYN296 T3, T4, and T5 generation transformants should include a 3.6 kb T-DNA sequence and a predicted 14.3 kb sequence on the left side of the genome, with a total fragment length of approximately 18.0 kb. For example... Figure 5 As shown, the hybridization band was the expected size of 18.0 kb. However, no hybridization band was observed after hybridization of the non-transgenic control material Westar genomic DNA with the probe following enzyme digestion.
[0255] XhoI has two restriction sites in the T-DNA region. The marker band obtained after XhoI digestion and probe hybridization of the genomic DNA from the WYN296 T3, T4, and T5 generation transformants should include a 4.09 kb T-DNA sequence and a predicted 5.4 kb sequence on the left side of the genome, with a total fragment length of approximately 9.5 kb. For example... Figure 5 As shown, the hybridization band was the expected size of 9.5 kb. However, no hybridization band was observed after hybridization of the non-transgenic control material Westar genomic DNA with the probe following enzyme digestion.
[0256] The target gene showed only one specific hybridization band under different generations and enzyme digestion conditions. The results of band number and size analysis are shown in Table 4. These results indicate that the target gene cp4 epsps is inserted into the WYN296 rapeseed genome as a single copy.
[0257] Table 4
[0258]
[0259] 2) Analysis of specific probe hybridization results for the Bar gene
[0260] HindIII has one restriction site in the T-DNA region. The marker band obtained after HindIII digestion and probe hybridization of the genomic DNA from the WYN296 T3, T4, and T5 generation transformants should include a 4.6 kb T-DNA sequence and a predicted 1.1 kb sequence on the right side of the genome, with a total fragment length of approximately 5.7 kb. (For example...) Figure 6 As shown, the hybridization band was the expected size of 5.7 kb. However, no hybridization band was observed after hybridization of the non-transgenic control material Westar genomic DNA with the probe following enzyme digestion.
[0261] NocI has one restriction site in the T-DNA region. The marker band obtained after NocI digestion and probe hybridization of the genomic DNA from the WYN296 T3, T4, and T5 generation transformants should include a 2.8 kb T-DNA sequence and a predicted 0.3 kb sequence on the right side of the genome, with a total fragment length of approximately 3.1 kb. For example... Figure 6 As shown, the hybridization band was approximately 3.1 kb in size, as expected. However, no hybridization band was observed after hybridization of the non-transgenic control material Westar genomic DNA with the probe following enzyme digestion.
[0262] The target gene showed only one specific hybridization band in different generations and under different enzyme digestion conditions. The results of band number and size analysis are shown in Table 5. These results indicate that the target gene bar is inserted into the WYN296 rapeseed genome in a single copy form.
[0263] Table 5
[0264]
[0265] Example 5: Test of tolerance of the transgenic rapeseed WYN296 to the target herbicide
[0266] 5.1 Experimental Materials and Methods
[0267] (1) Plant material: T4 generation of transgenic herbicide-tolerant rapeseed WYN296 and non-transgenic rapeseed receptor control Westar.
[0268] (2) Herbicide: glufosinate, with an active ingredient content of 200 g / L, in aqueous solution; manufactured by Zhejiang Xin'an Chemical. (Recommended dosage: 150-250 mL / mu, with 200 mL / mu as 1×, 400 mL as 2×, and so on)
[0269] Glyphosate, marketed as Nongwang, contains 41% isopropylamine salt as its active ingredient. It is a liquid formulation manufactured by Zhejiang Xin'an Chemical Co., Ltd. The recommended dosage on the glyphosate label is set at 1 times the recommended dose.
[0270] (3) Randomized block design, with three replicates per treatment and a plot size of 2m². 2 Sowing was carried out according to the conventional rapeseed sowing rate. Each treatment room had a 1.0-meter-wide isolation strip. The following treatments were implemented:
[0271] 1. Genetically modified herbicide-tolerant rapeseed WYN296 does not require herbicide application.
[0272] 2. Genetically modified herbicide-tolerant rapeseed WYN296 was sprayed with the target herbicide glufosinate.
[0273] 3. Genetically modified herbicide-tolerant rapeseed WYN296 was sprayed with glyphosate as the target herbicide.
[0274] 4. The corresponding non-GMO control rapeseed was not sprayed with herbicides.
[0275] 5. The corresponding non-GMO control rapeseed was sprayed with the target herbicide glufosinate.
[0276] 6. The corresponding non-GMO control rapeseed was sprayed with the target herbicide glyphosate.
[0277] The target herbicides glyphosate and glufosinate are each given three application gradients.
[0278] 1. Medium dosage of pesticide registration labels
[0279] 2. Twice the dose of the medium dose
[0280] 3. Four times the medium dose
[0281] The spraying time is when the rapeseed has 4-5 leaves, and the application method is foliar spraying.
[0282] (4) Investigation and recording: The number of normal rapeseed seedlings (grade 0 and grade 1) in each replicate was investigated and recorded 1 week and 2 weeks after application. The severity level and number of rapeseed seedlings in each replicate were investigated and recorded 4 weeks after application. See Table 6 for the grading of pesticide damage symptoms.
[0283] Table 6 Symptoms of herbicide damage
[0284]
[0285] 5.2 Data Processing
[0286] The herbicide damage rate is calculated according to formula (1).
[0287]
[0288] In the formula: P—rapeseed herbicide damage rate, in percentage (%); N—number of normal plants; T—total number of seedlings observed.
[0289] The Duncan's new multiple range method using DPS analysis software was used to analyze and compare the differences in herbicide damage rates between different treatments of transgenic rapeseed and the non-transgenic control. Based on the survey results 4 weeks after application, the tolerance level of the target herbicide to the transgenic rapeseed and non-transgenic rapeseed controls was determined according to the criteria in Table 7.
[0290] Table 7 Grading Criteria for Rapeseed Tolerance to Target Herbicides
[0291]
[0292] 5.3 Results and Analysis
[0293] (1) Tolerance level of glyphosate in T4 generation plants of transformant WYN296
[0294] The study investigated the phytotoxicity rate of rapeseed plants transformed from WYN296 under various glyphosate treatments. The phytotoxicity rate of WYN296 after 1× and 2× glyphosate treatments was 0%, with no obvious phytotoxicity symptoms. Under 4× glyphosate treatment, the phytotoxicity rate of the T4 generation plants of WYN296 was 4.78% after one week. In contrast, the non-transgenic control showed obvious phytotoxicity symptoms, with a 100% phytotoxicity rate and the highest phytotoxicity level (Level 5). As the rapeseed grew, the phytotoxicity symptoms of the transformants recovered; specifically, at the 2nd and 4th weeks after spraying, the phytotoxicity level was 0, and the phytotoxicity rate was 0%. In contrast, the non-transgenic control showed progressively worsening herbicide damage symptoms, ultimately leading to death. This indicates that the specialized variant WYN296 could tolerate four times the recommended field dose of glyphosate. Therefore, the tolerance of the transgenic WYN296 to the target herbicide glyphosate was classified as high tolerance (level 1), while the non-transgenic control Westar showed sensitive tolerance (level 5). The results of the glyphosate tolerance of WYN296 in the transgenic rapeseed event are shown in Table 8. Figure 7 As shown.
[0295] Table 8 Damage rate after spraying WYN296 with 4 times glyphosate
[0296]
[0297] Note: Data are expressed as mean ± standard deviation.
[0298] (2) Tolerance level of glufosinate to T4 generation plants of transformant WYN296
[0299] The phytotoxicity rate of rapeseed plants transformed from WYN296 was investigated under various concentrations of glufosinate treatment. The phytotoxicity rate of WYN296 after 1× and 2× glufosinate treatments was 0%, with no obvious phytotoxicity symptoms. Under 4× glufosinate treatment, the phytotoxicity rate of the T4 generation plants of WYN296 was 4.22% after one week. In contrast, the non-transgenic control showed obvious phytotoxicity symptoms, with a 100% phytotoxicity rate and the highest phytotoxicity level (Level 5). As the rapeseed grew, the phytotoxicity symptoms of the transformants recovered; specifically, at the 2nd and 4th weeks after spraying, the phytotoxicity level was 0, and the phytotoxicity rate was 0%. In contrast, the non-transgenic control showed progressively worsening herbicide damage symptoms, ultimately leading to death. This indicates that the specialized variant WYN296 was able to tolerate four times the recommended field dose of glufosinate. Therefore, the tolerance of the transgenic WYN296 to the target herbicide glufosinate was rated as high tolerance (level 1), while the non-transgenic control Westar was rated as sensitive (level 5). The results of the glufosinate tolerance of WYN296 in the transgenic rapeseed event are shown in Table 9. Figure 8 As shown.
[0300] Table 9 Damage rate after spraying WYN296 with 4 times dilution of glufosinate
[0301]
[0302] Note: Data are expressed as mean ± standard deviation.
[0303] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A nucleic acid molecule, characterized in that, It has the following characteristics: (1) Any nucleotide sequence as shown in SEQ ID NO:21~23; (2) A nucleotide sequence obtained by modifying, substituting, deleting and / or adding one or more bases to the nucleotide sequence shown in (1); (3) A sequence that has at least 80% homology with the nucleotide sequence shown in (1); (4) Complementary sequences to sequences shown in (1), (2) or (3).
2. The nucleic acid molecule according to claim 1, characterized in that, It originates from genetically modified plants, seeds, or cells, including those involved in the WYN296 genetically modified rapeseed incident; The accession number for the genetically modified rapeseed event WYN296 is CGMCC No. 30708.
3. A primer set, characterized in that, include: At least one of primer pairs 1 to 4; The primer pair 1 has: (5) The forward primer as shown in SEQ ID NO:13 and the downstream primer with the nucleotide sequence shown in SEQ ID NO:14; (6) A nucleotide sequence obtained by modifying, substituting, deleting and / or adding one or more bases to the nucleotide sequence shown in (5); (7) A sequence that has at least 80% homology with the nucleotide sequence shown in (5); (8) A complementary sequence to the sequence shown in (5), (6) or (7); and / or The primer pair 2 has the following characteristics: (9) The forward primer as shown in SEQ ID NO:15 and the downstream primer with the nucleotide sequence shown in SEQ ID NO:16; (10) A nucleotide sequence obtained by modifying, substituting, deleting and / or adding one or more bases to the nucleotide sequence shown in (9); (11) A sequence that has at least 80% homology with the nucleotide sequence shown in (9); (12) A complementary sequence to the sequence shown in (9), (10) or (11); and / or The primer pair 3 has: (13) The forward primer as shown in SEQ ID NO:17 and the downstream primer with the nucleotide sequence shown in SEQ ID NO:18; (14) A nucleotide sequence obtained by modifying, substituting, deleting and / or adding one or more bases to the nucleotide sequence shown in (13); (15) A sequence that has at least 80% homology with the nucleotide sequence shown in (13); (16) A complementary sequence to the sequence shown in (13), (14) or (15); and / or Primer pair 4 has: (17) The forward primer as shown in SEQ ID NO:19 and the downstream primer with the nucleotide sequence shown in SEQ ID NO:20; (18) A nucleotide sequence obtained by modifying, substituting, deleting and / or adding one or more bases to the nucleotide sequence shown in (17); (19) A sequence that has at least 80% homology with the nucleotide sequence shown in (17); (20) Complementary sequences to sequences shown in (17), (18) or (19).
4. A reagent kit, characterized in that, include: The primer set as described in claim 3, as well as acceptable auxiliaries, carriers, and / or devices.
5. The use of the primer set of claim 3 and / or the kit of claim 4 in the following (a) and / or (b); (a) Detection of nucleic acid molecules in the genetically modified rapeseed event WYN296; (b) Detect the presence of nucleic acid molecules of the genetically modified rapeseed event WYN296 in the sample.
6. A method for detecting the presence of nucleic acid molecules related to the transgenic rapeseed event WYN296 in a sample, characterized in that, The nucleic acid molecules described in claim 1 or 2 can be detected using the primer set of claim 3 and / or the kit of claim 4.
7. A method for protecting rapeseed plants from damage caused by herbicides, characterized in that, Transgenic rapeseed plants containing the nucleic acid molecules described in claim 1 or 2 are planted, and herbicides are applied; The accession number for the genetically modified rapeseed event WYN296 is CGMCC No. 30708.
8. The method according to claim 7, characterized in that, The herbicide is glyphosate herbicide and / or glufosinate herbicide.
9. A method for controlling weeds in fields where rapeseed is planted, characterized in that, The herbicide is applied to a field where genetically modified rapeseed plants are grown, the genetically modified rapeseed plants containing the nucleic acid molecules described in claim 1 or 2.
10. A method for cultivating rapeseed plants tolerant to glyphosate and / or glufosinate herbicides, characterized in that, Includes the following steps: Step 1: Plant rapeseed seeds containing the nucleic acid molecules described in claim 1 or 2, and grow and develop them into rapeseed plants, which serve as the first parent rapeseed plants; Step 2: Take the first parent rapeseed plant and sexually cross it with the second parent rapeseed plant that lacks tolerance to glyphosate herbicide and / or glufosinate herbicide, thereby producing a large number of offspring plants; Step 3: Spray the progeny plants with an effective dose of glyphosate herbicide and / or glufosinate herbicide, and harvest plants with reduced plant damage compared to other plants that do not have the transgenic rapeseed event WYN296.