KASP molecular marker related to potassium ion content of tobacco and application thereof

Abstract

The application discloses a KASP molecular marker related to potassium ion content of tobacco and application thereof, and belongs to the technical field of tobacco molecular breeding, wherein the KASP molecular marker is designed based on a SNP site which is significantly related to the potassium ion content of tobacco, the SNP site is located at chromosome 20 of a tobacco reference genome ZY300 at 40643207, and the polymorphism of the SNP site is C / T. The KASP molecular marker provided by the application can be used for molecular assisted selection of the potassium ion content of tobacco, and is helpful to realize precise and efficient selection of the potassium ion content of tobacco, and has important significance for improving the improvement efficiency of the potassium ion content of tobacco.

Description

Technical Field

[0001] This invention relates to the field of tobacco molecular breeding technology, specifically to a KASP molecular marker related to the potassium ion content of tobacco and its application. Background Technology

[0002] Potassium ions (K) + Potassium ions (KI) are essential mineral nutrients for tobacco growth, development, and quality formation. Their content significantly impacts the plant's adaptation to abiotic stresses. Furthermore, the KI content in cured tobacco leaves directly affects combustibility, ash state, and cigarette flavor. In tobacco production practice, increasing the KI content is considered a crucial approach to improving industrial usability and enhancing product quality.

[0003] Current methods for improving potassium ion content in tobacco mainly rely on field fertilization and conventional breeding selection. However, potassium ion content is a typical quantitative trait, significantly influenced by both genetic and environmental factors, and varies considerably under different ecological conditions and genetic backgrounds. Simply relying on phenotypic selection is not only inefficient but also has a long breeding cycle, making it difficult to meet the needs of precision breeding.

[0004] With the development of molecular breeding technology, existing studies have attempted to identify genetic loci associated with tobacco potassium ion content through quantitative trait locus analysis or association analysis. However, most current research remains at the level of locus localization or statistical association, lacking molecular markers that can be directly used in breeding practice and possess stable predictive capabilities. Furthermore, the applicability of some markers in different genetic backgrounds is limited, making large-scale application difficult. Therefore, this invention develops a molecular marker and its application method that can stably indicate tobacco potassium ion content levels and is suitable for molecular-assisted breeding, which is of great significance for improving the efficiency of tobacco potassium ion content improvement. Summary of the Invention

[0005] In view of the technical problems existing in the background art, the purpose of the present invention is to provide a molecular marker that is significantly related to the potassium ion content of tobacco and its application method, so as to achieve accurate and efficient selection of the potassium ion content trait of tobacco.

[0006] To achieve the above objectives, the present invention specifically adopts the following technical solution: In a first aspect, the present invention provides a single nucleotide polymorphism (SNP) site associated with potassium ion content in tobacco. This SNP site is located at chromosome 20, position 40643207 of the tobacco reference genome ZY300, and its polymorphism is C / T. Specifically, for tobacco materials, the potassium ion content phenotype carrying the "TT" allele is significantly higher than that carrying the "CC" allele.

[0007] Secondly, based on the SNP sites discovered by this invention, this invention provides the application of reagents for detecting SNP sites related to potassium ion content in tobacco breeding. That is, by detecting the genotype of the tobacco material to be tested at the SNP site, rapid screening of tobacco materials with high or low potassium ion content can be achieved, thereby significantly improving the selection efficiency of tobacco potassium ion content breeding, and thus shortening the breeding cycle and rapidly obtaining new tobacco varieties (lines).

[0008] Preferably, in the above applications, the reagents for detecting SNP sites associated with potassium ion content in tobacco include KASP molecular markers designed based on Kompetitive Allele-Specific PCR (KASP) technology. KASP is an economical, efficient, flexible, and accurate genotyping technique that is widely used in the field of plant and animal breeding (molecular marker-assisted selection).

[0009] More preferably, in the above applications, the KASP molecular marker includes two allele-specific forward primers and one universal reverse primer, as shown below: Primer_Allele X (SEQ ID NO.1): 5'-AAGCATAGCATCAGTTTTTGTCAAC-3'; Primer_Allele Y (SEQ ID NO.2): 5'-AAGCATAGCATCAGTTTTTGTCAAT-3'; Primer_Common 1 (SEQ ID NO. 3): 5'-GGTCACTCATCCAAACTAGAATTCA-3'.

[0010] It is understandable that in practical use, the two allele-specific forward primers, Primer_Allele X and Primer_Allele Y, are each linked to different fluorescent reporter groups. For example, in some embodiments of this invention, the fluorescent reporter groups used are FAM and HEX.

[0011] Thirdly, the present invention provides a detection kit containing a KASP molecular marker for detecting SNP sites associated with potassium ion content in tobacco.

[0012] Preferably, in the above-mentioned detection kit, the KASP molecular markers include Primer_Allele X with nucleotide sequence as shown in SEQ ID NO.1, Primer_Allele Y with nucleotide sequence as shown in SEQ ID NO.2, and Primer_Common 1 with nucleotide sequence as shown in SEQ ID NO.3.

[0013] Preferably, the above-mentioned detection kit also contains other reagents for PCR amplification, such as DNA extraction reagents and reaction buffers containing DNA polymerase, dNTPs, etc.

[0014] Fourthly, the present invention provides applications of the above-mentioned detection kit, including but not limited to the selection of tobacco materials with high potassium ion content and the identification of potassium ion content levels in tobacco materials.

[0015] Fifthly, the present invention provides a method for identifying the potassium ion content level of tobacco materials, comprising the following steps: detecting the genotype of the genome of the tobacco material to be tested at the SNP site provided by the present invention, wherein the potassium ion content phenotype of the tobacco material with the TT genotype is higher than that of the tobacco material with the CC genotype.

[0016] In a sixth aspect, the present invention provides a method for breeding new tobacco varieties or lines, comprising the following steps: using the detection kit provided by the present invention to screen tobacco materials for genotypes in the early stage of breeding, preferably materials with high potassium ion content carrying the "TT" allele, and using the screened materials for breeding new tobacco varieties or lines.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a SNP locus that is stably associated with potassium ion content in tobacco. This SNP locus has not been previously reported, and it can effectively distinguish potassium ion content traits in tobacco materials with different genetic backgrounds. Furthermore, the KASP molecular marker developed based on this SNP locus can be directly applied to molecular-assisted breeding, exhibiting good practicality and the following advantages: 1) It can rapidly and accurately predict the potassium ion content level of tobacco materials in the early stages of breeding; 2) It significantly improves the selection efficiency of tobacco potassium ion content breeding and shortens the breeding cycle; it is beneficial for achieving precise improvement of tobacco quality traits and has good application value. Attached Figure Description

[0018] To more clearly illustrate the technical solution of the present invention, the accompanying drawings used in the present invention will be briefly described below. Obviously, the drawings described below are merely some embodiments of the present invention, and those skilled in the art can obtain other drawings based on these drawings without any creative effort.

[0019] Figure 1 This is a genome-wide association study (GWAS) of potassium ion content in Example 1 of the present invention.

[0020] Figure 2 This is a linkage disequilibrium analysis of significantly associated intervals in Example 1 of this application.

[0021] Figure 3 This represents the phenotypic differences among different genotypes at the most significant SNP loci in Example 1 of this invention.

[0022] Figure 4 This is the KASP typing result of germplasm resources in Example 3 of the present invention.

[0023] Figure 5 The difference in potassium ion content is shown in the different subtypes of KASP markers in Example 4 of this invention. Detailed Implementation

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains; the terminology used herein is for the purpose of describing particular implementations only and is not intended to limit the invention; the terms “comprising” and “having”, and any variations thereof, in the specification and claims of this invention are intended to cover non-exclusive inclusion.

[0025] Potassium ion content is crucial for tobacco growth, development, and leaf quality. Current methods for improving tobacco potassium ion content primarily rely on field fertilization and conventional breeding selection. However, conventional breeding, based on phenotypic selection, struggles to accurately distinguish between high and low potassium ion content materials in the early stages, resulting in low breeding efficiency and long breeding cycles. Furthermore, the number of molecular markers related to tobacco potassium ion content disclosed in existing technologies is limited. While Chinese patent application CN104593497A and the dissertation from the Chinese Academy of Agricultural Sciences, "Generation-wide Association Analysis of Genetic Variation in Tobacco Potassium Content," provide SSR (Simple Sequence Repeat) molecular markers for rapid detection of high and low potassium content in tobacco, these markers suffer from low throughput and lack stability and applicability across different genetic backgrounds.

[0026] With the dramatic decrease in sequencing costs and the rapid development of bioinformatics, SNP markers have become the mainstream and future direction of molecular genetics and breeding research. However, current technologies lack SNP markers that can be directly used in breeding practice and have stable predictive capabilities. To address the technical problem of the lack of SNP markers related to potassium ion content in tobacco, this invention, through genome-wide association analysis, has identified an SNP locus significantly associated with potassium ion content in tobacco. This SNP locus is located at chromosome 20, position 40643207, of the tobacco reference genome ZY300, and its polymorphism is C / T, laying the foundation for the development of molecular markers.

[0027] In specific embodiments of the present invention, the above-mentioned SNP sites significantly correlated with the potassium ion content in tobacco are obtained through the following methods: 1) Constructing a multiparent advanced generation inter-cross (MAGIC) population of tobacco: Select multiple tobacco parental materials that have significant differences in potassium ion content and genetic background, and construct a MAGIC population through multiple rounds of hybridization and random recombination to obtain a genetic material population with high genetic diversity and high recombination frequency. 2) Potassium ion content phenotypic determination: After planting the MAGIC population obtained in step 1) under different environmental conditions, the potassium ion content of all individuals under different environmental conditions was determined by conventional chemical analysis methods, so as to obtain the potassium ion content phenotypic data of each individual in the population. 3) Genome-wide association analysis of potassium ion content-related loci: Combining genotype data from the MAGIC population, an association analysis was performed on the potassium ion content phenotype in tobacco and genome-wide molecular markers to locate genetic loci significantly associated with potassium ion content; 4) Screen for SNP sites that are significantly associated with potassium ion content within the genomic region where the target site obtained in step 3) is located.

[0028] Based on the SNP sites significantly associated with tobacco potassium ion content discovered in this invention, this embodiment of the invention further developed a KASP molecular marker, which comprises three primers: Primer_Allele X (nucleotide sequence as shown in SEQ ID NO.1), Primer_Allele Y (nucleotide sequence as shown in SEQ ID NO.2), and Primer_Common 1 (nucleotide sequence as shown in SEQ ID NO.3). This KASP molecular marker was applied to genotyping of tobacco germplasm resources, and further comparative analysis was performed in conjunction with the potassium ion content phenotype of the corresponding materials. The results show a correspondence between the molecular marker developed in this invention and the potassium ion content trait in tobacco.

[0029] The embodiments of the present invention provide the application of the above-mentioned SNP sites and their KASP molecular markers in molecular-assisted selection of potassium ion content in tobacco, including but not limited to the following treatments: genotypic screening of tobacco materials in the early stage of breeding, preferential selection of materials with high potassium ion content carrying favorable alleles, and use of the screened materials for the breeding of new tobacco varieties or lines.

[0030] The following are some specific embodiments. It should be noted that the embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, they shall be performed in accordance with the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all conventional products that can be obtained commercially.

[0031] Example 1 This example provides a SNP site that is significantly associated with potassium ion content, and its acquisition process is as follows: (1) Construct a MAGIC population of 8 parent tobacco plants.

[0032] Eight tobacco parental materials with significant differences in potassium ion content and genetic background (namely, Honghua Dajinyuan, Samsun, Florida 301, Beinhart 1000, VAM, BASMA, Tangpeng, and Xiaohuaqing) were selected. Through multiple rounds of hybridization and random recombination, a MAGIC population was constructed to obtain a genetic material population with high genetic diversity and high recombination frequency.

[0033] (2) Phenotypic determination of potassium ion content in tobacco.

[0034] The MAGIC population obtained in step (1) was planted under two environmental conditions, representative tobacco leaf samples were collected, and the potassium ion content of the tobacco leaves was measured to obtain the potassium ion content phenotypic data of each individual in the population.

[0035] (3) Genome-wide association analysis of potassium ion content-related sites.

[0036] Genome-wide association analysis (GWA) was conducted using high-density genotype data from the MAGIC population, combined with potassium ion content phenotypic information. MLM models were used to identify SNPs significantly associated with potassium ion content, and Bonferroni correction was employed to determine the significance threshold. Linkage disequilibrium decay analysis was used to identify candidate intervals, and stable loci with repeated testing under multiple environments and major-effect QTLs with high phenotypic variance explanation rates were screened to clarify the main genetic contributors to potassium ion content. Figure 1 As shown, genome-wide association analysis detected a QTL site on chromosome 20 that was significantly associated with potassium ion content.

[0037] Based on the most significant SNP and linkage disequilibrium analysis, the SNP on chromosome 20 most significantly correlated with the potassium ion content phenotype was linked. Using the LD decay distance, this SNP site was extended 5 Mb upstream and downstream, and the recombination rate between SNPs was calculated. A region with a low recombination rate and high linkage to the significant site (approximately 2 Mb) was selected as the candidate gene range for subsequent in-depth analysis. Figure 2 ).

[0038] Further phenotypic analysis of the peak SNPs (Table 1) revealed that the potassium ion content phenotype carrying the "TT" allele was significantly higher than that carrying the "CC" allele. The "TT" allele was the type that increased potassium ion content in the tobacco population. Figure 3 ).

[0039] Table 1 Location information of the highest point SNP

[0040] Example 2 This example uses KASP technology to design allele-specific primers for the SNP sites obtained in Example 1 and constructs a KASP genotyping system. The nucleotide sequences of each primer are shown below: Primer_Allele X (SEQ ID NO.1): 5'-AAGCATAGCATCAGTTTTTGTCAAC-3'; Primer_Allele Y (SEQ ID NO.2): 5'-AAGCATAGCATCAGTTTTTGTCAAT-3'; Primer_Common 1 (SEQ ID NO. 3): 5'-GGTCACTCATCCAAACTAGAATTCA-3'.

[0041] Furthermore, a tail sequence GAAGGTGACCAAGTTCATGCT (SEQ ID NO.4) corresponding to the FAM fluorescence detection system can be introduced at the 5' end of Primer_Allele X, and a tail sequence GAAGGTCGGAGTCAACGGATT (SEQ ID NO.5) corresponding to the HEX fluorescence detection system can be introduced at the 5' end of Primer_Allele Y.

[0042] Example 3 Based on the KASP genotyping system provided in Example 2, this example performed genotyping analysis on 100 independent tobacco germplasm resources (i.e., external materials unrelated to the population used in the examples). The specific experimental process and conclusions are as follows: (1) DNA extraction from the test material.

[0043] Young leaves from 100 tobacco germplasm resources were selected, and genomic DNA was extracted using the conventional CTAB method. DNA integrity was assessed by 1% agarose gel electrophoresis, and DNA concentration and purity were determined using a spectrophotometer. The DNA from each sample was diluted to a working concentration for later use.

[0044] (2) KASP reaction system configuration.

[0045] Using genomic DNA as templates, amplification was performed using the KASP primers described in Example 2. The reaction system included 2× KASP Master Mix, primer mixture, and genomic DNA template. Primer_Allele X had a tail sequence corresponding to the FAM fluorescence detection system at its 5' end, and Primer_Allele Y had a tail sequence corresponding to the HEX fluorescence detection system at its 5' end; Primer_Common 1 was a universal primer. Each sample had an independent reaction well, and a template-free control (NTC) was included to monitor for reagent contamination and non-specific amplification.

[0046] (3) PCR system and amplification procedure.

[0047] PCR 10 μL system: 2×Master Mix 5.0 μL, Assay Mix 0.14 μL, DNA template 20-50 ng, the remainder supplemented with ddH2O; the amplification program is as follows: 94℃ for 20 s, 62℃ for 60 s, the temperature is decreased by 0.5℃ per cycle for the first 10 cycles, down to 57℃; then 94℃ for 20 s, 57℃ for 60 s, for 30 cycles.

[0048] (4) Fluorescence signal reading and genotyping.

[0049] After PCR amplification, endpoint fluorescence signal scanning was performed using a quantitative real-time PCR instrument or a genotyping device that supports endpoint fluorescence reading. Scatter cluster analysis was then performed based on the fluorescence signal intensities of the FAM and HEX channels. When a sample is found to have a strong fluorescence signal only in the FAM channel, it is determined to be a CC homozygous genotype. When a sample is found to have a strong fluorescence signal only in the HEX channel, it is determined to be a homozygous TT genotype. When both FAM and HEX fluorescence signals are detected in a sample, it is determined to be a heterozygous genotype. Samples with no obvious fluorescence signal or abnormal clustering positions are deemed invalid typing.

[0050] (5) Test results.

[0051] Test results as follows Figure 4 As shown, different samples formed clearly separated clusters in the fluorescence signal space. Genotyping was performed based on the endpoint fluorescence signals of the FAM and HEX channels: samples with only FAM fluorescence signals were identified as CC homozygous genotypes; samples with only HEX fluorescence signals were identified as TT homozygous genotypes. In addition, a small number of samples were distributed between the two clusters, exhibiting heterozygous genotypes. The clusters among the genotypes were tight and clearly defined, with low background signal, indicating that this KASP molecular marker has good genotyping stability and discriminative ability, and can be used for rapid genotyping of tobacco germplasm resources.

[0052] Example 4 Using the tobacco materials that underwent KASP genotyping in Example 3 as the test subjects, the potassium ion content of the corresponding samples was determined, and the phenotypic differences between different genotypes were analyzed to verify the correlation between the KASP molecular markers provided by this invention and the potassium ion content trait in tobacco.

[0053] (1) Test materials.

[0054] The tobacco materials for which KASP genotyping had been completed in Example 3 were used as experimental materials. Based on the genotyping results of Example 3, each material was divided into different genotype groups.

[0055] (2) Determination of potassium ion content.

[0056] Samples of the middle tobacco leaves of each material after topping were collected, dried and pulverized, and the potassium ion content was determined by flame photometry to obtain the corresponding potassium ion content phenotypic data for each material.

[0057] (3) Statistical analysis.

[0058] Based on the KASP typing results of Example 3, the average potassium ion content and variation of each genotype group were statistically analyzed, and statistical methods were used to analyze the significance of differences in potassium ion content among different genotype groups.

[0059] (4) Results analysis.

[0060] Test results as follows Figure 5 As shown, there were significant differences in potassium ion content levels among different genotypes, with materials carrying favorable alleles exhibiting significantly higher potassium ion content than those carrying unfavorable alleles (t-test, P < 0.01). These results indicate that this molecular marker can not only achieve stable and accurate genotyping but also effectively indicate the potassium ion content trait in tobacco, and can be directly used for molecular-assisted selection of potassium ion content.

[0061] In summary, the core of this invention lies in providing a previously unreported SNP site that is stably associated with potassium ion content in tobacco, and designing an allele-specific KASP molecular marker based on this SNP site. The resulting KASP molecular marker can be used for molecular-assisted selection of potassium ion content in tobacco, achieving precise and efficient selection of the potassium ion content trait in tobacco and improving the efficiency of potassium ion content improvement in tobacco.

[0062] It should be noted that the present invention is not limited to the above-described embodiments. The above embodiments are merely examples, and any embodiments that have the same structure and perform the same effects as the technical concept within the scope of the present invention are included within the scope of the present invention. Furthermore, various modifications that can be conceived by those skilled in the art to the embodiments, and other ways of constructing by combining some of the constituent elements of the embodiments, without departing from the spirit of the present invention, are also included within the scope of the present invention.

Claims

1. The application of a reagent for detecting SNP sites related to potassium ion content in tobacco in tobacco breeding, characterized in that, The SNP locus is located at chromosome 20, position 40643207, of the tobacco reference genome ZY300, and its polymorphism is C / T; the tobacco breeding involves selecting tobacco materials with high potassium ion content, wherein the potassium ion content phenotype of the TT genotype is higher than that of the CC genotype.

2. The application according to claim 1, characterized in that, The reagents include KASP primers designed based on the SNP sites.

3. The application according to claim 2, characterized in that, The KASP primers include the following: The nucleotide sequences are Primer_Allele X as shown in SEQ ID NO.1, Primer_Allele Y as shown in SEQ ID NO.2, and Primer_Common 1 as shown in SEQ ID NO.

3.

4. The application according to claim 3, characterized in that, The primers Primer_Allele X and Primer_Allele Y are linked to different fluorescent reporter groups.

5. A test kit, characterized in that, The reagent contains a reagent for detecting a SNP site associated with potassium ion content in tobacco, the SNP site being located at chromosome 20, position 40643207 of the tobacco reference genome ZY300 and having a C / T polymorphism, and the reagent contains primers with nucleotide sequences as shown in SEQ ID NO. 1-3.

6. The detection kit according to claim 5, characterized in that, It also contains other reagents used for PCR amplification.

7. The application of the detection kit as described in claim 5 in the selection of tobacco materials with high potassium ion content or in the identification of potassium ion content levels in tobacco materials, wherein the potassium ion content phenotype of the TT genotype is higher than that of the CC genotype.

8. A method for identifying the potassium ion content level of tobacco materials, characterized in that, Includes the following steps: The genotype of the tobacco material to be tested at the SNP site described in claim 1 was detected, wherein the potassium ion content phenotype of the TT genotype was higher than that of the CC genotype.

9. A method for breeding new tobacco varieties or lines, characterized in that, Includes the following steps: Using the detection kit described in claim 5, genotypic screening of tobacco materials is carried out in the early stage of breeding, materials with high potassium ion content carrying the TT allele are selected, and the selected materials are used for the breeding of new tobacco varieties or lines.

Images