A primer pair, a kit and a method for detecting the expression amount of a liver function gene HNF1A

By designing primer pairs targeting the HNF1A gene and using qPCR technology, the problem of rapidly detecting the expression level of the HNF1A gene in liver function cells was solved, realizing an economical and efficient detection method suitable for rapid identification of liver function cells and monitoring of the relative expression level of the HNF1A functional gene.

CN122104923APending Publication Date: 2026-05-29HEXAELL BIOTECH

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HEXAELL BIOTECH
Filing Date
2024-11-28
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Current technologies lack rapid and economical methods to detect whether cells express the HNF1A gene or determine its relative expression level, and require expensive instruments and equipment.

Method used

A primer pair targeting the HNF1A gene in liver function and its detection method were designed. The amplification reaction was carried out using qPCR technology with TB Green premixed solution, reference dye and primer mixture. The relative expression level was calculated by combining ΔΔCT method, and the method does not rely on expensive instruments.

Benefits of technology

This method enables rapid monitoring of the relative expression level of the HNF1A gene in liver function cells. It is simple to operate, economical, does not require expensive instruments or equipment, and has good specificity and stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104923A_ABST
    Figure CN122104923A_ABST
Patent Text Reader

Abstract

The application discloses a primer pair, a kit and a method for detecting the expression amount of a liver function gene HNF1A. The primer pair comprises a forward primer as shown in SEQ ID NO:1 and a reverse primer as shown in SEQ ID NO:2. The primer pair of the application can realize monitoring of the relative expression amount of the HNF1A gene in a liver function cell product, and can realize rapid identification of liver function cells and relative expression of the HNF1A function gene of the cells, and the method is simple and convenient to operate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a primer pair, kit, and method for detecting the expression level of the liver function gene HNF1A. Background Technology

[0002] HNF1A (also known as TCF1) belongs to the nuclear factor 1 transcription factor family of hepatocytes and is an important upstream regulator of genes involved in lipoprotein metabolism and glucose-induced insulin secretion. It is mainly expressed in various tissues, including the human liver, and is an important marker of liver function. To confirm whether a cell sample belongs to hepatocytes or hepatocytes, and to determine the relative expression level of the HNF1A gene in liver function cells, a rapid and cost-effective experimental method is urgently needed. Summary of the Invention

[0003] This invention discloses a primer pair and a method for detecting the relative expression level of the liver function gene HN1A. The method disclosed in this invention is convenient and rapid, and can detect whether cells express the HNF1A gene or the relative expression level of the HNF1A gene in a short time. It does not require expensive instruments and equipment and has good specificity and stability.

[0004] The present invention solves the above-mentioned technical problems through the following technical solutions.

[0005] A first aspect of the present invention provides a primer pair for targeting the HNF1A gene of liver function, the primer pair comprising a forward primer as shown in SEQ ID NO:1 and a reverse primer as shown in SEQ ID NO:2.

[0006] A second aspect of the present invention provides a kit for detecting the expression level of the liver function gene HNF1A, the kit comprising the primer pair as described in the first aspect of the present invention.

[0007] In some embodiments of the present invention, the kit further includes buffer, DNA polymerase, and dNTPs.

[0008] In some embodiments of the present invention, the kit further includes a fluorescent dye or a probe.

[0009] In some embodiments of the present invention, the fluorescent dye is selected from TB Green, SYBR Green I, JOE, ROX and TAMRA.

[0010] In some embodiments of the present invention, the kit further includes primer pairs for detecting internal reference genes.

[0011] In some embodiments of the present invention, the internal reference gene is selected from GAPDH, β-actin and ACTB.

[0012] In some embodiments of the present invention, the primer pair of the internal reference gene includes a forward primer as shown in SEQ ID NO:19 and a reverse primer as shown in SEQ ID NO:20.

[0013] A third aspect of the invention provides the use of the primer pairs as described in the first aspect of the invention in the preparation of a kit for detecting the relative expression level of the liver function gene HNF1A.

[0014] A fourth aspect of the present invention provides a method for detecting the expression level of the liver function gene HNF1A, the method comprising the step of contacting a primer pair as described in the first aspect of the present invention or a kit as described in the second aspect of the present invention with a nucleic acid sample to be tested to induce an amplification reaction.

[0015] In some embodiments of the present invention, the method is for non-diagnostic purposes.

[0016] In some embodiments of the present invention, the amplification reaction is qPCR; the qPCR reaction system includes TBGreen premix, reference dye, nuclease-free water, primer mixture and the nucleic acid sample to be tested.

[0017] In some embodiments of the present invention, the concentrations of the forward and reverse primers are both 5–12 μmol / L, for example 10 μmol / L.

[0018] In some embodiments of the present invention, the concentration of the nucleic acid sample to be tested in the reaction system is 0.001 to 0.008 μg / μL, for example 0.004 μg / μL.

[0019] In some embodiments of the present invention, each 20 μL of the reaction system comprises: 0.2 μL of primer mixture, 10 μL of TBGreen premix, 0.4 μL of ROX reference dye, 7.4 μL of nuclease-free water, and 2 μL of nucleic acid sample to be tested.

[0020] In some embodiments of the present invention, the reaction procedure of the qPCR is as follows: (1) initial denaturation: 95℃, 10min; (2) cyclic amplification: 95℃ for 15s, 60℃ for 1min, 40 cycles; (3) melting curve: starting from 60℃, for every 0.3℃ increase, maintain this temperature for 5 seconds until the temperature rises to 95℃.

[0021] In some embodiments of the present invention, the method further includes the step of extracting RNA from the sample to be tested and performing reverse transcription to obtain the nucleic acid sample to be tested.

[0022] The reagents and raw materials used in this invention are all commercially available.

[0023] The positive and progressive effects of this invention are as follows:

[0024] The primer pairs of this invention enable the monitoring of the relative expression level of the HNF1A gene in liver function cell products, allowing for rapid identification of liver function cells and the relative expression of the HNF1A functional gene in cells. The method is simple and convenient to operate, and does not require expensive instruments or equipment, making it economical and convenient. Attached Figure Description

[0025] Figures 1-3 The dissolution curves of GAPDH in the blank control, reference, and test sample are shown respectively; where Derivative Reporter (-Rn') represents the test report generated from the analyzed data.

[0026] Figures 4-7 The melting curves of HNF1A in the blank control, reference, test sample, and positive control are shown respectively; where Derivative Reporter (-Rn') represents the test report generated after data analysis. Detailed Implementation

[0027] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0028] 1. Experimental Materials

[0029] 1.1 Reagents

[0030]

[0031]

[0032] 1.2 Consumables

[0033] Consumable Name Manufacturer Product code 0.1 mL optical 96-well plate Life Technology Corporation 4346906 qPCR sealing film Life Technology Corporation 4311971 1.5mL sterile EP tube Axygen MCT-150-CS 20μL pipette tip AXYGEN or other similar products T-300-RS 200μL nozzle AXYGEN or other similar products T-200-BRS 1000μL pipette tip AXYGEN or other similar products T-1000-BRS 200mL conical flask Shu Niu or other similar products N / A Ice box N / A N / A

[0034] 1.3 Instruments / Equipment

[0035]

[0036]

[0037] Example 1

[0038] This embodiment designs primers for human liver function cells HNF1A, following the design principles:

[0039] 1. Primer design across introns

[0040] Choosing primers designed across introns prevents the amplification of gDNA templates, ensuring that all products originate from cDNA amplification, thus eliminating the impact of gDNA contamination.

[0041] 2. Primer length

[0042] Generally, the number of bases should be between 17 and 25, and the difference between the upstream and downstream primers should not be too large.

[0043] The length of the amplification product should be controlled within 80-150 bp, and should not exceed 300 bp.

[0044] 3. GC content and Tm value

[0045] The GC content of the primers should be controlled between 40% and 60%, with 45% to 55% being optimal. The GC content of the forward and reverse primers should be approximately the same to obtain identical Tm values ​​and annealing temperatures.

[0046] The Tm value should ideally be between 58-62℃, generally around 60℃. The Tm values ​​of upstream and downstream should be as close as possible, preferably not exceeding 4℃.

[0047] 4. Avoid selecting A at the 3' end of the primer.

[0048] When the 3′ end of a primer is mismatched, the synthesis efficiency varies greatly depending on the base. When the terminal base is A, chain synthesis can still be initiated even with a mismatch; however, when the terminal base is T, the initiation efficiency is greatly reduced. Therefore, it is best to avoid choosing A for the 3′ end of the primer and instead choose T.

[0049] 5. Base distribution

[0050] The distribution of the four bases in the primers should ideally be random, and more than three consecutive G or C bases should be avoided at the 3′ end, as they are more likely to pair up in GC-enriched sequence regions.

[0051] 6. Primers should avoid continuous base complementarity with each other as much as possible.

[0052] There cannot be four consecutive complementary bases between the primers themselves or between primers. The primers themselves should not have complementary sequences, otherwise they will fold into hairpin structures, affecting the annealing binding of the primer to the template.

[0053] 7. Primers amplify the target-specific product.

[0054] The ultimate goal of qPCR is to determine the abundance of the target gene. If non-specific amplification occurs, quantification will be inaccurate. Therefore, after designing primers, BLAST analysis is necessary to compare the product specificity with sequence databases.

[0055] Based on the above principles, the following primers were designed:

[0056]

[0057]

[0058] Based on the above analysis, primer pair 1 was selected for detection of HNF1A in liver function cells. In addition, BLAST analysis of the forward and reverse primer sequences of this primer pair showed that the homology with the HNF1A gene was 100%, indicating high specificity.

[0059] In addition, the primers for the internal reference gene GAPDH are as follows:

[0060] Positive: GGACCTGACCTGCCGTCTAG (SEQ ID NO:19)

[0061] Reverse: GTAGCCCAGGATGCCCTTGA (SEQ ID NO:20)

[0062] Example 2

[0063] This embodiment provides a method for detecting HNF1A in liver function cells.

[0064] 1. Experimental Procedure

[0065] 1.1 Cell RNA Nucleic Acid Extraction

[0066] 1.1.1 Take a certain amount of the test sample and reference cell suspension, and extract RNA nucleic acid according to the EasyPure RNA Kit instructions;

[0067] 1.1.2 The concentration of the extracted RNA was detected using a UV / Vis spectrophotometer. Each sample was measured twice, and the average value was taken.

[0068] 1.1.3 Sample A260 / A280 range: 1.80~2.20.

[0069] 1.1.4 Store the extracted RNA at -80°C.

[0070] 1.2 RNA reverse transcription

[0071] The extracted test sample and reference RNA were reverse transcribed according to the following steps:

[0072] 1.2.1 Experimental Preparation

[0073] Add nuclease-free water to dilute the primers to 100 μmol / L (i.e., 0.5 μg / μL) according to the dilution volume provided on the tube wall of the Oligo dT primer (dry powder) (or in the primer synthesis instructions).

[0074] Place all reagents and RNA samples at room temperature until they melt into a liquid state before use.

[0075] Preheat the dry thermostat to 42°C.

[0076] 1.2.2 Preparation of the reverse transcription system

[0077] Each reverse transcription system sample is considered as one basic unit. Samples less than one are counted as one basic unit. The total reaction volume of each basic unit is 25 μl.

[0078] 1) Calculate the required number of units to be prepared based on the sample quantity and requirements.

[0079] Unit quantity (N) = Theoretical required unit quantity + loss.

[0080] 2) Calculate the amount of each reagent and prepare and dispense it (mix each reagent together according to the prepared volume and then dispense it).

[0081]

[0082]

[0083] 3) Calculate the required RNA volume based on the sample concentration, add nuclease-free water to bring the volume to 25 μL (for 1 basic unit), vortex to mix, and then centrifuge briefly. Nuclease-free water volume (μL) = 25 - 8.5 (reagent aliquots) - RNA volume.

[0084] 4) Place the prepared RNA reverse transcription system in a dry thermostat at 42℃ for 1 hour.

[0085] 5) The cDNA sample after reverse transcription should be stored at -20℃ or below.

[0086] 1.3 Procedure for determining the relative expression level of the HNF1A gene (qPCR method)

[0087] 1.3.1 Method Principle

[0088] In this method, the relative expression level is detected by the ΔΔCT method in qPCR. The CT values ​​of the target gene HNF1A and the internal reference gene GAPDH in the test sample and the reference (RS) are obtained by qPCR detection. The relative expression level of the HNF1A gene in the test sample is then calculated by the following formula.

[0089] Relative expression level = 2 -ΔΔCT

[0090] Wherein, ΔCT = ΔCT1 - ΔCT2, where ΔCT1 = average CT value of the target gene in the test sample - average CT value of GAPDH in the test sample, and ΔCT2 = average CT value of the target gene in the reference sample - average CT value of GAPDH in the reference sample.

[0091] 1.3.2 Preparation of primer mixture

[0092] 1) Mix equal volumes of 10 μmol / L primer solutions for the forward primer (F) and reverse primer (R) of the HNF1A gene and the internal reference gene GAPDH. This mixture is called the forward / reverse primer mixture of the HNF1A gene and the internal reference gene GAPDH, denoted as "F+R".

[0093] 2) Reference substance (RS)

[0094] The reference standard is a cDNA solution from UCFT control cells that do not contain the HNF1A gene, which is derived from UCFT control cells through RNA extraction and reverse transcription.

[0095] 3) Sample

[0096] The cDNA solution of the liver function cells to be tested is obtained from the cells through RNA extraction and reverse transcription.

[0097] 4) Positive Control (PC)

[0098] The HNF1A gene sequence was obtained from NCBI. The HNF1A nucleic acid sequence was then obtained by gene synthesis. The nucleic acid sequence was then inserted into a plasmid vector to obtain a positive control plasmid containing the HNF1A target gene.

[0099] The HNF1A positive control plasmid stock solution (1 μg / μL) needs to be diluted 1×10⁻⁶ with DNA dilution buffer. 5 The plasmid was tested after dilution, and it served as a control containing the HNF1A gene. Plasmid stock solution and dilution: 1×10⁻⁶ 5 The shelf life and storage conditions of the plasmid after doubling are shown in the table below:

[0100] Group Storage conditions Validity period plasmid stock solution -80℃ and below 3 years <![CDATA[Plasmid after dilution by 1×10 5 times]]> -40℃ and below 6 months

[0101] 5) Dilution of the test sample and reference standard

[0102] Since the amount of cDNA (complementary DNA) obtained from the reverse transcription reaction (referred to as reverse transcription amount) may exist in the three systems shown in the table below, in order to ensure that the cDNA concentration of the sample is consistently 0.004 μg / μL during detection, it is necessary to perform dilutions of the corresponding folds:

[0103] cDNA reverse mixing amount n (μg) of sample cDNA solution dilution factor For example n≥1 10 5μL + 45μL nuclease-free water n=0.5 5 10μL + 40μL nuclease-free water n=0.1 No dilution required NA

[0104] For example, when the amount of cDNA reversed (n) is greater than or equal to 1, the reverse transcription system increases exponentially (n × 25), so the original cDNA concentration remains unchanged at 0.04 μg / μL (original cDNA concentration = n / 25 × n).

[0105] 6) Blank control (NTC): Take an appropriate amount of nuclease-free water (e.g., 50 μL) as a blank control.

[0106] 1.3.3 Preparation of qPCR reaction system

[0107] 1) Calculate the number of reaction wells for each gene: Number of reaction wells (N) = (Number of samples to be tested + Reference + Plasmid (if needed) + NTC + Loss) × Number of parallel wells

[0108] (GMP samples have 3 duplicates of parallel wells, while non-GMP samples should have at least 2 duplicates of parallel wells).

[0109] 2) Based on the above number of reaction wells, calculate and prepare the amount of each gene according to the system in the table below (actual reagent preparation volume = volume of the reagent per well × number of reaction wells N):

[0110]

[0111] 1.3.4 Sample addition

[0112] 1) Dispense qPCR reaction solution into 96-well plates at 18 μL / well. Then add 2 μL of the prepared reference template, the sample template to be tested, the positive plasmid (optional), and NTC respectively. The sample loading layout can be referred to the table below (or can be arranged according to the actual situation).

[0113] 2) After adding the samples, attach the sealing film, place the plate in a centrifuge for a short time, and then put the qPCR microplate into the qPCR instrument.

[0114] 1.3.5 qPCR reaction

[0115] 1) The parameters of the confirmed reaction procedure are shown in the table below:

[0116]

[0117] 2) After confirming that the information is correct and saving it, you can run the program.

[0118] 1.3.6 Data Storage

[0119] 1) Depending on the instrument, set the threshold line to a fixed value before performing data analysis;

[0120] 2) After adjusting the threshold line, click "Save" to save the analyzed data.

[0121] 1.3.7 Data Analysis

[0122] relative expression level of target gene = 2 -ΔΔCT Wherein, ΔCT = ΔCT1 - ΔCT2, where ΔCT1 = the average CT value of the target gene in the test sample - the average CT value of GAPDH in the test sample, and ΔCT2 = the average CT value of the target gene in the reference sample - the average CT value of GAPDH in the reference sample.

[0123] Note: A CT value > 35.0000 indicates that the gene is not expressed. When the target gene of the reference sample is not amplified (i.e., no signal) or the CT value is > 35.0000, the CT value should be uniformly set to 35.0000 before calculating the relative expression level.

[0124] Example 3

[0125] This embodiment verifies the detection method provided in Embodiment 2.

[0126] 1. Verification of the implementation process

[0127] 1.1 Specificity

[0128] 1.1.1 Sample Preparation

[0129] No Template Control (NTC): Nuclease-free water;

[0130] Reference substance (RS): Reference cDNA;

[0131] Sample group (S): cDNA from liver function cells;

[0132] Positive Control (PC): HNF1A positive plasmid

[0133] 1.1.2 Test Method

[0134] The procedure was performed according to step 1.3 of Example 2, which describes the relative expression level of the HNF1A gene (qPCR method).

[0135] 1.1.3 Acceptance Criteria

[0136]

[0137]

[0138] 1.1.4 Specificity Verification Results

[0139]

[0140] "Undetermined" indicates that the experimental results did not reach the expected analyzable range, meaning there were no valid CT values.

[0141] 1.1.5 Conclusion

[0142] Specificity verification results show (e.g.) Figure 1-7 The validation results for the template-free control group (NTC), the test sample group (Sample), the reference standard (RS), and the HNF1A positive control group all met the acceptance criteria. The specificity validation results for this experiment all met the requirements, and the specificity experiment was passed.

[0143] 1.2 Intermediate Precision

[0144] The robustness of the method was examined through intermediate precision experiments (by different personnel and at different times). See below for details:

[0145] 1.2.1 Sample Preparation

[0146] Sample group (S): 2 batches of liver function cell cDNA;

[0147] 1.2.2 Different personnel

[0148] Two lab technicians performed the test sample detection using the same model of qPCR instrument, following the operating steps of step 1.3 of Example 2 regarding the relative expression level of the HNF1A gene (qPCR method).

[0149] When analyzing the results, the threshold line needs to be adjusted before data processing and analysis, and the RSD value between the HNF1A gene detection results of different experimenters in the same batch of samples needs to be calculated.

[0150] 1.2.3 Different Dates

[0151] The same analyst performed the tests on the samples using the same model of qPCR instrument, following the procedure in step 2.3, which describes the relative expression level of the HNF1A gene (qPCR method). Each batch of samples was tested once, and the tests were conducted over three days.

[0152] When analyzing the results, the threshold line needs to be adjusted before data processing and analysis, and the RSD values ​​between the gene detection results of the same batch of samples within 3 days need to be calculated.

[0153] 1.2.4 Acceptance Criteria

[0154] Different personnel: The RSD values ​​of gene detection results from the same batch of samples by two different laboratory technicians are ≤30%;

[0155] Different dates: The RSD value of each gene detection result in the same batch of samples is ≤30%.

[0156] 1.2.5 Precision Validation Results

[0157] 1.2.5.1 Verification results from different personnel

[0158]

[0159]

[0160] 1.2.5.2 Validation results at different times

[0161]

[0162] 1.2.6 Precision Validation Conclusion

[0163] For different personnel: the RSD values ​​of gene detection results for liver function cells / C012404005 were 14% to 25% for different personnel; the RSD values ​​of gene detection results for liver function cells / C012405006 were 3% to 19% for different personnel. The verification results for different personnel met the acceptance standard that the RSD values ​​of gene detection results for the same batch of samples by two experimenters are ≤30%.

[0164] For different dates: For liver function cells / C012404005, the RSD values ​​for each gene test result on different dates ranged from 12% to 28%; for liver function cells / C012405006, the RSD values ​​for each gene test result on different dates ranged from 6% to 24%. The test results from different dates met the acceptance standard of ≤30% RSD values ​​for each gene test result in the same batch of samples.

[0165] In summary, the gene test results of the two batches of test samples from different personnel and on different dates met the intermediate precision acceptance criteria, and the intermediate precision verification experiment was passed.

[0166] 1.3 Durability

[0167] 1.3.1 Sample Preparation

[0168] Sample group (S): 2 batches of liver function cell cDNA.

[0169] 1.3.2 Different Equipment

[0170] The same analyst performed the tests using two different qPCR instruments, ABI Stepone Plus and ABI 7500, following the procedure for HNF1A gene relative expression level (qPCR method) in step 1.3 of Example 2.

[0171] When analyzing the results, the threshold line needs to be adjusted before data processing and analysis, and the RSD value between the HNF1A gene detection results of the same batch of samples from different devices needs to be calculated.

[0172] 1.3.3 Different threshold lines

[0173] The same analyst performed the detection using an ABI Stepone Plus qPCR instrument, following the procedure for the relative expression level of the HNF1A gene (qPCR method) in step 1.3 of Example 2 (detection was performed in 3 parallel wells).

[0174] During the results analysis, the threshold lines were adjusted to "2.0" and "1.0" respectively before data processing was performed.

[0175] 1.3.4 Acceptance Criteria

[0176] Different devices: The RSD value of each gene detection result in the same batch of samples is ≤50%.

[0177] Different threshold lines: The detection results of each gene in the same batch of samples are ≥100.

[0178] 1.3.5 Durability Verification Results

[0179] 1.3.5.1 Different threshold lines

[0180]

[0181] 1.3.5.2 Different Equipment

[0182]

[0183] 1.3.6 Durability Verification Conclusion

[0184] 1.3.6.1 Different threshold lines

[0185] Liver function cells / C012404005 HNF1A gene detection results at different threshold lines >100;

[0186] Liver function cells / C012405006 HNF1A gene detection results at different threshold lines >100;

[0187] The detection results at different thresholds meet the acceptance criteria that the HNF1A gene detection result of the same batch of samples is ≥100.

[0188] 1.3.6.2 Different Equipment

[0189] The RSD values ​​of HNF1A gene detection results from different devices in liver function cells (C012404005) ranged from 2% to 21%.

[0190] The RSD values ​​of HNF1A gene detection results from different devices in liver function cells (C012405006) ranged from 9% to 22%.

[0191] The results from different devices met the acceptance criteria that the RSD value of the HNF1A gene detection results of the same batch of samples was ≤50%.

[0192] In summary, the results of gene detection on different threshold lines and different devices for the two batches of test samples met the robustness acceptance criteria, and the robustness test of this experiment was passed.

[0193] 1.4 Verification Conclusion

[0194] The method for detecting HNF1A gene expression level in liver function (qPCR) has been verified to have good specificity, sensitivity (different testers and test times), and robustness (different thresholds and different equipment).

Claims

1. A primer pair targeting the HNF1A gene for liver function, characterized in that, The primer pair includes a forward primer as shown in SEQ ID NO:1 and a reverse primer as shown in SEQ ID NO:

2.

2. A kit for detecting the expression level of the liver function gene HNF1A, characterized in that, The kit includes the primer pair as described in claim 1; Preferably, the kit further includes buffer, DNA polymerase, and dNTPs; More preferably, the kit also includes a fluorescent dye or probe; More preferably, the fluorescent dye is selected from TB Green, SYBR Green I, JOE, ROX, and TAMRA.

3. The kit according to claim 2, characterized in that, The kit also includes primer pairs for detecting the internal reference gene; Preferably, the internal reference gene is selected from GAPDH, β-actin, and ACTB; More preferably, the primer pair for the internal reference gene includes a forward primer as shown in SEQ ID NO:19 and a reverse primer as shown in SEQ ID NO:

20.

4. The use of the primer pair as described in claim 1 in the preparation of a kit for detecting the relative expression level of the liver function gene HNF1A.

5. A method for detecting the expression level of the liver function gene HNF1A, characterized in that, The method includes the step of contacting the primer pair as described in claim 1 or the kit as described in claim 2 or 3 with the nucleic acid sample to be tested to induce an amplification reaction.

6. The method as described in claim 5, characterized in that, The method described is not for diagnostic purposes.

7. The method as described in claim 5, characterized in that, The amplification reaction is qPCR; the qPCR reaction system includes TB Green premix, reference dye, nuclease-free water, primer mixture and the nucleic acid sample to be tested.

8. The method as described in claim 7, characterized in that, In the primer mixture, the concentrations of both the forward and reverse primers are 5–12 μmol / L, for example, 10 μmol / L; and / or The concentration of the nucleic acid sample to be tested in the reaction system is 0.001–0.008 μg / μL, for example, 0.004 μg / μL; Preferably, each 20 μL of the reaction system comprises: 0.2 μL of primer mixture, 10 μL of TB Green premix, 0.4 μL of ROX reference dye, 7.4 μL of nuclease-free water, and 2 μL of nucleic acid sample to be tested.

9. The method as described in claim 7 or 8, characterized in that, The qPCR reaction procedure is as follows: (1) Initial denaturation: 95℃, 10min; (2) Cyclic amplification: 95℃ for 15s, 60℃ for 1min, 40 cycles; (3) Melting curve: starting from 60℃, maintain this temperature for 5 seconds for every 0.3℃ increase until the temperature reaches 95℃.

10. The method according to any one of claims 5-9, characterized in that, The method further includes the step of extracting RNA from the sample to be tested and performing reverse transcription to obtain the nucleic acid sample to be tested.