Qtl for controlling maize kernel drying rate and its application

Abstract

The present application relates to a major QTL for controlling the dehydration rate of corn kernels, related molecular markers and their application in screening or improving the moisture content or dehydration rate of corn kernels, and belongs to the field of molecular genetics. The present application provides a major QTL for controlling the dehydration rate of corn kernels, qKDR1, and simultaneously discloses nine InDel sites significantly related to the dehydration rate of corn kernels. The present application discloses a method for screening the dehydration rate of corn kernels based on the above-mentioned Indel sites. Further, the present application discloses a method for operating qKDR1 by using genetic engineering means to change the moisture content or dehydration rate of corn kernels.

Description

Technical Field

[0001] This invention relates to the major QTLs for controlling the dehydration rate of maize kernels, related molecular markers, and their applications in screening or improving the moisture content or dehydration rate of maize kernels, belonging to the field of molecular genetics. Background Technology

[0002] Grain moisture content is a key factor affecting the quality of mechanized corn harvesting, safe storage, and economic benefits. The moisture content of the grains at harvest has a significant impact on corn harvesting, drying, storage, transportation, and processing. Excessive moisture content often causes economic losses for corn growers and operators, reduces economic benefits, and easily leads to grain mold, affecting corn quality. Furthermore, mechanized grain harvesting has become one of the main factors limiting corn production in my country, and the most critical aspect of mechanized corn grain harvesting is that the grain moisture content at harvest cannot reach the standard of ≤25% for mechanized harvesting (Wang Z, Wang X, Zhang L, Liu X, Di H, Li T, Jin X. QTL underlying field grain drying rate after physiological maturity in maize (Zea Mays L.)[J]. Euphytica, 2012, 185(3):521-528.). Therefore, the breeding of corn varieties with low grain moisture content at harvest is very important. In addition, low grain moisture content can shorten the growth cycle of corn, which is of great significance for pre-frost harvesting in high-latitude regions of my country and for not affecting wheat planting in the Huang-Huai-Hai region.

[0003] On the other hand, the appropriate harvest moisture content varies depending on the harvesting purpose. For example, corn kernels intended for silage require a high moisture content during harvest, generally controlled above 30%; while for fresh corn, to maintain better taste and nutritional value, the moisture content can be as high as 75%. Therefore, QTLs or functional genes that can control the moisture content and dehydration rate of corn kernels have significant industrial value. Summary of the Invention

[0004] To address the aforementioned issues, this invention locates a major QTL—qKDR1—controlling maize kernel moisture content and dehydration rate traits through map-based cloning. Ten molecular markers were identified within the qKDR1 region. Using the qKDR1 region and molecular markers, we can screen for maize kernel moisture content or dehydration rate traits, and we can also use genetic engineering techniques to manipulate qKDR1 to alter maize kernel moisture content or dehydration rate.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] This invention provides the application of maize genome fragments in improving maize kernel moisture content or dehydration rate traits, characterized in that the fragment positions correspond to Chromosome 1: 20,007,756 to 20,009,147 in B73 genome V4 version;

[0007] In some embodiments, the nucleotide sequence or reverse complementary sequence of the above fragment is shown as either SEQ ID NO. 1 or SEQ ID NO. 2.

[0008] The present invention also provides a molecular marker, characterized in that the marker corresponds to position 67; or position 70; or position 473; or position 513; or position 597; or position 599; or position 605; or positions 722-779; or positions 729-778; or positions 1131-1377 of the sequence shown in SEQ ID NO. 2.

[0009] The present invention also provides a method for identifying or assisting in the identification of corn kernel moisture content or dehydration rate traits, characterized by comprising the following steps: (1) detecting the above-mentioned molecular markers in the test material; (2) if the detection result is that the above-mentioned markers are present, the test material will exhibit low kernel moisture content or fast dehydration rate traits; if the detection result is that the above-mentioned markers are not present, the test material will exhibit high kernel moisture content or slow dehydration rate traits.

[0010] The present invention also provides a method for cultivating maize materials with low grain moisture content or fast dehydration rate, characterized in that a nucleic acid molecule with the sequence shown in SEQ ID NO. 2 is introduced into the maize material to be improved, and the molecular markers in the material to be tested are detected according to the above method, and materials containing the above molecular markers are screened.

[0011] The present invention also provides a method for increasing the moisture content of maize kernels or reducing the dehydration rate, characterized in that the genomic fragment corresponding to the bases between positions 501-1272 or between positions 1049-1417 of SEQ ID NO. 2 in the maize material to be improved is deleted, and plants with increased maize kernel moisture content or reduced dehydration rate are selected.

[0012] In some implementations, the above-mentioned method for deleting fragments employs gene editing methods.

[0013] In some implementations, the target DNA sequence for the gene editing described above is shown in SEQ ID NO. 3 and SEQ ID NO. 4.

[0014] This invention also provides a kit for increasing the moisture content of corn kernels or reducing the dehydration rate, characterized in that it comprises any one of the following:

[0015] (1) An RNA molecule capable of recognizing the target sequence described above; in some embodiments, the sequence of the RNA molecule described above is shown in SEQ ID NO. 5 and SEQ ID NO. 6;

[0016] (2) The DNA molecule encoding the RNA described in (1);

[0017] (3) A vector for expressing the RNA described in (1).

[0018] The present invention also provides a mutant gene, characterized in that: the nucleic acid sequence of the mutant gene is as shown in SEQ ID NO. 7 or SEQ ID NO. 8.

[0019] The present invention also provides the application of the above-mentioned molecular markers, methods, kits, and mutant genes in improving the traits of corn kernel moisture content or dehydration rate.

[0020] Compared with existing technologies, the beneficial effects of this invention are as follows: The qKDR1 major-effect QTL locus provided by this invention has the function of controlling the grain moisture content or dehydration rate trait in maize, and this QTL has not been reported in previous publications. This invention also provides a functional molecular marker closely linked to qKDR1 and a method for detecting the marker, which can specifically identify genotypes with different grain moisture content or dehydration rate expressions from a maize population, and assist in the identification and improvement of grain moisture content or dehydration rate traits in maize varieties, thereby obtaining maize varieties with different moisture contents or dehydration rates. Manipulating qKDR1 using gene editing techniques can increase maize grain moisture content and reduce dehydration rate. Attached Figure Description

[0021] Figure 1 Fine mapping and cloning of qKDR1. A: Initial mapping results of QTL linkage analysis (different colored curves represent different degrees of AUDDC index in BLUP); B: Location of the qKDR1 segment on the chromosome; C: Fine mapping of qKDR1, phenotype is AUDDC value between two water measurements; D: NIL DAN340 relative to NIL K22 Insert 6181 bp.

[0022] Figure 2 qKDR1 segment correlation analysis. Arrows indicate Indel6181, Indel50, and Indel234 markers, and the horizontal line represents the threshold (P=0.01).

[0023] Figure 3Haplotype analysis of the qKDR1 segment. Genotypes with different dehydration rates were screened using three marker combinations: Indel6181, Indel50, and Indel234, where Hap1 to Hap5 represent different haplotypes.

[0024] Figure 4 Editing qKDR1 alters the dehydration rate of maize kernels. A: Target location and sequence of qKDR1 edited in maize inbred line B104; B: Target location and sequence of qKDR1 edited in maize inbred line Zheng 58; C: Phenotypic results from the Beijing experimental site; D: Phenotypic results from the Jilin experimental site. Z58-KO1 and B104-KO2 represent knockout lines, and Z58-WT1 and B104-WT2 represent wild types. Light-colored text indicates target sequences.

[0025] Figure 5 qKDR1 activity assays for different fragments. A: Schematic diagram of fragment location and size; B: Schematic diagram of GUS reporter gene vector expression cassette; C: GUS activity; significant differences indicated by different letters. Detailed Implementation

[0026] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0027] As used herein, “maize” means any maize plant and includes all plant varieties that can be bred with maize, including the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which the plant can regenerate, plant callus, and complete plant cells in a plant or plant part, such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, etc. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' direction; amino acid sequences are written from left to right in the amino to carboxyl direction. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Committee on Biochemistry Nomenclature. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, “nucleic acid” includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and, unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the basic properties of natural nucleotides and hybridize with single-stranded nucleic acids in a manner similar to that of naturally occurring nucleotides. As used herein, the term “encoding” or “encoded” in the context of a particular nucleic acid means that the nucleic acid contains the essential information to guide the translation of that nucleotide sequence into a particular protein. Codons are used to represent the information encoding the protein. As used herein, “full-length sequence” referring to a particular polynucleotide or the protein it encodes means the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. Full-length polynucleotides encode the full-length, catalytically active form of that particular protein. The terms “polypeptide,” “polypeptide,” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. This term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. This term is also used for naturally occurring amino acid polymers. The terms “residue” or “amino acid residue” or “amino acid” are used interchangeably in this document to refer to an amino acid incorporated into a protein, polypeptide, or peptide (collectively, “protein”). Amino acids can be naturally occurring amino acids, and unless otherwise limited, may include known analogs of natural amino acids that can function in a similar manner to naturally occurring amino acids.

[0028] The term "trait" refers to the physiological, morphological, biochemical, or physical characteristics of a plant or a particular plant material or cell. In some cases, this trait is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch, or oil content of seeds or leaves, or by observing metabolic or physiological processes, such as by measuring tolerance to water deprivation or specific salt, sugar, or nitrogen concentrations, or by observing the expression levels of one or more genes, or by agronomic observations such as tolerance to osmotic stress or yield.

[0029] "Plant" includes indexes for whole plants, plant organs, plant tissues, seeds, and plant cells, as well as their offspring. Plant cells include, but are not limited to, cells from seeds, suspension cultures, plumules, meristematic regions, callus, leaves, roots, seedlings, gametophytes, sporophytes, pollen, and microspores. "Offspring" includes any subsequent generations of a plant.

[0030] In this application, the terms "comprising," "including," or variations thereof should be understood to include other elements, numbers, or steps besides those described. "Test plant" or "test plant cell" refers to a plant or plant cell in which genetic modification has taken effect, or a progeny cell of such a modified plant or cell containing the modification. "Control," "control plant," or "control plant cell" provides a reference point for measuring phenotypic changes in the test plant or plant cell.

[0031] Negative or control plants may include, for example: (a) wild-type plants or cells, i.e., plants or cells with the same genotype as the genetically modified starting material, the genetic modification producing the test plants or cells; (b) plants or plant cells with the same genotype as the starting material but transformed with an empty construct (i.e., a construct with no known effect on the target trait, such as a construct containing the target gene); (c) plants or plant cells that are non-transformed isomers of the test plants or plant cells; (d) plants or plant cells that are genetically identical to the test plants or plant cells but not exposed to conditions or stimuli that would induce the expression of the target gene; or (e) the test plants or plant cells themselves, which are under conditions where the target gene is not expressed.

[0032] Those skilled in the art will readily recognize that advances in molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, have provided a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequences and potential gene sequences of proteins of interest in agriculture.

[0033] In some embodiments, the nucleotide sequence of this application may be modified to perform conserved amino acid substitutions. Principles and examples of conserved amino acid substitutions are further described below. In some embodiments, the nucleotide sequence of this application may be substituted without altering the amino acid sequence according to disclosed monocotyledonous codon preferences; for example, a codon encoding the same amino acid sequence may be substituted with a codon preferred by monocotyledons without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application may be substituted with a different codon encoding the same amino acid sequence, thereby changing the nucleotide sequence without altering the encoded amino acid sequence. Conserved variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiments due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in this application may be substituted according to a codon preferred by monocotyledons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side-chain substituents, such as the hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituents having the various properties considered above are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978), *Atlas of Protein Sequence and Structure* (Natl. Biomed. Res. Found., Washington, D. C.) (incorporated herein by reference). Conserved substitutions, such as replacing one amino acid with another amino acid having similar properties, can be performed. Identification of sequence consistency includes hybridization techniques. For example, a known nucleotide sequence, in whole or in part, can be used as a probe for selective hybridization with other corresponding nucleotide sequences present in cloned genomic DNA fragments or cDNA fragment groups (i.e., genomic libraries or cDNA libraries) from a selected organism. The hybridization probe may be a genomic DNA fragment, cDNA fragment, RNA fragment, or other oligonucleotide, and may be labeled with a detectable group such as 32P or other detectable markers. Thus, for example, hybridization probes can be prepared by labeling synthetic oligonucleotides based on sequences from the embodiment. Methods for preparing hybridization probes and constructing cDNA and genomic libraries are generally known in the art. Hybridization of the sequences can be performed under stringent conditions. As used herein, the terms "stringent conditions" or "stringent hybridization conditions" refer to conditions under which the probe will hybridize with its target sequence to a detectable extent (e.g., at least 2, 5, or 10 times the background) relative to hybridization with other sequences.Harshness conditions are sequence-dependent and vary across different environments. By controlling hybridization harshness and / or washing conditions, target sequences 100% complementary to the probe can be identified (homologous probe method). Alternatively, harshness conditions can be adjusted to allow for some sequence mismatches in order to detect lower similarities (heterologous probe method). Typically, probe lengths are less than about 1000 or 500 nucleotides. Typically, harshness conditions are those where the salt concentration is less than about 1.5 M Na ions at pH 7.0 to 8.3, typically about 0.01 M to 1.0 M Na ion concentration (or other salts), and the temperature conditions are: at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Harshness conditions can also be achieved by adding a destabilizing agent such as formamide. Exemplary low-tightness conditions include hybridization at 37°C using 30% to 35% formamide buffer, 1 M NaCl, and 1% SDS (sodium dodecyl sulfate), followed by washing at 50°C to 55°C in 1 to 2× SSC (20× SSC = 3.0 M NaCl / 0.3 M trisodium citrate). Exemplary medium-tightness conditions include hybridization at 37°C using 40% to 45% formamide, 1.0 M NaCl, and 1% SDS, followed by washing at 55°C to 60°C in 0.5× to 1× SSC. Exemplary high-tightness conditions include hybridization at 37°C using 50% formamide, 1 M NaCl, and 1% SDS, followed by a final wash at 60°C to 65°C in 0.1× SSC for at least about 20 minutes. Optionally, the wash buffer may contain about 0.1% to about 1% SDS. Hybridization duration is typically less than about 24 hours, typically from about 4 hours to about 12 hours. Specificity typically depends on post-hybridization washing, with key factors being the ionic strength and temperature of the final washing solution. The Tm (thermodynamic melting point) of DNA-DNA hybrids can be approximated by the formula from Meinkoth and Wahl (1984) Anal. Biochem. 138: 267-284: Tm = 81.5℃ + 16.6(logM) + 0.41(%GC) - 0.61(%formamide) - 500 / L; where M is the molar concentration of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, "formamide%" is the percentage of formamide in the hybridization solution, and L is the base pair length of the hybrid. Tm is the temperature at which 50% of the complementary target sequence hybridizes with a perfectly matched probe (at a given ionic strength and pH). Washing is typically performed at least until equilibration is reached and a low hybridization background level is achieved, such as for 2 hours, 1 hour, or 30 minutes. Each 1% mispairing should lower Tm by approximately 1°C; therefore, Tm, hybridization, and / or washing conditions can be adjusted to hybridize with the desired sequence of consistency.For example, if a sequence with ≥90% homology is required, the Tm can be lowered by 10°C. Typically, stringency conditions are chosen to be approximately 5°C lower than the Tm of the specific sequence and its complementary sequence at the defined ionic strength and pH. However, under very stringent conditions, hybridization and / or washing can be performed at 4°C lower than the stated Tm; under moderately stringent conditions, hybridization and / or washing can be performed at 6°C lower than the stated Tm; and under low stringency conditions, hybridization and / or washing can be performed at 11°C lower than the stated Tm.

[0034] In some embodiments, a fragment of a nucleotide sequence and the amino acid sequence it encodes is also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide of an embodiment or a portion of the amino acid sequence of a polypeptide. A fragment of the nucleotide sequence may encode a protein fragment that retains the biological activity of the native or corresponding full-length protein and thus has protein activity. Mutant proteins include biologically active fragments of native proteins containing consecutive amino acid residues that retain the biological activity of the native protein. Some embodiments also include transformed plant cells or transgenic plants containing a nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed using an expression vector containing a nucleotide sequence of at least one embodiment and a promoter operatively linked thereto that drives expression in plant cells. Transformed plant cells and transgenic plants represent plant cells or plants whose genome contains a heteropolynucleotide. Generally, the heteropolynucleotide is stably integrated into the genome of the transformed plant cell or transgenic plant to pass the polynucleotide to offspring. The heteropolynucleotide may be integrated into the genome alone or as part of an expression vector. In some embodiments, the plants involved in this application include plant cells, plant protoplasts, plant cell tissue cultures capable of regenerating plants, plant callus, plant masses, and plant cells that are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, ears, rachis, husks, straw, roots, root tips, anthers, etc. This application also includes plant cells, protoplasts, tissues, callus, embryos, flowers, stems, fruits, leaves, and roots derived from transgenic plants of this application or their progeny, and thus at least partially containing the nucleotide sequences of this application.

[0035] In the context of nucleic acid amplification, the term "amplification" refers to any process in which additional copies of a selected nucleic acid (or its transcribed form) are produced. Common amplification methods include replication methods based on various polymerases, including polymerase chain reaction (PCR), ligase-mediated methods such as ligase chain reaction (LCR), and amplification methods based on RNA polymerases (e.g., via transcription).

[0036] An allele is “associated” with a trait when it is linked to the trait, and when the presence of an allele is an indicator that the desired trait or the form of the trait will occur in a plant containing the allele.

[0037] As used in this article, the term "quantitative trait locus" or "QTL" refers to a polymorphic locus that has at least one allele associated with differential expression of a phenotypic trait in at least one genetic context (e.g., in at least one breeding population or offspring). QTLs can function through single-gene or multi-gene mechanisms.

[0038] The term "QTL mapping" used in this article refers to the method of locating QTLs on a genetic map using methods similar to single-gene mapping, determining the distance between the QTL and the genetic marker (expressed as recombination rate). Depending on the number of markers, it can be divided into single-marker, double-marker, and multi-marker methods. Based on the statistical analysis methods, it can be divided into variance and mean analysis, regression and correlation analysis, moment estimation, and maximum likelihood estimation, etc. Based on the number of marker intervals, it can be divided into zero-interval mapping, single-interval mapping, and multi-interval mapping. In addition, there are comprehensive analysis methods that combine different methods, such as QTL composite interval mapping (CIM), multi-interval mapping (MIM), multiple QTL mapping, and multi-trait mapping (MTM).

[0039] The term "molecular marker" as used in this article refers to a specific DNA segment that reflects a certain difference in the genome of an individual or population.

[0040] The term "major gene" used in this article refers to a gene that determines a trait by a single gene. The term "minor gene" refers to several non-allelic genes that each has only a partial influence on the phenotype of the same trait; such genes are called additive genes or polygenes. In additive genes, each gene has only a small phenotypic effect, hence the name minor gene.

[0041] The term "inbred line" used in this article refers to a line obtained by self-pollinating under artificially controlled self-pollination for several generations, continuously eliminating undesirable rows of ears, and selecting individual plants with better agronomic traits for self-pollination, thereby obtaining a line with more uniform agronomic traits and a simpler genetic basis.

[0042] The term "backcross" as used in this article refers to the method of hybridizing the F1 generation with either of the two parents.

[0043] As used herein, the term "hybridization" or "hybrid" refers to the fusion of gametes (e.g., cells, seeds, or plants) that produce offspring through pollination. This term includes sexual hybridization (one plant being pollinated by another) and self-pollination (self-pollination, such as when pollen and ovules come from the same plant). The term "hybridization" refers to the gamete fusion that produces offspring through pollination.

[0044] The term "backcross" as used in this article refers to the process in which the hybrid offspring are repeatedly backcrossed with one of the parents. In a backcross scheme, the "donor" parent refers to the parental plant that possesses the desired gene or locus to be infiltrated. The "recipient" parent (used once or multiple times) or "recurrent" parent (used twice or multiple times) refers to the parental plant into which the gene or locus is infiltrated. The initial hybridization produces the F1 generation; then, the term "BC1" refers to the second use of the recurrent parent, "BC2" refers to the third use of the recurrent parent, and so on.

[0045] As used herein, the term "tightly linked" refers to a recombination frequency between two linked loci of equal to or less than about 10% (i.e., a segregation frequency of no more than 10 cM on a genome map). In other words, tightly linked loci co-segregate at least 90% of the time. Marker loci are particularly useful in this invention when they show a significant probability of co-segregation (linkage) with a desired trait (e.g., pathogen resistance). Tightly linked loci, such as marker loci and second loci, may show an intralocular recombination frequency of 10% or less, preferably about 9% or less, more preferably about 8% or less, more preferably about 7% or less, more preferably about 6% or less, more preferably about 5% or less, more preferably about 4% or less, more preferably about 3% or less, more preferably about 2% or less. In a highly preferred embodiment, the associated loci show a recombination frequency of about 1% or less, for example, about 0.75% or less, more preferably about 0.5% or less, more preferably about 0.25% or less. Two loci located on the same chromosome, and whose distance between them such that the recombination frequency between the two loci is less than 10% (e.g., approximately 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, 0.25%, or lower), are also referred to as "close to each other." In some cases, two different markers can have the same genomic map coordinates. In that case, the two markers are close enough that the recombination frequency between them is so low as to be undetectable.

[0046] Centiliter (“cM”) is a unit of measurement for recombination frequency. 1 cM is equal to the 1% probability that a marker at one locus will separate from a marker at a second locus after a single-generation cross.

[0047] A "favorable allele" is an allele at a specific locus that confers or contributes to an agronomically desired phenotype, such as increased kernel water content in maize, and allows for the identification of plants with the agronomically desired phenotype. A marked "favorable" allele is a marker allele that cosegregates with the favorable phenotype.

[0048] A "gene map" is a description of gene linkages between loci on one or more chromosomes in a given species, typically presented as a graph or table. For each gene map, the distance between loci is measured by the frequency of recombination between them, and recombination between loci can be detected using various markers. A gene map is the product of the mapping population, the types of markers used, and the polymorphic potential of each marker across different populations. The order and genetic distance between loci in one gene map may differ from those in another. However, using a general frame of common markers allows for the association of information between one map and another. Those skilled in the art can use the frame of common markers to identify marker locations and loci of interest on individual gene maps.

[0049] "Genographic location" is the position on the gene map relative to the surrounding genetic markers on the same linkage group, where the specified marker can be found in a given population.

[0050] "Gene mapping" is a method for defining linkage relationships at gene loci, which is performed using genetic markers, marker segregation, and standard genetic principles of recombination frequency.

[0051] "Genetic recombination frequency" is the frequency of exchange events (recombination) between two loci. Recombination frequency can be observed after marker and / or segregation of traits following meiosis.

[0052] The term "genotype" is the genetic makeup of an individual (or group of individuals) at one or more loci, as opposed to an observable trait (phenotype). A genotype is defined by the alleles at one or more known loci that the individual has inherited from their parents. The term genotype can be used to refer to an individual's genetic makeup at a single locus, at multiple loci, or more generally, to refer to the genetic makeup of all the genes in an individual's genome.

[0053] "Germium" refers to the genetic material of an individual (e.g., a plant), a group of individuals (e.g., a plant strain, variety, or family), or a clone derived from or obtained from a strain, variety, species, or culture. Germium can be a part of an organism or cell, or can be isolated from an organism or cell. Germium typically provides genetic material and specific molecular structure that provides the physical basis for some or all of the heritable traits of an organism or cell culture. As used herein, germplasm includes cells, seeds, or tissues from which new plants can grow, or plant parts such as leaves, stems, pollen, or cells that can be cultured into a whole plant.

[0054] A “marker” is a nucleotide sequence or its encoded product (e.g., a protein) used as a reference point. For markers used to detect recombination, they need to detect differences or polymorphisms within the monitored population. For molecular markers, this means that differences at the DNA level are due to differences in multiple nucleotide sequences (e.g., SSRs, RFLPs, FLPs, and SNPs). Genomic variability can originate from any source, such as the presence and sequence of insertions, deletions, duplications, repetitive elements, point mutations, recombination events, or transposons. Molecular markers can be derived from the genome or expressed nucleic acids (e.g., ESTs) and can also refer to nucleic acids used as probes or primer pairs that can amplify sequence fragments using PCR-based methods.

[0055] Markers corresponding to genetic polymorphisms among population members can be detected using methods established in the art. These methods include, for example, DNA sequencing, PCR-based sequence-specific amplification methods, restriction fragment length polymorphism detection (RFLP), isoenzyme labeling detection, polynucleotide polymorphism detection (ASH) via allele-specific hybridization, amplified variable sequence detection of plant genomes, autonomous sequence replication detection, simple repeat sequence detection (SSR), single nucleotide polymorphism detection (SNP), or amplified fragment length polymorphism detection (AFLP). Established methods are also known for detecting expressed sequence tags (ESTs) and SSR markers derived from EST sequences, as well as randomly amplified polymorphic DNA (RAPD).

[0056] A “marker allele” or “marker locus allele” can refer to one of several polymorphic nucleotide sequences located at a marker locus in a population, which is polymorphic with respect to the marker locus.

[0057] A “labeled probe” is a nucleic acid sequence or molecule that can be used to identify the presence or absence of a marker locus by nucleic acid hybridization, such as a nucleic acid molecular probe complementary to a marker locus sequence. A labeled probe containing 30 or more adjacent nucleotides (“all or part” of the marker locus sequence) can be used for nucleic acid hybridization. Alternatively, in some respects, a molecular probe refers to any type of probe capable of distinguishing (i.e., genotyping) specific alleles present at a marker locus.

[0058] As described above, when identifying linked loci, the term "molecular marker" can be used to refer to a genetic marker, or its encoded product (e.g., a protein) used as a reference point. Markers can be derived from genomic nucleotide sequences or expressed nucleotide sequences (e.g., from spliced ​​RNA, cDNA, etc.), or from encoded polypeptides. The term also refers to nucleic acid sequences complementary to or flanked by marker sequences, such as nucleic acids used as probes or primer pairs capable of amplifying marker sequences. A "molecular marker probe" is a nucleic acid sequence or molecule that can be used to identify the presence or absence of a marker locus, such as a nucleic acid probe complementary to a marker locus sequence. Alternatively, in some respects, a molecular probe refers to any type of probe capable of distinguishing (i.e., genotype) specific alleles present at a marker locus. Nucleic acids are "complementary" when they hybridize specifically in solution, for example, according to the Watson-Crick base pairing principle. Some markers described herein are also called hybridization markers when located in insertion / deletion regions, such as the non-collinear regions described herein. This is because insertion regions are polymorphisms concerning the absence of insertions. Therefore, the marker only needs to indicate the presence or absence of the insertion / deletion region. Any suitable marker detection technique can be used to identify such hybridization markers, such as KASP technique or PCR amplification.

[0059] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s *Molecular Cloning: A Laboratory Manual* (Sambrook J & Russell DW, 2001), or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available and conventional methods well known to those skilled in the art.

[0060] Example 1: QTL Identification of Moisture Content in Corn Kernels

[0061] Using a population of 201 recombinant inbred lines obtained by crossing maize inbred lines DAN340 and K22, QTL loci for maize kernel dehydration rate were detected. The DAN340 / K22 recombinant inbred line population was planted in five geographical locations in China using a randomized block design: 2013, Hainan (Sanya; 109.19°E, 18.38°N); 2014, Hubei (Wuhan; 114.32°E, 30.58°N), Henan (Xinxiang; 113.81°E, 35.20°N), Liaoning (Shenyang; 123.47°E, 41.68°N), and Jilin (Gongzhuling; 124.83°E, 43.51°N). The moisture content of maize kernels was measured at five consecutive stages at 34, 40, 46, 52, and 58 days post-pollination. The area under the dry down curve (AUDDC) was calculated to measure the rate of kernel dehydration (AUDDC: moisture content change index; assessment method: Yang J, Carena M and Uphaus J. Area under the dry down curve (AUDDC): a method to evaluate rate of dry down in maize[J]. Crop Sci., 2010, 50(6):2347-2354.). A mixed linear model was used to calculate the best linear unbiased predictor value (BLUP) to eliminate the influence of environmental factors. The BLUP value for each line was used as the phenotype for QTL mapping. Ultimately, a major QTL, qKDR1, was detected on the left arm of chromosome 1, which explained 9.81% of the phenotypic variation. Fine-tuning of the qKDR1 stage was employed, heterozygous individuals were planted to screen for novel recombination events, flanking markers of the qKDR1 region were used to identify new recombinants, and novel molecular markers were developed to determine breakpoints in identified recombinants. For new recombinants, the Student's Test was used to assess the NILs of progeny. DAN340 and NIL K22 The dehydration rates of homozygous individuals were compared. By integrating the QTL localization information of all recombinants, the QTL was narrowed down to a 1417 bp non-coding region. The markers and sequences used for fine localization of qKDR1 are shown in Table 1.

[0062]

[0063] Continued from the table above

[0064]

[0065] Name_F and Name_R represent the names of the forward and reverse primers, respectively.

[0066] Through several quarters of fine mapping, the QTL was located to a 1417 bp segment on chromosome 1 of maize. This segment corresponds to Chromosome 1: 20,007,756-20,009,147 in the B73 V4 genome. This segment is located in a non-coding region between genes and has no functional annotation. Sequence analysis of this segment in near-isogenic lines showed that NIL... DAN340 It is 7592 bp (as shown in SEQ ID NO. 1), NIL K22 It is 1417 bp (as shown in SEQ ID NO. 2), NIL DAN340 Compared to NIL K22 An additional 6181 bp insertion fragment exists between positions 722 and 779 of SEQ ID NO. 2. Figure 1 ). with NIL DAN340 In comparison, NIL K22 The two NILs exhibited a faster grain dehydration rate, but showed little difference in other agronomic traits (Table 2). This indicates that qKDR1 controlled the dehydration rate without affecting yield or other agronomic traits. Further analysis using sequencing and PCR revealed 9 loci significantly associated with grain dehydration rate in 399 population samples from different genetic backgrounds. These loci were located at Chr1:20007822 (N1), Chr1:20007825 (N2), Chr1:20008218 (N3), Chr1:20008258 (N4), Chr1:20008336 (N5), Chr1:20008338 (N6), Chr1:20008344 (N7), Chr1:20008466-20008515 (Indel50), and Chr1:20008872-20009107 (Indel234). Figure 2 The markers correspond to positions 67, 70, 473, 513, 597, 599, 605, 729-778, and 1131-1377 of the sequence shown in SEQ ID NO. 2.

[0067] 18HN represents the phenotypic experiment conducted in Hainan in 2018; N represents the sample size; the p-value was evaluated using a two-tailed t-test.

[0068] Example 2 Cloning of the corn kernel moisture content gene

[0069] The 10 trait-related loci mentioned above can be used as detection targets to assist in the identification or screening of maize materials with different grain moisture content or dehydration rates.

[0070] This embodiment selects the loci located at Chr1:20008493 and Chr1:20008878 (named Indel50 and Indel234, respectively) and NIL. DAN340 Compared to NIL K22 The inserted fragment (named Indel6181) was used as a filter marker to design a detection method.

[0071] Design primer pairs MCK57_3F: GTGGTGCATGCATTGTTCAT and MCK57_R: GTCTACAGCCACGAACACGA to detect Indel6181 markers, using NIL. K22 Using genotype as a reference, genotypes with a 6181 bp inserted band were selected to identify those with slow dehydration, while genotypes with no inserted band were selected to identify those with fast dehydration. Primer pairs QDR1_F: TCACACGGGACAATCTGTAG and QDR1_R: AGGAAGCTTGTGCGAATTTG were designed to detect the Indel50 marker, using NIL... K22 Using genotype as a reference, bands with a 50 bp deletion (corresponding to bases 729-778 of the sequence shown in SEQ ID NO. 2) were used to screen for genotypes with slow dehydration, while bands without deletions were used to screen for genotypes with fast dehydration. MCK57_7F: CGCACTGCAGCTTCGTAGTC and MCK57_R: GTCTACAGCCACGAACACGA primer pairs were designed to detect the Indel234 marker, using NIL... K22Using genotype as a reference, a 234 bp inserted band was used to screen for genotypes with slow dehydration, while a band without insertion was used to screen for genotypes with fast dehydration; Indel234 corresponds to SEQ ID NO. The sequence at positions 1131-1377 of the sequence shown in 2 is "GATATATATAGCCGCGCGCAATACGCACATGCATCATGCATGGGGGACAGGTTGCTCTTATGATCTATCGGCAAGCTGGAGATGCTAGCTGCTGCTGCGTCCATGCGTTGTTCTTCTTTAGCCGTCAGGCATGGACCTGACTGGAACCAACCGAATTCCTGAGTTTCTTC TCTTTTTTTCCCCTCGCGTACCTGCGCTGCGCTGCGCAGGGCATGTGACGCAGCCACATCTCGAACTTAACGAGAG" is replaced with the sequence "CATGGACCTGACTGGAAACCAACCGAATTCCTGAGTTTCTTCTCTTTTTTCCCCCTTCGCGTACGTACCTGCGCTGCGCAGGGCATGTGAGGCTACCCGCAGTGATAT The sequence "AGGTAAAGAAGACGCCACCAATATAAGGCTAGGTATAGAGTAAAATTTTACTGCAGTGGAGTACTCTATAGGTAGCTGTAAACTTATGGGGGGCAAACAAAACGCTATTTACAGCGTCGATGCTTTTTTACTCTATCAGTCCACACGTCCATGCAGCAGGTACGGTGCCGAGCGCCATCAGCCGGTGTGGCAGTAGGGGACAAAAAAAGATATATAATATATGTAGTGATTGATATAGAGTTGATGTATGGAGTAAATATGACTGCAGTAGATTATGATATAGGGTAGAGAATCTTGATGATGAGGATAGAATATTTCTTTTAGAGTAGAAATTTAGAGTAGCCTGACGCAGCCCAT" is 234 bp longer than the original sequence. The remaining seven marker sites can also be selected using primers designed based on relevant gene sequences. Using a combination of three markers—Indel6181, Indel50, and Indel234—to screen for genotypes with different dehydration rates, the associated population can be divided into five haplotypes, including Hap1 and NIL. K22 Similar genotypes, fastest dehydration; Hap2 and NIL DAN340Genotypes are similar, and dehydration is slower; the Hap5 genotype dehydrates the slowest. Figure 3 ).

[0072] The specific molecular marker detection operation is a standard procedure, for example, you can refer to the content of Example 3 of CN114989281A.

[0073] Example 3: Editing the qKDR1 section to regulate the grain dehydration rate

[0074] This invention further attempts to utilize CRISPR-Cas9 technology to knock out the qKDR1 region in maize inbred lines Zheng 58 and B104 to test the technical effectiveness of this approach. The qKDR1 region in Zheng 58 and B104 is identical to the K22 and DAN340 genotypes, respectively. The designed target locations and sequences are as follows: Figure 4 As shown. For other maize gene editing procedures, please refer to Example 2 of CN112646013A.

[0075] In this embodiment, gene editing generated two mutants, Z58-KO1 and B104-KO2, in Zheng 58 and B104. Compared with wild-type plants, both the Z58-KO1 and B104-KO2 knockout lines exhibited a slower dehydration rate. Figure 4 The results show that manipulating qKDR1 can alter the dehydration rate of maize kernels. Furthermore, knocking out qKDR1 only slightly affects a few agronomic traits (Table 3), while most agronomic traits remain unaffected. Therefore, manipulating qKDR1 can improve the dehydration rate of maize kernels, creating maize germplasm with different moisture contents and dehydration rates.

[0076] 22BJ and 22JL represent phenotypic experiments conducted in Beijing and Jilin in 2022, respectively; the p-value was evaluated using a two-tailed t-test.

[0077] This invention further utilizes a dual reporter gene vector to truncate qKDR1 into different fragments and insert them into the posterior end of the GUS gene, where NIL... DAN340 The fragment is qKDR1 2D and qKDR1 3D NIL K22 The fragment is qKDR1 2K qKDR1 3K qKDR1 4K qKDR1 5K ( Figure 5 After ligation into the vector, the expression level of the reporter gene was detected, and qKDR1 was found. 3D qKDR1 2K qKDR1 3K qKDR1 4KqKDR1 5K Both can inhibit the expression of the GUS gene. Figure 5 This indicates that the core area where qKDR1 functions is qKDR1. 5K This refers to the 369 bp region located at positions 1049-1417 of the SEQ ID NO. 2 sequence. Therefore, deleting the segment between positions 1049-1417 can achieve the technical effect of reducing the dehydration rate and increasing the moisture content of the grains.

[0078] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A molecular marker, characterized in that, The mark corresponds to the 67th position, or the 70th position, or the 473rd position, or the 513th position, or the 597th position, or the 599th position, or the 605th position, or the 722nd-779th positions, or the 729th-778th positions, or the 1131st-1377th positions.

2. A method for identifying or assisting in the identification of corn kernel moisture content or dehydration rate traits, characterized in that, The steps include: (1) detecting the molecular marker described in claim 1 in the test material; (2) if the test result shows that the material contains the marker, the test material will exhibit the characteristics of low grain moisture content or fast dehydration rate; if the test result shows that the material does not contain the marker, the test material will exhibit the characteristics of high grain moisture content or slow dehydration rate.

3. A method for cultivating maize materials with low grain moisture content or rapid dehydration rate, characterized in that, The nucleic acid molecule with the sequence shown in SEQ ID NO. 2 is introduced into the maize material to be improved, and the molecular marker described in claim 1 is detected in the material to be tested according to the method of claim 2, and materials containing the molecular marker described in claim 1 are screened.

Images