A kind of film-forming type hydrogel containing keratin 8 and its application in promoting the repair of fish body surface injury

By constructing a film-forming hydrogel containing keratin 8, the problem of insufficient adhesion of fish surface wound treatment materials in the aquatic environment was solved, achieving a synergistic effect of stable coverage and tissue repair, and improving the healing efficiency of fish surface injuries.

CN122075673APending Publication Date: 2026-05-26TIANJIN AGRICULTURE COLLEGE

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TIANJIN AGRICULTURE COLLEGE
Filing Date
2026-04-22
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing materials for treating fish surface wounds have insufficient adhesion in the aquatic environment, making it difficult to form a stable and continuous physical barrier. They also lack the ability to regulate tissue repair, which affects fish health and aquaculture efficiency.

Method used

A film-forming hydrogel containing keratin 8 was constructed. By optimizing the composition of the hydrogel system and the distribution ratio of each component, it was made to form a covering layer on the wound surface. Keratin 8 was added as a functional component to promote tissue repair.

Benefits of technology

The material achieves adhesion stability and continuous protection in aquatic environments, significantly improves wound healing efficiency, blocks bacterial spread, and promotes the repair of fish surface injuries.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122075673A_ABST
    Figure CN122075673A_ABST
Patent Text Reader

Abstract

This invention discloses a film-forming hydrogel containing keratin 8 and its application in promoting the repair of fish surface injuries, belonging to the technical field of fish wound repair materials. The film-forming hydrogel containing keratin 8, by mass percentage, consists of 8.25% polyvinyl acetate, 4.5% polyethylene ester, 1.1% xanthan gum, 0.2% benzyl chloride, 0.9% phenoxyethanol, 0.1% ethylhexylglycerin, 0.5% propylene glycol, 7% mica, 1% titanium dioxide, 1.5%–3% keratin 8, and the balance being water. Experimental verification shows that the film-forming hydrogel provided by this invention can block bacterial diffusion; it can form a stable and barrier-like covering layer in an aquatic environment; and it can promote the repair of fish surface injuries, significantly improving healing efficiency. This invention provides a feasible solution for underwater repair of surface injuries in aquatic animals.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of fish wound repair materials technology, and in particular to a film-forming hydrogel containing keratin 8 and its application in promoting the repair of fish body surface injuries. Background Technology

[0002] Skin injuries in fish are a common problem in aquaculture, negatively impacting fish health and farming efficiency. During harvesting, transportation, and routine farming operations, fish are prone to scale loss, abrasions, and skin breakdown. The fish's skin serves as a crucial interface between the body and the external aquatic environment; damage to this interface not only disrupts its physical barrier function but also damages the mucus layer structure and disrupts osmotic pressure regulation, increasing the risk of pathogenic microorganism infection. Because fish are constantly exposed to high humidity and microorganism-rich aquatic environments, wounds are difficult to seal, leading to secondary infections and wound enlargement, ultimately affecting individual survival rates and aquaculture profitability. Therefore, developing wound repair technologies adapted to the characteristics of aquatic environments is of great significance for improving fish health and farming efficiency.

[0003] Currently, the main methods for treating surface wounds in fish include aquatic medication and topical application of antibacterial agents. Aquatic medication allows for group treatment, but the drugs are easily diluted rapidly in water, making it difficult to maintain effective concentrations and potentially increasing environmental burden. While topical application can increase the local drug concentration at the wound site to some extent, under continuous water flow and high humidity conditions, the drugs struggle to adhere stably to the wound surface, resulting in a short duration of action and difficulty in forming a sustained and effective physical barrier. Furthermore, existing materials for wound covering mainly include hydrogels and film-forming materials. While hydrogels such as chitosan and alginate have some moisturizing and covering effects, their adhesion in aquatic environments is weak, making them prone to detachment and hindering stable and continuous wound coverage. Some film-forming materials can form a physical barrier on the wound surface, but they are mostly designed for terrestrial environments and lack stability under aquatic conditions, making it difficult to provide long-term protection. Therefore, existing materials primarily focus on antibacterial or simple covering functions, lacking the ability to adhere stably in aquatic environments and also lacking the ability to regulate tissue repair processes, making it difficult to simultaneously address the needs of wound protection and tissue repair.

[0004] Keratin 8 is an intermediate filament protein widely distributed in epithelial cells, playing a crucial role in maintaining cell structural stability, resisting mechanical stress, and regulating cell migration. However, existing research has largely focused on its biological functions as an intracellular functional protein, with limited studies on its application as an exogenous functional component in wound repair materials, particularly in the field of wound repair in aquatic animals. Therefore, it is necessary to develop a material system with good film-forming properties and adhesion stability in aquatic environments, and to introduce functional components that promote tissue repair, in order to achieve continuous protection of the wound and regulation of the repair process. Summary of the Invention

[0005] The purpose of this invention is to provide a film-forming hydrogel containing keratin 8 and its application in promoting the repair of skin injuries in fish, in order to solve the problems existing in the prior art. This invention constructs a hydrogel with film-forming properties and adhesion ability by optimizing the composition of the hydrogel system and the distribution ratio of each component, so that it can form a covering layer on the wound surface, thereby improving the adhesion stability of the material in the aquatic environment and prolonging its action time. At the same time, keratin 8 is added to the hydrogel as a functional component to promote the wound tissue repair process and achieve a synergistic effect of wound protection and tissue repair.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a film-forming hydrogel containing keratin 8, which, by mass percentage, consists of 8.25% polyvinyl acetate, 4.5% polyethylene ester, 1.1% xanthan gum, 0.2% benzyl chloride, 0.9% phenoxyethanol, 0.1% ethylhexylglycerin, 0.5% propylene glycol, 7% mica, 1% titanium dioxide, 1.5%-3% keratin 8, and the balance being water.

[0007] Optionally, the amount of keratin 8 used is 1.5%-2%.

[0008] Optionally, the amount of keratin 8 used is 2%.

[0009] The present invention also provides a method for preparing the aforementioned film-forming hydrogel, comprising the following steps: Take polyvinyl acetate, polyvinyl alcohol and water, heat and stir; then add xanthan gum and propylene glycol, mix thoroughly; then add benzyl chloride, phenoxyethanol, ethylhexylglycerin, mica and titanium dioxide, stir thoroughly and sonicate, after ultraviolet sterilization, add keratin 8 and sonicate again, and let stand to obtain the product.

[0010] Optionally, the heating is performed to 95°C; The ultrasonic treatment was performed at a power of 420 W, with a 3-second operation followed by a 5-second pause, repeated 5 times. The settling period is 24 hours at 4°C.

[0011] Optionally, after adding xanthan gum and propylene glycol and mixing thoroughly, the process further includes keeping warm for 30 minutes and then cooling to 45°C.

[0012] This invention also provides the use of the film-forming hydrogel in any of the following: (1) Prepare products that promote the repair of skin damage in fish; (2) Prevents the spread of bacteria; (3) Prepare products that prevent the spread of bacteria.

[0013] Optionally, the bacteria include Vibrio parahaemolyticus (V. parahaemolyticus). Vibrio parahaemolyticus ).

[0014] The present invention also provides a product that promotes the repair of skin damage in fish, including the aforementioned film-forming hydrogel.

[0015] The present invention also provides a product for blocking the spread of bacteria, comprising the aforementioned film-forming hydrogel; The bacteria include Vibrio parahaemolyticus.

[0016] The present invention discloses the following technical effects: This invention constructs a film-forming hydrogel system containing keratin 8. In vitro performance evaluation results show that, in the hydrogel composite system, when the addition amounts of polyvinyl acetate and polyvinyl alcohol are 8.25% and 4.5%, respectively, the resulting hydrogel is superior to the high-addition groups (14.1% and 5.4%) in terms of film-forming time, substrate adhesion, water resistance stability, and bacterial diffusion barrier performance. This indicates that the polymer combination at this ratio is beneficial for forming a stable covering layer and improving its adhesion stability in the aquatic environment. Furthermore, applying keratin 8 at a mass percentage of 0-3% via a hydrogel carrier to the local wound surface of koi carp significantly promotes tissue repair and improves wound healing efficiency, with a 2% addition showing the best repair effect. In summary, the film-forming hydrogel provided by this invention can block bacterial diffusion; it can form a stable and barrier-like covering layer in the aquatic environment; and it can promote the repair of fish surface injuries, significantly improving healing efficiency. This invention provides a feasible solution for underwater repair of surface injuries in aquatic animals. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is an SDS-PAGE electrophoresis analysis of recombinant keratin 8 (KRT8); M represents the protein molecular weight standard; 1–3 represent KRT8 protein samples; the red arrows indicate the KRT8 protein bands. Figure 2 The results show the substrate adhesion properties and water resistance stability of the film-forming hydrogel. Figure 3 The results represent the evaluation of the barrier performance of the film-forming hydrogel against bacterial diffusion. Figure 4 This is a schematic diagram illustrating the healing process of wounds on the body surface of a koi carp. Figure 5 The curve showing the change in the healing rate of wounds on the body surface of koi carp; Figure 6 Histopathological observation results of the skin tissue of the koi wound; scale bar = 200μm, 50μm. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] Example 1: Preparation of film-forming hydrogels and evaluation of their film-forming properties 1. Preparation and processing of recombinant KRT8 protein A recombinant expression vector containing the KRT8 gene was constructed using conventional molecular cloning methods.

[0025] The KRT8 encoding sequence used in this embodiment is derived from the tongue sole (Semi-smooth tongue sole). Cynoglossus semilaevis The NCBI accession number is XP_024916046.1. Primers with EcoRI and XhoI restriction sites (F: CGCCATGGATGAACGCGATGAAAAGCTATA, SEQ ID NO.1; R: CGGAATTCTTAAAACGCACGGCGGCTACTG, SEQ ID NO.2) were used to amplify the CDS region of KRT8 by PCR. The PCR product was cloned into the pMD18-T vector, double-digested with EcoRI and XhoI, and then subcloned into the pET-32a(+) vector to construct the recombinant plasmid pET32a-CsKrt8 encoding a 6×His tag fusion protein. The recombinant plasmid pET32a-CsKrt8 was transformed into E. coli BL21(DE3), and positive clones were screened and inoculated into TB medium containing ampicillin, and cultured at 37°C until the logarithmic growth phase (OD50). 600 The concentration was 0.6–0.8. IPTG was then added to a final concentration of 1 mmol / L to induce protein expression. After induction culture, bacterial cells were collected. The bacterial cells were resuspended in lysis buffer and then sonicated. After centrifugation, the supernatant was collected and purified using His-tagged affinity chromatography. The eluent was collected to obtain recombinant KRT8 protein, and the protein expression and purification effect were verified by SDS-PAGE electrophoresis. Figure 1 The purified KRT8 protein was placed in a dialysis bag, and denaturing agents such as urea were gradually removed to achieve protein renaturation. Dialysis was performed at 4°C. After dialysis, the protein was further equilibrated in a PBS buffer system and concentrated using anhydrous sucrose. The protein concentration was finally determined using the BCA method.

[0026] 2. Preparation of film-forming hydrogels Ten hydrogel systems were prepared according to the formulations shown in Table 1. Based on the different contents of polyvinyl acetate (PVAc) and polyvinyl alcohol (PVA), they were divided into a low PVAc+PVA (LP) group and a high PVAc+PVA (HP) group. Each group was further divided into five formulations: K0, K1.5, K2, K2.5, and K3, based on the amount of keratin 8 (KRT8) added. K0 represents no KRT8 added, while the others represent KRT8 additions of 1.5%, 2%, 2.5%, and 3%, respectively. Each formulation was prepared by weighing the components according to their mass percentages.

[0027] First, weigh out polyvinyl acetate, polyvinyl alcohol, and distilled water according to the formula, heat to 95℃, and stir at 30-40 r / min until a homogeneous and transparent liquid is formed. Then, add xanthan gum and propylene glycol to the resulting system, mix thoroughly, keep warm for 30 min, and then cool to 45℃. Next, add the required mass of benzyl chloride, phenoxyethanol, ethylhexylglycerin, mica, and titanium dioxide, and stir thoroughly and sonicate (420 W, 3 s interval, 5 s cycle, 5 cycles) to ensure uniform dispersion. After UV sterilization (254 nm wavelength, 30 min irradiation), cool the colloid at 4℃. After cooling, add recombinant keratin 8, stir, and sonicate (420 W, 3 s interval, 5 s cycle, 5 cycles) to ensure uniform dispersion in the colloid; finally, stabilize at 4℃ for 24 h (stand still) to obtain the final product.

[0028] Table 1 Hydrogel Components 3. Film formation time measurement The 10 groups of samples prepared above were used to determine the film-forming rate. The specific method was as follows: Take a sheet of tin foil, mark a 1 cm × 1 cm square area on its surface with a marker, accurately pipette 10 μL of the sample to be tested and add it to this area, then use a brush to evenly spread the sample across the entire surface. Timing was started immediately after coating, and the surface film formation was tested using the finger pressure method specified in GB / T1728-1979. This involved lightly touching the sample surface with a finger; when the surface felt slightly sticky and no sample residue remained on the finger, it was considered that a dry film had formed, and the required time was recorded. Three replicates were set for each group, and the film-forming time was measured separately. The average of the three measurements was taken as the film-forming time for this example. A film-forming time ≤ 1 min was considered to indicate good film-forming performance.

[0029] 4. Results and Analysis As shown in Table 2, the average film-forming time of samples in the HP-K0, HP-K1.5, HP-K2, and HP-K2.5 groups was greater than 1 min; while the average film-forming time of samples in the HP-K3 and LP-K0, LP-K1.5, LP-K2, LP-K2.5, and LP-K3 groups was less than 1 min. Therefore, HP-K3 and LP-K0 to LP-K3 groups were selected as candidate formulations for subsequent experiments.

[0030] Table 2 Film Formation Time Example 2: Evaluation of the adhesive properties and water resistance of the film-forming hydrogel The hydrogel formulations with a film-forming time of less than 1 min in Example 1 (HP-K3 and LP-K0 to LP-K3 groups) were selected for adhesion and water resistance tests.

[0031] 1. Substrate adhesion determination After the film formation test in Example 1 was completed, the sample was placed at room temperature for further drying to allow it to fully form a film on the tin foil substrate surface, and then left to stand for 24 hours. After drying, the adhesion of the film to the tin foil substrate surface was observed. If the film showed no obvious peeling, cracking, or detachment on the substrate surface, remained continuous and intact, and the results of each replicate sample were consistent, then its adhesion performance was considered good.

[0032] 2. Water resistance test The samples that have completed the adhesion test were then used for the water resistance test. The specific method was as follows: the substrate with the film attached was placed in a beaker, and aerated tap water was added to completely submerge it. The beaker was then left to stand at room temperature. Every hour, the morphological changes of the film were observed and recorded, including whether there was significant expansion, cracking, or detachment. When the film completely detached or showed significant cracking, it was considered a failure.

[0033] 3. Results and Analysis In the adhesion test, no samples in any experimental group showed any lifting or edge detachment after drying for 24 hours, indicating that all materials had good substrate adhesion performance. Figure 2 ).

[0034] Water resistance test results showed that the HP-K3 group sample experienced large-area detachment after immersion in water for 2 hours, and the film was almost completely detached from the substrate surface by 4 hours, exhibiting poor water resistance stability. In contrast, the LP-K0, LP-K1.5, LP-K2, LP-K2.5, and LP-K3 groups, although showing localized detachment after immersion in water for 2 hours, maintained a continuous film structure; by 4 hours, the film still covered the substrate surface, demonstrating better water resistance stability. Considering both adhesion and water resistance test results, the LP-K0 to LP-K3 groups exhibited superior overall performance and can be considered as candidate formulations for subsequent bacterial barrier performance evaluation. Figure 2 ).

[0035] Example 3 Evaluation of the barrier performance of film-forming hydrogels against bacterial diffusion The antibacterial properties of samples from the LP-K0, LP-K1.5, LP-K2, LP-K2.5 and LP-K3 groups were determined.

[0036] 1. Preparation of bacterial culture Select Vibrio parahaemolyticus ( Vibrio parahaemolyticus Provided by the Tianjin Key Laboratory of Aquatic Ecology and Aquaculture, this bacterium has been reported in the literature Xue Zhang, Jingfeng Sun, Feng Chen, et al. Phenotypic andgenomic characterization of a Vibrio parahaemolyticus strain causing disease in Penaeus vannamei provides insights into its niche adaptation and pathogenic mechanism. Microb Genom, 2021, 7. (NCBI accession number: MT799994). After being revived from storage at -80℃, the strain was inoculated into LB medium for activation culture and cultured overnight with shaking at 35℃ and 160 rpm. Subsequently, it was transferred to fresh medium at a 1% (v / v) inoculation rate and cultured under the same conditions for approximately 8 hours to obtain a bacterial suspension in the logarithmic growth phase. The bacterial suspension was diluted with sterile physiological saline to approximately 1×10⁻⁶. 7 CFU / mL available for use.

[0037] 2. Bacterial diffusion barrier experiment TCBS agar plates were used as the culture medium. Using a 0.5 cm diameter punch, holes were uniformly punched in the plates, maintaining equal spacing between wells. The sample to be tested was uniformly coated onto the walls and bottom of each well, forming a continuous film on the inner surface of the well. Then, 100 μL of bacterial suspension was added to each well. The blank control group underwent only hole punching, without coating with hydrogel, and the same volume and concentration of bacterial suspension was added directly. Each group had three replicates. The treated plates were incubated at 35°C for 48 h, and bacterial growth in each well was observed and recorded.

[0038] Using the blank control group as a reference, record whether bacteria diffuse from the well to the surrounding culture medium. If bacteria in the blank control group expand outward from the well to form a clear diffusion area, while bacterial growth in the experimental group is limited to the area within the well and no diffusion outward is observed, it indicates that the hydrogel forms an effective physical barrier within the well and has good bacterial diffusion blocking performance.

[0039] 3. Results and Analysis like Figure 3 As shown, in the blank control group, bacteria in the wells could significantly diffuse and grow into the surrounding culture medium, forming an outward-expanding growth area. However, in the LP-K0, LP-K1.5, LP-K2, LP-K2.5, and LP-K3 groups, the wells were covered by a hydrogel film, and no bacterial diffusion was observed. These results indicate that the film-type hydrogels composed of LP-K0, LP-K1.5, LP-K2, LP-K2.5, and LP-K3 can form a continuous covering layer on the wound surface, effectively blocking the spread and migration of Vibrio parahaemolyticus, and exhibiting good physical antibacterial activity.

[0040] Example 4: Evaluation of the application effect of film-forming hydrogel in the repair of skin wounds in koi carp 1. Experimental fish farming and grouping Healthy koi carp, measuring 14±2 cm in length and 120±7 g in weight, were selected. The fish were randomly divided into 6 groups, with 3 replicates per group. The specific setup for each group is as follows: (1) Blank control group: Only the trauma model was established, and no treatment was given; (2) 0% KRT8 group: trauma model + LP-K0 group hydrogel treatment; (3) 1.5% KRT8 group: trauma model + LP-K1.5 group hydrogel treatment; (4) 2% KRT8 group: trauma model + LP-K2 group hydrogel treatment; (5) 2.5% KRT8 group: trauma model + LP-K2.5 group hydrogel treatment; (6) 3% KRT8 group: trauma model + LP-K3 group hydrogel treatment.

[0041] Each parallel koi was kept in an independent aquaculture tank with the water temperature controlled at 21℃ and a continuous oxygen supply from the circulating water system. During the experiment, the koi were fed twice a day (once in the morning and once in the evening), with a total feed amount of 2% of the fish's body weight.

[0042] 2. Trauma model establishment and hydrogel treatment Before the experiment, the koi were anesthetized with MS-222 (100 mg / L) until they lost their balance before the procedure. Subsequently, the dorsal region along the lateral line of the koi was disinfected using cotton balls soaked in 75% alcohol. A sterilized skin punch (5 mm in diameter) was used to gently press and rotate vertically over the disinfected area to remove local scales and create a circular wound approximately 5 mm in diameter. The wounding was limited to the epidermis and superficial tissues, without damaging muscle tissue. Only one wound was created per koi.

[0043] After wound formation, hydrogel samples were taken from each group, and approximately 10 μL of sample was evenly applied to the wound surface using a pipette, ensuring complete coverage. After application, the experimental fish were placed outside the water for approximately 45 seconds to allow the hydrogel to form a stable coating on the wound surface. The fish were then returned to their respective rearing tanks for continued culture. An interval treatment method was used during the experiment, with hydrogel reapplication performed every 3 days on days 0, 3, 6, 9, and 12.

[0044] 3. Methods for evaluating wound healing Photographs of the koi wounds were taken on days 0, 3, 6, 9, and 12 after wound formation, with three fish from each group. Images of the wounds were acquired using a stereomicroscope. The wound area was measured using ImageJ image analysis software, and the wound healing rate was calculated using the following formula: Wound healing rate (%) = (Initial wound area − Current wound area) / Initial wound area × 100%. Morphological changes during the wound healing process were also observed, including wound contraction, surface tissue coverage, and any abnormalities.

[0045] 4. Histopathological studies On days 7 and 12 post-traumatic injury, three koi carp were randomly selected from each group. After anesthesia with MS-222 (100 mg / L), approximately 1 cm × 1 cm skin tissue (including epidermis, dermis, and some muscle tissue) was harvested from the wound area. The obtained tissue samples were fixed in 4% paraformaldehyde solution, dehydrated with graded ethanol, cleared with xylene, and then embedded in paraffin. Sections were 5 μm thick. After drying, the sections were stained with hematoxylin and eosin (H&E) and mounted using standard procedures. Pathological changes in the wound tissues of different treatment groups were observed under a microscope, including the formation of regenerated epithelium, the degree of dermal tissue reconstruction, angiogenesis, and the distribution characteristics of fibroblasts.

[0046] 5. Results and Analysis 5.1 Wound healing status and healing rate After establishing skin trauma models for each group of koi, the initial morphology and area of ​​the wounds were basically the same, with clear wound edges. Subsequently, a simulated wound overlay diagram was drawn based on the wound healing process. On day 3, the wounds in each group showed varying degrees of area reduction, accompanied by the wound edges contracting towards the center. There was no significant difference in wound healing rates among the groups. Figure 4 ).

[0047] By day 9, the wound shrinkage in the blank control group was not significant, while the wound shrinkage in the 0% KRT8 group was significant, and a thin layer of regenerated epithelial structure formed on the surface; in contrast, the wound shrinkage and epithelial regeneration in each KRT8-treated group were further enhanced, with some wounds in the 2% KRT8 group already almost completely covered by new tissue. Figure 4 The statistical results of wound healing rate showed that on day 9, the healing rates of the 0%, 1.5%, 2%, and 3% KRT8 groups were significantly higher than those of the blank control group (Table 3). Figure 5 ).

[0048] By day 12, the blank control group still had a large area of ​​unhealed wounds, the wounds in the 0% KRT8 group had further shrunk, and the wounds in all KRT8-treated groups had healed significantly, with the wounds in the 2% KRT8 group being almost completely covered by new tissue. Figure 4 The healing rate results showed that the healing rates of the blank control, 0% (matrix control), 1.5%, 2%, 2.5%, and 3% KRT8 groups were approximately 34.34%, 66.11%, 80.07%, 97.14%, 67.99%, and 61.79%, respectively. The healing rate of the blank control group was significantly lower than that of the other treatment groups, while the healing rate of the 2% KRT8 group was significantly higher than that of the other KRT8 treatment groups, indicating that this concentration provided the best repair effect (Table 3). Figure 5 ).

[0049] Table 3. Average healing rate of koi body surface wounds Note: Figure 5 The significance analysis of the wound healing rate of Chinese koi carp was performed. Data are expressed as mean ± standard deviation (SD) (n=3). Different letters indicate significant differences between groups (p<0.05), and the same letter indicates no significant difference.

[0050] 5.2 Histological changes in the wound H&E staining results of wound tissue as follows Figure 6As shown, on day 0, all wounds in each group exhibited defects in the epidermis and dermis, with tissue rupture and exposure of the basal structure visible in the wound area. By day 7, all wounds in each group had entered the tissue repair stage. The control group wounds were mainly composed of immature granulation tissue with a loose structure, obvious inflammatory cell infiltration, few new blood vessels, and insignificant regeneration of epithelium. In the 0% KRT8 group, granulation tissue formation was observed, accompanied by an increase in fibroblasts and the formation of new capillaries, with regenerated epithelium extending from the wound edge towards the center. Among the KRT8-treated groups, the 1.5% KRT8 group showed a lower degree of tissue differentiation and still exhibited some degree of inflammatory cell infiltration; the 2.5% and 3% KRT8 groups showed more obvious granulation tissue and epithelial regeneration in the wound area, but the granulation tissue was relatively abundant or the tissue structure was not yet dense. In contrast, the 2% KRT8 group showed a smaller area of ​​granulation tissue, a denser tissue arrangement, obvious regenerated epithelium formation extending towards the center of the wound, continuous coverage in some areas, and gradual establishment of dermal tissue, indicating a better trend of tissue reconstruction.

[0051] On day 12, the wound tissues in each group showed further differentiation. In the control group, significant granulation tissue and fibrous tissue proliferation were still observed, and the tissue structure had not fully recovered. In the 0% KRT8 group, granulation tissue was significantly reduced, tissue differentiation was improved, and a relatively complete dermal-like structure was observed. In the KRT8-treated groups, the 1.5% and 2.5% KRT8 groups showed significant fibrous tissue deposition in the wound area, and the tissue structure tended to be denser; while the 3% KRT8 group showed some degree of tissue stratification, granulation tissue was still relatively abundant. In contrast, the 2% KRT8 group showed near-complete regression of granulation tissue, intact epidermal coverage, clear differentiation between the epidermis and dermis, and a relatively regular tissue arrangement, closely resembling the morphology of normal skin tissue.

[0052] The above results indicate that the film-forming hydrogel prepared in this invention can promote the repair of wounded tissues on the body surface of koi, with the repair effect being most prominent when 2% keratin 8 is added.

[0053] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A film-forming hydrogel containing keratin 8, characterized in that, By weight percentage, it consists of 8.25% polyvinyl acetate, 4.5% polyethylene ester, 1.1% xanthan gum, 0.2% benzyl chloride, 0.9% phenoxyethanol, 0.1% ethylhexylglycerin, 0.5% propylene glycol, 7% mica, 1% titanium dioxide, 1.5%-3% keratin 8 and the balance water.

2. The film-forming hydrogel as described in claim 1, characterized in that, The amount of keratin 8 used is 1.5%-2%.

3. The film-forming hydrogel as described in claim 2, characterized in that, The amount of keratin 8 used is 2%.

4. The method for preparing the film-forming hydrogel according to any one of claims 1-3, characterized in that, Includes the following steps: Take polyvinyl acetate, polyvinyl alcohol and water, heat and stir; then add xanthan gum and propylene glycol, mix thoroughly; then add benzyl chloride, phenoxyethanol, ethylhexylglycerin, mica and titanium dioxide, stir thoroughly and sonicate, after ultraviolet sterilization, add keratin 8 and sonicate again, and let stand to obtain the product.

5. The preparation method according to claim 4, characterized in that, The heating is to be heated to 95°C; The ultrasonic treatment was performed at a power of 420 W, with a 3-second operation followed by a 5-second pause, repeated 5 times. The settling period is 24 hours at 4°C.

6. The preparation method according to claim 4, characterized in that, The process of adding xanthan gum and propylene glycol, mixing thoroughly, and then keeping warm for 30 minutes before cooling to 45°C also includes the steps of adding xanthan gum and propylene glycol, mixing thoroughly, and then keeping warm for 30 minutes before cooling down to 45°C.

7. The use of the film-forming hydrogel according to any one of claims 1-3 in any of the following: (1) Prepare products that promote the repair of skin damage in fish; (2) Prevents the spread of bacteria; (3) Prepare products that prevent the spread of bacteria.

8. The application as described in claim 7, characterized in that, The bacteria include Vibrio parahaemolyticus ( Vibrio parahaemolyticus ).

9. A product that promotes the repair of skin damage in fish, characterized in that, Including the film-forming hydrogel according to any one of claims 1-3.

10. A product that blocks the spread of bacteria, characterized in that, Including the film-forming hydrogel according to any one of claims 1-3; The bacteria include Vibrio parahaemolyticus.