Fluorescent quantitative PCR detection method of KIR2DS5 mRNA and detection kit thereof

Abstract

The invention belongs to the field of biological detection, and particularly relates to a fluorescent quantitative PCR (polymerase chain reaction) detection method of KIR2DS5 mRNA (messenger ribonucleic acid) as well as a detection kit, a primer and a design method of a probe. The method comprises the following steps: (1) performing KIR genetic typing on a DNA (deoxyribonucleic acid) sample by using a PCR-SSOP method, and screening out KIR2DS5 positive DNA; (2) carrying out PCR (Polymerase Chain Reaction) amplification and electrophoresis on the positive DNA sample; (3) extracting a KIR2DS5 specific DNA band, tapping rubber, purifying, connecting with a T vector, transforming, selecting flora, extracting plasmids, and sequencing; (4) comparing a sequencing result with a KIR / IPD database to confirm that the sequence is a characteristic gene sequence; and (5) designing a primer and a probe by using primer design software according to the characteristic KIR2DS5 gene sequence. And carrying out gene detection by using the designed primer and probe. According to the method, the specificity and accuracy of PCR detection are improved.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a fluorescence quantitative PCR detection method for KIR2DS5 mRNA and its detection kit. Background Technology

[0002] Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins primarily expressed on the surface of NK cell membranes. They interact with ligand HLA molecules to generate allogeneic NK cells, exerting a genomic vegetative-viral (GVL) effect and playing a crucial role in the prognosis of hematopoietic stem cell transplantation. KIRs are located on human chromosome 19q13.4 and contain two (KIR2D) or three (KIR3D) extracellular Ig-like domains. They are classified into two types: inhibitory KIRs (iKIRs) and activating KIRs (aKIRs). iKIR genes include those with heterologous response activity, such as KIR2DL1, KIR2DL2, and KIR3DL1, while aKIR genes include KIR2DS1, KIR2DS2, KIR2DS5, KIR2DS4, KIR2DS5, and KIR3DS1. The DNA sequences of KIR genes are 80-90% identical. Currently, primer design often involves searching for the target gene sequence on NCBI or performing whole-genome sequencing on the gene. Then, primers are designed using primer design software based on the gene sequence, and BLAST is performed. These methods have certain limitations when designing primers for KIR genes, mainly low efficiency, poor specificity, and low accuracy. Summary of the Invention

[0003] To address the problems existing in the prior art, the present invention aims to provide a fluorescence quantitative PCR detection method and kit for KIR2DS5 mRNA, so as to improve the detection efficiency and specificity of KIR2DS5.

[0004] To achieve the above objectives, the present invention provides the following technical solution:

[0005] Primers and probes for quantitative real-time PCR detection of KIR2DS5 mRNA, their sequences are as follows:

[0006] 2DS5F: 5'-AGAGAGGGGACGTTTAACC-3';

[0007] 2DS5R: 5'-CACTGGGCGCTGACAACT-3';

[0008] Fluorescent probe: 5'-CATCGGTCGCATGACA-3'.

[0009] The method for obtaining the primers and probes of claim 1 includes the following steps:

[0010] (1) Extract DNA samples from normal individuals, perform KIR genotyping using the PCR-SSOP method, and screen out normal individuals with KIR2DS5 positive DNA samples;

[0011] (2) The selected DNA samples were amplified by PCR and agarose gel electrophoresis using commercially available KIR2DS5 sequence-specific primer amplification plates (purchased from OneLambda);

[0012] (3) The PCR product was extracted from the KIR2DS5 specific band, and after gel cutting and purification, it was ligated with the T vector. The recipient was TOP10 competent streptomycin-resistant Escherichia coli. After selecting the bacterial population, the plasmid was extracted and sequenced using an ABI 3730XL sequencer.

[0013] (4) The sequencing results were compared with the KIR / IPD database and confirmed that it was a characteristic KIR2DS5 gene sequence. The specific sequence obtained by sequencing was: 5'- AGAGAGGGGACGTTTAACCACACTTTGCGCCTCATTGGAGAGCACATTGATGGGGTCTCCAAGGGCAACTTCTCCATCGGTCGCATGACACAAGACCTGGCAGGGACCTACAGATGCTACGGTTCTGTTACTCACTCCCCCTATCAGTTGTCAGCGCCCAGTG-3';

[0014] (5) Based on the characteristic KIR2DS5 gene sequence, primers and probes as described in claim 1 were designed using primer design software.

[0015] Furthermore, in the method for obtaining the primers and probes described in this invention, the instrument used for PCR amplification is a PerkinElmer GeneAmp 9700 PCR amplification instrument.

[0016] Furthermore, in the method for obtaining the primers and probes described in this invention, the T vector used in step (3) is a pMD18-T Vector.

[0017] Furthermore, in the method for obtaining the primers and probes described in this invention, the primers and probes are designed using PrimerExpress software.

[0018] The use of the primers and probes for detecting KIR2DS5 mRNA by quantitative real-time PCR as described in this invention in the preparation of a KIR2DS5 mRNA quantitative real-time PCR detection kit.

[0019] The method for detecting KIR2DS5 mRNA includes the following steps:

[0020] (1) Extract total RNA;

[0021] (2) Reverse transcribe RNA into cDNA;

[0022] (3) Using the primers and probes in claim 1, the mRNA transcription level of KIR2DS5 was detected using a general quantitative PCR system.

[0023] Beneficial effects

[0024] This invention provides a quantitative real-time PCR detection method and kit for KIR2DS5 mRNA. The invention employs the PCR-SSOP method to perform routine KIR genotyping on normal human DNA samples. After screening for KIR2DS5 positive samples, the DNA samples are amplified by PCR using specific primers, followed by electrophoresis. The PCR products are ligated to a T-vector, and then clonal amplification, screening, and sequencing are performed. Because PCR products are not specific, direct sequencing yields poor results; approximately several dozen bases at the primer ends are undetectable during direct sequencing. If this sequence is needed, direct sequencing will miss this gene segment. Ligating the PCR products to T-phages avoids this problem. Furthermore, this invention directly identifies the characteristic gene sequence within the KIR2DS5 gene sequence, directly avoiding the amplification of other unknown bands with high homology. The quantitative real-time PCR detection of KIR2DS5 mRNA using the primers and probes obtained in this invention exhibits high specificity and accuracy. The primer and probe design method of this invention can also be applied to other highly homologous KIR genes. Attached Figure Description

[0025] Figure 1 The standard curve for real-time PCR of ABL standard in the embodiments of the invention is obtained by using the data in Table 1 as the horizontal and vertical axes. The horizontal axis is represented by the logarithm of the copy number of ABL standard, specifically log10(200, 2000, 20000, 200000, 200000) = (2.3010, 3.3010, 4.3010, 5.3010, 6.3010), and the vertical axis is the Ct value of ABL standard.

[0026] Figure 2 This is a schematic diagram illustrating the design concept for KIR2DS5 mRNA fluorescence quantitative PCR detection in this invention.

[0027] Figure 3The image shows a 1.5% agarose gel electrophoresis image of the KIR2DS5 positive product obtained by real-time PCR using the KIR2DS5 primers and probes designed in this invention. Detailed Implementation

[0028] The present invention will be further described below with reference to specific embodiments, but these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0029] Experimental methods:

[0030] 1. DNA extraction: DNA was extracted from whole blood according to the instructions of the DNA extraction kit (purchased from Promega, USA).

[0031] 2. Genotyping using PCR-SSOP:

[0032] This step of the experiment was performed using the KIR SSO genotyping kit (purchased from One Lambda).

[0033] 2.1 PCR reaction system: KIR SSO amplification was divided into three groups: Group 1, Group 2, and Group 3. Each reaction well contained 7.5 µL of D-Mix, 2 µL of Primer, 0.1 µL of Taq enzyme, and 2.5 µL of DNA sample (D-Mix and Primer were purchased from One Lambda).

[0034] 2.2 PCR amplification was performed using a Perkin Elmer GeneAmp 9700 PCR amplification instrument. PCR amplification conditions were as follows: 96℃ for 3 min per cycle; 96℃ for 20 s, 60℃ for 20 s, 72℃ for 20 s for a total of 5 cycles; 96℃ for 10 s, 60℃ for 15 s, 72℃ for 20 s for a total of 32 cycles; 72℃ for 10 min per cycle; termination at 4℃.

[0035] 2.3 The amplification products were denatured with alkaline solution, then neutralized with acidic solution, and then incubated with microbeads and fluorescent secondary antibody. After washing, the samples were detected using a Luminex 200 instrument to screen out normal human DNA samples that were positive for KIR2DS5.

[0036] 3. PCR amplification

[0037] 3.1 PCR reaction system: PCR buffer 115µL, ddH2O 152µL, KIR2DS5 positive DNA sample selected in step 2 31µL, Taq enzyme 1.8µL, KIR2DS5 sequence-specific primer amplification plate (PCR buffer and KIR2DS5 sequence-specific primer amplification plate were purchased from One Lambda).

[0038] 3.2 Centrifuge at 3000 rpm for 15-20 seconds;

[0039] 3.3 PCR amplification was performed using a Perkin Elmer GeneAmp 9700 PCR amplification instrument. PCR amplification conditions: pre-denaturation, 95℃ for 5 min; PCR cycles: denaturation, 95℃ for 30 s; annealing, 68℃ for 30 s; extension, 72℃ for 90 s; a total of 30 cycles.

[0040] 3.4 Prepare a 1.5% agarose gel for electrophoresis, image the gel using a UV gel imager, take and print the electrophoresis image of the amplified products, and affix it to the KIR worksheet for result interpretation;

[0041] 3.5 Based on the results interpretation, the KIR2DS5 band on the agarose gel was cut and purified to obtain the KIR2DS5 gene.

[0042] 4. TA Cloning

[0043] 4.1 Ligation: Add 1 µL of pMD18-T Vector, 0.2 pmol of KIR2DS5 gene, and Solution I (pMD) to a microcentrifuge tube. TM Add 5 µL of the ligation solution from the 18-T Vector Cloning Kit (Takara 6011) and ddH2O to a final volume of 10 µL; react at 16 °C for 30 min.

[0044] 4.2 Transformation Culture: Take 50 µL of competent cells, place them on ice, and after complete thawing, gently suspend the cells evenly. Add 5 µL of ligation medium and incubate on ice for 30 min. Heat shock at 42℃ for 45 s, then incubate on ice for 3 min. Add 500 µL of 2×YT antibiotic-free medium and incubate at 37℃ with shaking at 220 rpm for 1 h. Centrifuge at 5000 rpm for 5 min, discard 400 µL of culture medium with a pipette tip, and spread the remaining culture onto an ampicillin plate (with appropriate amounts of IPTG and X-gal added). Incubate the plate upright at 37℃ for 10 min, then invert and incubate overnight for 12 h. Pick 6 white spots with a sterile 10 µL pipette tip, inoculate with 2 mL of bacteria, and incubate overnight.

[0045] 4.3 Plasmid extraction: Plasmid extraction was performed according to the instructions of the magnetic bead plasmid mini-prep kit (Shanghai Shuomei Biotechnology Co., Ltd.);

[0046] 4.4 Sequencing was performed using an ABI 3730XL sequencer. The obtained sequence was compared with the KIR2DS5 sequence in the KIR / IPD database, confirming that it was the characteristic KIR2DS5 gene sequence.

[0047] The specific sequence after sequencing is: 5'-AGAGAGGGGACGTTTAACCACACTTTGCGCCTCATTGGAGAGCACATTGATGGGGTCTCCAAGGGCAACTTCTCCATCGGTCGCATGACACAAGACCTGGCAGGGACCTACAGATGCTACGGTTCTGTTACTCACTCCCCCTATCAGTTGTCAGCGCCCAGTG-3';

[0048] 5. Primers and probes for the characteristic KIR2DS5 gene sequence were designed using PrimerExpress software. The specific sequences of the obtained primers and probes are as follows.

[0049] 2DS5F: 5'-AGAGAGGGGACGTTTAACC-3';

[0050] 2DS5R: 5'-CACTGGGCGCTGACAACT-3';

[0051] Fluorescent probe: 5'-CATCGGTCGCATGACA-3'.

[0052] 6. Quantitative Real-Time PCR

[0053] 6.1 RNA extraction;

[0054] 6.1.1 Take 10 mL of peripheral blood, centrifuge at 1500 rpm for 5 min, and discard the supernatant;

[0055] 6.1.2 Add 5 mL of PBS buffer, centrifuge at 1500 rpm for 5 min, and discard the supernatant;

[0056] 6.1.3 Add 1 mL of PBS buffer, centrifuge at 1500 rpm for 5 min, and discard the supernatant;

[0057] 6.1.4 Add 1 mL of Trizol and pipette to fully lyse the cells; store at -20°C for later use.

[0058] 6.1.5 Thaw the Trizol sample from which total RNA will be extracted on ice;

[0059] 6.1.6 Add 200µL of chloroform to the melted Trizol sample, mix well, and centrifuge at 12000rpm for 15min at 4℃;

[0060] 6.1.7 Transfer the supernatant to a 1.5 mL EP tube, add 500 µL of isopropanol, mix well, precipitate on ice for 5 min, and centrifuge at 12000 rpm for 15 min at 4 °C.

[0061] 6.1.8 Discard the supernatant, add 600µL of 75% ethanol, mix well, and centrifuge at 12000rpm for 5min at 4℃;

[0062] 6.1.9 Discard the supernatant, add 800µL of anhydrous ethanol, mix well, and centrifuge at 12000rpm for 5min at 4℃;

[0063] 6.1.10 Discard the supernatant, dry it, dissolve it in DEPC water, and adjust the RNA concentration to 0.5 ug / µL.

[0064] 6.2 mRNA reverse transcription into cDNA

[0065] 6.2.1 Reaction system: 2µL Random Primer, 9µL DEPC water, and 4µL RNA were mixed and then briefly centrifuged at 3000rpm (Random Primer was purchased from Shanghai Bioengineering Co., Ltd.).

[0066] 6.2.2 PCR reaction conditions: 70℃ for 5 min, then 4℃ to terminate;

[0067] 6.2.3 Mix 8µL of 5×Buffer, 1µL of MMLV reverse transcriptase, 0.5µL of Rnasin, 1.5µL of dNTP, and 15µL of DEPC water, and add them to 6.2.2 (MMLV reverse transcriptase was purchased from IBM).

[0068] 6.2.4 Mix 6.2.3 thoroughly and centrifuge briefly at 3000 rpm;

[0069] 6.2.5 PCR reaction conditions: 37℃ for 60 min, 95℃ for 5 min, and terminate at 4℃.

[0070] 6.3 Quantitative Real-Time PCR

[0071] 6.3.1 PCR reaction system: 96-well plate, add MIX (including Mg) to each well. 2+12.5 µL of the following reagents were prepared: dNTPs, Taq polymerase, UNG enzyme, and ROX reference dye; 0.5 µL of upstream primer; 0.5 µL of downstream primer; 0.3 µL of probe; 4 µL of cDNA; and 7.2 µL of ddH2O.

[0072] 6.3.2 Brief centrifugation at 3000 rpm;

[0073] 6.3.3 PCR reaction conditions: 50℃ for 2 min, 1 cycle; 95℃ for 10 min, 1 cycle; 95℃ for 15 s, 60℃ for 1 min, 40 cycles in total;

[0074] 6.3.4 Analyze the results using Roche Light Cycler 480 software.

[0075] The expression level of KIR2DS5 mRNA was analyzed by real-time PCR using the kit of the present invention. The results are as follows: The transcription level of KIR target gene mRNA was calculated by the following formula: (KIR target gene mRNA copy number / ABL internal reference gene mRNA copy number) × 10000, which is defined as the copy number of KIR target gene in every 10000 ABL genes in all nucleated blood cells.

[0076] Standard curve: A standard curve is prepared by diluting a T-vector containing a known copy number of the housekeeping gene abl fragment at different concentrations. The amplification efficiency is determined by the slope of the curve. Table 1 shows the correspondence between ABL standards and Ct values. The obtained standard curves are as follows: Figure 1 As shown in Table 2, the copy number of KIR2DS5 is as follows. Fluorescence threshold: The critical value at which fluorescence exceeds the background. The fluorescence threshold is 10 times the mean plus standard deviation of the baseline fluorescence signal. The cycle number corresponding to the PCR amplification reaching the fluorescence threshold is called the Ct value.

[0077] Figure 3 The image shown is a 1.5% agarose gel electrophoresis image of the KIR2DS5 positive product obtained by real-time quantitative PCR using the KIR2DS5 primers and probes designed in this invention. Figure 3 As can be seen from the electrophoresis diagram, the conclusion that the KIR2DS5 positive product after blast is 163bp is consistent with the conclusion that the primers and probes designed in this invention have good recognition specificity for the KIR2DS5 gene.

[0078]

[0079]

Claims

1. A method for specifically detecting human KIR2DS5 mRNA, characterized in that, Including the following methods: (1) Normal human DNA samples were extracted and KIR genotyping was performed using the PCR-SSOP method. PCR amplification was performed using a Perkin ElmerGeneAmp 9700 PCR amplification instrument. PCR amplification conditions were as follows: 96℃ for 3 min per cycle; 96℃ for 20 s, 60℃ for 20 s, 72℃ for 20 s for a total of 5 cycles; 96℃ for 10 s, 60℃ for 15 s, 72℃ for 20 s for a total of 32 cycles; 72℃ for 10 min per cycle; termination at 4℃. Normal human DNA samples that were positive for KIR2DS5 were screened out. (2) The selected DNA samples were amplified by PCR and agarose gel electrophoresis using KIR2DS5 sequence-specific primer amplification plates. The PCR reaction system consisted of 115 µL of PCR buffer, 152 µL of ddH2O, 31 µL of the selected KIR2DS5 positive normal human DNA sample, 1.8 µL of Taq enzyme, and KIR2DS5 sequence-specific primer amplification plates. The PCR amplification conditions were as follows: pre-denaturation, 95 °C for 5 min; PCR cycles: denaturation, 95 °C for 30 s; annealing, 68 °C for 30 s; extension, 72 °C for 90 s; a total of 30 cycles. (3) The PCR product was extracted from the KIR2DS5 specific band, and after gel cutting and purification, the KIR2DS5 gene was obtained and ligated with the T vector. The recipient was TOP10 competent streptomycin-resistant Escherichia coli. After selecting the bacterial population, the plasmid was extracted and sequenced using an ABI3730XL sequencer. (4) The sequencing results were compared with the KIR / IPD database and confirmed that it was a characteristic KIR2DS5 gene sequence. The specific sequence obtained by sequencing was: 5'- AGAGAGGGGACGTTTAACCACACTTTGCGCCTCATTGGAGAGCACATTGATGGGGTCTCCAAGGGCAACTTCTCCATCGGTCGCATGACACAAGACCTGGCAGGGACCTACAGATGCTACGGTTCTGTTACTCACTCCCCCTATCAGTTGTCAGCGCCCAGTG-3'; The method for detecting KIR2DS5 mRNA includes the following steps: (1) Extract total RNA; (2) Reverse transcribe RNA into cDNA; (3) Using the primers and probes described below, the mRNA transcription level of KIR2DS5 was detected using a general quantitative PCR system. The expression level of KIR2DS5 mRNA was analyzed by quantitative real-time PCR. The primer and probe sequences for detecting KIR2DS5 mRNA were as follows: 2DS5F: 5'-AGAGAGGGGACGTTTAACC-3'; 2DS5R: 5'-CACTGGGCGCTGACAACT-3'; Fluorescent probe: 5'-CATCGGTCGCATGACA-3'; The transcription level of the target gene mRNA is calculated using the following formula: (KIR target gene mRNA copy number / ABL internal reference gene mRNA copy number) × 10000, which is defined as the KIR target gene copy number in every 10000 ABL genes in all blood nucleated cells.

2. The method for specifically detecting human KIR2DS5 mRNA according to claim 1, characterized in that, The extraction of total RNA Includes the following steps: Collect 10 mL of peripheral blood, centrifuge at 1500 rpm for 5 min, and discard the supernatant; Add 5 mL of PBS buffer, centrifuge at 1500 rpm for 5 min, and discard the supernatant; Add 1 mL of PBS buffer, centrifuge at 1500 rpm for 5 min, and discard the supernatant; Add 1 mL of Trizol and pipette to fully lyse the cells. Store at -20°C for later use. Thaw the Trizol sample from which total RNA will be extracted on ice; Add 200µL of chloroform to the melted Trizol sample, mix well, and centrifuge at 12000rpm for 15min at 4℃. Transfer the supernatant to a 1.5 mL EP tube, add 500 µL of isopropanol, mix well, precipitate on ice for 5 min, and centrifuge at 12000 rpm for 15 min at 4 °C. Discard the supernatant, add 600µL of 75% ethanol, mix well, and centrifuge at 12000rpm for 5min at 4℃. Discard the supernatant, add 800µL of anhydrous ethanol, mix well, and centrifuge at 12000rpm for 5min at 4℃. Discard the supernatant, dry the sample, dissolve it in DEPC water, and adjust the RNA concentration to 0.5 ug / µL.

3. The method for specifically detecting human KIR2DS5 mRNA according to claim 1, characterized in that, The RNA was reverse transcribed into cDNA. Includes the following steps: Reaction system: Random Primer 2µL, DEPC water 9µL, RNA 4µL. Mix well and then briefly centrifuge at 3000rpm. PCR was performed under the following conditions: 70℃ for 5 min, then 4℃ to terminate the reaction. Mix 8µL of 5×Buffer, 1µL of MMLV reverse transcriptase, 0.5µL of Rnasin, 1.5µL of dNTP, and 15µL of DEPC water and add them to the PCR reaction system. Mix well and centrifuge briefly at 3000 rpm; PCR reaction was performed under the following conditions: 37℃ for 60 min, 95℃ for 5 min, and terminated at 4℃.

4. The method for specifically detecting human KIR2DS5 mRNA according to claim 1, characterized in that, The quantitative PCR method includes the following steps: PCR reaction system: 96-well plate, each well contains 12.5 µL of MIX, 0.5 µL of upstream primer, 0.5 µL of downstream primer, 0.3 µL of probe, 4 µL of cDNA, and 7.2 µL of ddH2O; the MIX includes Mg 2+ dNTPs, Taq enzyme, UNG enzyme, and ROX reference dye; Brief centrifugation at 3000 rpm; PCR reaction conditions: 50℃ for 2 min, 1 cycle; 95℃ for 10 min, 1 cycle; 95℃ for 15 s, 60℃ for 1 min, 40 cycles in total; The results were analyzed using Roche Light Cycler 480 software.

Images