A synergistic editing system targeting zebrafish olig2 gene and crisper / cas9 knock-in method and application thereof

Abstract

This invention discloses a targeted zebrafish olig2 A gene co-editing system and its application. The system consists of a specific sequence of endogenous gRNA (SEQ ID NO:2), a microhomologous arm (SEQ ID NO:1), and exogenous gRNA (SEQ ID NO:3). The genomic ends produced by the cleavage of the endogenous gRNA are identical to the microhomologous arm sequence; the cleavage site of the exogenous gRNA is located inside the microhomologous arm, directly exposing the intact microhomologous arm to the broken ends of the donor plasmid. The three components work synergistically to achieve exogenous reporter gene editing via MMEJ repair. olig2 Efficient, seamless, and precise knock-in of sites. This invention also provides a CRISPR / Cas9 knock-in kit, method, and zebrafish model containing this system for application in neurological research and drug screening.

Description

Technical Field

[0001] This invention belongs to the field of zebrafish gene editing technology, specifically relating to a method for editing zebrafish genes. olig2 Gene loci, specific gRNA and microhomologous arm combinations that enable efficient and precise knock-in, CRISPR / Cas9 systems containing such combinations, their construction methods and applications. Background Technology

[0002] Oligodendrocyte transcription factor 2 (OLT2) Olig2 In vertebrate neural development, specific motor neurons and oligodendrocytes play a central role. Zebrafish, due to their high genetic similarity to humans, transparent embryos, and ease of genetic manipulation, are ideal model organisms for studying nervous system development. To further investigate... olig2 Gene function often requires the construction of knock-in models that precisely insert reporter genes at endogenous sites to achieve in situ, real-time tracking of their expression.

[0003] Currently, gene knock-in technology is commonly used to study gene function, enabling the tracking of endogenous gene expression, conditional knockout, or gain-of-function studies. Traditional gene knock-in techniques rely on homologous recombination (HR) or non-homologous end joining (NHEJ) pathways.The human renal pathway (HR) is highly dependent on the cell cycle, primarily occurring during the S and G2 phases. In zebrafish, the initial cleavages after fertilization are extremely rapid, significantly compressing the cell cycle and almost entirely lacking the typical G1 and G2 phases. This results in consistently low efficiency (5-15%) of the HR pathway at the individual level in zebrafish and other model fish species. (Alberts, B., Heald, R., Johnson, A., Morgan, D., Raff, M., Roberts, K., & Walter, P. (2022). Molecular biology of the cell (7th ed.). WW Norton & Company. (Hoshijima K, Jurynec MJ, Grunwald DJ. Precise genome editing by homologous recombination[M] / / Methods in cellbiology. Academic Press, 2016, 135:) 121-147.); While the NHEJ pathway is relatively efficient, the integration process is inaccurate, easily leading to random insertion, deletion, or inversion of exogenous sequences, and cannot guarantee the accuracy of knock-in (ChangHHY, Pannunzio NR, Adachi N, Lieber MR. Non-homologous DNA end joining and alternative pathways to double-strand break repair. Nat Rev Mol Cell Biol.2017 Aug;18(8):495-506. doi: 10.1038 / nrm.2017.48. Epub 2017 May 17. PMID:28512351; PMCID: PMC7062608.)(Xue C, Greene EC. DNA Repair Pathway Choices in CRISPR-Cas9-Mediated Genome Editing. Trends Genet. 2021 Jul;37(7):639-656.doi: 10.1016 / j.tig.2021.02.008. Epub 2021 Apr 22. PMID: 33896583; PMCID: PMC8187289.).

[0004] Despite the aforementioned challenges, recent studies have utilized the CRISPR / Cas9 system in zebrafish. olig2The reporter gene knock-in was achieved at the gene locus (Chang CT, Kawanishi T, Nandagopal S, et al. A Knock-in Zebrafish Reporter Line for Live Visualization of Endogenous Olig2 Protein Dynamics[J]. Zebrafish, 2025, 22(5): 182-188.). This study successfully constructed an olig2-mNeonGreen fusion protein reporter line using a traditional HR repair mechanism based on a long homologous arm (approximately 1 kb). However, this method has significant limitations: firstly, the inherent inefficiency of the HR pathway it relies on in early zebrafish embryos remains unresolved, and this study does not provide specific knock-in efficiency data for the F0 generation; secondly, this method constructs a fusion protein, which may potentially interfere with the normal function and regulation of endogenous proteins.

[0005] In recent years, microhomological end joining (MMEJ) has been applied to gene editing as an independent, cell cycle-independent DNA double-strand break repair mechanism. MMEJ utilizes short microhomological arms (typically 5-25 bp) to mediate repair, theoretically enabling precise knock-in in various cellular states, including early embryos. However, the efficient and specific application of the MMEJ mechanism to zebrafish remains a challenge. olig2 This important gene locus still faces significant technical hurdles. Its efficiency is highly dependent on: (1) gRNAs with extremely high cleavage activity under specific genomic conditions; and (2) specific microhomologous arm sequences that can efficiently pair with the broken ends and mediate precise repair. The combination of these two factors is highly unpredictable and site-specific. Existing technologies, including the aforementioned HR-based knock-in methods, have limited effectiveness in zebrafish. olig2 It is difficult to obtain a high proportion (e.g., >20%) of precise knock-in events at the F0 generation, and the efficiency of establishing stable strains (species passaging rate) is often low and unstable. This makes the process of building a reliable model time-consuming and labor-intensive, and the success rate is difficult to guarantee, which severely limits its application in high-throughput studies or drug screening.

[0006] Furthermore, existing MMEJ-based knock-in strategies often suffer from design gaps. For example, donor plasmid linearization often uses universal gRNA (UgRNA), whose cleavage site is located upstream of the microhomology arm, resulting in an extra sequence (gap) unrelated to the genome at the donor break end. This design with a "gap" may not only reduce the efficiency of microhomology finding and pairing but also introduce the risk of inaccurate integration (Welker JM, Wierson WA, Almeida MP, et al. GeneWeld: efficient targeted integration directed by short homology inzebrafish[J]. Bio-protocol, 2021, 11(14): e4100-e4100.). Therefore, the field still needs a highly integrated, seamless editing component system that can organically unify genome-targeted cleavage, precise donor linearization, and microhomology repair mechanisms, thereby enabling integration in zebrafish, etc. olig2 These important and difficult-to-edit sites enable the precise knock-in of stable, efficient, and non-redundant sequences.

[0007] Therefore, there is still an urgent need in this field for a method that can overcome the efficiency bottleneck of existing repair mechanisms and is specifically designed for zebrafish. olig2 By optimizing the characteristics of gene loci, a new technical solution for stable, efficient, and precise knock-in can be achieved. Summary of the Invention

[0008] In view of this, regarding existing technologies in zebrafish olig2 This invention addresses the technical challenges of low efficiency, poor accuracy, and a lack of reliable and efficient gene knock-in methods by providing a novel solution. The core of this invention lies in the discovery and construction of an editing system composed of specific sequence elements that functionally synergistically coordinate, achieving for the first time efficient, seamless, and precise knock-in at this site based on micro-homological end joining (MMEJ).

[0009] One of the objectives of this invention is to provide a targeted zebrafish... olig2 The gene-specific endogenous gRNA, the sequence of which is shown in SEQ ID NO:2, was obtained through extensive screening and exhibits surprisingly high cleavage activity at the target site, forming the primary basis for achieving efficient editing.

[0010] The second objective of this invention is to provide a method for zebrafish olig2 A collaborative editing system for efficient and precise gene site knock-in. This system is not a simple combination of existing components, but rather consists of three core elements that are precisely coupled in sequence and function: a) The endogenous gRNA described in one of the above objectives; b) A microhomologous arm, the sequence of which is shown in SEQ ID NO:1, and the sequence is identical to the end-fracture sequence of the genomic DNA produced by the cleavage of the endogenous gRNA; c) Exogenous gRNA, the sequence of which is shown in SEQ ID NO:3, with its target sequence designed to at least partially overlap with the microhomologous arm sequence and its cleavage site adjacent to the 5' end of the microhomologous arm, such that the donor plasmid DNA break ends generated after cleavage directly and without gaps begin with the entire sequence of the microhomologous arm.

[0011] The endogenous gRNA, microhomologous arms, and exogenous gRNA work synergistically: the endogenous gRNA generates genomic breaks with specific homologous ends; the exogenous gRNA generates donor breaks with perfectly matching homologous ends; and the microhomologous arms act as precise "molecular guides," mediating seamless ligation between the two ends via the MMEJ pathway. This specific combination is the core of this invention, and its synergistic effect is key to achieving significantly higher efficiency and precision than conventional methods.

[0012] The third objective of this invention is to provide a method for achieving [something] in zebrafish. olig2 A complete CRISPR / Cas9 system for precise gene knock-in. This system includes: a) The aforementioned collaborative editing system; b) A donor plasmid containing the microhomologous arm sequence shown in SEQ ID NO:1; c) Cas9 mRNA or Cas9 protein.

[0013] This system achieves precise integration of exogenous sequences through the MMEJ pathway.

[0014] A fourth objective of this invention is to provide a preferred embodiment of the aforementioned CRISPR / Cas9 system, wherein the donor plasmid further comprises a reporter gene. More preferably, the reporter gene comprises a 5×myc tag, a P2A peptide, and an mCherry fluorescent protein gene. This design achieves co-expression of the reporter protein and the endogenous olig2 protein through the P2A peptide, rather than fusion, minimizing potential interference with the function of the endogenous protein.

[0015] The fifth objective of this invention is to provide a gene editing kit comprising the aforementioned CRISPR / Cas9 system. This kit provides a ready-to-use tool for related research.

[0016] The sixth objective of this invention is to provide a method for implementing the above-mentioned CRISPR / Cas9 system in zebrafish. olig2A method for precise gene knock-in. The method includes microinjecting the system into zebrafish fertilized eggs. Preferably, the injection dosage is: 20 ng / μL donor plasmid, 100 ng / μL gRNA, 200 ng / μL Cas9 mRNA, 1 nL per egg.

[0017] The seventh objective of this invention is to provide applications for zebrafish models carrying precisely knocked-in reporter genes constructed using the above methods in related fields, particularly in in vivo tracing. olig2 Its applications include expressing and studying the mechanisms of nervous system development and disease, as well as screening drugs that promote neural development, regeneration, or treatment of nervous system diseases.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) A three-in-one collaborative editing system was created, breaking through the efficiency bottleneck: Compared with the traditional homology recombination (HR) method that relies on long homology arms, this invention is the first to target zebrafish. olig2 This important and difficult-to-edit site was successfully constructed and validated as a complete microhomological end join (MMEJ) knock-in solution. This system is not a simple combination of isolated elements, but a functionally synergistic whole composed of specific endogenous gRNAs, perfectly matched microhomological arms, and precisely located exogenous gRNAs, fundamentally overcoming the inherent inefficiency of HR in early zebrafish embryos.

[0019] (2) The core components are non-obvious, and the synergistic effect brings unexpected high efficiency: Through extensive experimental screening, this invention found that among 12 candidate gRNAs, only the gRNA with the sequence SEQ ID NO:2 showed an unexpectedly high cleavage efficiency (78%) at the target site, while most other designs had low efficiency or even zero efficiency. Combining this specific high-efficiency gRNA with a specially designed microhomologous arm (SEQ ID NO:1) and a precisely matched exogenous gRNA (SEQ ID NO:3) produced a significant synergistic effect. Experiments showed that this specific combination achieved a positive expression rate of up to 25.5% in F0 generation embryos. This efficiency far exceeds the level usually reported by conventional HR methods (<10%), and is also significantly better than the random integration efficiency based on NHEJ, which is difficult for those skilled in the art to predict.

[0020] (3) Seamless and precise integration was achieved, solving a key design challenge in MMEJ applications: Unlike some existing MMEJ strategies that use universal gRNA (UgRNA) resulting in irrelevant "gap sequences" at the donor ends, the exogenous gRNA (SEQ ID NO:3) in this invention has a carefully designed cleavage site located inside the microhomologous arm, ensuring that there are no redundant nucleotides at the donor plasmid break ends, directly exposing the complete homologous sequence. This "gap-free" design enables perfect docking between the genome and the donor ends. Experimental verification shows that in successful integration events, the MMEJ-mediated precise knock-in accounts for approximately 62%, achieving a dual breakthrough of high integration efficiency and high precision, completely solving the problems of high randomness and poor precision in the traditional NHEJ pathway.

[0021] (4) Optimized design and significant application advantages: The P2A-mCherry reporter system used in this invention achieves co-expression of the reporter protein and the endogenous olig2 protein instead of fusion, minimizing potential interference with the normal function and regulation of the endogenous protein, and more realistically reflecting gene expression dynamics. The zebrafish strain constructed using this invention provides a basis for live, real-time observation. olig2 It provides a powerful, efficient, reliable, and quantifiable tool for expressing spatiotemporal patterns, tracing neural cell lineages such as oligodendrocytes, conducting in-depth research on the development and disease mechanisms of the nervous system, and carrying out high-throughput drug screening. Attached Figure Description

[0022] Figure 1 This is a diagram of the precise knock-in mode mediated by the MMEJ mechanism in Embodiment 1 of the present invention.

[0023] Figure 2 This is a schematic diagram of the precise knock-in principle mediated by the MMEJ mechanism in Embodiment 1 of the present invention. In the diagram, HA represents a microhomologous arm, TAA represents a stop codon, ΔCDS represents the completed CDS sequence, myc represents the myc protein tag, p2A represents the 2A peptide, mCherry represents the red fluorescent protein gene, SV40 represents the SV40 poly(A) structure, the underlined letters represent the gRNA target sequence, the red font NGG represents the PAM region recognized by the gRNA, the letter spacing represents the CRSIPR / Cas9 cleavage site, the yellow highlighted font represents the microhomologous arm, and the lowercase blue letters represent degenerate bases in synonymous codons.

[0024] Figure 3 This is a schematic diagram of the efficiency test of some endogenous gRNAs in Example 1 of the present invention.

[0025] Figure 4 This is a spectrum of the donor plasmid in Example 1 of the present invention.

[0026] Figure 5The results are the genotype identification results of the F0 generation early embryo pool in Example 1 of this invention. A represents the PCR detection results of the knock-in upstream integration site (adaptor), B represents the PCR detection results of the knock-in downstream adapter, C represents a schematic diagram of the knock-in genome structure, PCR primer positions, and products, D represents the sequencing results of the PCR products used to detect the ligation of the knock-in upstream adapter in the embryo pool, and E represents the sequencing results of the PCR products used to detect the ligation of the knock-in downstream adapter in the embryo pool.

[0027] Figure 6 This is a graph showing the results of the specific red fluorescence positive expression rate of F0 generation larvae in Example 1 of the present invention.

[0028] Figure 7 The results of tail fin genotyping of F0 generation juvenile fish in Example 1 of this invention.

[0029] Figure 8 In Embodiment 1 of the present invention olig2 -KI F1 generation in vivo imaging and genotyping results.

[0030] Figure 9 In Embodiment 1 of the present invention olig2 -KI F1 generation cell lineage tracing and identification; immunofluorescence results showed the nervous system.

[0031] Figure 10 In Embodiment 1 of the present invention olig2 -KI F1 live imaging shows gene expression. Detailed Implementation

[0032] The present invention will be further described in detail below with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention. Unless otherwise specified, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, and all reagents and consumables are commercially available products.

[0033] Example 1 This embodiment provides a method for implementing the MMEJ mechanism in Zebrafish. olig2 Methods for precise and efficient gene knock-in (see diagram of MMEJ mechanism-mediated precise knock-in) Figure 1 See the diagram for the precise keying principle. Figure 2 ), including the following steps: 1. Screening and identification of endogenous gRNAs Through zebrafish olig2 Multiple rounds of design and screening were conducted on specific gene regions to identify the most specific gRNA with the highest cleavage efficiency from 12 candidate gRNAs. The testing methods for the 12 candidate gRNAs are as follows: The corresponding gRNAs were synthesized using an in vitro transcription kit. Cas9 mRNA and each gRNA were injected separately into 1-cell stage zebrafish embryos at the following dosages: gRNA 100 ng / μL, Cas9 mRNA 200 ng / μL, with an injection volume of approximately 1 nL per egg. Eight hours after microinjection, 10-20 intact embryos were collected from each gRNA-injected sample, and DNA was extracted. PCR amplification was performed using primers approximately 200 bp upstream and downstream of the cleavage site. The primers used for PCR are shown in Table 1.

[0034] Table 1 Primers used for efficiency detection of candidate endogenous gRNAs

[0035] The PCR amplification system is as follows:

[0036] The PCR reaction program settings are as follows:

[0037] The obtained products were subjected to Sanger sequencing, and the gRNA efficiency was comprehensively evaluated by analyzing the sequencing peak chromatogram and using EditCo online software. The 12 candidate gRNA sequences and their in vivo cleavage efficiencies are shown in Table 2. Figure 3 As shown.

[0038] Table 2 Candidate endogenous gRNA sequences and their relative cleavage efficiencies

[0039] As shown in Table 2, although there are general design rules, specific requirements apply to... olig2 The discovery of highly efficient gRNAs at gene loci is highly uncertain and requires extensive trial and error. Ultimately, this invention successfully screened out the only highly efficient gRNA, namely gRNA-10 (SEQ ID NO:2). Its cleavage efficiency is as high as 78%, far exceeding that of other gRNAs, demonstrating significant technical effects. Subsequent experiments were conducted using gRNA-10 (SEQ ID NO:2).

[0040] 2. Homologous arm design and donor carrier construction 2.1 Homogeneous Arm Design To achieve MMEJ repair, short microhomologous arm sequences need to be designed adjacent to the predetermined cleavage sites on both the donor plasmid and genomic DNA. Through investigation, the designed microhomologous arm sequence is GGACGGGGCTTTCAGCC (SEQ ID NO:1), located to the left of the target cleavage site on the genome and to the right of the target cleavage site on the donor plasmid. The requirements for the microhomologous arm are: GC content greater than 50%, and both ends must be GC. Experiments have shown that the designed homologous sequence can significantly improve the efficiency of MMEJ-mediated precise knock-in.

[0041] 2.2 Donor Carrier Construction First, a high-fidelity PCR enzyme was used, with pMD-18T as a template, and primers Vect-F1 and Vect-R1 were used to perform PCR to amplify and obtain the plasmid backbone.

[0042] The primers used for PCR are: Vect-F1: 5'-GGTCAGTCGGGGCATGCTGACGGCGCGAGCGGTCTCCTCCGGGCAAATC; Vect-R1: 5'-GCAGCGGGGGCCACGGCTGACCGAGCGGCCTATAGTGAGTCGTATTACGTAGATCC.

[0043] The amplification product was 2986 bp in length. The PCR amplification system is as follows:

[0044] The PCR reaction program settings are as follows:

[0045] Then, using a plasmid containing a 5×myc tag, P2A peptide, and mCherry fluorescent protein expression element as a template, PCR was performed using primers Insert-F1 and Insert-R1 to obtain the inserted fragment.

[0046] The primers used for PCR are: Insert-F1: 5'-AGCATGCCCCGACTGACCAGTGACTCAAAAACTAAAGGAATAACTTTGCTGATGGAGC; Insert-R1: 5'-TCAGCCGTGGCCCCCCGCTGCAGCTACCCGGGTTAC.

[0047] The amplification product was 1084 bp in length. The PCR amplification system is as follows:

[0048] The PCR reaction program settings are as follows:

[0049] Then, using a one-step seamless cloning kit, the purified and recovered plasmid backbone and insert fragment were ligated to obtain the knock-in donor plasmid pMD-olig2-V1. Because this donor plasmid exhibited non-specific fluorescence in early zebrafish embryos, it was further modified by inverting the knock-in element to obtain the donor plasmid pMD-olig2-KI-V2. The specific procedures are as follows: Using pMD-olig2-V1 as a template, PCR was performed using primers Vect-F2 and Vect-R2 to amplify the plasmid backbone. The primers used for PCR were: Vect-F2: 5'-GCGAGCGGGAGGATCCCCGGGTACCG; Vect-R2: 5'-GGAGGTGTCGGGCAAATCGTCGACCTG.

[0050] The amplification product was 2078 bp in length. The PCR amplification system is as follows:

[0051] The PCR reaction program settings are as follows:

[0052] Using pMD-olig2-V1 as a template, PCR was performed using primers Insert-F2 and Insert-R2 to amplify the inserted fragment. The primers used for PCR were: Insert-F2: 5'-TTTGCCCGACACCTCCCCTGAACCTG; Insert-R2: 5'-GGATCCTCCCGCTCGCGCCGTCAGCA.

[0053] The amplification product was 1305 bp in length. The PCR amplification system is as follows:

[0054] The PCR reaction program settings are as follows:

[0055] Using a one-step seamless cloning kit, the purified and recovered plasmid backbone and insert fragment were ligated. The ligation product was transformed into *E. coli* DH5α, and after verification, the culture was expanded to obtain the knock-in donor plasmid pMD-olig2-KI-V2 (plasmid map shown). Figure 4(The sequence is shown in SEQ ID NO:4).

[0056]

[0057] 3. Exogenous gRNA design The designed exogenous gRNA targets the negative sense strand of the donor plasmid, with most of the sequence overlapping with the microhomologous arms. Additionally, the six sequences at the PAM end are designed as GAGCGG, resulting in the overall sequence: GGCTGAAAGCCCCGTCCGAGCGG (SEQ ID NO:3). Furthermore, to ensure effective linearization of the donor plasmid and thus provide the necessary ends for subsequent MMEJ repair, the cleavage efficiency of the gRNA targeting the donor plasmid (SEQ ID NO:3) was validated.

[0058] In vivo experiments were conducted: donor plasmid pMD-olig2-KI, Cas9 mRNA, and the aforementioned gRNA were co-injected into 1-cell stage zebrafish embryos, and gRNA efficiency was subsequently evaluated using the same method as in Example 1. The results showed that the exogenous gRNA cleavage efficiency was 63%, meeting the criteria for high-efficiency gRNA.

[0059] 4. Microinjection of zebrafish embryos 4.1 Preparation of gRNA and Cas9 Based on the designed genomic target sequence (SEQ ID NO:2) and the donor plasmid target sequence (SEQ ID NO:3), gRNA was synthesized in vitro via transcription. Simultaneously, Cas9 mRNA or recombinant Cas9 protein was prepared.

[0060] 4.2 Preparation of Injection Mixture Donor plasmid, gRNA, and Cas9 mRNA were mixed at specific concentrations, with phenol red added as an indicator. The final concentrations were: donor plasmid 20 ng / μL, gRNA 100 ng / μL, and Cas9 mRNA 200 ng / μL.

[0061] 4.3 Microinjection Using a microinjector, the above mixture was injected into the cytoplasm of single-cell stage fertilized eggs of wild-type AB strain zebrafish, with an injection volume of approximately 1 nL per egg, thus completing the microinjection.

[0062] 5. Screening and identification of F0 generation positive individuals 5.1 Phenotypic Observation Eight hours after injection, mixed genomic DNA was extracted from 10-20 embryos. Specific primers were used to detect the ligation of the knock-in upstream and downstream adapters, and sequencing was used to preliminarily determine the accuracy of the knock-in. PCR conditions were as follows: (1) Knock in the upstream connector and use the following primers for detection: F: 5'-GCCCATCACGCCGGTTTC-3'; R: 5'-GTCGCCCAAGCTCTCCATTT-3'.

[0063] The amplification product was 585 bp in length. The PCR amplification system is as follows:

[0064] The PCR reaction program settings are as follows:

[0065] (2) Knock in the downstream connector and use the following primers for detection: F: 5'-AGCGGATAACAATTTCACACAGGA-3'; R: 5'-AAAAGTCTGTGGTGGCTTCAAA-3'.

[0066] The amplification product is 195 bp in length. The PCR amplification system is as follows:

[0067] The PCR reaction program settings are as follows:

[0068] The results showed that knocking in both upstream and downstream linkers amplified very distinct specific bands (see [link]). Figure 5 A and B). The sequencing results of the PCR product knocked into the upstream adapter showed a single peak, consistent with the predicted results, indicating that the knock-in site was precisely ligated. Figure 5 D). Sequencing results of the PCR product from the knock-in downstream adapter showed mixed peaks, indicating numerous insertion or deletion mutations. This is a result of DNA repair mediated by non-homologous end ligation. Since no microhomologous arms were designed downstream of the knock-in, this is consistent with the expected result. Figure 5 E).

[0069] When the embryo reaches 2 days postpartum (dpf), observe under a fluorescence microscope whether specific fluorescent signals appear in the expected nervous system regions (such as the spinal cord and brain) (see [link to relevant documentation]). Figure 6 The proportion of positive embryos was statistically analyzed, and the results showed that, using the specific gRNA (SEQ ID NO:2) and microhomologous arm (SEQ ID NO:1) combination provided by this invention, the positive expression rate of F0 generation embryos reached 25.5% (N=337). This efficiency level not only far exceeds the conventional efficiency of knock-in in zebrafish using methods such as HR (usually below 10%), but also surpasses the recent achievements in this field. olig2The HR protocol for the site (which did not report specific efficiency data) significantly exceeded the precise knock-in ratio expected by the conventional NHEJ method, directly demonstrating the unexpected high efficiency of the specific gRNA (SEQ ID NO:2) and microhomologous arm (SEQ ID NO:1) combination provided by this invention.

[0070] 5.2 Genotyping Embryos exhibiting a positive phenotype were cultured to a length of 1.5-2 cm. The tail fin of each embryo was harvested and DNA extracted. PCR detection of the knock-in upstream and downstream adapters was performed according to method 5.1. The PCR product of the knock-in upstream adapter was used to determine the genotype of the knock-in positive individuals using Sanger sequencing. Genotype identification results ( Figure 7 The results showed that among the successfully integrated alleles, precise knock-in events mediated by the MMEJ mechanism accounted for approximately 62%, representing a dominant proportion. This confirms that the microhomologous arm (SEQ ID NO: 1) designed in this invention can efficiently guide the MMEJ repair pathway, achieving a high proportion of precise integration events while maintaining high integration efficiency (25.5%), thus solving the technical problems of high randomness and poor precision in the NHEJ pathway.

[0071] 6. Establishment of stable strains All mature F0 generation individuals (including those with weak fluorescence and negative tail fin identification) were crossbred with wild-type zebrafish. F1 generation embryos were collected, and individuals carrying the knock-in allele were screened by fluorescence observation and PCR identification. Experimental results showed ( Figure 8 The germline passaging rate of precisely knocked-in alleles was 20% (N=15). This established a stable... olig2 Genetic reporter strain of zebrafish.

[0072] Furthermore, this model fish can be used for in vivo real-time or immunofluorescence observation. olig2 Dynamic expression and tracking of oligodendrocyte lineage development ( Figure 9 , 10 It can be used to study the pathogenesis of related nervous system diseases and to screen drugs, providing a powerful tool for neuroscience research.

[0073] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.

[0074] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A targeted zebrafish olig2 The endogenous gRNA of a gene is characterized by, The endogenous gRNA sequence is shown in SEQ ID NO:

2.

2. A method for use in zebrafish olig2 A collaborative editing system for precise gene site knock-in, characterized by: It consists of the following functionally coordinated components: a) The endogenous gRNA as described in claim 1; b) Micro-homologous arms, the sequence of which is shown in SEQ ID NO:1; c) Exogenous gRNA, the sequence of which is shown in SEQ ID NO:

3.

3. A method for achieving this in zebrafish olig2 The CRISPR / Cas9 system for precise gene knock-in is characterized by, Include: a) The collaborative editing system as described in claim 2; b) A donor plasmid containing the microhomologous arm sequence shown in SEQ ID NO:1; c) Cas9 mRNA or Cas9 protein.

4. The CRISPR / Cas9 system according to claim 3, characterized in that, The donor plasmid also contains a reporter gene.

5. The CRISPR / Cas9 system according to claim 4, characterized in that, The reporter gene contains a 5×myc tag, a P2A peptide, and an mCherry fluorescent protein gene.

6. A gene editing kit, characterized in that, The kit comprises the CRISPR / Cas9 system as described in any one of claims 3-5.

7. A method for achieving this in zebrafish olig2 The method for precise gene knock-in is characterized by, The method includes the following steps: microinjecting the CRISPR / Cas9 system of any one of claims 3-5 into zebrafish fertilized eggs.

8. The method according to claim 7, characterized in that, The microinjection dosages are as follows: donor plasmid 20 ng / μL, gRNA 100 ng / μL, Cas9 mRNA 200 ng / μL, 1 nL injected per oocyte.

9. The use of zebrafish prepared by the method of claim 7 or 8 in screening drugs that promote neural development, regeneration, or treatment of nervous system diseases.

Images