A genetically engineered bacteria with a deleted acetyltransferase gene asp12 and a construction method and application thereof

Abstract

This invention discloses a genetically engineered bacterium lacking the acetyltransferase gene asp12, its construction method, and its applications. This invention utilizes CRISPR / Cas9 to knock out the asp12 gene encoding acetyltransferase in Aspergillus terreus strain GZU-31-1, constructing the genetically engineered bacterium Δasp12. This invention found that compared to the wild-type Aspergillus terreus strain GZU-31-1, the genetically engineered bacterium Δasp12 exhibits increased accumulation and significantly higher yield of the compound Aspermeroterpene F, which possesses anti-inflammatory and anti-hepatic fibrosis activities. Based on the genetically engineered bacterium Δasp12, this invention also provides a method for preparing the compound Aspermeroterpene F, further improving the yield of the compound by optimizing the fermentation culture medium. This invention is beneficial for the development of anti-inflammatory and anti-hepatic fibrosis drugs.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering, fermentation engineering, and biopharmaceutical manufacturing technology. More specifically, it relates to a genetically engineered bacterium lacking the acetyltransferase gene asp12, its construction method, and its applications. Background Technology

[0002] Hepatic fibrosis (HF) is a pathological change caused by chronic liver damage resulting from pathogenic factors such as viruses and harmful chemicals. It manifests as abnormal and excessive deposition of extracellular matrix in the liver, abnormal proliferation of connective tissue, and impaired hepatocyte function. HF is a core pathological process in the progression of various chronic liver diseases and a common pathway for almost all chronic liver diseases to progress to cirrhosis and liver cancer. While its early stages are reversible, there is currently a lack of effective clinical drugs to treat HF. Therefore, there is an urgent need to continuously explore compounds with anti-liver fibrosis effects to facilitate the development of clinical drugs.

[0003] Numerous compounds with anti-hepatic fibrosis activity have been reported, providing resources for the development of anti-hepatic fibrosis drugs. However, compounds derived from microorganisms face challenges such as low yields. For example, compound Aspermeroterpene F is derived from Aspergillus terreus (…). Aspergillus terreus A mixed-origin terpene compound isolated from the culture of strain GZU-31-1 not only exhibited superior anti-inflammatory activity compared to the positive control indomethacin (https: / / doi.org / 10.1016 / j.bioorg.2021.105111), but also significantly inhibited the proliferation of extracellular matrix proteins, demonstrating anti-hepatic fibrosis activity. It could be developed into a novel anti-inflammatory and / or anti-hepatic fibrosis drug (https: / / doi.org / 10.1002 / cbdv.202500123). However, the low yield of compound Aspermeroterpene F in wild-type strains greatly limits its development and application, necessitating methods to increase its yield.

[0004] In recent years, the rapid development of synthetic biology technologies has provided new ideas and methods for modifying the metabolic pathways of complex natural products. Based on elucidating biosynthetic pathways in microorganisms and identifying microbial biosynthetic gene clusters for natural products, synthetic biology techniques can be used to perform molecular genetic operations such as in vivo knockout, substitution, or recombination of key genes in the discovered biosynthetic processes. This not only enables the production of more structural analogs of novel natural products but also increases the yield of metabolic intermediates of natural products or the targeted accumulation of required active molecules, providing more physical molecules and energy reserves for the discovery of natural products and drug development. However, the biosynthetic process of Aspermeroterpene F remains unclear. Summary of the Invention

[0005] To address the shortcomings of the prior art, this invention provides a genetically engineered bacterium lacking the acetyltransferase gene asp12, its construction method, and its applications.

[0006] The first objective of this invention is to provide a genetically engineered bacterium lacking the acetyltransferase gene asp12.

[0007] A second objective of this invention is to provide a method for constructing the genetically engineered bacteria.

[0008] A third object of the present invention is to provide a composition containing the genetically engineered bacteria.

[0009] A fourth object of the present invention is to provide the use of the genetically engineered bacteria or the composition in the production of the compound Aspermeroterpene F.

[0010] A fifth object of the present invention is to provide the use of the genetically engineered bacteria or the composition in the preparation of products for the production of the compound Aspermeroterpene F.

[0011] A sixth object of the present invention is to provide a method for preparing the compound Aspermeroterpene F using the genetically engineered bacteria or the composition.

[0012] The above-mentioned objective of this invention is achieved through the following technical solution: This invention utilizes CRISPR / Cas9 to knock out the asp12 gene encoding acetyltransferase in Aspergillus terreus strain GZU-31-1, constructing a genetically engineered bacterium Δasp12. This invention found that, compared to the wild-type Aspergillus terreus strain GZU-31-1, the genetically engineered bacterium Δasp12 exhibits increased accumulation and significantly higher yield of the compound Aspermeroterpene F, which possesses anti-inflammatory and anti-liver fibrosis activities. Therefore, this invention seeks protection for the genetically engineered bacterium, its construction method, and its applications.

[0013] This invention provides a genetically engineered bacterium lacking the acetyltransferase gene asp12, which is obtained by completely or functionally knocking out the acetyltransferase gene asp12 in Aspergillus terreus; the amino acid sequence of the acetyltransferase Asp12 encoded by the acetyltransferase gene asp12 is shown in SEQ ID NO.2.

[0014] In a specific embodiment of the present invention, the nucleotide sequence of the acetyltransferase gene asp12 is shown in SEQ ID NO.1.

[0015] In a specific embodiment of the present invention, the Aspergillus terreus is strain GZU-31-1.

[0016] The present invention also provides a method for constructing the genetically engineered bacteria, the method comprising: constructing a recombinant knockout vector of the acetyltransferase gene asp12, and using homologous recombination to completely knock out the acetyltransferase gene asp12; or using a CRISPR gene editing system to insert, delete or transform bases in the coding region of the acetyltransferase gene asp12, thereby inactivating the gene and achieving functional knockout.

[0017] Optionally, the CRISPR gene editing system is a CRISPR / Cas9 gene editing system.

[0018] In a specific embodiment of the present invention, by constructing a CRISPR-Cas9 gene inactivation plasmid of the acetyltransferase gene asp12 and transforming it into the protoplast of Aspergillus terreus strain GZU-31-1, an inactivated mutant strain of the acetyltransferase gene asp12 was obtained, namely the genetically engineered bacteria lacking the acetyltransferase gene asp12.

[0019] Specifically, the nucleotide sequences of the primers used to construct the CRISPR-Cas9 gene inactivation plasmid for the acetyltransferase gene asp12 are shown in SEQ ID NO. 3-6.

[0020] Specifically, the nucleotide sequences of the PCR primers used to detect the genotype of the asp12 gene inactivation mutant are shown in SEQ ID NO. 7–10.

[0021] The present invention also provides a composition containing the genetically engineered bacteria.

[0022] Optionally, it may also contain excipients acceptable to the genetically engineered bacteria.

[0023] Specifically, the genetically engineered bacteria are live bacteria.

[0024] This invention seeks protection for the use of the genetically engineered bacteria lacking the acetyltransferase gene asp12 or the composition thereof in the production of the compound Aspermeroterpene F.

[0025] The present invention also claims protection for the use of the genetically engineered bacteria lacking the acetyltransferase gene asp12 or the composition thereof in the preparation of a product for the production of the compound Aspermeroterpene F.

[0026] Specifically, the structural formula of the compound Aspermeroterpene F is shown in formula (I): Formula (I).

[0027] Optionally, the product used to produce the compound Aspermeroterpene F is a bacterial agent containing the genetically engineered bacteria.

[0028] Optionally, the formulation of the microbial agent is a powder or a suspension.

[0029] The present invention also provides a method for preparing the compound Aspermeroterpene F using the genetically engineered bacteria or the composition, comprising the following steps: S1. Inoculate the genetically engineered bacteria or the composition into a culture medium, and ferment the genetically engineered bacteria to obtain a fermentation culture; S2. The fermentation culture obtained in S1 was extracted using an organic solvent to obtain the compound Aspermeroterpene F; The structural formula of the compound Aspermeroterpene F is shown in formula (I): Formula (I).

[0030] Optionally, the culture medium described in S1 is PDB liquid culture medium, YG liquid culture medium, or rice culture medium.

[0031] Preferably, the culture medium in S1 is a rice culture medium.

[0032] Specifically, the rice culture medium is formulated as follows: 0.8–1.2 g of rice and 0.003–0.03 g of sea salt are added to every 1 mL of water.

[0033] Preferably, the rice culture medium is formulated as follows: 1 g of rice and 0.003 g of sea salt per 1 mL of water.

[0034] Optionally, the organic solvent used for extraction of the obtained fermentation culture is methanol and / or ethyl acetate.

[0035] In a specific embodiment of the present invention, the method for preparing the compound Aspermeroterpene F using the genetically engineered bacteria includes the following steps: S1. The genetically engineered bacteria are inoculated into rice culture medium and fermented to obtain a fermentation culture. S2. Extract the obtained fermentation culture with methanol 2-3 times, combine the extracts, concentrate under reduced pressure to remove methanol, and extract the remaining aqueous solution with ethyl acetate 2-4 times. Combine the extracts and concentrate to obtain crude extract. S3. The crude extract was subjected to silica gel column chromatography with a 200-300 mesh, using petroleum ether / ethyl acetate as the eluent for gradient elution, with a volume ratio from 9:1 to 0:100. The fraction eluted by the petroleum ether / ethyl acetate gradient with a volume ratio of 6:4 was collected and recorded as fraction 4. S4. Fraction 4 was subjected to ODS C18 reversed-phase column chromatography with methanol / water as the eluent for gradient elution from 40:60 to 100:0 (volume ratio). The fraction eluted with methanol / water at a volume ratio of 60:40 was collected and designated as fraction 4-3. S5. Fraction 4-3 was separated by semi-preparative high-performance liquid chromatography using a SHIMSEN Amkylo C18 column, eluted with methanol / water at a volume ratio of 65:35, at a flow rate of 10.0 mL / min, and the fraction with a retention time of 33.6 min was collected and concentrated to obtain the compound Aspermeroterpene F.

[0036] The present invention has the following beneficial effects: This invention utilizes CRISPR / Cas9 to knock out the asp12 gene encoding acetyltransferase in Aspergillus terreus strain GZU-31-1, constructing a genetically engineered bacterium Δasp12 encoding acetyltransferase with inactivated asp12 gene. This invention found that compared to the wild-type Aspergillus terreus strain GZU-31-1, the accumulation of the compound Aspermeroterpene F, which possesses anti-inflammatory and anti-liver fibrosis activities, was significantly increased in the genetically engineered bacterium Δasp12, with a significantly higher yield. Based on the genetically engineered bacterium Δasp12, this invention also provides a method for preparing the compound Aspermeroterpene F, further improving the yield of the compound by optimizing the fermentation culture medium. This invention is beneficial for the development of anti-inflammatory and anti-liver fibrosis drugs and has important significance for the treatment of liver fibrosis. Attached Figure Description

[0037] Figure 1 The results show the detection of fermentation products of wild-type Aspergillus terreus GZU-31-1 and genetically engineered strains that have deleted the genes asp6, asp14, asp10 and asp12, respectively.

[0038] Figure 2 The figures show HPLC-UV chromatograms of extracts obtained from fermentation culture of wild-type Aspergillus terreus GZU-31-1 and genetically engineered strain Δasp12 using different culture media, as well as the yield calculation results of compound Aspermeroterpene F. Figure A is the HPLC-UV chromatogram; Figure B is the standard curve of compound Aspermeroterpene F; and Figure C is the yield calculation result of compound Aspermeroterpene F.

[0039] Figure 3 For compound 13 1 ¹H NMR (700 MHz) spectrum, solvent: deuterated chloroform.

[0040] Figure 4 For compound 13 13 C10 NMR (175 MHz) spectrum, solvent: deuterated chloroform. Detailed Implementation

[0041] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0042] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0043] Aspergillus terrestris used in the embodiments of the present invention ( Aspergillus terreus The strain GZU-31-1 has been disclosed in the patent application number 2020100322621. This strain was deposited at the Guangdong Provincial Microbial Culture Collection Center on December 17, 2019, with the accession number GDMCC NO: 60789. The deposit address is 5th Floor, Experimental Building, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province.

[0044] The nucleotide sequence of the acetyltransferase gene asp12 is shown in SEQ ID NO.1, and the amino acid sequence of the acetyltransferase it encodes is shown in SEQ ID NO.2.

[0045] Example 1: Construction of the genetically engineered bacterium Δasp12 lacking the acetyltransferase gene asp12 This invention utilizes CRISPR / Cas9 technology to inactivate the acetyltransferase gene asp12 in Aspergillus terrestris strain GZU-31-1, obtaining... A. terreus The GZU-31-1 / Δasp12 mutant strain is the genetically engineered bacterium Δasp12 that lacks the acetyltransferase gene asp12.

[0046] The construction process of the genetically engineered bacterium Δasp12 is as follows: 1. Primer design For the acetyltransferase gene asp12 of Aspergillus terrestris strain GZU-31-1, this invention, after selecting the sgRNA (20bp) sequence, designed and synthesized primers (Cas9-ligase-F / R and Cas9-asp12-R1 / F2) for constructing its CRISPR-Cas9 gene inactivation plasmid, and PCR primers (ID-asp12-F1 / F2 / R1 / R2) for detecting the genotype of gene asp12 inactivation mutant strains.

[0047] The nucleotide sequence (5'→3') of the primer is shown below: Cas9-ligase-F: TCAGGGCGATGGCCCACTACGCGTAAGCTCCCTAATTGGCC (SEQ ID NO.3); Cas9-ligase-R: TGATTAGGGGTGATGGTTCACGAGCCAAGAGCGGATTCCTCAG (SEQ ID NO. 4); Cas9-asp12-R1: GACGAGCTTACTCGTTTCGTCCTCACGGACTCATCAGCACCATCGGTGATGTCTGCTCA (SEQ IDNO.5); Cas9-asp12-F2: AACGAGTAAGCTCGTCCACCATCTTATGGATGCAACGTTTTAGAGCTAGAAATAGCAAG (SEQ ID NO. 6).

[0048] ID-asp12-F1: CCACTTGTTGAATTGCCGCC (SEQ ID NO.7); ID-asp12-F2: ACGGCATTTTCCTAAAAGCATGG (SEQ ID NO.8); ID-asp12-R1: GGTCATGATCACAGTAGCGTCATG (SEQ ID NO.9); ID-asp12-R2:GCTGACAAATGGCGTTTTCTCCG (SEQ ID NO. 10).

[0049] 2. Construction of CRISPR-Cas9 gene inactivation plasmid Using plasmid p76-pFC332-hph as a template, PCR amplification was performed using primer pairs Cas9-ligase-F / Cas9-asp12-R1 and Cas9-asp12-F2 / Cas9-ligase-R, respectively. The PCR amplification products were named fragment 1 and fragment 2, respectively, and were purified and recovered for later use.

[0050] The PCR amplification reaction system (50 μL) consisted of: 3 U high-fidelity DNA polymerase, 5 μL 10×Buffer, 0.5 mmol / L dNTPs, 2.5 μL dimethyl sulfoxide (DMSO), 0.5 μmol / L primers, approximately 1 ng DNA template, and water to a final volume of 50 μL. The PCR amplification conditions were: pre-denaturation at 94℃ for 5 min; amplification cycles of 94℃ denaturation for 45 s, 60℃ annealing for 45 s, and 72℃ extension for 90 s, for 30 cycles; and a final extension at 72℃ for 10 min.

[0051] use BsaA I. The plasmid pBSKⅡ-Cas9-Hyg was digested with a single enzyme to obtain the linearized plasmid pBSKⅡ-Cas9-Hyg. Using the ClonExpress Ultra One Step Cloning Kit (Novizan), fragment 1, fragment 2, and the linearized plasmid were ligated and assembled in one step using a multi-fragment one-step cloning method. The recombinant product was then transformed into... E.coil DH5α commercial competent cells were plated on LB selection plates (containing 100 μg / mL ampicillin) and cultured overnight at 37°C. Positive single clones were picked from the plates, and recombinant plasmids were extracted. The resulting recombinant plasmid was named pCas9-asp12-Hyg, which will be used as the CRISPR-Cas9 gene inactivation plasmid for subsequent inactivation of the asp12 gene.

[0052] 3. Preparation of Aspergillus terreus GZU-31-1 protoplasts Aspergillus terrestris strain GZU-31-1 was inoculated onto potato dextrose agar (PDA) medium and incubated statically at 28°C for 7 days. 2 mL of 0.01% Tween 80 Buffer was added to a petri dish, and a suitable amount of spores was scraped from a disposable throat swab and suspended in 20 mL of PDB medium. The mycelium was filtered through a 0.45 μm filter membrane, and the filtrate was collected into a new 125 mL Erlenmeyer flask and incubated at 200 rpm and 28°C for 12 h on a shaker until spore germination. After confirming spore germination by microscopic examination, the spores were collected in a 50 mL centrifuge tube and centrifuged at 4000 rpm for 10 min, discarding the supernatant. The precipitate was resuspended in 10 mL of Osmatic Buffer, centrifuged at 4000 rpm for 10 min, and the supernatant was discarded to wash the germinating spores. 10 mL of Osmatic Buffer (containing 2 g Extralyse Enzyme and 30 mg Yatalase) containing digestive enzymes was prepared beforehand. Resuspend the precipitate with STC Buffer (STC Buffer), transfer the mixture to a new 125 mL Erlenmeyer flask, and digest overnight at 80 rpm and 28°C on a shaker. Collect the digested bacterial solution into a 50 mL centrifuge tube, and carefully add twice the volume (approximately 20 mL) of Trapping Buffer along the tube wall to form two distinct layers. Centrifuge at 3900 rpm for 25 min at 4°C. After centrifugation, protoplasts will be observed floating between the two layers as white flocculent particles. Carefully aspirate approximately 2 mL of the floating protoplasts using a cut disposable sterile dropper, add an equal volume of STC Buffer, mix carefully, and centrifuge at 3900 rpm for another 25 min at 4°C, discarding the supernatant. Add 1 mL of STC Buffer to the precipitate and gently agitate to suspend the protoplasts evenly in the solution. Finally, aliquot the protoplasts into 75 μL aliquots in 1.5 mL centrifuge tubes placed on ice for later use in transfection.

[0053] 4. Transfect Aspergillus terrestris GZU-31-1 protoplasts with the gene-inactivating plasmid pCas9-asp12-Hyg. Add approximately 3 μg of the constructed recombinant plasmid pCas9-asp12-Hyg to a centrifuge tube containing 75 μL of Aspergillus terrestris GZU-31-1 protoplasts, gently mix, then add 25 μL of PEG solution and mix well. Incubate on ice for 1 hour. After incubation, add 1 mL of PEG solution and mix thoroughly by pipetting. Incubate at room temperature for 30 min. Spread the incubated suspension evenly onto a CDS selection plate containing 400 μg / mL hygromycin and incubate upside down at 28°C for 3–7 days until single colonies grow. After small colonies grow on the transfection plate, transfer them to a CDS plate containing 400 μg / mL hygromycin using a sterile toothpick. Incubate at 28°C for 7 days and extract genomic DNA from single colonies. Using PCR primers for detecting the genotype of the asp12 inactivated mutant strain, obtain positive clones by PCR detection (the amplified bands show a significant change in size compared to the wild type), thus obtaining the genetically engineered bacterium Δasp12 lacking the acetyltransferase gene asp12.

[0054] Example 2: Fermentation culture of genetically engineered bacterium Δasp12 and detection of its products In addition to constructing the genetically engineered bacterium Δasp12, which lacks the acetyltransferase gene asp12, this invention also constructed, with reference to the method described in Example 1, genetically engineered bacteria Δasp6, Δasp14, Δasp14, and Δasp10, which lack the monooxygenase gene asp10. This invention fermented Aspergillus terreus GZU-31-1 wild-type and the four genetically engineered bacteria respectively, and analyzed their fermentation products.

[0055] 1. Fermentation culture of wild-type and genetically engineered Aspergillus terreus GZU-31-1 Wild-type Aspergillus terrestris GZU-31-1 and the four genetically engineered strains were activated separately and inoculated into rice culture medium (50 g rice, 1.5 g sea salt, 50 mL water) at a 1% (v / v) inoculation rate. After culturing at 28°C for 28 days, 500 mL of methanol was added, and the mixture was extracted by sonication for 30 min. The extract was evaporated to dryness using a rotary evaporator, and the residue was dissolved in DMSO to form the test sample. The sample was then detected using a low-resolution liquid chromatography-mass spectrometry (LC-LRMS) system.

[0056] 2. Detection of fermentation products The testing conditions are: Phenomenex ®Luna, 5 μm, 4.6 × 250 mm, C-18 reversed-phase column; mobile phase A was ultrapure water containing 0.1% formic acid, and mobile phase B was analytical acetonitrile containing 0.1% formic acid; flow rate was 1 mL / min; elution program: 0→40 min, 5%~67% B phase; 40→21 min, 67%~95% B phase; 41→45 min, 95% B phase; 45→46 min, 95%~5% B phase; 46→50 min, 5% B phase.

[0057] The detection results of fermentation products of wild-type Aspergillus terreus GZU-31-1 and genetically engineered strains that respectively deleted the asp6, asp14, asp10 and asp12 genes are as follows: Figure 1 As shown in the figure, compound 13 is the compound Aspermeroterpene F. (The remaining text appears to be incomplete and requires further context.) Figure 1 It was found that, except for the genetically engineered bacterium Δasp12, the compound Aspermeroterpene F was not detected in the fermentation products of wild-type Aspergillus terreus GZU-31-1 and other genetically engineered bacteria. These results indicate that the present invention has constructed a genetically engineered bacterium capable of producing the compound Aspermeroterpene F.

[0058] Example 3: Optimization of the fermentation medium used for the genetically engineered bacterium Δasp12 1. Preparation of culture medium To enable the genetically engineered bacterium Δasp12 to produce a higher yield of the compound Aspermeroterpene F, this invention optimized the rice fermentation medium used for the genetically engineered bacterium Δasp12 and screened some other culture media.

[0059] The culture medium formula used is shown below: PDB liquid culture medium: 12 g of commercial potato glucose water culture medium powder, add water to make up to 1 L and then sterilize for later use.

[0060] YG liquid culture medium: 5 g yeast extract, 20 g glucose, trace elements (weighed as follows: 2.20 g ZnSO4·7H2O, 1.10 g H3BO3, 0.50 g MnCl2·4H2O, 0.16 g FeSO4·7H2O, 0.16 g CoCl2·5H2O, 0.16 g CuSO4·5H2O, 0.11 g (NH4)6Mo7O) 24 4H2O, 5.00 g Na4EDTA (dissolved in sterile, enzyme-free water and brought to a final volume of 1 L) 40 μL, then diluted with water to a final volume of 1 L and sterilized for later use.

[0061] GYT liquid culture medium: 5 g yeast extract, 10 g glucose, 2 g peptone, 2 g sea salt, add water to make up to 1 L and sterilize for later use.

[0062] Rice culture medium: 180 g rice, 0.54 g sea salt, add water to make up to 180 mL and sterilize before use.

[0063] 2. Fermentation culture The genetically engineered bacteria Δasp12, activated on a plate, were inoculated into PDB liquid medium and cultured at 28°C and 200 rpm for 2 days to obtain seed culture. 2.5 mL of seed culture was inoculated into 500 mL hexagonal flasks containing 250 mL of PDB liquid medium, YG liquid medium, and GYT liquid medium (3 replicates for each type) and cultured statically for 10 days. Another 2.5 mL of seed culture was inoculated into 500 mL hexagonal flasks containing 250 g of rice medium (3 replicates) and cultured statically for 25 days.

[0064] 3. Isolation and extraction of fermentation cultures For the fermentation cultures of each liquid culture medium, the fermentation cultures were centrifuged at 4000 rpm for 10 min to obtain fermentation supernatant and mycelium, respectively. The mycelium was freeze-dried and weighed. The fermentation supernatant was extracted three times with an equal volume of ethyl acetate. The ethyl acetate layer was concentrated by distillation to obtain the supernatant extract. The weighed mycelium was freeze-dried and ground into powder. 0.5 g of dry powder was extracted three times with 15 mL of methanol at room temperature. The extracts were combined, methanol was recovered under reduced pressure, and water was evaporated to obtain the weighed mycelium extract. For the fermentation cultures of rice culture medium, the cultures were freeze-dried and weighed. Then, 0.5 g of rice culture powder was weighed and extracted three times with 15 mL of methanol at room temperature. The extracts were combined, methanol was recovered under reduced pressure, and water was evaporated to obtain the weighed rice culture medium extract.

[0065] 4. Plotting the standard curve and calculating the yield of compound Aspermeroterpene F (1) Plotting the standard curve of compound Aspermeroterpene F: Accurately weigh 3.2 mg of Aspermeroterpene F standard and dissolve it thoroughly in 1 mL of DMSO. Take 5 μL, 10 μL, 12.5 μL, 15 μL, 20 μL and 25 μL of the 3.2 mg / mL Aspermeroterpene F stock solution, respectively, and dilute with methanol to a total volume of 200 μL. Take 20 μL for HPLC-UV injection analysis, calculate the peak area of ​​the standard at a wavelength of 280 nm and plot a standard curve for subsequent content determination.

[0066] (2) Calculation of the yield of compound Aspermeroterpene F Take the obtained supernatant extract, first add 200 μL DMSO to initially dissolve the sample, then add methanol to make up to 12 mL. After centrifugation, take 20 μL of supernatant for HPLC-UV analysis. After comparison with the standard, calculate the peak area of ​​compound Aspermeroterpene F at a UV wavelength of 280 nm. Calculate the content of compound Aspermeroterpene F in the bacterial culture according to the standard curve. For mycelial extract, first add 200 μL DMSO to initially dissolve the sample, then add methanol to make up to 5 mL. After centrifugation, take 20 μL of supernatant for HPLC-UV analysis. After comparison with the standard, calculate the peak area of ​​compound Aspermeroterpene F at a UV wavelength of 280 nm. Calculate the content of compound Aspermeroterpene F in the bacterial cells according to the standard curve. The total amount of compound Aspermeroterpene F in the supernatant and bacterial cells is the yield in the corresponding culture medium. For the rice culture medium extract, 200 μL of DMSO was added to initially dissolve the sample, and then methanol was added to make up to 5 mL. After centrifugation, 20 μL of the supernatant was injected for HPLC-UV analysis. The peak area of ​​compound Aspermeroterpene F at a UV wavelength of 280 nm was calculated. The total content of compound Aspermeroterpene F in the culture was calculated according to the standard curve, which is the yield in the rice culture medium.

[0067] The HPLC-UV chromatograms of extracts obtained from fermentation cultures of wild-type Aspergillus terreus GZU-31-1 and genetically engineered strain Δasp12 using different culture media, and the calculated yields of compound Aspermeroterpene F are shown below. Figure 2 As shown; Figure 2 In the image, A represents the HPLC-UV chromatogram; Figure 2 In this context, B represents the standard curve of compound Aspermeroterpene F; Figure 2 In the figure, C represents the calculated yield of compound Aspermeroterpene F. Figure 2 It was found that the yield of the compound Aspermeroterpene F in the fermentation culture of the genetically engineered bacterium Δasp12 was significantly increased compared with that of the wild type. A comparison of the yield of Aspermeroterpene F in different culture media showed that rice medium was superior for the fermentation culture of the genetically engineered bacterium Δasp12.

[0068] Example 4: Efficient separation and preparation of compound Aspermeroterpene F Using the rice culture medium described in Example 3, 800 bottles of genetically engineered bacteria Δasp12 were cultured according to its fermentation method. The cultures were statically fermented at 28°C for 28 days to obtain the fermentation culture. All cultures were collected in a large container and extracted three times with 20 L of methanol. The extracts were combined, concentrated under reduced pressure to remove methanol, and the remaining aqueous phase was extracted four more times with 2 times its volume of ethyl acetate. The extracts were combined and concentrated to obtain a crude extract (824 g). HPLC analysis of the extract confirmed the presence of compound 13.

[0069] The crude extract was subjected to silica gel column chromatography at a mesh size of 200–300, with petroleum ether / ethyl acetate as the eluent and gradient elution (volume ratio from 9:1 to 0:100). The fraction eluted at a petroleum ether / ethyl acetate volume ratio of 6:4 was collected and designated as fraction 4 (425 g). Fraction 4 was then subjected to ODS C18 reversed-phase column chromatography, with methanol / water as the eluent and gradient elution (volume ratio from 40:60 to 100:0). The fraction eluted at a methanol / water volume ratio of 60:40 was collected and designated as fraction 4-3 (57 g). Fraction 4-3 was further prepared using semi-preparative high-performance liquid chromatography (methanol:water = 65:35 v / v, flow rate 10.0 mL / min) on a SHIMSEN Amkylo C18 column. The fraction with a retention time of 33.6 min was collected and concentrated to obtain a total of 42 g of compound 13.

[0070] Compound 13 1 H NMR (700 MHz) spectrum as follows Figure 3 As shown. Compound 13 13 The C NMR (175 MHz) spectrum is as follows: Figure 4 As shown. Through comparison with standards and spectroscopic analysis, compound 13 isolated from the fermentation culture of genetically engineered bacteria Δasp12 was identified as compound Aspermeroterpene F.

[0071] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A genetically engineered bacterium lacking the acetyltransferase gene asp12, characterized in that, The genetically engineered bacteria were obtained by completely or functionally knocking out the acetyltransferase gene asp12 in Aspergillus terreus; the amino acid sequence of the acetyltransferase Asp12 encoded by the acetyltransferase gene asp12 is shown in SEQ ID NO.

2.

2. The genetically engineered bacterium according to claim 1, characterized in that, The nucleotide sequence of the acetyltransferase gene asp12 is shown in SEQ ID NO.

1.

3. The genetically engineered bacterium according to claim 1, characterized in that, The Aspergillus terreus strain is Aspergillus terreus strain GZU-31-1.

4. The method for constructing the genetically engineered bacteria according to claim 1, characterized in that, By constructing a recombinant knockout vector for the acetyltransferase gene asp12, the acetyltransferase gene asp12 can be completely knocked out using homologous recombination; or by using a CRISPR gene editing system to insert, delete, or transform bases in the coding region of the acetyltransferase gene asp12, thereby inactivating the gene and achieving functional knockout.

5. The construction method according to claim 4, characterized in that, The CRISPR gene editing system is the CRISPR / Cas9 gene editing system.

6. A composition comprising the genetically engineered bacteria according to any one of claims 1 to 3.

7. The composition according to claim 6, characterized in that, It also contains excipients that can be accepted by the genetically engineered bacteria.

8. The use of the genetically engineered bacteria according to any one of claims 1 to 3 or the composition according to claim 6 or 7 in the production of compound Aspermeroterpene F, characterized in that, The structural formula of the compound is shown in formula (I): Equation (I).

9. The use of the genetically engineered bacteria according to any one of claims 1 to 3 or the composition according to claim 6 or 7 in the preparation of a product for the production of the compound Aspermeroterpene F, characterized in that, The structural formula of the compound is shown in formula (I): Equation (I).

10. A method for preparing the compound Aspermeroterpene F using any of the genetically engineered bacteria according to claims 1-3 or the composition according to claim 6 or 7, characterized in that, Includes the following steps: S1. Inoculate the genetically engineered bacteria or the composition into a culture medium, and ferment the genetically engineered bacteria to obtain a fermentation culture; S2. The fermentation culture obtained in S1 was extracted using an organic solvent to obtain the compound Aspermeroterpene F; the structural formula of the compound is shown in formula (I): Equation (I).

Images