A self-catalytic amplification-free CRISPR nucleic acid detection kit and a detection method thereof
By constructing a tube-type reaction system using self-catalytic elements and signal amplification elements, the timing interference problem between amplification and detection in CRISPR nucleic acid detection is solved, achieving high-sensitivity and high-specificity nucleic acid detection, which is suitable for on-site detection scenarios with limited resources.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SICHUAN UNIV
- Filing Date
- 2026-03-27
- Publication Date
- 2026-06-02
AI Technical Summary
In existing CRISPR nucleic acid detection technologies, the timing interference between amplification and detection leads to false negative results, and existing methods increase operational complexity and the risk of cross-contamination, making it difficult to achieve convenient one-tube detection.
A one-tube reaction system is constructed using an autocatalytic element and a signal amplification element. The Cas12a protein is activated by crRNA to cleave circ-crRNA, thereby achieving cascade amplification of the signal and avoiding temporal interference between the amplification reaction and detection. Furthermore, the activity of the Cas12a protein can be precisely regulated through the design of circ-crRNA.
It achieves highly sensitive and specific nucleic acid detection, simplifies the operation process, reduces the risk of cross-contamination, is suitable for on-site testing scenarios with limited resources, and has multiple detection capabilities and stability.
Smart Images

Figure CN122128403A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of nucleic acid detection technology, and in particular to a self-catalytically amplified, amplification-free CRISPR nucleic acid detection kit and its detection method. Background Technology
[0002] Nucleic acid testing, as a core technology in molecular diagnostics, plays an irreplaceable role in pathogen identification, genetic disease screening, and early tumor screening. Taking bacterial detection as an example, traditional culture methods for identifying Mycobacterium tuberculosis require several weeks, and the positive rate is limited by strain viability; however, real-time quantitative PCR based on nucleic acid detection can shorten the time to several hours, achieving accurate identification of low-abundance pathogens. Similarly, in the detection of fastidious bacteria such as Mycoplasma pneumoniae and Legionella pneumophila, nucleic acid testing technology has become the preferred clinical diagnostic method, and its rapid and highly sensitive characteristics provide crucial evidence for early intervention in infectious diseases.
[0003] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and its associated protein (Cas) system, as an adaptive immune mechanism in bacteria and archaea, have achieved revolutionary breakthroughs in gene editing in recent years. Class II CRISPR-Cas systems, represented by effector proteins such as Cas12 and Cas13, possess unique dual enzymatic cleavage activity. When Cas proteins bind to crRNA to form a ribonucleoprotein complex, they can specifically recognize and cleave target nucleic acids complementary to crRNA; this process is called cis-cleavage. After cis-cleavage, the Cas protein undergoes a conformational change, entering a transiently activated state and gaining non-specific trans-cleavage capability, enabling it to indiscriminately cleave free single-stranded DNA (Cas12) or single-stranded RNA (Cas13) in the system. This cleavage characteristic of the CRISPR system is cleverly combined with fluorescence resonance energy transfer (FRET) technology to establish a highly efficient nucleic acid detection platform. Its core mechanism lies in designing a short oligonucleotide with a fluorescent group and a quencher group labeled at both ends as a signal reporter molecule. In the initial state, the fluorescence signal is suppressed due to the spatial proximity of the fluorescent group and the quencher group. When the target is present, the activated Cas protein cleaves the reporter molecule through trans-cleavage activity, separating the fluorophore from the quencher group, thereby releasing a detectable fluorescent signal.
[0004] However, current CRISPR nucleic acid detection technology still faces significant technical bottlenecks. On the one hand, since single-molecule recognition events are difficult to generate detectable signals, existing methods generally rely on combining them with isothermal amplification techniques (such as RPA and LAMP) to improve sensitivity. However, there is temporal interference between the two in the same reaction system: at the amplification temperature, the Cas enzyme may be activated prematurely and cleave the target nucleic acid, leading to the degradation of the amplification substrate and ultimately causing false negative results. To resolve this technical conflict, researchers have tried various strategies, including using physical separation methods such as tube-in-tube structures to separate the amplification and detection systems, or using chemical modification methods such as light-guided ribonucleic acid and adding heparin sodium to inhibit enzyme activity to regulate the reaction sequence. Although these methods alleviate the mutual interference between amplification and detection to some extent, physical separation methods increase the complexity of operation and the risk of cross-contamination during the opening and transfer process, while chemical modification methods introduce light dependence and reagent stability issues, making it difficult to achieve truly convenient one-tube detection.
[0005] Therefore, in view of the above-mentioned problems in the existing technology, there is an urgent need to develop a new nucleic acid detection strategy that does not require pre-amplification and has self-catalytic signal amplification function. Summary of the Invention
[0006] This invention overcomes the shortcomings of the prior art and provides a self-catalytically amplified, amplification-free CRISPR nucleic acid detection kit and its detection method.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: Firstly, the present invention provides a self-catalytically amplified, amplification-free CRISPR nucleic acid detection kit, comprising:
[0008] The autocatalytic element comprises crRNA, Cas12a protein, and target DNA;
[0009] A signal amplification element comprising circ-crRNA, Cas12a protein, target DNA, and a signal reporter molecule;
[0010] The autocatalytic element and the signal amplification element together constitute a tubular reaction system. After the crRNA recognizes the target DNA, it activates the Cas12a protein, cuts the circ-crRNA and forms an autocatalytic amplification cycle, which in turn cuts the signal reporter molecule to achieve signal output.
[0011] In a preferred embodiment of the present invention, the circ-crRNA is prepared by circularizing pre-crRNA and removing uncirculated linear RNA, and the preparation process includes:
[0012] Pre-crRNA circularization was catalyzed by T4 RNA Ligase 1 at 25-45℃.
[0013] Inactivate T4 RNA Ligase 1 at 75-100℃;
[0014] Non-circular RNA was digested with RNase R at 25-45℃;
[0015] RNase R was inactivated at 55-80℃ to obtain circ-crRNA.
[0016] In a preferred embodiment of the present invention, the nucleotide sequence of the pre-crRNA is shown in SEQ ID No. 1, and the nucleotide sequence of the circ-crRNA is shown in SEQ ID No. 2.
[0017] In a preferred embodiment of the present invention, the nucleotide sequence of the target DNA is shown in SEQ ID No. 3, and the nucleotide sequence of the crRNA is shown in SEQ ID No. 5.
[0018] In a preferred embodiment of the present invention, the signal reporter molecule is a short-chain DNA, namely TA reporter, with fluorescent and quenching groups labeled at both ends, respectively. Its nucleotide sequence is shown in SEQ ID No. 4, wherein the fluorescent group is FAM and the quenching group is BHQ1.
[0019] In a preferred embodiment of the present invention, the molar ratio of each component in the reaction system is:
[0020] crRNA: Cas12a: circ-crRNA: target DNA: TA reporter=1: 10-800: 100-300: 1-200: 100-300.
[0021] In a preferred embodiment of the present invention, the reaction system further comprises 1× buffer solution, the composition of which includes:
[0022] 45-55mM NaCl, 5-15mM Tris-HCl, 5-15mM MgCl2, 50-150μg / mL recombinant albumin, pH 7.8-8.0.
[0023] Secondly, the present invention provides a self-catalytically amplified, amplification-free CRISPR nucleic acid detection method based on any of the above-described reagent kits, comprising the following steps:
[0024] S1. Mix the target DNA with crRNA, Cas12a protein, circ-crRNA and signal reporter molecules to prepare a reaction system;
[0025] S2. Incubate at 15-45℃ for 40-60 minutes;
[0026] S3. Measure the fluorescence intensity of the reaction system and detect the target nucleic acid based on the fluorescence signal.
[0027] In a preferred embodiment of the present invention, the method for preparing the target DNA is as follows:
[0028] Mix target-TS and target-NTS in equal molar amounts, anneal at 80-90℃ for 5-10 min, cool to room temperature and hold for 20-40 min to obtain the final product.
[0029] In a preferred embodiment of the present invention, the fluorescence intensity is measured under the following conditions: excitation wavelength of 480 nm and emission wavelength of 510-600 nm.
[0030] This invention addresses the shortcomings of the prior art and has the following beneficial effects:
[0031] (1) This invention provides a self-catalytic amplification-free CRISPR nucleic acid detection kit and its detection method. It utilizes the transient non-specific cleavage activity of Cas12a protein after activation and uses circ-crRNA as a substrate and catalyst for signal amplification. This enables cascade amplification of signals, allowing a single crRNA to trigger the cleavage and activation of multiple circ-crRNAs, thereby generating a large number of activated Cas12a proteins. Ultimately, these proteins cleave hundreds of signal reporter molecules, releasing detectable fluorescent signals. Compared with existing methods that rely on pre-amplification steps to improve sensitivity, this invention fundamentally avoids the temporal interference between amplification reaction and CRISPR detection. It eliminates the need for complex time control and physical separation, achieving true amplification-free detection. This can meet the detection needs of low-abundance targets in clinical samples while maintaining the inherent high specificity recognition capability of the CRISPR system.
[0032] (2) The present invention adopts a single-tube reaction system design. The operator only needs to mix the sample with the reagent kit components and incubate at a constant temperature to complete the entire detection process. There is no need for complicated temperature control procedures and multiple sample addition steps. Compared with the existing technology that uses physical separation or chemical modification to control the reaction sequence, the present invention avoids the risk of cross-contamination caused by opening the lid and transfer, eliminates the problems of light dependence and reagent stability, and thus greatly reduces the complexity of operation and the technical requirements for operators. This technology can be applied to on-site testing scenarios with limited resources. It can be conveniently used in primary medical institutions, entry-exit inspection and quarantine sites, food safety rapid testing points, etc., thereby expanding the application scope of nucleic acid detection technology.
[0033] (3) This invention achieves precise regulation of Cas12a protein activity through the design of circ-crRNA. Based on the difference in spatial conformation between circ-crRNA and crRNA, the circular structure hinders the recognition and binding of circ-crRNA and Cas12a protein, forming a natural switch control, which effectively reduces the background signal. In the absence of a target, the fluorescence signal in the system remains at an extremely low level, thereby improving the signal-to-noise ratio of detection. Compared with the existing methods that rely on chemical modification or physical isolation to control the reaction initiation, this invention achieves endogenous activity regulation without the need to add additional regulatory reagents or apply external stimulation, ensuring the stability and reliability of the reaction system. This provides a technical basis for multiplex detection and complex sample detection in CRISPR systems, and allows for the simultaneous detection of multiple targets in the same system without interference.
[0034] (4) The self-catalytic amplification of the present invention provides a combination of high sensitivity and high specificity. Compared with the traditional method that requires secondary amplification, the present invention achieves a leap in sensitivity by means of signal self-amplification while maintaining recognition specificity. It truly achieves accurate recognition and controllable amplification, thus providing a solution with both reliability and sensitivity for applications such as nucleic acid detection. Attached Figure Description
[0035] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0036] Figure 1 This is a schematic diagram illustrating the working principle of a self-catalytically amplified, amplification-free CRISPR nucleic acid detection kit and its detection method according to the present invention.
[0037] Figure 2These are 18% nucleic acid page gel images before and after pre-crRNA circularization in Example 1 of this invention;
[0038] Figure 3 This is the result of the shielding effect of circ-crRNA on Cas12a in Example 2 of the present invention;
[0039] Figure 4 This describes the effect of crRNA-induced autocatalytic activation of Cas12a protein cleavage of circ-crRNA on fluorescence signal under different conditions in Example 3 of this invention.
[0040] Figure 5 This is the establishment of a standard curve showing the relationship between target DNA and fluorescence intensity in Example 4 of this invention. Detailed Implementation
[0041] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0042] Many specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways different from those described herein. Therefore, the scope of protection of the invention is not limited to the specific embodiments disclosed below.
[0043] It should be noted that the raw materials, equipment and reagents used in this invention can all be purchased from the market or obtained through existing preparation methods.
[0044] The nucleotide sequences used in the following examples are shown in Table 1; the nucleotide sequence of the pre-crRNA is shown in SEQ ID No. 1 in Table 1, the nucleotide sequence of the circ-crRNA is shown in SEQ ID No. 2 in Table 1, the nucleotide sequence of the target DNA is shown in SEQ ID No. 3 in Table 1, the nucleotide sequence of the TA-reporter is shown in SEQ ID No. 4 in Table 1, and the nucleotide sequence of the crRNA is shown in SEQ ID No. 5 in Table 1.
[0045] Nucleotide sequences used in Table 1:
[0046] name sequence pre-crRNA CAAUCCUUAGGACAGUCUUCTTATTUAAUUUCUACUAAGUGUAGAU circ-crRNA |CAAUCCUUAGGACAGUCUUCTTATTUAAUUUCUACUAAGUGUAGAU| target DNA CTTGGTAGTGATGGTGCATAGTCC TA-reporter FAM-TTATT-BHQ1 crRNA UAAUUUCUACUAAGUGUAGAUCAAUCCUUAGGACAGUCUUC
[0047] like Figure 1As shown, the detection principle of this invention is as follows: after crRNA, Cas12a protein and target DNA form a ternary complex, Cas12a cis-cleaves the target DNA. Subsequently, Cas12a protein enters a transiently activated state and non-specifically cleaves small DNA oligonucleotide segments in circ-crRNA. After circ-crRNA is cleaved, it continuously guides and activates Cas12a protein. A large number of activated Cas12a proteins non-specifically cleave the TA reporter, generating a fluorescent signal.
[0048] Example 1:
[0049] This example illustrates the circularization of pre-crRNA in the CRISPR / Cas12a system. The specific steps are as follows:
[0050] The reaction was carried out in a 20–40 μL solution containing 1× buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT (pH 7.5)), 500 nM pre-crRNA, 2 U T4 RNA Ligase 1, 50 nM ATP, and 10% PEG 8000. The reaction was carried out at 37 °C for 60 min, followed by heating to 95 °C and holding for 2 min to denature T4 RNA Ligase 1.
[0051] Add 1 μL of RNase R (2 U / μL) to the above reaction solution, incubate at 37 °C for 120 min to digest the non-circular pre-crRNA, then raise the temperature to 70 °C and hold for 5 min to inactivate RNase R, thus obtaining the successfully circularized pre-crRNA, which is named circ-crRNA.
[0052] Among them, the circularization result of pre-crRNA is as follows Figure 2 As shown.
[0053] Example 2:
[0054] This embodiment is used to investigate the shielding effect of circ-crRNA on Cas12a, that is, circ-crRNA alone cannot activate the non-specific trans cleavage of Cas12a, and there is no fluorescent signal. The specific steps are as follows:
[0055] The reaction was carried out in a 20–40 μL solution containing 1× buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg / ml recombinant albumin (pH 7.9)), 100 nM Cas12a, 300 nM TAreporter, 200 nM target DNA, and 100 nm crRNA / pre-crRNA / circ-crRNA, and was carried out at 37 °C for 50 min. After the reaction, fluorescence intensity was measured at an excitation wavelength of 480 nm, an emission range of 510–600 nm, and a step size of 2 nm.
[0056] Among them, the shielding effect of circ-crRNA on Cas12a is as follows: Figure 3 As shown, compared with the crRNA group, the fluorescence intensity of both the pre-crRNA and circ-crRNA groups was lower, especially the circ-crRNA group, whose fluorescence intensity value was only 348, which directly indicates the shielding effect of circ-crRNA on Cas12a.
[0057] Example 3:
[0058] This embodiment is used to investigate the effect of crRNA-induced autocatalytic activation of Cas12a protein cleavage of circ-crRNA on fluorescence signal under different conditions.
[0059] The different conditions were circ-crRNA concentration, Cas12a concentration, and incubation temperature.
[0060] (1) The effect of different circ-crRNA concentrations on fluorescence intensity, the specific steps are as follows:
[0061] The reaction was carried out in a solution with a total volume of 80-100 μL containing 1× buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg / ml recombinant albumin (pH 7.9)), 100 nM Cas12a, 1 nM crRNA, 300 nM TA reporter, and 200 nM target DNA. The concentrations of circ-crRNA were controlled at 100 nM, 150 nM, 200 nM, 250 nM, and 300 nM, respectively. The reaction was carried out at 37 °C for 60 min. After the reaction, the fluorescence intensity was measured. The excitation wavelength was 480 nm, the emission range was 510-600 nm, and the step size was 2 nm.
[0062] Among them, the fluorescence intensity of circ-crRNA at different concentrations is as follows: Figure 4As shown in (A), within the range of 100-250 nM, the fluorescence intensity gradually increased with increasing circ-crRNA concentration; subsequently, further increases in circ-crRNA concentration resulted in decreased fluorescence intensity. Although the highest fluorescence intensity was observed in the 250 nM circ-crRNA group, the signal-to-noise ratio of the 200 nM circ-crRNA group was 80.9, which was higher than that of the 250 nM circ-crRNA group.
[0063] (2) The effect of different Cas12a concentrations on fluorescence intensity, the specific steps are as follows:
[0064] The reaction was carried out in a solution with a total volume of 80–100 μL containing 1× buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg / ml recombinant albumin (pH 7.9)), 200 nM circ-crRNA, 1 nM crRNA, 300 nM TA reporter, 200 nM target DNA, and Cas12a concentrations controlled at 10 nM, 50 nM, 100 nM, 200 nM, 400 nM, and 800 nM, respectively. The reaction was carried out at 37 °C for 60 min. After the reaction, the fluorescence intensity was measured, with an excitation wavelength of 480 nm, an emission range of 510–600 nm, and a step size of 2 nm.
[0065] It should be noted that controlling the concentration of circ-crRNA to 200 nM is based on the results of step (1) in Example 3.
[0066] Among them, the fluorescence intensity of Cas12a at different concentrations is as follows: Figure 4 As shown in (B), within the range of 10-50 nM, the fluorescence intensity gradually increases with increasing Cas12a concentration; however, within the range of 100-800 nM, despite continuous increases in Cas12a concentration, the fluorescence intensity gradually decreases, indicating an excess of Cas12a. The analytical results show that the signal-to-noise ratio of the 50 nM Cas12a group is 71.35, higher than other groups, indicating that the amount of Cas12a used is appropriate.
[0067] (3) The effect of different incubation temperatures on fluorescence intensity, the specific steps are as follows:
[0068] The reaction was carried out in a solution with a total volume of 80-100 μL containing 1× buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg / ml recombinant albumin (pH 7.9)), 200 nM circ-crRNA, 1 nM crRNA, 300 nM TA reporter, 200 nM target DNA, and 50 nM Cas12a. The reaction was carried out at 18 ℃, 22 ℃, 27 ℃, 32 ℃, 37 ℃, and 42 ℃ for 60 min, respectively. After the reaction, the fluorescence intensity was measured, with an excitation wavelength of 480 nm and an emission range of 510-600 nm in 2 nm increments.
[0069] It should be noted that controlling the concentration of circ-crRNA to 200 nM is based on the results of step (1) in Example 3; controlling the concentration of Cas12a to 50 nM is based on the results of step (2) in Example 3.
[0070] Among them, the fluorescence intensity at different incubation temperatures is as follows: Figure 4 As shown in (C), the fluorescence value at 37 °C reached 13931, and the signal-to-noise ratio was as high as 108.49, which is much higher than the signal-to-noise ratio at other incubation temperatures. This indicates that 37 °C is the optimal incubation temperature for the autocatalytic activation of Cas12a protein cleavage of circ-crRNA initiated by crRNA.
[0071] Example 4:
[0072] In this embodiment, the establishment of a standard curve to investigate the relationship between target DNA concentration and fluorescence intensity is carried out through the following steps:
[0073] The reaction was carried out in a solution with a total volume of 80–100 μL containing 1× buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg / ml recombinant albumin (pH 7.9)), 200 nM circ-crRNA, 1 nM crRNA, 300 nM TA reporter, 50 nM Cas12a, and target DNA, and was carried out at 37 °C for 60 min. After the reaction, the fluorescence intensity was measured, with an excitation wavelength of 480 nm, an emission range of 510–600 nm, and a step size of 2 nm.
[0074] It should be noted that the concentrations of circ-crRNA, Cas12a, and incubation temperature are based on the results described in Example 3.
[0075] Furthermore, experiments were conducted using different concentrations of target DNA, specifically 10... 8 10 7 10 6 10 5 10 4 10 3 10 2 10 1 10 0 Fluorescence intensity data were measured using fM assays. Fluorescence intensities were obtained using different concentrations of target DNA, as shown below. Figure 5 As shown, the fluorescence intensity gradually increases with increasing target DNA concentration. When the target DNA concentration is at 10... 2 -10 5 Within the specified range, the target DNA concentration showed a linear relationship with fluorescence intensity. The linear regression equation was: y = 5.44x + 344.97, R0. 2 =0.9953, where x represents the concentration of target DNA (lg fM), y represents the fluorescence intensity, and R 2 The value represents the correlation coefficient. The limit of detection (LOD) is 8.67 fM, indicating good detection sensitivity, and it can be applied to nucleic acid detection in various scenarios.
[0076] Comparative Example 1:
[0077] In this comparative example, fluorescence intensity analysis was used to investigate the effect of crRNA-induced autocatalytic activation of Cas12a protein cleavage of circ-crRNA on fluorescence signal amplification. The specific steps are as follows:
[0078] The reaction was carried out in a 20–40 μL solution containing 1× buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg / ml recombinant albumin (pH 7.9)), 100 nM Cas12a, 300 nM TAreporter, 200 nM target DNA, 1 nm crRNA, or 100 nm circ-crRNA, or 1 nm crRNA and 100 nm circ-crRNA, and was carried out at 37 °C for 50 min. After the reaction, fluorescence intensity was measured at an excitation wavelength of 480 nm, an emission range of 510–600 nm, and a step size of 2 nm.
[0079] Among them, low concentrations of crRNA (which cannot activate Cas12a), circ-crRNA (which also cannot activate Cas12a due to its own shielding effect), and low concentrations of both crRNA and circ-crRNA were used to measure and analyze fluorescence intensity by controlling the concentration variables of the three groups. This can intuitively illustrate the effect of crRNA-induced autocatalytic activation of Cas12a protein cleavage of circ-crRNA on fluorescence signal amplification.
[0080] The results are shown in Table 2. Low concentrations of crRNA cannot completely activate Cas12a. However, after low concentrations of crRNA activate a small portion of Cas12a, Cas12a non-specifically trans-cleaves a large amount of circ-crRNA in the system, continuously activating the remaining Cas12a. Subsequently, a large amount of activated Cas12a cleaves the TA-reporter, generating a strong fluorescence signal. Therefore, the effect of crRNA-induced autocatalytic activation of Cas12a protein cleavage of circ-crRNA on amplifying the fluorescence signal is obvious.
[0081] Table 2:
[0082] Group Name Main components fluorescence intensity low concentration crRNA group 1 nm crRNA 1044 circ-crRNA group 100 nm circ-crRNA 348 Low concentration crRNA and circ-crRNA group 1 nm crRNA and 100 nm circ-crRNA 22268
[0083] The above description is based on the preferred embodiments of the present invention. It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered exemplary and non-limiting in all respects. The scope of the invention is defined by the appended claims rather than the foregoing description, and all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention. No reference numerals in the claims should be construed as limiting the scope of the claims.
[0084] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.
Claims
1. A self-catalytically amplified, amplification-free CRISPR nucleic acid detection kit, characterized in that, include: The autocatalytic element comprises crRNA, Cas12a protein, and target DNA; A signal amplification element comprising circ-crRNA, Cas12a protein, target DNA, and a signal reporter molecule; The autocatalytic element and the signal amplification element together constitute a tubular reaction system. After the crRNA recognizes the target DNA, it activates the Cas12a protein, cuts the circ-crRNA and forms an autocatalytic amplification cycle, which in turn cuts the signal reporter molecule to achieve signal output.
2. The self-catalytically amplified, amplification-free CRISPR nucleic acid detection kit according to claim 1, characterized in that: The circ-crRNA is prepared by circularizing pre-crRNA and removing uncirculated linear RNA. The preparation process includes: Pre-crRNA circularization was catalyzed by T4 RNA Ligase 1 at 25-45℃. Inactivate T4 RNA Ligase 1 at 75-100℃; Non-circular RNA was digested with RNase R at 25-45℃; RNase R was inactivated at 55-80℃ to obtain circ-crRNA.
3. The self-catalytically amplified, amplification-free CRISPR nucleic acid detection kit according to claim 2, characterized in that: The nucleotide sequence of the pre-crRNA is shown in SEQ ID No. 1, and the nucleotide sequence of the circ-crRNA is shown in SEQ ID No.
2.
4. The self-catalytically amplified, amplification-free CRISPR nucleic acid detection kit according to claim 1, characterized in that: The nucleotide sequence of the target DNA is shown in SEQ ID No. 3, and the nucleotide sequence of the crRNA is shown in SEQ ID No.
5.
5. The self-catalytically amplified, amplification-free CRISPR nucleic acid detection kit according to claim 1, characterized in that: The signal reporter molecule is a short-chain DNA, namely TA reporter, with fluorescent and quenching groups labeled at both ends, and its nucleotide sequence is shown in SEQ ID No.
4. The fluorescent group is FAM and the quenching group is BHQ1.
6. The self-catalytically amplified, amplification-free CRISPR nucleic acid detection kit according to claim 5, characterized in that: The molar ratio of each component in the reaction system is: crRNA: Cas12a: circ-crRNA: target DNA: TA reporter=1: 10-800: 100-300: 1-200: 100-300.
7. The self-catalytically amplified, amplification-free CRISPR nucleic acid detection kit according to claim 1, characterized in that: The reaction system also contains 1× buffer solution, the composition of which includes: 45-55mM NaCl, 5-15mM Tris-HCl, 5-15mM MgCl2, 50-150μg / mL recombinant albumin, pH 7.8-8.
0.
8. A self-catalytically amplified, amplification-free CRISPR nucleic acid detection method based on the kit described in any one of claims 1-7, characterized in that, Includes the following steps: S1. Mix the target DNA with crRNA, Cas12a protein, circ-crRNA and signal reporter molecules to prepare a reaction system; S2. Incubate at 15-45℃ for 40-60 minutes; S3. Measure the fluorescence intensity of the reaction system and detect the target nucleic acid based on the fluorescence signal.
9. The self-catalytically amplified, amplification-free CRISPR nucleic acid detection method according to claim 8, characterized in that: The method for preparing the target DNA is as follows: Mix target-TS and target-NTS in equal molar amounts, anneal at 80-90℃ for 5-10 min, cool to room temperature and hold for 20-40 min to obtain the final product.
10. The self-catalytically amplified, amplification-free CRISPR nucleic acid detection method according to claim 8, characterized in that: The fluorescence intensity was measured under the following conditions: excitation wavelength of 480 nm and emission wavelength of 510-600 nm.