A Nanopore Sequencing Detection Method for Sarcoma EWS-ETS Fusion Genes Based on Single-End Primers

By using single-end primer amplification and nanopore sequencing technology, the problems of low detection rate and poor localization accuracy in sarcoma EWS-ETS fusion gene detection have been solved, achieving high sensitivity and high accuracy in fusion gene detection, which is suitable for clinical application.

CN122128413APending Publication Date: 2026-06-02SHANGHAI SIXTH PEOPLES HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-24
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing methods for detecting EWS-ETS fusion genes in sarcomas have problems such as low detection rate of rare fusions, high risk of primer dimers, and poor accuracy in breaking point localization. Furthermore, the nanopore sequencing detection process has not been fully adapted, making it difficult to meet clinical needs.

Method used

A single-end primer amplification strategy was adopted, combined with nanopore sequencing technology. Multiplex PCR amplification was performed using a 3' end ETS family gene-specific single primer and a 5' end universal primer. Subsequently, nanopore library construction and sequencing were carried out, and bioinformatics analysis was combined to achieve the identification of fusion genes and precise location of breakpoints.

Benefits of technology

It significantly improves the detection rate of rare fusion genes, reduces the risk of non-specific amplification, achieves ±1bp precision localization of fusion breakpoints, greatly improves detection specificity and sensitivity, and has a standardized and easy-to-operate process, making it suitable for clinical applications.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

This invention relates to a nanopore sequencing detection method for sarcoma EWS-ETS fusion genes based on single-end primers. It designs an amplification strategy combining a 3' gene-specific single primer with a universal primer, leveraging the long read advantage of nanopore sequencing. A complete detection workflow is constructed, encompassing sample pretreatment, nucleic acid extraction, single-end primer amplification, nanopore library construction and sequencing, and fusion gene identification. The clinical application pathway is also clearly defined. This invention eliminates the need for prior knowledge of the fusion partner gene, significantly improving the detection sensitivity of rare EWS-ETS fusion genes. It offers high breakpoint localization accuracy and standardized procedures, enabling efficient screening and confirmation of sarcoma fusion genes, providing reliable technical support for accurate diagnosis, prognostic assessment, and targeted therapy of sarcoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and tumor diagnostic technology, and specifically relates to a nanopore sequencing detection method for sarcoma EWS-ETS fusion genes based on single-end primers. Background Technology

[0002] Sarcoma is a common type of malignant bone and soft tissue tumor. EWS-ETS family gene fusions (such as EWSR1-FLI1, EWSR1-ERG, EWSR1-ETV1, etc.) are core driver mutations in the development and progression of sarcoma. The fusion type and breakpoint location directly determine the sarcoma classification, prognosis, and the selection of targeted therapy. Therefore, accurate detection of EWS-ETS fusion genes is a key prerequisite for precision diagnosis and treatment of sarcoma.

[0003] Currently, commonly used clinical methods for detecting sarcoma fusion genes mainly include quantitative real-time PCR, first-generation sequencing, and second-generation short-read sequencing. These methods have many technical drawbacks: traditional paired-end fixed primer amplification strategies require prior knowledge of the fusion partner gene, resulting in extremely low detection rates for rare EWS-ETS fusion variants; primer dimer formation is risky, and non-specific amplification is significant, leading to insufficient detection sensitivity and specificity; second-generation short-read sequencing has difficulty crossing repetitive sequence regions at fusion breakpoints, has poor analytical capabilities for complex structural variations, and low accuracy in breakpoint localization.

[0004] Nanopore sequencing technology, with its advantages of ultra-long reads, real-time sequencing, and no need for PCR amplification, has shown great potential in the detection of fusion genes. However, its application in the detection of fusion genes in sarcoma EWS-ETS is still limited by suitable amplification and library preparation strategies. Current technologies have not yet established single-end primer detection procedures specifically for nanopore sequencing, which cannot fully leverage the technological advantages of nanopore sequencing and fails to meet the clinical needs for highly sensitive detection of rare fusion genes and accurate analysis of complex structural variations. Summary of the Invention

[0005] This invention provides a nanopore sequencing detection method for sarcoma EWS-ETS fusion genes based on single-end primers, addressing the problems of low detection rate of rare fusions, high risk of primer dimers, poor accuracy of breakpoint localization, and lack of detection procedures adapted to nanopore sequencing in existing sarcoma EWS-ETS fusion gene detection methods.

[0006] This invention provides a nanopore sequencing detection method for sarcoma EWS-ETS fusion genes based on single-end primers, comprising the following steps: (1) Sample pretreatment: Pretreatment of FFPE tissue samples or fresh tissue samples from sarcoma patients; (2) RNA extraction and reverse transcription: Total RNA was extracted from the tissue samples and reverse transcribed into cDNA for later use; (3) Single-end primer amplification: The cDNA was amplified by multiplex PCR using an amplification strategy of a 3' end ETS family gene-specific single primer + a 5' end universal primer. The 3' end ETS family gene-specific single primer was anchored to the conserved 3' end region of the FLI1, ERG or ETV1 gene. The 5' end universal primer was a universal adapter sequence adapted for nanopore sequencing library construction. (4) Nanopore library construction and sequencing: The amplification products are purified and the library is constructed. Sequencing is performed using a nanopore sequencing platform to obtain sequencing data; (5) Fusion gene identification: Sequencing data is processed through bioinformatics analysis to identify EWS-ETS fusion genes and accurately locate breakpoints; (6) Clinical application: Based on the fusion gene determination results, clinical screening and clinical confirmation of sarcoma EWS-ETS fusion gene can be achieved.

[0007] Preferably, the pretreatment of the FFPE tissue sample in step (1) is as follows: slice the FFPE tissue sample and place it in a sterile centrifuge tube, add xylene and let it stand, then centrifuge, discard the supernatant to complete dewaxing; add ethanol and let it stand, then centrifuge, discard the supernatant to complete dehydration; finally, let it air dry in a clean bench.

[0008] Preferably, the pretreatment of fresh tissue samples in step (1) is as follows: take fresh tissue samples, cut tissue blocks and place them in sterile centrifuge tubes, add PBS buffer to wash, remove blood and impurities, and then air dry in a clean bench.

[0009] Preferably, in step (2), the total RNA is extracted using the TRIzol method combined with chloroform extraction, isopropanol precipitation, and washing with 75% cold ethanol. The extracted total RNA is dissolved in DEPC water and frozen at -70°C. Reverse transcription is performed using a reverse transcription kit, with the total RNA as a template, and cDNA is synthesized according to the kit instructions.

[0010] Preferably, the design principle of the 3' end ETS family gene-specific single primer in step (3) is as follows: length 15~30nt, Tm value 60~70℃, GC content 40%~60%, the last 12 bases of the 3' end are completely complementary to the template, and avoid three or more consecutive G / C sequences, and there are no self-complementary sequences of four consecutive bases to avoid hairpin structures; there are no complementary sequences of four consecutive bases with the universal primer to avoid primer dimers; the 5' end universal primer sequence is TTTCTGTTGGTGCTGATATTGC, Tm value 58.0℃, GC content 36.8%, this primer has no specific target region, and can bind to the universal adapter sequence introduced during reverse transcription or amplification to achieve non-specific amplification. Optionally, a 10bp UMI molecular tag (NNNNNNNNNN) can be added to the 5' end of the 5' end of the universal primer to eliminate subsequent PCR amplification bias and sequencing errors.

[0011] Preferably, the 3' end ETS family gene-specific single primer pool contains primers for FLI1 exon6 (GTCCGTCATTTTGAACTCCC), primers for the conserved 3' end region of the ERG gene (CTGGATTTGCAAGGCGGCTAC), and primers for the conserved 3' end region of the ETV1 gene (TAGTAATAGCGGAGTGAACGG), with each primer mixed in equal molar amounts.

[0012] Preferably, the multiplex PCR amplification system in step (3) comprises: 12.5 μL of 2×PCR Mix, 1 μL of 3' ETS family gene-specific single primer pool, 1 μL of 5' universal primer, 2 μL of cDNA template, and enzyme-free water to a final volume of 25 μL; the PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, for 40 cycles; 72℃ final extension for 5 min; and incubation at 4℃. The PCR amplification product is purified using magnetic beads to remove primer dimers, non-specific amplification fragments, and free primers. The purified product is eluted with TE buffer and set aside for later use.

[0013] Preferably, the nanopore sequencing platform in step (4) uses the PCR-cDNA sequencing kit SQK-PCS109. The specific steps for library construction are as follows: the PCR amplification product is purified by magnetic beads to remove primer dimers and non-specific fragments; end repair and adapter ligation are performed according to the kit instructions; after the library construction is completed, the library is loaded into the nanopore sequencing chip and sequenced using the Oxford Nanopore MinION platform. The amount of raw sequencing data is ≥5Gb, the average read length is ≥1kb, N50 is ≥5kb, and the Q value of the sequencing data is ≥7.

[0014] Preferably, the bioinformatics analysis process in step (5) is as follows: S1. Data preprocessing: Basecalling was performed on the raw nanopore sequencing data using Guppy v6.0.6 to remove low-quality reads with a Q value <7, adapter sequences, and short fragments <200bp; if the amplification primers were tagged with UMI molecules, repetitive sequence clustering was performed based on UMI to eliminate PCR amplification bias and sequencing errors. S2. Sequence alignment: Minimap2 was used to align the quality-controlled reads to the human reference genome GRCh38. S3. Fusion gene identification: Combine Arriba, STAR-Fusion, and LongGF tools to predict fusion events and screen out candidate fusion genes whose breakpoints support ≥5 reads; S4. Precise breakpoint localization: Manually verify that the breakpoint of the candidate fusion gene supports reads, requiring sequence consistency on both sides of the breakpoint >95%, and achieve ±1bp precision localization of the EWS-ETS fusion gene breakpoint. S5. Result determination: If a fusion sequence of the EWSR1 gene and the ETS family (FLI1 / ERG / ETV1, etc.) gene is detected, and the breakpoint location meets the above requirements, it is determined to be a positive fusion gene; otherwise, it is a negative result.

[0015] Preferably, the clinical application in step (6) specifically includes: (1) Clinical screening: For patients suspected of having sarcoma (such as Ewing sarcoma, primitive neuroectodermal tumor), FFPE tissue or fresh tissue samples are collected and EWS-ETS fusion gene is detected using this method; if the fusion gene is positive, the sample is included in the clinical confirmation stage; if the result is negative, further investigation is conducted in combination with the patient's clinicopathological characteristics, imaging examinations, and other molecular test results to rule out sarcoma or determine it to be a non-EWS-ETS fusion sarcoma.

[0016] (2) Clinical confirmation: For positive samples, the PacBio HiFi high-accuracy sequencing platform is used for verification to confirm the type and breakpoint location of the fusion gene; at the same time, the patient's clinical pathological data (such as histological morphology and immunohistochemical results) and imaging examination results (such as CT / MRI) are comprehensively analyzed to finally complete the clinical confirmation of the sarcoma EWS-ETS fusion gene; based on the confirmed fusion gene type and breakpoint information, a personalized targeted therapy and prognostic assessment plan is formulated for the patient.

[0017] Beneficial effects Compared with existing technologies, the detection method of the present invention has the following significant advantages: (1) Significantly improve the detection rate of rare fusion genes: The amplification strategy of using a single primer specific to the 3' end of the ETS family gene and a universal primer does not require prior knowledge of the EWSR1 fusion breakpoint location and partner gene information. It can effectively amplify unknown fusion variants and the detection sensitivity of rare EWS-ETS fusion genes reaches 0.01%, which is more than 5 times higher than the traditional double-end primer method.

[0018] (2) Reduce the risk of non-specific amplification: The 3' end specific single primer targets the conserved region at the 3' end of the ETS family gene, while the universal primer has no specific target site. This avoids the complementary pairing of the two-end primers, greatly reduces the risk of primer dimer formation, and the detection specificity is close to 100%. There are no false positive signals in the negative control.

[0019] (3) High precision in breaking point localization: Combining the advantages of ultra-long read length of nanopore sequencing, it can directly cross the repetitive sequence region of the fusion breaking point and achieve ±1bp precision localization of the fusion breaking point, which is more than 10 times higher than that of traditional second-generation sequencing, and can accurately resolve complex structural variations.

[0020] (4) The detection process is standardized and easy to operate: A complete standardized process has been constructed from sample pretreatment (adapted to FFPE / fresh tissue), RNA extraction, single-end primer amplification to nanopore library construction and sequencing, and fusion gene determination. The parameters of each step are clear and the reproducibility is good, which can be promoted and applied in clinical laboratories.

[0021] (5) Clear clinical application pathway: A two-level application pathway of clinical screening-confirmation was designed. Combined with the PacBio HiFi platform validation and multi-dimensional clinical data analysis, the clinical reliability of the test results is guaranteed. It can directly provide clear molecular basis for the accurate subtyping, prognostic assessment and targeted therapy of sarcoma.

[0022] (6) Adaptation to dynamic clinical monitoring: The single-end primer amplification strategy can be integrated into the automated nanopore library construction process and can be combined with ctDNA liquid biopsy technology to achieve a closed loop from tissue baseline detection to dynamic monitoring of blood ctDNA, providing technical support for tumor burden assessment and early recurrence warning. Attached Figure Description Detailed Implementation

[0023] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0024] Example 1 Nanopore sequencing detection of EWSR1-FLI1 fusion gene in sarcoma FFPE tissue samples based on single-end primers I. Experimental Materials 1. Sample: FFPE tissue sample from a sarcoma patient (preliminary clinical pathological diagnosis suspected Ewing sarcoma); 2. Reagents: Xylene, pure ethanol, TRIzol reagent, proteinase K, lysis buffer, chloroform, isopropanol, 75% ethanol, DEPC water, reverse transcription kit, 2×PCR Mix, magnetic bead purification kit, nanopore PCR-cDNA sequencing kit (SQK-PCS109); 3. Primers: 3' FLI1-specific single primer (GTCCGTCATTTTGAACTCCC, 10 μM), 5' universal primer (TTTCTGTTGGTGCTGATATTGC, 10 μM, with a 10 bp UMI tag added to the 5' end); 4. Instruments: High-speed refrigerated centrifuge, constant temperature incubator, PCR instrument, Oxford Nanopore MinION sequencing platform, and ultra-clean workbench.

[0025] II. Experimental Procedure 1. Sample pretreatment: Cut 15 FFPE tissue sections with a thickness of 5μm and place them in a 1.5mL sterile centrifuge tube; add 1mL xylene, incubate at 37℃ for 10min, centrifuge at 15000rpm for 5min, discard the supernatant, and repeat twice; add 1mL pure ethanol, incubate at room temperature for 5min, centrifuge at 15000rpm for 3min, discard the supernatant, and repeat three times; air dry in a clean bench for 30min.

[0026] 2. RNA extraction and reverse transcription: Add 200 μL of lysis buffer + 1 mg / mL proteinase K, incubate at 55 °C for 20 h; inactivate at 95 °C for 10 min; add 1 mL of TRIzol and mix well, incubate at 4 °C for 5 min; add 200 μL of chloroform and vortex for 15 s, incubate at 4 °C for 5 min; centrifuge at 13000 rpm at 4 °C for 10 min, collect the supernatant; add an equal volume of isopropanol and precipitate overnight at -20 °C; centrifuge at 13000 rpm at 4 °C for 10 min, discard the supernatant; wash once with 75% cold ethanol, centrifuge at 11000 rpm at 4 °C for 8 min, discard the supernatant; dissolve RNA in DEPC water and freeze at -70 °C; reverse transcribe RNA into cDNA using a reverse transcription kit and store at -20 °C.

[0027] 3. Single-end primer amplification: Prepare a 25 μL PCR system: 12.5 μL 2×PCR Mix, 1 μL FLI1 specific single primer, 1 μL universal primer, 2 μL cDNA template, and 8.5 μL enzyme-free water; Amplification program: 95℃ pre-denaturation for 3 min, 40 cycles of 95℃ for 10 s, 60℃ for 30 s, and 72℃ for 1 min, and a final extension at 72℃ for 5 min; Purify the amplification product with magnetic beads.

[0028] 4. Nanopore library preparation and sequencing: End repair and adapter ligation were performed using the SQK-PCS109 kit, and the library was purified by magnetic beads. The library was loaded into a nanopore sequencing chip and sequenced using the MinION platform, yielding 6.2 Gb of raw data, with an average read length of 1.5 kb and N50 of 6.1 kb.

[0029] 5. Fusion Gene Determination: Basecalling was performed using Guppy v6.0.6 to remove low-quality reads, resulting in 4.8Gb of high-quality reads. UMI was used for deduplication, and Minimap2 was used for alignment to GRCh38. Analysis using Arriba / STAR-Fusion / LongGF tools detected the EWSR1-FLI1 fusion sequence, with 28 reads supporting the breakpoint. Manual verification showed 98.7% sequence identity on both sides of the breakpoint, achieving ±1bp localization (fusion of EWSR1 exon7 and FLI1 exon6), confirming a positive fusion gene.

[0030] 6. Clinical Application: The sample was positive in clinical screening and was further verified using the PacBio HiFi platform, confirming the EWSR1-FLI1 exon7-exon6 fusion. Combined with the patient's clinicopathology (small round cell tumor, CD99 positive) and imaging examination (intraosseous space-occupying lesion), the final clinical diagnosis was Ewing sarcoma, and a targeted therapy plan for the EWSR1-FLI1 fusion was developed for the patient.

[0031] Example 2 Clinical screening of EWS-ETS fusion gene in fresh sarcoma tissue samples based on single-end primers Fresh biopsy tissue samples were taken from sarcoma patients and tested according to the sample pretreatment, RNA extraction, single-end primer amplification (3' end ETS family gene-specific single primer pool: equimolar mixture of FLI1 / ERG / ETV1 primers), nanopore library construction and sequencing, and fusion gene determination steps in Example 1. The results showed that no fusion sequence of EWSR1 and ETS family genes was detected, and the fusion gene was determined to be negative. Combined with the patient's clinicopathological characteristics (spindle cell sarcoma, CD99 negative) and MRI examination results, Ewing sarcoma was finally ruled out, and the sarcoma was determined to be a non-EWS-ETS fusion type, providing molecular basis for clinical diagnosis and treatment.

Claims

1. A nanopore sequencing detection method for sarcoma EWS-ETS fusion genes based on single-end primers, characterized in that, Includes the following steps: (1) Sample pretreatment: Pretreatment of FFPE tissue samples or fresh tissue samples from sarcoma patients; (2) RNA extraction and reverse transcription: Total RNA was extracted from the tissue samples and reverse transcribed into cDNA for later use; (3) Single-end primer amplification: The cDNA was amplified by multiplex PCR using an amplification strategy of a 3' end ETS family gene-specific single primer + a 5' end universal primer. The 3' end ETS family gene-specific single primer was anchored to the conserved 3' end region of the FLI1, ERG or ETV1 gene. The 5' end universal primer was a universal adapter sequence adapted for nanopore sequencing library construction. (4) Nanopore library construction and sequencing: The amplification products are purified and the library is constructed. Sequencing is performed using a nanopore sequencing platform to obtain sequencing data; (5) Fusion gene identification: Sequencing data is processed through bioinformatics analysis to identify EWS-ETS fusion genes and accurately locate breakpoints; (6) Clinical application: Based on the fusion gene determination results, clinical screening and clinical confirmation of sarcoma EWS-ETS fusion gene can be achieved.

2. The method according to claim 1, characterized in that, The pretreatment of the FFPE tissue sample in step (1) is as follows: slice the FFPE tissue sample and place it in a sterile centrifuge tube, add xylene and let it stand, then centrifuge, discard the supernatant to complete dewaxing; add ethanol and let it stand, then centrifuge, discard the supernatant to complete dehydration; finally, let it air dry in a clean bench.

3. The method according to claim 1, characterized in that, The pretreatment of fresh tissue samples in step (1) is as follows: take fresh tissue samples, cut tissue blocks and place them in sterile centrifuge tubes, add PBS buffer to wash, remove blood and impurities, and then air dry in a clean bench.

4. The method according to claim 1, characterized in that, In step (2), total RNA was extracted using the TRIzol method combined with chloroform extraction, isopropanol precipitation, and washing with 75% cold ethanol. The extracted total RNA was dissolved in DEPC water and stored at -70°C. Reverse transcription was performed using a reverse transcription kit, with total RNA as a template, and cDNA was synthesized according to the kit instructions.

5. The method according to claim 1, characterized in that, The design principles for the 3' end ETS family gene-specific single primer in step (3) are as follows: length 15~30nt, Tm value 60~70℃, GC content 40%~60%, the last 12 bases of the 3' end are completely complementary to the template, and avoid three or more consecutive G / C, and there are no self-complementary or complementary sequences of four consecutive bases to the universal primer; the 5' end universal primer sequence is TTTCTGTTGGTGCTGATATTGC, Tm value 58.0℃, GC content 36.8%.

6. The method according to claim 5, characterized in that, The 3' ETS family gene-specific single primer pool contains primer GTCCGTCATTTTGAACTCCC for FLI1 exon6, primer CTGGATTTGCAAGGCGGCTAC for the conserved 3' region of the ERG gene, and primer TAGTAATAGCGGAGTGAACGG for the conserved 3' region of the ETV1 gene, with each primer mixed in equimolar amounts.

7. The method according to claim 1, characterized in that, The multiplex PCR amplification system in step (3) includes: 12.5 μL of 2×PCR Mix, 1 μL of 3' ETS family gene-specific single primer pool, 1 μL of 5' universal primer, 2 μL of cDNA template, and enzyme-free water to a final volume of 25 μL; the PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, for 40 cycles; 72℃ final extension for 5 min; and 4℃ incubation.

8. The method according to claim 1, characterized in that, In step (4), the nanopore sequencing platform uses the PCR-cDNA sequencing kit SQK-PCS109 to construct the library. After the library construction is completed, the library is loaded into the nanopore sequencing chip and sequenced using the Oxford Nanopore MinION platform. The amount of raw sequencing data is ≥5Gb, the average read length is ≥1kb, N50 is ≥5kb, and the Q value of the sequencing data is ≥7.

9. The method according to claim 1, characterized in that, The bioinformatics analysis process in step (5) includes data preprocessing, sequence alignment, fusion gene identification, precise location of breakpoints, and result determination.

10. The method according to claim 1, characterized in that, The clinical application in step (6) is as follows: (1) Clinical screening: Tissue samples from suspected sarcoma patients are tested using this method. If the fusion gene is positive, the process proceeds to the confirmation stage; if the result is negative, further investigation is conducted based on clinical and pathological features. (2) Clinical confirmation: For positive samples, the PacBio HiFi sequencing platform is used for verification. Combined with the patient's clinical pathology and imaging results, the type and breakpoint information of the EWS-ETS fusion gene in sarcoma are finally confirmed, providing a basis for precise clinical diagnosis and treatment.