An extracellular vesicle separation and enrichment system based on bidirectional complementary nucleic acid aptamer and viscoelastic microfluidics and application thereof

Abstract

The application discloses an extracellular vesicle separation and enrichment system based on bidirectional complementary nucleic acid aptamer and viscoelastic microfluidics and application thereof, and relates to the technical field of biology.The extracellular vesicle separation and enrichment system comprises two structurally paired single-stranded nucleic acid aptamers and a microfluidic chip.The application combines the specific affinity, stable clustering of bidirectional complementary nucleic acid aptamer and the precise sorting technology of viscoelastic microfluidics to develop an extracellular vesicle separation and enrichment system, which can improve the separation recovery rate and purity of extracellular vesicles, maximally retain the structural integrity and biological activity of the vesicles, and thus meet the application requirements of basic scientific research and clinical transformation.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to an extracellular vesicle separation and enrichment system based on bidirectional complementary nucleic acid aptamers and viscoelastic microfluidics, and its applications. Background Technology

[0002] Extracellular vesicles, as important carriers of intercellular information transmission, carry biomarkers such as proteins and nucleic acids, which are key targets for early disease screening, mechanism research, and clinical diagnosis, making them a research focus in the field of bioassay. However, extracellular vesicles are present in low concentrations and are dispersed in biological samples, and they easily coexist with impurities such as lipoproteins, free proteins, and cell debris. Their efficient separation and enrichment has become a core challenge restricting basic research and clinical translation. Existing mainstream separation technologies have many shortcomings, such as: 1. Differential ultracentrifugation: It is cumbersome and time-consuming, and it is easy to cause vesicle rupture and aggregation, resulting in a low recovery rate. Furthermore, it cannot completely remove impurities such as lipoproteins and free proteins, and the purity is difficult to meet the high-end requirements of omics detection. 2. Immunoaffinity separation: This method relies on specific antibodies and magnetic beads, has high reagent costs, antibody binding is easily affected by steric hindrance, has low recovery rate, and can only separate vesicles carrying specific markers on their surface, resulting in sample bias. 3. Conventional size separation methods (ultrafiltration, size exclusion chromatography): limited resolution, high overlap between the particle size of tiny vesicles and impurities, insufficient separation purity, and the ultrafiltration process is prone to vesicle retention and loss; 4. Existing nucleic acid aptamer-assisted separation technologies: Most of them use single aptamer labeling or single-terminal complementary self-assembly, which has poor pairing stability and uneven clustering effect. They still rely on traditional separation methods and cannot achieve both high purity and high recovery rate.

[0003] The core challenges of existing technologies are: insufficient separation resolution due to small particle size, difficulty in balancing specific affinity and large-scale separation, high equipment or reagent costs, easily compromised vesicle activity, and inability to simultaneously improve purity and recovery rate. Therefore, there is an urgent need to develop a new extracellular vesicle separation and enrichment technology to achieve low-cost, high-purity, and high-recovery extracellular vesicle separation. Summary of the Invention

[0004] The purpose of this invention is to provide an extracellular vesicle separation and enrichment system based on bidirectional complementary nucleic acid aptamers and viscoelastic microfluidics, and its application, to solve the problems existing in the prior art. This extracellular vesicle separation and enrichment system can improve the separation and recovery rate and purity of extracellular vesicles, and maximize the preservation of vesicle structural integrity and biological activity, thereby meeting the application needs of basic scientific research and clinical translation.

[0005] To achieve the above objectives, the present invention provides the following solution: This invention provides an extracellular vesicle separation and enrichment system based on bidirectional complementary nucleic acid aptamers and viscoelastic microfluidics, comprising two structurally paired single-stranded nucleic acid aptamers and a microfluidic chip; The two paired single-stranded nucleic acid aptamers are a first single strand and a second single strand; The first single chain comprises three parts in sequence: the 5' complementary region of the first single chain, the specific aptamer of the extracellular vesicle transmembrane protein, and the 3' complementary region of the first single chain; The second single chain comprises three parts in sequence: the 5' complementary region of the second single chain, the specific aptamer of the extracellular vesicle transmembrane protein, and the 3' complementary region of the second single chain; The complementary region at the 5' end of the first single chain is complementary to the complementary region at the 5' end of the second single chain; the complementary region at the 3' end of the first single chain is complementary to the complementary region at the 3' end of the second single chain. The microfluidic chip includes a sample input unit, a sheath fluid input unit, a focusing channel (12), a main channel (13), a shunt unit (14), and multiple outlets; The sample input unit includes a sample inlet (6), a first focusing structure (7), and a sample buffer chamber (8). The sheath fluid input unit includes a sheath fluid inlet (9), a second focusing structure (10), and a connecting channel (11). The first focusing structure (7) and the second focusing structure (10) are respectively connected to the focusing channel (12) through the sample buffer chamber (8) and the connecting channel (11), and the focusing channel (12) is connected to the diversion unit (14) through the main channel (13); the multiple outlets include a first outlet (1), a second outlet (2), a third outlet (3), a fourth outlet (4) and a fifth outlet (5), and the diversion unit (14) is respectively connected to the first outlet (1), the second outlet (2), the third outlet (3), the fourth outlet (4) and the fifth outlet (5); The third outlet (3) is coaxially arranged along the flow direction of the main channel (13), the first outlet (1) and the fifth outlet (5) are symmetrically distributed on the upper and lower sides of the main channel (13), and the second outlet (2) and the fourth outlet (4) are symmetrically distributed on the oblique sides of the main channel (13). The first focusing structure (7) and the second focusing structure (10) are array-type micropillar structures.

[0006] Furthermore, the extracellular vesicle transmembrane protein is CD63.

[0007] Further, the nucleotide sequence of the first single strand is shown in SEQ ID NO.1; the nucleotide sequence of the second single strand is shown in SEQ ID NO.2.

[0008] The present invention also provides the application of the above-described extracellular vesicle separation and enrichment system in the preparation of products for separating extracellular vesicles.

[0009] Furthermore, the product is a reagent kit.

[0010] The present invention also provides a product for separating extracellular vesicles, comprising the above-described extracellular vesicle separation and enrichment system.

[0011] Furthermore, the product is a reagent kit.

[0012] Furthermore, the product also includes a sample phase Newtonian fluid and a sheath flow phase non-Newtonian viscoelastic fluid; The sample phase Newtonian fluid was a sterile, enzyme-free PBS buffer. The sheath flow phase non-Newtonian viscoelastic fluid is a PBS buffer containing 1000 ppm polyethylene oxide (PEO) + 50 ppm polyvinylpyrrolidone (PVP) + 20 ppm hyaluronic acid (HA).

[0013] The present invention also provides a method for isolating extracellular vesicles for purposes other than disease diagnosis or treatment, comprising the step of isolating extracellular vesicles from the sample to be isolated using the above-described extracellular vesicle isolation and enrichment system. The separation of extracellular vesicles specifically includes the following steps: After pretreatment of the sample to be separated, a pretreated sample is obtained; The pretreated sample was incubated with a diluent for the first single chain and a diluent for the second single chain to obtain a specific incubation sample labeled with the first single chain and a specific incubation sample labeled with the second single chain. The specific incubation samples labeled with the first single strand and the specific incubation samples labeled with the second single strand are mixed and clustered to obtain clustered samples. Using the microfluidic chip, the clustered sample was separated using a Newton-non-Newton biphase viscoelastic microfluidic separation method to obtain purified extracellular vesicle samples.

[0014] Furthermore, the Newtonian-non-Newtonian dual-phase viscoelastic microfluidic separation method includes the following steps: The clustered sample is diluted with a sample phase Newtonian fluid and injected into the chip sample inlet. At the same time, a sheath flow phase non-Newtonian viscoelastic fluid is injected from both sheath flow inlets, so that the fluid forms a stable co-flow focusing pattern in the chip. The purified extracellular vesicle sample was collected from the main outlet of the chip center. The sample phase Newtonian fluid was a sterile, enzyme-free PBS buffer. The sheath flow phase non-Newtonian viscoelastic fluid is a PBS buffer containing 1000 ppm PEO + 50 ppm PVP + 20 ppm HA.

[0015] The present invention discloses the following technical effects: This invention combines bidirectional complementary nucleic acid aptamer specific affinity, stable clustering, and viscoelastic microfluidic precision sorting technology to develop an extracellular vesicle separation and enrichment system. This system can improve the separation and recovery rate and purity of extracellular vesicles, and preserve the structural integrity and biological activity of vesicles to the greatest extent, thereby meeting the application needs of basic scientific research and clinical translation.

[0016] This invention enhances clustering stability through bidirectional complementary pairing, preventing vesicle detachment and loss, and significantly improving recovery rate; it thoroughly removes impurities and ensures separation purity through dual screening using aptamer-specific targeting and size sorting; it eliminates the need for expensive equipment and reagents such as ultracentrifugation and immunomagnetic beads throughout the process, significantly reducing costs; and it operates in a gentle liquid phase environment without high-speed shearing forces, thus fully preserving the vesicle structure and biological activity.

[0017] Compared with existing technologies, this invention can improve the recovery rate of extracellular vesicles, reduce the amount of residual impurities, shorten the entire separation process to within 2 hours, is easy to operate, adapts to conventional laboratory conditions, and the purified samples can be directly used for proteomics, transcriptomics, biomarker detection and functional verification experiments. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a schematic diagram of the structure of a bidirectional complementary nucleic acid trap; Figure 2 This is a schematic diagram of a viscoelastic microfluidic separation process; Figure 3 This is a schematic diagram of a microfluidic chip; where 1: first outlet; 2: second outlet; 3: third outlet; 4: fourth outlet; 5: fifth outlet; 6: sample inlet; 7: first focusing structure; 8: sample buffer chamber; 9: sheath fluid inlet; 10: second focusing structure; 11: connecting channel; 12: focusing channel; 13: main channel; 14: shunt unit; Figure 4The diagram shows the specific structure and liquid flow direction of the microfluidic chip; where A is the overall structure and liquid flow direction of the microfluidic chip; B is the physical schematic diagram of the microfluidic chip; C is the structural schematic diagram of components 7 and 10; D is the structural schematic diagram of component 14; F is the structural schematic diagram of component 12; and F is the liquid flow direction schematic diagram of component 12. Figure 5 Characterization images of NTA (A) and TEM (B) after dispersion of vesicle clusters isolated from plasma samples; where the scale bar for B is 100 nm; Figure 6 Characterization images of NTA (A) and TEM (B) of vesicle clusters separated from HEK 293T cell supernatant samples after dispersion; where the scale bar of B is 100 nm. Detailed Implementation

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0025] This invention develops an extracellular vesicle separation and enrichment system based on bidirectional complementary nucleic acid aptamers and viscoelastic microfluidics, comprising two structurally paired single-stranded nucleic acid aptamers (a first single strand and a second single strand) and a microfluidic chip. The core regions of both single-stranded nucleic acids contain the same extracellular vesicle transmembrane protein-specific aptamer sequence, allowing independent targeting and binding to transmembrane proteins on the vesicle surface. The first single strand has complementary base sequences at its 5' and 3' ends, while the second single strand's 5' end sequence is completely complementary to the first single strand's 5' end sequence, and its 3' end sequence is completely complementary to the first single strand's 3' end sequence, achieving precise bidirectional base pairing between the two strands (5' end to 5' end, 3' end to 3' end), eliminating the risk of mismatches and non-specific binding. The two aptamer strands are incubated separately with the sample to be separated, each specifically binding to the vesicle surface. After mixing, the two strands crosslink through bidirectional complementary end sequence pairing, connecting multiple individual microvesicles to form modular vesicle clusters with significantly increased particle size and uniform distribution, widening the particle size difference between the target analyte and impurities (specifically, as shown in the image). Figure 1 (As shown). The clustered samples were injected into a buffer system containing a trace amount of viscoelastic polymer, such as... Figure 2 As shown, by utilizing the synergistic effect of size-dependent viscoelastic force and inertial lift within the microfluidic channel, large-diameter vesicle clusters are focused into the same channel for enrichment and collection, while small-diameter free proteins, lipoproteins, cell debris, and unclustered single vesicles are retained in other channels and removed, thus achieving precise size sorting.

[0026] Example 1 This embodiment provides a microfluidic chip, such as Figures 3-4 As shown, the microfluidic chip includes a sample input unit, a sheath fluid input unit, a focusing channel (12), a main channel (13), a shunt unit (14), and multiple outlets; The sample input unit includes a sample inlet (6), a first focusing structure (7), and a sample buffer chamber (8); The sheath fluid input unit includes a sheath fluid inlet (9), a second focusing structure (10), and a connecting channel (11). The first focusing structure (7) and the second focusing structure (10) are connected to the focusing channel (12) through the sample buffer chamber (8) and the connecting channel (11), respectively. The focusing channel (12) is connected to the diversion unit (14) through the main channel (13). Multiple outlets include the first outlet (1), the second outlet (2), the third outlet (3), the fourth outlet (4) and the fifth outlet (5). The diversion unit (14) is connected to the first outlet (1), the second outlet (2), the third outlet (3), the fourth outlet (4) and the fifth outlet (5), respectively. The third outlet (3) is coaxially arranged along the flow direction of the main channel (13), the first outlet (1) and the fifth outlet (5) are symmetrically distributed on the upper and lower sides of the main channel (13), and the second outlet (2) and the fourth outlet (4) are symmetrically distributed on the oblique sides of the main channel (13). The first focusing structure (7) and the second focusing structure (10) are array-type micropillar structures with a micropillar spacing of 45 μm.

[0027] Example 2 1. Experimental Materials Biological samples: human plasma samples (healthy volunteers, EDTA anticoagulated, processed within 2 h after collection), HEK 293T cell culture supernatant (collected after culturing to 80% confluence in serum-free medium for 48 h).

[0028] Nucleic acid aptamers: Single-stranded DNA aptamers targeting the extracellular vesicle transmembrane protein CD63 (sequences verified in vitro and synthesized by Sangon Biotech). The two aptamer strand sequences are designed as follows: Chain 1 (aptX) CD63 ): 5'- aaagaaatct CACCCCACCTCGCTCCCGTGACACTAATGCTA acagaacata -3' (SEQ ID NO.1); where the lowercase letters are the complementary end sequence and the uppercase letters in the middle are the CD63-specific aptamer sequence; Chain 2 (aptY) CD63 ): 5'- agatttcttt CACCCCACCTCGCTCCCGTGACACTAATGCTA tatgttctgt -3' (SEQ ID NO.2); where the lowercase letters are sequences that are completely complementary to the corresponding ends of chain 1, and the uppercase letters in the middle are consistent with chain 1.

[0029] Reagents: sterile enzyme-free PBS buffer (pH 7.4), polyethylene oxide (PEO, Mw 600,000 Da, Sigma), polyvinylpyrrolidone (PVP, Mw 40,000 Da), hyaluronic acid (HA, Mw 100,000 Da), BCA protein quantification kit, Western blot reagents (CD9 / CD63 / CD81 primary antibody, HRP-labeled secondary antibody, ECL chemiluminescence solution), 0.22 μm sterile filter membrane.

[0030] Microfluidic chip: The PDMS microfluidic chip provided in Example 1.

[0031] 2. Experimental Methods 2.1 Experimental procedures of the present invention group (1) Sample preprocessing Plasma sample: Take 1 mL of EDTA-anticoagulated plasma and centrifuge it sequentially at 300×g for 10 min, 2000×g for 20 min, and 10000×g for 30 min at 4℃. Collect the supernatant after each centrifugation. Finally, filter it through a 0.22 μm sterile filter membrane to remove cells, cell debris, and large lipoprotein particles. Obtain the pretreated plasma supernatant and dilute it 150 times. Place it on ice for later use.

[0032] Cell culture supernatant: Take 10 mL of serum-free HEK 293T cell culture supernatant, process it with the same centrifugation parameters as the plasma sample above, filter it and set it aside, and finally adjust the volume to 1 mL.

[0033] (2) Nucleic acid trap preparation and vesicle targeting binding aptor dilution: aptX CD63 aptY CD63 Dilute to 10 with sterile, enzyme-free PBS buffer. -4 At a working concentration of μM, denatured at 95℃ for 5 min, then cooled in an ice bath for 10 min to restore the secondary structure, and stored at 4℃ for later use.

[0034] Specific incubation: The pretreated samples were incubated with aptX separately. CD63 aptY CD63 Mix equal volumes of the diluent and place in a 37°C incubator. Incubate with shaking (100 rpm) for 30 min to allow the aptamer core sequence to specifically bind to the CD63 protein on the vesicle surface.

[0035] (3) Bidirectional complementary pairing and clustering Clustering: will mark aptX CD63 400 μL of specific incubation sample and labeled aptY CD63 Mix 400 μL of the specific incubation sample (total volume 800 μL), then add 10×PBS buffer and mix well. Adjust the ionic strength of the system (final concentration 1×PBS), and let it stand at room temperature (25℃) for 15 min to achieve vesicle cross-linking through bidirectional end complementary sequence pairing.

[0036] Structural stability: After the clustering reaction, the samples were placed at room temperature for 5 min to stabilize the modular vesicle cluster structure and prevent disclusification during subsequent separation. The particle size of the clustered samples was pre-detected using a nanoparticle tracking analyzer (NTA, Malvern NanoSight NS300). The NTA and TEM characterization results of the dispersed vesicle clusters isolated from plasma samples and HEK 293T cell supernatant samples are shown below. Figures 5-6 .

[0037] (4) Newtonian-non-Newtonian two-phase viscoelastic microfluidic separation Fluid system preparation: ① Sample phase Newtonian fluid: sterile enzyme-free PBS buffer (pH 7.4), filtered through a 0.22 μm filter membrane, and stored at 4℃; ② Sheath flow phase non-Newtonian viscoelastic fluid: PBS buffer (pH 7.4) containing 1000 ppm PEO + 50 ppm PVP + 20 ppm HA, stirred with a magnetic stirrer for 2 h until completely dissolved, filtered through a 0.22 μm filter membrane, and stored at 4°C after removing air bubbles.

[0038] Chip pretreatment: Rinse the PDMS microfluidic chip with anhydrous ethanol, dry it with nitrogen, and then rinse the channel three times with sheath flow fluid to avoid non-specific adsorption on the channel wall. Fix the chip on a constant temperature stage and set the temperature to 25°C and keep it constant.

[0039] Injection and flow rate control: ① After clustering, the sample phase is diluted with a Newtonian fluid at a volume ratio of 1:1 (final volume 1.6 mL) and loaded into the sample syringe; the sheath flow phase non-Newtonian viscoelastic fluid is loaded into the sheath flow syringe. ② The sample syringe is connected to the chip sample inlet, and the sheath flow syringe is connected to both sheath flow inlets, both of which are connected to a micro-injection pump; ③ Set the pump parameters: sheath flow rate 1000 μL / h, sample flow rate 200 μL / h (sheath flow: sample flow = 5:1), total flow rate 1200 μL / h, start the injection pump to form a stable co-current focusing pattern of fluid within the chip.

[0040] Separation and collection: After starting the pump, wait for the fluid to flow steadily inside the chip for 3 minutes before starting collection: Use sterile centrifuge tubes to collect the target vesicle clusters from the main outlet at the center of the chip (collect 1 tube every 10 minutes, each tube is about 200 μL), connect the secondary outlets on both sides to waste liquid bottles, and continuously discharge impurities and waste liquid; after collection, store the target sample at 4℃ and complete the subsequent detection within 1 hour.

[0041] 2.2 Experimental procedures for the control group Three control groups were set up, and the experimental method was the same as above (i.e., the same as the present invention group), the only difference being the method of separation and clustering, as detailed below: Control group 1 (conventional differential ultracentrifugation): The pretreated sample was taken and ultracentrifuged at 100,000×g for 70 min at 4℃. The supernatant was discarded, and the precipitate was resuspended in 200 μL PBS to be used as the test sample. When the pretreated sample was plasma, 800 μL of plasma pretreated sample was taken and diluted to 32 mL. When the pretreated sample was HEK 293T cell supernatant, the sample volume was 32 mL.

[0042] Control Group 2 (Single-Terminal Complementary Nucleic Acid Aptamers + Ultrafiltration Separation): CD63 aptamers with only 5' end complementarity were incubated and clustered, then concentrated by ultrafiltration at 300 kDa (3000×g) for 20 min. The retentate was the test sample. The CD63 aptamers with only 5' end complementarity are as follows: Chain 3: 5'- aaagaaatct CACCCCACCTCGCTCCCGTGACACTAATGCTA-3' (SEQ ID NO.3); Chain 4:5'- agatttcttt CACCCCACCTCGCTCCCGTGACACTAATGCTA (SEQ ID NO. 4).

[0043] Control group 3 (direct viscoelastic microfluidic separation without aptamer-mediated separation): 800 μL of pretreated sample was taken, and without aptamer labeling, it was directly diluted with the sample phase fluid and then viscoelastic microfluidic separation was performed according to step (4) of this invention.

[0044] 2.3 Testing Indicators and Operating Methods For the purified samples of the present invention group and the three control groups, four core indicators were simultaneously detected, including recovery rate, purity, vesicle structure integrity, and biomarker expression. Three biological replicates were set up for each sample, and the average value of the results was taken.

[0045] Recovery rate determination (NTA method): The concentration (vesicles / mL) of vesicles (monodisperse vesicles generated after DNase I digestion and depolymerization) in the pretreated samples and the final purified samples of each experimental group was determined using a NanoSight NS300 nanoparticle tracking analyzer. The recovery rate was calculated according to the formula: Recovery rate (%) = (purified sample vesicle concentration × purified sample volume) / (pretreated sample vesicle concentration × pretreated sample volume) × 100%.

[0046] Detection parameters: detection time 60s, camera level 16, detection temperature 25℃, each sample is detected 3 times, and the average value is taken.

[0047] Purity assay (BCA protein quantification method): Using the BCA protein quantification kit, the total protein concentration (μg / μL) and vesicle particle concentration (cells / μL) of each experimental group were measured, and the purity was calculated according to the formula: Purity (vesicles / μg) = Vesicle concentration / Total protein concentration Meanwhile, the expression of impurity protein (albumin ALB) was detected by Western blot to determine the residual impurity status.

[0048] Vesicle structural integrity detection (TEM method): Take 10 μL of the sample to be tested, add DNaseI for digestion to disperse the vesicle clusters into single vesicles, then drop it onto a copper grid coated with carbon film, let it stand for 2 min, negatively stain with 2% phosphotungstic acid for 5 min, blow dry with nitrogen, and observe under a transmission electron microscope to observe the vesicle morphology, whether it ruptures / aggregates, and count the percentage of intact vesicles.

[0049] 3. Experimental Results All experimental data are expressed as mean ± standard deviation (x ± s) and analyzed using one-way ANOVA. P <0.05 indicates a statistically significant difference. P <0.01 indicates a highly significant difference.

[0050] 3.1 Recovery rate test results (NTA method) The vesicle recovery rates of plasma and cell supernatant samples in this invention group were significantly higher than those in the three control groups, and the differences were extremely significant. P <0.01), see Table 1 for specific data.

[0051] Table 1 Comparison of extracellular vesicle recovery rates among different groups (%, x±s, n=3) Experimental results show that the bidirectional complementary aptamers of the present invention have high clustering stability and no vesicle detachment. Furthermore, the viscoelastic microfluidic separation is a gentle liquid phase separation with no vesicle retention / rupture, thus significantly improving the recovery rate. Control group 1 is prone to vesicle rupture due to ultracentrifugation, control group 2 has uneven single-end complementary clustering and is prone to retention by ultrafiltration, and control group 3 has no aptamer clustering, with tiny vesicles easily discharged with impurities, all of which lead to a low recovery rate.

[0052] 3.2 Purity test results (BCA method + Western blot detection of extraneous proteins) Quantitative purity data: The purity (number of vesicle particles / total protein content) of the sample group of this invention was significantly higher than that of the three control groups, and the amount of impurities was the lowest. Specific data are shown in Table 2.

[0053] Table 2 Comparison of extracellular vesicle purity in each group (×10) 8 (particles / μg, x±s, n=3) Western blot detection of extraneous proteins: No albumin (ALB) bands were found in the samples of this invention. ALB bands were found in control groups 1, 2 and 3. Among them, control group 1 had the highest gray value and the most serious extraneous protein residue.

[0054] Experimental results show that the present invention group completely removes impurities such as free proteins and lipoproteins through dual screening of aptamer-specific targeting and viscoelastic microfluidic size sorting; while control group 1 cannot remove small molecule impurities, control group 2 cannot separate impurities with a particle size similar to that of vesicles by ultrafiltration, and control group 3 has no specific targeting and cannot completely remove impurities by size sorting alone, all of which result in low purity.

[0055] 3.3 Comparison of Separation Time Both the invention group and each control group underwent sample pretreatment. The total time mentioned below refers to the time from the start of sample pretreatment to the final collection and purification of the sample.

[0056] From sample pretreatment to final collection and purification, the entire process of this invention takes ≤2 hours (50 min for cluster incubation + 70 min for microfluidic separation), which is far shorter than existing technologies. Control group 1 (differential ultracentrifugation): total time ≥4h (including 70 min of ultracentrifugation + multiple centrifugations and resuspension); Control group 2 (single-terminal complementarity + ultrafiltration): total processing time ≥ 2.5 h; Control group 3 (direct microfluidic separation): The entire process took about 1.5 hours, but the separation effect was poor.

[0057] Example 3 Repeatability verification experiment: Human plasma samples (n=5) and HEK 293T cell culture supernatant (n=5) from different batches were repeatedly separated and purified according to the method of the present invention group in Example 2. The recovery rate, purity, and percentage of intact vesicles were tested. The results showed: The recovery rate of plasma samples ranged from 87.5% to 90.8%, with an RSD (relative standard deviation) of 1.8%. The purity of the cell supernatant sample fluctuated between 8.2 and 8.8 × 10⁻⁶. 8 pcs / μg, RSD=2.1%; The percentage of intact vesicles ranged from 95.1% to 97.2%, with an RSD of 1.0%. All indicators had RSDs below 5%, indicating that the separation and enrichment system of the present invention has good reproducibility and is suitable for large-scale experimental and clinical applications.

[0058] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An extracellular vesicle separation and enrichment system based on bidirectional complementary nucleic acid aptamers and viscoelastic microfluidics, characterized in that, It includes two structurally paired single-stranded nucleic acid aptamers and a microfluidic chip; The two paired single-stranded nucleic acid aptamers are a first single strand and a second single strand; The first single chain comprises three parts in sequence: the 5' complementary region of the first single chain, the specific aptamer of the extracellular vesicle transmembrane protein, and the 3' complementary region of the first single chain; The second single chain comprises three parts in sequence: the 5' complementary region of the second single chain, the specific aptamer of the extracellular vesicle transmembrane protein, and the 3' complementary region of the second single chain; The complementary region at the 5' end of the first single chain is complementary to the complementary region at the 5' end of the second single chain; the complementary region at the 3' end of the first single chain is complementary to the complementary region at the 3' end of the second single chain. The microfluidic chip includes a sample input unit, a sheath fluid input unit, a focusing channel (12), a main channel (13), a shunt unit (14), and multiple outlets; The sample input unit includes a sample inlet (6), a first focusing structure (7), and a sample buffer chamber (8). The sheath fluid input unit includes a sheath fluid inlet (9), a second focusing structure (10), and a connecting channel (11). The first focusing structure (7) and the second focusing structure (10) are respectively connected to the focusing channel (12) through the sample buffer chamber (8) and the connecting channel (11), and the focusing channel (12) is connected to the diversion unit (14) through the main channel (13); the multiple outlets include a first outlet (1), a second outlet (2), a third outlet (3), a fourth outlet (4) and a fifth outlet (5), and the diversion unit (14) is respectively connected to the first outlet (1), the second outlet (2), the third outlet (3), the fourth outlet (4) and the fifth outlet (5); The third outlet (3) is coaxially arranged along the flow direction of the main channel (13), the first outlet (1) and the fifth outlet (5) are symmetrically distributed on the upper and lower sides of the main channel (13), and the second outlet (2) and the fourth outlet (4) are symmetrically distributed on the oblique sides of the main channel (13). The first focusing structure (7) and the second focusing structure (10) are array-type micropillar structures.

2. The extracellular vesicle isolation and enrichment system according to claim 1, characterized in that, The extracellular vesicle transmembrane protein is CD63.

3. The extracellular vesicle isolation and enrichment system according to claim 2, characterized in that, The nucleotide sequence of the first single strand is shown in SEQ ID NO.1; the nucleotide sequence of the second single strand is shown in SEQ ID NO.

2.

4. The use of the extracellular vesicle separation and enrichment system as described in any one of claims 1-3 in the preparation of products for separating extracellular vesicles.

5. The application according to claim 4, characterized in that, The product in question is a reagent kit.

6. A product for isolating extracellular vesicles, characterized in that, The extracellular vesicle isolation and enrichment system according to any one of claims 1-3.

7. The product according to claim 6, characterized in that, The product in question is a reagent kit.

8. The product according to claim 6, characterized in that, The products also include sample phase Newtonian fluids and sheath flow phase non-Newtonian viscoelastic fluids; The sample phase Newtonian fluid was a sterile, enzyme-free PBS buffer. The sheath flow phase non-Newtonian viscoelastic fluid is a PBS buffer containing 1000 ppm polyethylene oxide, 50 ppm polyvinylpyrrolidone, and 20 ppm hyaluronic acid.

9. A method for isolating extracellular vesicles for purposes other than disease diagnosis or treatment, characterized in that, The method includes the step of separating extracellular vesicles from the sample to be separated using the extracellular vesicle separation and enrichment system according to any one of claims 1-3; The method specifically includes the following steps: After pretreatment of the sample to be separated, a pretreated sample is obtained; The pretreated sample was incubated with a diluent for the first single chain and a diluent for the second single chain to obtain a specific incubation sample labeled with the first single chain and a specific incubation sample labeled with the second single chain. The specific incubation samples labeled with the first single strand and the specific incubation samples labeled with the second single strand are mixed and clustered to obtain clustered samples. Using the microfluidic chip, the clustered sample was separated using a Newton-non-Newton biphase viscoelastic microfluidic separation method to obtain purified extracellular vesicle samples.

10. The method according to claim 9, characterized in that, The Newtonian-non-Newtonian two-phase viscoelastic microfluidic separation method includes the following steps: The clustered sample is diluted with a sample phase Newtonian fluid and injected into the chip sample inlet. At the same time, a sheath flow phase non-Newtonian viscoelastic fluid is injected from both sheath flow inlets, so that the fluid forms a stable co-flow focusing pattern in the chip. The purified extracellular vesicle sample was collected from the main outlet of the chip center. The sample phase Newtonian fluid was a sterile, enzyme-free PBS buffer. The sheath flow phase non-Newtonian viscoelastic fluid is a PBS buffer containing 1000 ppm polyethylene oxide, 50 ppm polyvinylpyrrolidone, and 20 ppm hyaluronic acid.

Images