A high-temperature keratinase, its coding gene, preparation method and application
By preparing high-temperature keratinase and its encoding gene, the problem of low microbial enzyme yield has been solved, and efficient hydrolysis of keratin and other proteins under high temperature and wide pH conditions has been achieved, which has good market application prospects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- BIOGAS SCI RES INST MIN OF AGRI
- Filing Date
- 2024-11-28
- Publication Date
- 2026-05-29
AI Technical Summary
Existing microbial keratinase production suffers from low enzyme yield, poor heat resistance, and low activity, making it difficult to effectively decompose keratin. Furthermore, traditional treatment methods are harmful to the environment and fail to fully utilize keratin resources.
The thermogenic keratinase and its encoding gene were designed and prepared, cloned into a prokaryotic expression vector by PCR, expressed in Escherichia coli Rosseta(DE3)plysS and purified by nickel affinity chromatography to obtain a keratinase with high specific activity.
Thermostable keratinase maintains good activity over a wide pH range and at high temperatures, and can efficiently hydrolyze keratin, casein and bovine serum albumin, showing broad application prospects.
Smart Images

Figure BDA0005157634890000031 
Figure HDA0005157634900000011 
Figure HDA0005157634900000012
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of genetic engineering and enzyme engineering, specifically relating to a high-temperature keratinase and its encoding gene, preparation method and application. Background Technology
[0002] Keratin is a hard, fibrous protein widely found in animal hair, scales, feathers, horns, and other structures. Its main components are α-keratin and β-keratin, found in animal hair, bird feathers, and human hair. During the production of agricultural and industrial products, byproducts containing keratin are often generated. Due to their complex structure and high disulfide bond content, they are difficult to process (VERMA et al., 2017). However, this does not mean that waste keratin is worthless. In fact, waste keratin can be considered a rich source of protein or amino acids and can be used in the production of feed, fertilizers, cosmetics, and other products (CALLEGARO et al., 2019; LANGE et al., 2016). Currently, the amount of feather waste generated worldwide each year is enormous. Because feather waste contains a large amount of keratin, the natural decomposition process is very lengthy. Therefore, traditional feather waste treatment often uses physicochemical methods, which not only damage the environment but also fail to fully utilize feather keratin.
[0003] Keratinase is a proteolytic enzyme that can effectively break down keratin and is widely found in fungi, bacteria, and archaea (FANG et al., 2014; FELLAHI et al., 2016; RAMNANI et al., 2005). However, the production of keratinase using microorganisms has disadvantages such as low enzyme yield, poor heat resistance, and low activity, which are far from meeting the requirements of practical applications.
[0004] Therefore, there is a need for a keratinase that has excellent heat resistance and activity and can be synthesized in large quantities. Summary of the Invention
[0005] The problem this application aims to solve is to provide a high-temperature keratinase that can maintain excellent activity under high temperature and wide pH conditions, and can not only hydrolyze keratin, but also has excellent hydrolytic ability to casein and bovine serum albumin.
[0006] To solve the above-mentioned technical problems, this application adopts the following technical solution:
[0007] On the one hand, this application provides a high-temperature keratinase, the amino acid sequence of which is shown in SEQ ID NO.1.
[0008] On the other hand, this application provides a gene encoding the high-temperature keratinase, the nucleotide sequence of which is shown in SEQ ID NO.2.
[0009] In another aspect, this application provides a method for preparing the aforementioned high-temperature keratinase, the method comprising:
[0010] 1) The nucleotide sequence shown in SEQ ID NO.2 was obtained by PCR;
[0011] 2) The nucleotide sequence shown in SEQ ID NO.2 was cloned into a prokaryotic expression vector;
[0012] 3) Transform the product obtained in step 2) into genetically engineered bacteria;
[0013] 4) The product obtained in step 3) is induced and cultured and then broken to obtain the crude protease solution;
[0014] 5) Perform nickel affinity chromatography on the product obtained in step 4) to obtain the purified protease solution.
[0015] Furthermore, the prokaryotic expression vector includes pET22b(+).
[0016] Furthermore, the genetically engineered bacteria include the Escherichia coli Rosseta(DE3)plysS expression strain.
[0017] Furthermore, the induction culture includes the following steps:
[0018] In LB liquid medium containing Kan antibiotic, cultured at 30°C with shaking at 200 rpm until OD. 600 The concentration was 1.0–1.2. 0.5 mmol / L IPTG was added and cultured at 30°C and 120 rpm for 15 hours. 1 mL of bacterial culture was centrifuged at 12000 rpm for 2 min to collect the bacterial cells. 5 mL of Lysis Buffer was added and mixed thoroughly. The bacteria were sonicated and centrifuged at 4°C and 12000 rpm for 30 min. The supernatant was collected.
[0019] Furthermore, the nickel affinity chromatography includes the following steps:
[0020] Using a nickel affinity chromatography column, after washing the column with Bingding Buffer (20 mM PBS buffer, pH 7.4), the product obtained in step 4) was slowly loaded and flowed through the column. The column was washed again with Bingding Buffer, and then with Elution Buffer (20 mM PBS + 300 mM imidazole, pH 7.4). The column was then dialyzed overnight using a 5 kDa dialysis bag to obtain purified keratinase.
[0021] In another aspect, this application provides the application of the above-mentioned high-temperature keratinase or the above-mentioned gene or the above-mentioned method in the treatment of protein-containing substances, wherein the protein includes at least one of keratin, casein and bovine serum albumin.
[0022] The present invention has the following beneficial effects:
[0023] The keratinase provided by this invention has a specific activity as high as 50-55 KU / mg, and can maintain good activity in environments with pH 6.5-11.5 or temperature 35-85℃. It can effectively hydrolyze various proteins such as keratin, casein and bovine serum albumin, and has good market application prospects. Attached Figure Description
[0024] To more clearly illustrate the technical solutions in this disclosure, the accompanying drawings used in some embodiments of this disclosure will be briefly described below.
[0025] Figure 1 The pH stability test results of the keratinase obtained in this invention are shown, wherein "KerKP2139" represents the keratinase obtained in Example 2;
[0026] Figure 2 The experimental results show the temperature range of adaptation of the keratinase obtained in this invention.
[0027] Figure 3 The results show the thermal stability of the keratinase obtained in this invention. Detailed Implementation
[0028] The technical solutions in some embodiments of this disclosure will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this disclosure, and not all embodiments. Based on the embodiments provided in this disclosure, all other embodiments obtained by those skilled in the art are within the scope of protection of this disclosure.
[0029] Example 1
[0030] 1.1 Vectors, strains, and culture media
[0031] Strains: E. coli DH5α, E. coli Rosseta (DE3) Vector: pET22b(+)
[0032] LB medium (liquid): 1% peptone, 0.5% yeast extract, 1% NaCl.
[0033] Solid culture medium: 1.5% agar powder added to LB liquid medium.
[0034] 1.2 Experimental Methods (Construction of Recombinant Plasmids) Primer Synthesis
[0035] The primers used in this experiment are
[0036] Table 1 Primer sequences
[0037] Primer name Primer sequence Kerkp2139-F CGCTGCCCAGCCGGCGATGGCCGATCAATATGTTCCCGGA Kerkp2139-R GCCGGATCTCAGTGGTGGTGGTGGTGGTGCCCACCACCCGTGGTCAG
[0038] Using DNA as a template, upstream and downstream primers Kerkp2139-F and Kerkp2139-F of the gene to be cloned were synthesized and PCR was performed. The reaction system is shown in Table 2, and the reaction conditions are shown in Table 3. After PCR products were subjected to 1.5% agarose gel electrophoresis, the target fragment was excised from the gel and purified according to the gel extraction kit steps to recover the DNA fragment. The above target DNA was assembled with pET22b(+) plasmid using Gibson assay, and the reaction system is shown in Table 4. The molar ratio of target gene DNA to vector was optimized to 2:1-10:1, with 3:1 recommended. The DNA concentration was determined by a nucleic acid quantification instrument. After mixing all reactants, the reaction was carried out at 50°C for half an hour.
[0039] Table 2 PCR reaction system
[0040] Components 50μL system 2×PrimerMax 25μL Kerkp2139-F 2.5μL Kerkp2139-R 2.5μL Diluted bacterial solution 2μL ddH20 18μL
[0041] Table 3 PCR Procedure
[0042]
[0043] Table 4 Gibson Assembly Procedure
[0044] Components 20μL system DNA fragments 4μL GibsonAssemblyMasterMix(2X) 10μL <![CDATA[ddH20]]> 6μL
[0045] 1.3 Conversion of Linkage Products
[0046] E. coli DH5α competent cells (100 μL per tube) were removed from -80℃ and thawed on ice. The ligation product was added to the competent cells, and the cells were incubated on ice for 30 min. Then, the cells were heat-shocked at 42℃ for 60 s, followed by an ice incubation for 2 min. 700 μL of LB medium was added, and the cells were cultured at 37℃ with shaking at 180 rpm for 45 min. A suitable amount of the transformed competent cells was plated on LB agar plates containing Kan+ and incubated overnight at 37℃. Positive clones were selected, plasmids were extracted, and PCR was performed to identify the recombinant clones.
[0047] 1.4 Screening and Identification of Positive Clones
[0048] Positive single colonies were randomly selected and inoculated into 5 mL of LB medium containing kanamycin (100 mg / mL), and cultured overnight at 37°C with a shaker. The bacterial cells were collected by centrifugation, and plasmids were extracted using a plasmid extraction kit. The presence of the insert fragment in the obtained plasmids was confirmed by PCR. The selected recombinant plasmids were sent to Genewiz for sequencing to verify their correctness.
[0049] 1.5 Sequence Analysis
[0050] After removing the vector sequence from the sequencing results, BLAST analysis was performed to align the sequence with the genome sequence. The correctness of the amplified sequence was determined, and the ORF (Organic Riddle Function) of the enzyme gene was predicted using the ORF finder tool. The sequence is shown in SEQ ID NO.2.
[0051] 1.6 Transformation of host bacteria
[0052] The verified pET22b(+) plasmid containing the target gene was transformed into 100 μL of E. coli RoseTTA(DE3)plysS and plated on LB plates containing Kan+, and cultured at 37°C (method as in 2.3).
[0053] 1.7 Screening of positive clones and induction of expression
[0054] Single clones were picked and inoculated into 5 mL of liquid LB medium containing Kan+ and cultured overnight. Plasmid was extracted and PCR was performed to verify the positive result. Positive clones were inoculated into 100 mL of liquid TB medium and cultured at 30°C with a constant temperature shaker at 180 rpm / min until the OD600 reached approximately 1.0–1.2. 0.5 mM IPTG was added, and the culture was continued at 16°C with a constant temperature of 100 rpm / min for 15 h. After the culture was completed, the bacterial cells were collected by centrifugation, resuspended in PBS buffer, and the cells were sonicated. The cells were then centrifuged at 16000 g for 15 min at 4°C, and the supernatant was collected to obtain the crude keratinase solution.
[0055] 1.8 Purification and Acquisition of Keratinase Solution
[0056] The purification column was a nickel affinity chromatography column. After washing the column with Bingding Buffer (20 mM PBS buffer, pH 7.4), the product obtained in step 4) was slowly loaded and flowed through it. The column was washed again with Bingding Buffer, and then with Elution Buffer (20 mM PBS + 300 mM imidazole, pH 7.4). The column was dialyzed overnight using a 5 kDa dialysis bag to obtain the purified keratinase solution.
[0057] Example 2
[0058] 1) Prepare the sequence SEQ ID NO.2 obtained in Example 2;
[0059] 2) The nucleotide sequence shown in SEQ ID NO.2 was cloned into the pET22b(+)(+) vector;
[0060] 3) The product obtained in step 2) was transformed into E. coli RoseTTA(DE3)plysS engineered bacteria;
[0061] 4) The product obtained in step 3) was cultured in 100 mL of TB liquid medium containing Kan antibiotic at 30°C with shaking at 180 rpm until the OD600 reached 1.0–1.2. 0.5 mM IPTG was added, and the culture was incubated at 16°C with shaking at 100 rpm for 15 h. The bacterial cells were collected after centrifugation at 12000 rpm for 2 min, and 30 mL of PBS buffer was added and thoroughly mixed. The bacteria were then sonicated to disrupt the cytosolic state, and centrifuged at 16000 rpm for 15 min at 4°C. The supernatant was collected to obtain the crude keratinase solution.
[0062] 5) The product obtained in step 4) was subjected to nickel affinity chromatography. After washing the column with Bingding Buffer (20 mM PBS buffer, pH 7.4), the product obtained in step 4) was slowly loaded through the column. The column was washed again with Bingding Buffer, followed by washing with Elution Buffer (20 mM PBS + 300 mM imidazole, pH 7.4). The column was dialyzed overnight using a 5 kDa dialysis bag to obtain purified keratinase solution. The amino acid sequence of the obtained protease solution was performed, and the sequence is shown in SEQ ID NO. 1.
[0063] Example 3
[0064] The keratinase obtained in Example 2 was subjected to pH stability, optimum temperature, and thermal stability tests. The results are as follows: Figure 1 , Figure 2 and Figure 3 As shown.
[0065] Example 4
[0066] The keratinase obtained in Example 2 was subjected to enzyme activity assays on different substrates. The substrates included keratin powder, soluble keratin, feather meal, wool meal, casein, and bovine serum albumin. The activity was measured by mixing 400 μL of appropriately diluted enzyme solution with 800 μL of 50 mM glycine-sodium hydroxide buffer (pH 10) and 1% of each substrate, then incubating at 75°C for 1 h. The reaction was terminated with 800 μL of 10% trichloroacetic acid (TCA), followed by centrifugation at 10,000 rpm for 10 min. Enzyme activity was measured at 280 nm under each condition, and the results are shown in Table 5. The control group had TCA added beforehand to terminate the reaction. One unit (U / mL) of enzyme activity was defined as an increase of 0.01 μm in absorbance per 1 mL of enzyme solution at 280 nm per unit time.
[0067] Table 5 Enzyme activity applied to different substrates
[0068] Substrate Enzyme activity (U / mg) Keratin powder 50750±2415 Soluble keratin 42245±1470 Chicken feather powder 38500±1820 Wool powder 16310±1435 Casein 65485±770 Bovine serum albumin 64960±560
[0070] In summary, the keratinase provided in this application exhibits an enzyme activity exceeding 50% at pH values ranging from 6.5 to 11.5, maintains activity consistently at ambient temperatures between 35 and 85°C, and reaches its maximum activity at 75°C. Therefore, the keratinase provided in this application is a protease suitable for high-temperature environments. Furthermore, the keratinase provided in this application not only demonstrates significant hydrolytic ability against various keratins but also exhibits excellent hydrolytic ability against casein and bovine serum albumin. In the future, it can be applied not only to the recycling of keratin waste but also to fields such as genetic engineering and biomedicine, making it a protease with very promising applications.
[0071] The above description is merely a preferred embodiment of this disclosure. It should be understood that this disclosure is not limited to the forms disclosed herein and should not be construed as excluding other embodiments. It can be used in various other combinations, modifications, and environments, and can be altered within the scope of the concept described herein through the above teachings or techniques or knowledge in related fields. Any modifications and variations made by those skilled in the art that do not depart from the spirit and scope of this disclosure should be within the protection scope of the appended claims.
Claims
1. A high-temperature keratinase, characterized in that, The amino acid sequence of the thermokeratinase is shown in SEQ ID NO.
1.
2. The gene encoding the thermokeratinase of claim 1, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.
2.
3. The method for preparing the high-temperature keratinase according to claim 1, characterized in that, The method includes the following steps: 1) The nucleotide sequence shown in SEQ ID NO.2 was obtained by PCR; 2) The nucleotide sequence shown in SEQ ID NO.2 was cloned into a prokaryotic expression vector; 3) Transform the product obtained in step 2) into genetically engineered bacteria; 4) The product obtained in step 3) is induced and cultured and then broken to obtain the crude protease solution; 5) Perform nickel affinity chromatography on the product obtained in step 4) to obtain the purified protease solution.
4. The method according to claim 3, characterized in that, The prokaryotic expression vector includes pET22b(+).
5. The method according to claim 3, characterized in that, The genetically engineered bacteria include the Escherichia coli Rosseta(DE3)plysS expression strain.
6. The method according to claim 3, characterized in that, The induction culture includes the following steps: In LB liquid medium containing Kan antibiotic, cultured at 30°C with shaking at 200 rpm until OD. 600 The concentration was 1.0–1.
2. 0.5 mmol / L IPTG was added and cultured at 30°C and 120 rpm for 15 hours. 1 mL of bacterial culture was centrifuged at 12000 rpm for 2 min to collect the bacterial cells. 5 mL of Lysis Buffer was added and mixed thoroughly. The bacteria were sonicated and centrifuged at 4°C and 12000 rpm for 30 min. The supernatant was collected.
7. The method according to claim 3, characterized in that, The nickel affinity chromatography includes the following steps: Using a nickel affinity chromatography column, after washing the column with Bingding Buffer (20 mM PBS buffer, pH 7.4), the product obtained in step 4) was slowly loaded and flowed through the column. The column was washed again with Bingding Buffer, and then with Elution Buffer (20 mM PBS + 300 mM imidazole, pH 7.4). The column was then dialyzed overnight using a 5 kDa dialysis bag to obtain purified keratinase.
8. The application of the thermokeratinase of claim 1, the gene of claim 2, or the method of any one of claims 3 to 7 in the treatment of protein-containing substances, characterized in that, The protein includes at least one of keratin, casein, and bovine serum albumin.