Goldfish molecular marker assisted breeding method
By using molecular marker-assisted breeding and image recognition technology, the problems of germplasm degradation and imperfect strains caused by inbreeding in goldfish breeding have been solved. A new goldfish strain, 'Wangtianzhu', with visible pupils when viewed from above and a rounded body, has been obtained, realizing germplasm management and intellectual property protection.
Patent Information
- Application Number
- CN202610555196.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-24
- Publication Date
- 2026-08-25
- Estimated Expiration
- 2046-04-24
AI Technical Summary
There is a problem of genetic degradation caused by inbreeding in existing goldfish breeding, and there is a lack of strains on the market that combine visible pupils when viewed from above with a round and beautiful body shape. Furthermore, there is insufficient genetic management and intellectual property protection.
Using molecular marker-assisted breeding, independent families were constructed by selecting parents carrying specific molecular markers for orthogonal and reciprocal crosses. Genotyping was performed in the early F2 generation, and image recognition technology was used to determine the traits of "Sky Eye" and "Pearl Scale" to obtain the new F3 generation goldfish strain "Sky Pearl". Molecular markers were then used for germplasm tracking.
The breeding cycle was shortened, the breeding cost was reduced, and a healthy new goldfish strain, 'Wangtianzhu', was obtained. It has the characteristics of "sky-gazing eyes" and pearl scales, meets the aesthetic demands of the market, and achieves germplasm protection through molecular markers.
Smart Images

Figure CN122162734B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of ornamental fish genetic breeding technology. More specifically, this invention relates to a molecular marker-assisted breeding method for goldfish. Background Technology
[0002] Balloon pearl goldfish are beloved by aquarium enthusiasts for their unique spherical body shape and pearl-like scales. Currently, the mainstream balloon pearl goldfish on the market are mainly divided into three types based on eye characteristics: mouse-head balloon pearl, dragon-eye balloon pearl, and normal-eye balloon pearl. Among them, the mouse-head balloon pearl is considered a premium variety, with its eyes sunken inwards (commonly known as "nest eyes"), completely invisible when viewed from above, creating a unique visual aesthetic with its rounded body. However, this strain requires demanding breeding techniques and has an extremely low rate of producing high-quality specimens, resulting in a high price that fails to meet the needs of the mass market.
[0003] While Dragon Eye Ball Pearls and Normal Eyelid Ball Pearls are relatively easy to cultivate and have a low culling rate, they suffer from significant aesthetic defects: when viewed from above, the observer can only see the back of the eyeball and not the pupil, lacking visual interaction and appearing abrupt and unattractive; when viewed from the side, although the pupil is visible, their spherical shape gives a sense of deformity. Therefore, these two varieties have limited popularity in the market. In summary, existing Ball Pearl varieties cannot simultaneously satisfy the dual aesthetic requirements of "the pupil being visible when viewed from above" and "a perfectly round and beautiful shape."
[0004] Furthermore, in goldfish breeding practices, due to long-term and extensive artificial selection, severe inbreeding is prevalent within strains. This directly leads to a significant decline in the health and survival rate of offspring, resulting in prominent genetic degradation and becoming an industry-wide problem restricting the sustainable development of new goldfish strains.
[0005] More importantly, the current goldfish market lacks a comprehensive system for culturing breeds and managing germplasm. Once a newly bred superior strain is introduced to the market, its germplasm is easily circulated haphazardly and propagated by others, leading to a "bad money drives out good" situation, and the new strain quickly loses its rarity and commercial value. Breeders and research teams struggle to obtain reasonable returns for the innovative results they have invested so much effort in, severely dampening their enthusiasm for breeding.
[0006] Therefore, it is necessary to design a technical solution that can overcome the above-mentioned defects. Summary of the Invention
[0007] One objective of this invention is to provide a molecular marker-assisted breeding method for goldfish, which overcomes the genetic degradation caused by inbreeding and obtains a new goldfish strain called Wangtianzhu, whose pupils are visible when viewed from above and whose body shape is round and beautiful. At the same time, it achieves genetic tracking and intellectual property protection through molecular markers.
[0008] To achieve these objectives of the present invention, according to one aspect of the present invention, a method for marker-assisted breeding of goldfish is provided, comprising: S1: selecting goldfish with the "Sky-eye" trait that are homozygous for both the first and second markers as the first parent, wherein the first marker is a termination mutation site chr9: 28,575,379 C>T located in exon 38 of the LRP2 gene on chromosome 9, and the second marker is a missense mutation site chr9: 28575713 G>A located in exon 38 of the LRP2 gene on chromosome 9; and selecting goldfish with the "Pearlscale" trait as the second parent; S2: Perform reciprocal crosses between the first and second parents to construct two hybrid families, obtaining the F1 generation; S3: Perform sibling crosses within each F1 generation of the two hybrid families to obtain the F2 generation; S4: Extract fin DNA from each individual in the F2 generation of the two hybrid families, detect the genotype at the first molecular marker, and select individuals homozygous for the first molecular marker as the first candidate individuals; S5: Detect the genotype at the second molecular marker of the first candidate individuals, and select individuals homozygous for the second molecular marker as the second candidate individuals; S6: Raise the second candidate individuals to 10 months of age, and select individuals that simultaneously possess the standard Sky Eye trait and Pearl Scale trait as the candidate Sky Pearl strain; S7: Perform inter-family hybridization of the candidate Sky Pearl individuals selected in S6 from the two families to obtain the F3 generation, which is the target new goldfish strain.
[0009] Furthermore, the method for detecting the genotype of each individual at the first molecular marker in S4 is as follows: PCR amplification is performed using the first primer pair, the sequence of which is shown in SEQ ID NO: 1-2, to obtain the first amplified fragment. The first amplified fragment is then digested with the restriction endonuclease DdeI. If the digestion product consists of two bands of 139 bp and 222 bp, the individual is determined to be homozygous for the first molecular marker.
[0010] Furthermore, the method for detecting the genotype of the first candidate individual at the second molecular marker in S5 is as follows: PCR amplification is performed using the second primer pair, the sequence of which is shown in SEQ ID NO: 3-4, to obtain the second amplified fragment. The second amplified fragment is then digested with the restriction endonuclease BsrFI. If the digestion product is a 278 bp band, the individual is determined to be homozygous for the second molecular marker.
[0011] Further, in S1, the standard "sky-eye" trait and the pearl scale trait are determined by the following image recognition method: acquiring side view and top view images of the goldfish to be determined; inputting the acquired side view and top view images into a pre-trained first neural network model, the first neural network model including at least an eye feature extraction branch and a scale feature extraction branch; the eye feature extraction branch outputs the angle value of the goldfish's eyes turning upwards, and when the angle value reaches or exceeds a predetermined angle threshold, it is determined to be the standard "sky-eye" trait; the scale feature extraction branch outputs the calcification deposition feature map of the goldfish's body surface scales, and when the scales present a regularly arranged hemispherical protrusion and the area covering the body surface reaches or exceeds a predetermined area ratio threshold, it is determined to be the standard pearl scale trait.
[0012] Furthermore, eye region detection is performed on the input top-view image to extract the regions of interest for the left and right eyes. A heatmap regression network is then used to predict the coordinates of key points on the eyeballs for both eyes. These key points include at least the center point of the eyeball, the apex of the upper edge of the eyeball, and the outermost point in the horizontal direction of the eyeball. Based on the coordinates of the key points on the left eye, the upward rotation angle θ of the left eyeball is calculated. L Calculate the upward rotation angle θ of the right eyeball based on the coordinates of the key points of the right eye. R When θ L and θ R All reached or exceeded the predetermined angle threshold, and θ L With θ R When the absolute difference between them does not exceed the predetermined symmetry deviation threshold, it is judged as the standard Sky Eye characteristic.
[0013] Further, the input side view and top view images are segmented into scale instances, and the contour mask and category confidence of each scale protrusion are output. For each scale protrusion, its morphological quality parameters are calculated, including contour roundness, the ratio of protrusion height to base diameter, and surface curvature uniformity. When the contour roundness of the scale protrusion is greater than or equal to a first predetermined threshold, the ratio of protrusion height to base diameter is within a predetermined range, and the surface curvature uniformity is greater than or equal to a second predetermined threshold, the scale protrusion is determined to be an effective hemispherical protrusion. The proportion of the total area of the effective hemispherical protrusions to the total surface area of the goldfish is calculated. When this proportion reaches or exceeds a predetermined area proportion threshold, the spatial arrangement regularity score of the effective hemispherical protrusions is further calculated. The spatial arrangement regularity score is calculated based on the variance of the distance between adjacent protrusions and the gridded arrangement deviation of the protrusion center. When the spatial arrangement regularity score reaches or exceeds a predetermined regularity threshold, it is determined to be a standard pearl scale morphology.
[0014] Furthermore, in S2, both orthogonal and reciprocal crosses were conducted during the goldfish breeding season, and artificial wet insemination was used. The eggs and sperm were simultaneously released into a hatching basin containing tap water that had been aerated for 24 hours by squeezing the abdomen of the male and female fish. After fertilization, the eggs were left to stand for 30 minutes, rinsed, and then fresh tap water that had been aerated for 24 hours was added. The hatching basin was then suspended in the hatching pond and allowed to hatch naturally within a temperature range of 17-22℃. At least two repeat breeding groups were set up for both orthogonal and reciprocal cross families, and in each repeat breeding group, the male and female parents were paired in a one-male-one-female pairing.
[0015] Furthermore, in S6, after the second candidate individuals are raised to 10 months of age, an image acquisition pipeline is set up, with a first acquisition station and a second acquisition station set up in sequence. The first acquisition station is equipped with a top camera, the second acquisition station is equipped with a side camera, and a temporary storage pool is set up between the two stations. Goldfish are allowed to enter the first collection station one by one in turn. Top-view images are collected, and the angles of the left and right eyeballs turning upwards are calculated. If the angles of the left and right eyes both reach or exceed the predetermined angle thresholds and the absolute difference between the two does not exceed the predetermined symmetry deviation threshold, the individual is judged to be qualified for the "sky-gazing eye" trait and is released to the temporary storage pool and enters the second collection station; otherwise, it is directly diverted and rejected. When goldfish enter the second collection station and are viewed from the side, the proportion of the total area of effective hemispherical protrusions to the surface area of the goldfish's body is first calculated. If this proportion does not reach the predetermined area proportion threshold, the goldfish is directly eliminated. If it does reach the threshold, the spatial arrangement regularity score of the effective hemispherical protrusions is calculated. When the score reaches or exceeds the predetermined regularity threshold, the goldfish is judged to be qualified for the pearl scale trait and the individual is output as a candidate for the Wangtianzhu strain. If the regularity score does not reach the threshold, the goldfish is eliminated.
[0016] The present invention has at least the following beneficial effects: This invention is the first to simultaneously apply two specific molecular markers for the "Skyeye" trait (termination mutation site chr9: 28,575,379 C>T and missense mutation site chr9: 28575713 G>A) to goldfish assisted breeding. Early genotyping allows for precise identification of target homozygotes, eliminating the need to raise the entire F2 generation to 10 months of age for phenotypic identification, significantly shortening the breeding cycle and reducing breeding costs. Two independent families are constructed using reciprocal crosses, and molecular marker screening is performed in the F2 generation followed by phenotypic verification. Finally, the target individuals selected from the two families are crossbred, effectively overcoming the problem of decreased health and survival rates caused by high inbreeding in goldfish breeding, resulting in a robust commercial F3 population. The newly obtained goldfish strain, "Wangtianzhu," possesses both the "sky-gazing eye" and pearl scale characteristics. When viewed from above, the pupils are clearly visible, creating a sense of interaction with the viewer. Its body is round and spherical, with scales resembling pearls, overcoming the aesthetic shortcomings of existing ball-shaped pearl goldfish strains, which often lack pupils or have deformed bodies when viewed from above. This satisfies the market's aesthetic demand for a novel ball-shaped pearl goldfish. The "sky-gazing eye" parent stock used in the breeding process carries a unique molecular marker, which is also present in the resulting F3 strain. This allows for germplasm identification and distribution tracking through molecular detection methods, providing technical support for protecting breeders' intellectual property rights and ensuring controllable germplasm.
[0017] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description
[0018] Figure 1 This is a flowchart of one embodiment of this application. Detailed Implementation
[0019] The present invention will now be described in further detail so that those skilled in the art can implement it based on the description.
[0020] It should be understood that terms such as "having," "comprising," and "including" used in the embodiments of this application do not exclude the presence or addition of one or more other elements or combinations thereof. All directional indications (such as up, down, left, right, front, back, etc.) in the embodiments of this application are only used to explain the relative positional relationship and movement of components in a specific posture. If the specific posture changes, the directional indication will also change accordingly. When an element is referred to as "fixed to" or "set on" another element, it can be directly on the other element or may have an intervening element present. When an element is referred to as "connected to" another element, it can be directly connected to the other element or indirectly connected to the other element through an intervening element. Descriptions involving "first," "second," etc., in the embodiments of this application are for descriptive purposes only and should not be construed as indicating or implying their relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined with "first" or "second" may explicitly or implicitly include at least one of those features.
[0021] It should be noted that the technical solutions of the various embodiments of this application can be combined with each other, but only if they are based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such combination of technical solutions does not exist and is not within the scope of protection claimed by this application.
[0022] In one embodiment, first, goldfish with celestial eye trait and homozygous for both the first molecular marker and the second molecular marker are selected as the first parent. Here, the celestial eye trait refers to the eyes of the goldfish both turning upwards, with the pupils facing directly upwards, and this trait can be stably inherited to the offspring. The first molecular marker is a stop mutation site in exon 38 of the LRP2 gene on chromosome 9, specifically a change from cytosine (C) to thymine (T) at chr9: 28,575,379. This mutation causes the arginine codon to become a stop codon, resulting in premature termination of protein translation. The second molecular marker is a missense mutation site in the same exon of the same gene, specifically a change from guanine (G) to adenine (A) at chr9: 28575713. This mutation causes one amino acid to be replaced. The first parent is homozygous at both of these sites, that is, both alleles carry the mutation. Then, goldfish with pearl scale trait are selected as the second parent. The pearl scale trait means that the scales on the body surface of the goldfish bulge in the center to form a hemispherical protrusion, similar to pearls, and this trait can be stably inherited. During the breeding season, the first parent and the second parent are crossed orthogonally and reciprocally. Orthogonal crossing, for example, pairs the female first parent with the male second parent, and reciprocal crossing pairs the male first parent with the female second parent. Two independent hybrid families are constructed through these two mating methods respectively. For each family, fertilized eggs are obtained by artificial wet fertilization, and after hatching, they are reared conventionally. The resulting offspring are denoted as the F1 generation. When the F1 generation grows to one winter age (about 12 months old) and reaches sexual maturity, the F1 individuals within each family are intercrossed between siblings, that is, the male and female individuals within the same family mate with each other to reproduce, and the F2 generation is obtained. From the F2 generation population of each family, fin tissue samples of each individual are collected, and genomic DNA is extracted. Specific primers targeting the first molecular marker are used for PCR amplification, and through restriction enzyme digestion and electrophoresis typing, the genotype of each individual at the first molecular marker is detected, and individuals homozygous at this site are screened out. These individuals are called the first candidate individuals. Then, fin DNA is also collected from the first candidate individuals, and their genotypes at the second molecular marker are detected, and individuals homozygous at the second molecular marker are screened out, called the second candidate individuals. The second candidate individuals are continuously reared under the same breeding conditions until they reach 10 months old. At this time, the celestial eye trait and the pearl scale trait have been fully expressed, and phenotypic observation can be carried out with the naked eye or with the aid of image recognition. Individuals with both the standard celestial eye trait (both eyes turning upwards, and the pupils can be seen from above) and the standard pearl scale trait (obvious hemispherical protrusion of the scales, covering most of the body surface) are selected from the second candidate individuals, and these individuals are used as candidate celestial pearl strains. Finally, the candidate celestial pearl individuals from the orthogonal family and the reciprocal family are crossed between families, that is, female individuals are selected from one family and male individuals are selected from another family for paired reproduction. The resulting offspring are denoted as the F3 generation. This F3 generation is the finally obtained target new goldfish strain, called celestial pearl.
[0023] In existing technologies, goldfish breeders typically rely solely on visual observation of phenotypes for selection. This requires raising a large number of F2 generation individuals to 10 months of age or even longer to determine whether they simultaneously possess both the "celestial eye" and "pearl scale" traits. Furthermore, it is impossible to distinguish between homozygous and heterozygous individuals in the early stages, resulting in high breeding costs and long selection cycles. This embodiment collects fin DNA in the early F2 generation (fry stage) for stepwise screening using two molecular markers. Only the second candidate individuals with homozygous dual markers need to be raised to 10 months of age for phenotypic confirmation, significantly reducing the number of individuals requiring long-term rearing, shortening the selection cycle, and lowering the costs of feed, labor, and water usage. Simultaneously, by constructing two independent families through reciprocal crosses before interfamilial hybridization, the genetic degradation caused by long-term inbreeding is effectively avoided, resulting in higher health and survival rates in the F3 generation.
[0024] In one embodiment, the specific operation for detecting homozygotes of the first molecular marker is as follows: First, a first primer pair is designed and synthesized, wherein the sequence of the upstream primer is shown in SEQ ID NO: 1, and the sequence of the downstream primer is shown in SEQ ID NO: 2. Genomic DNA is extracted from goldfish fins as a template. A PCR reaction system is prepared, for example, a total volume of 20 μL, containing 10 μL of 2×dNTP-MIX, 0.5 μL each of the upstream and downstream primers, 1 μL of DNA template, and 8 μL of sterile double-distilled water. The reaction system is placed in a PCR instrument and the preset program is run: first, pre-denaturation at 95 °C for 3 min; then 35 cycles are performed, each cycle including denaturation at 95 °C for 30 s, annealing at 62.6 °C for 30 s, extension at 72 °C for 1 min; finally, final extension at 72 °C for 7 min, and storage at 4 °C. After amplification, a first amplified fragment of 361 bp in length is obtained. A portion of the PCR product is taken and the restriction endonuclease DdeI is added. The enzyme digestion reaction can be carried out at 37 °C for 30 min, and the enzyme dosage can be 0.5 units. Due to the presence of the first molecular marker site (chr9: 28,575,379C>T), different sizes of DdeI digestion fragments will be obtained: when the site is a homozygous mutant T, the amplified fragment is cleaved into two fragments of 139 bp and 222 bp; when the site is wild-type C, the amplified fragment remains intact at 361 bp. The digestion products are separated by electrophoresis on a 1% (w / v) agarose gel for 20 min. Observe the bands under the gel imaging system: if two bands of 139 bp and 222 bp appear, the individual is determined to be homozygous for the first molecular marker; if only one band of 361 bp appears, the individual is determined to be homozygous for the wild type; if three bands of 139 bp, 222 bp and 361 bp appear, the individual is heterozygous. However, this method only needs to screen for homozygotes, so heterozygotes are not retained.
[0025] Primers (SEQ ID NO: 1-2): lrp2_F: GGACCACCGAGACGGATACA, lrp2_R: TGGGATGGCGAAGCAGA.
[0026] PCR reaction system: Reaction system: Primer PCR procedure: DdeI restriction endonuclease, restriction site: Enzyme digestion temperature and dosage: 37℃ for 30 minutes, approximately 0.5 units.
[0027] Perform 1% agarose gel electrophoresis for 20 minutes, observe the bands, and classify them.
[0028] This embodiment uses PCR combined with restriction endonuclease digestion and agarose gel electrophoresis. No sequencing is required. Genotyping of a large number of individuals can be completed within hours using only conventional molecular biology equipment and reagents. The operation is simple, low-cost, and the band interpretation is intuitive, making it very suitable for rapid screening in general laboratories.
[0029] In one embodiment, the specific operation for detecting homozygotes of the second molecular marker is as follows: A second primer pair is designed and synthesized, with the upstream primer sequence shown in SEQ ID NO: 3 and the downstream primer sequence shown in SEQ ID NO: 4. Genomic DNA extracted from goldfish fins is used as a template for PCR amplification. The PCR reaction system can be similar to that for the first molecular marker detection, for example, a total volume of 20 μL, containing 10 μL of 2×dNTP-MIX, 0.5 μL each of upstream and downstream primers, 1 μL of DNA template, and 8 μL of sterile double-distilled water. The PCR program is as follows: 95°C pre-denaturation for 3 min; then 35 cycles, each cycle consisting of denaturation at 95°C for 30 s, annealing at 62.6°C for 30 s, extension at 72°C for 1 min; and a final extension at 72°C for 7 min. A second amplified fragment of 278 bp is obtained after amplification. The PCR product is then added to the restriction endonuclease BsrFI. The enzyme digestion reaction is carried out at 37°C for 30 min, with an enzyme dosage of 0.5 units. The second molecular marker site (chr9: 28575713 G>A) is located within the recognition sequence of BsrFI: when this site is wild-type G, BsrFI can cleave the 278 bp fragment into two fragments of 185 bp and 93 bp; when this site is mutant homozygous A, the recognition sequence changes to ACCGGT, and BsrFI cannot cleave it, thus the amplified fragment remains intact at 278 bp. The enzyme digestion products were electrophoresed on a 1% (w / v) agarose gel for 20 min. The electrophoretic bands were observed: if only one 278 bp band appeared, the individual was determined to be homozygous for the second molecular marker; if two bands appeared (185 bp and 93 bp), the individual was wild-type homozygous; if three bands appeared, the individual was heterozygous.
[0030] DNA was extracted from fish fins; Primers (SEQ ID NO: 3-4): lrp2_F: GAAGTGTTCCTGTGCCTTTGG, lrp2_R: TCGCAGGAGAGGTAGGTGAAG.
[0031] PCR reaction system: Reaction system: Primer PCR procedure: BsrFI is a restriction endonuclease with the following cleavage site: R / CCGGY, where R represents purine (A or G) and Y represents pyrimidine (C or T). This enzyme recognizes the sequence 5'-RCCGGY-3' and cleaves between R and C.
[0032] Enzyme digestion temperature and dosage: 37℃ for 30 minutes, approximately 0.5 units.
[0033] 1% agarose gel electrophoresis was performed for 20 minutes, and the bands were observed and genotyped. This embodiment established independent enzyme digestion detection systems for the two closely linked mutation sites. The primers were specifically designed, the digestion conditions were clearly defined, and the two detection methods could be performed in parallel or sequentially without interference. By first screening homozygotes for the first molecular marker to narrow down the candidate population, and then performing second molecular marker detection on the first candidate individuals, bihomozygous individuals were precisely identified step by step, significantly improving screening efficiency.
[0034] In one embodiment, image recognition methods are used to determine the standard "sky-eye" and standard "pearl scale" traits. Specifically, an image acquisition device is constructed, including a camera positioned above the goldfish and a camera positioned to the side. A single goldfish to be assessed is placed in a transparent observation tank with a moderate water level, allowing the goldfish to swim freely but restricting its range of motion. When the goldfish is stable in a horizontal posture, the top and side cameras are triggered simultaneously to acquire a top-view image and a side-view image. The acquired images are input into a pre-trained first neural network model. This model employs a multi-branch structure, containing at least one eye feature extraction branch and one scale feature extraction branch. The eye feature extraction branch is specifically designed for processing the top-view image. This branch contains multiple convolutional and pooling layers, capable of automatically learning and extracting features related to eye position and orientation. The output of this branch is one or more numerical values representing the upward rotation angle of the goldfish's eyes. For example, the output could be the left eye rotation angle θ. L and the angle of right eyeball rotation θ R The values are in degrees. A pre-defined angle threshold θ is used. th For example, this threshold can be set to 80° or 85°. If the output rotation angle value reaches or exceeds θ... th If the goldfish exhibits the standard "sky-gazing" trait, it is determined that it possesses the standard "sky-gazing" characteristic. The scale feature extraction branch processes both top-view and side-view images simultaneously. This branch, also composed of a convolutional neural network, extracts calcification deposition feature maps of the goldfish's scales from the images. The feature maps are presented as heatmaps, with highlighted areas corresponding to areas of prominent scale protrusions. Based on these feature maps, it can be determined whether the scales exhibit regularly arranged hemispherical protrusions, and the proportion of the body surface area covered by these protrusions to the total surface area of the goldfish is calculated, denoted as R. area A pre-set area ratio threshold R is used. th For example, it could be 60% or 70%. If R area ≥R th If the arrangement of the protrusions is regular (e.g., arranged in a grid or fish scale pattern), then the goldfish is considered to have standard pearl scale characteristics.
[0035] In existing technologies, goldfish breeders rely on visual inspection and experience to judge traits such as "sky-eye" and "pearl scales." However, the judgment standards differ among different breeders and are easily influenced by subjective factors such as the goldfish's swimming posture and lighting conditions, leading to unstable breeding results. This embodiment introduces a deep learning-based image recognition method, achieving automation and standardization of phenotypic determination. Through a trained neural network model, the eye rotation angle and scale protrusion coverage can be output objectively and repeatedly, eliminating human error and improving the accuracy and efficiency of breeding.
[0036] In one embodiment, the image recognition and determination of the goldfish's eye characteristics are further refined. First, for the acquired top-view image, a pre-trained eye region detection network (e.g., an object detection model based on YOLO or Faster R-CNN) is used to automatically locate the left and right eye regions of the goldfish, and images containing the regions of interest (ROIs) of the left and right eyes are cropped respectively. Then, each ROI is input into a heatmap regression network. This network can be a fully convolutional network based on an encoder-decoder structure, and its output is a heatmap of the same size as the original image, where the peak positions correspond to the predicted keypoint coordinates. For each eye, at least three keypoints need to be predicted: the eyeball center point C, the upper edge vertex U of the eyeball (i.e., the highest point after eyeball rotation), and the outermost point L of the eyeball in the horizontal direction. The eyeball center point C is used to locate the overall position of the eyeball, the upper edge vertex U of the eyeball is used to calculate the upward rotation angle, and the outermost point L of the eyeball in the horizontal direction is used to help determine the horizontal baseline of the eyeball. After obtaining the coordinates of the three keypoints of the left eye, the eyeball center point C is used to determine the keypoints of the goldfish. L and the upper edge apex U of the eyeball L Determine a vector pointing directly upwards, and then, based on the center point C of the eyeball... L L, the outermost point at eye level L Determine a horizontal reference vector, and calculate the angle between the two vectors, denoted as θ. L Similarly, the upward rotation angle θ of the right eyeball can be calculated using the coordinates of three key points on the right eye. R A pre-set angle threshold θ th For example, it can be 80° or 85°; at the same time, a symmetry deviation threshold Δθ is set. th For example, it can be 5° or 10°. When θ L ≥θ th And θ R ≥θ th And |θ L -θ R |≤Δθ thAt that time, the goldfish was determined to have the standard "sky-gazing eye" trait. In existing technologies, manual assessment of "sky-gazing eyes" often only involves a rough observation of whether the eyeballs are pointing upwards. It is difficult to quantify and evaluate individuals with inconsistent eye rotation angles, leading to the incorrect selection of individuals with unilateral "sky-gazing" or significantly different eye angles, thus affecting strain breeding. This embodiment uses a heatmap regression network to accurately locate multiple key points on the eyeballs and calculates the rotation angles of the left and right eyes separately. It also requires that the angles reach a threshold and be symmetrical, ensuring that both eyes of the selected individuals meet the "sky-gazing" standard, improving strain consistency and ornamental value.
[0037] In one embodiment, the image recognition and determination of pearl scale features are further refined. First, the acquired side and top view images are input into a pre-trained scale instance segmentation model, which can be based on Mask R-CNN or U-Net architectures. The model outputs a contour mask M for each scale protrusion. i (i.e., pixel-level segmentation regions) and the confidence level that the protrusion belongs to the pearl scale category. For each segmented scale protrusion, its morphological quality parameters are calculated. The morphological quality parameters include three indicators: contour roundness C. i The ratio H of the protrusion height to the base diameter i / D i and surface curvature uniformity S i Outline roundness C i The calculation formula is C i =4πA i / P i 2 A i For the projected area of the convex shape, P i Let C be the perimeter of the outline. i The closer the value is to 1, the closer the outline is to a circle. (Protrusion height H) i With base diameter D i The ratio is obtained by measuring the vertical distance Hi from the highest point of the protrusion to the base plane from the side view image and dividing it by the diameter Di of the base profile. Surface curvature uniformity S i The curvature variance σ at each point on the raised surface can be calculated. i 2 To evaluate, S i =1 / (1+σ i 2 The closer S_i is to 1, the smoother and more uniform the surface. A first predetermined threshold C is preset. th For example, C th It can be 0.7; the ratio of the protrusion height to the base diameter can be set within the range [r]. min, r max [Inside, for example, r] min =0.3, r max=0.6; Surface curvature uniformity threshold S th For example, it could be 0.8. When C i ≥C th r min ≤i i / D i ≤r max And S i ≥S th When this occurs, the scale protrusion is determined to be a valid hemispherical protrusion. Then, the total area A of all valid hemispherical protrusions is calculated. valid =∑A i (Only valid protrusions are counted), and the total surface area A of the goldfish's body. body (This can be estimated by segmenting the overall outline of the goldfish and calculating the pixel area), calculate the coverage R=A valid / A body A pre-set area ratio threshold R is used. th For example, it could be 50% or 65%. If R is like R... th Then, the spatial regularity score Q of the effective hemispherical protrusions is calculated. The spatial regularity score Q is based on two factors: the variance σ of the distance between adjacent protrusions. d 2 And the grid arrangement deviation E at the center of the protrusion grid Spacing variance σ d 2 =(1 / (N-1))∑(d j -d avg ) 2 , where d j d is the distance between the centers of adjacent protrusions. avg For the average spacing, σ d 2 A smaller value indicates a more uniform distribution. Grid arrangement deviation E grid =(1 / N) is more uniform. The gridded arrangement is biased towards pi, Gi), where p i G represents the actual coordinates of the protrusion center. i To fit the center point of the bulge to the corresponding grid node coordinates on an ideal mesh (e.g., a rhombic or square mesh), distance is the Euclidean distance. σ d 2 and E grid After normalization and weighted summation, we get Q = 1 - [w1*(σ)] d 2 / σ dmax ) + w2 * ( E grid / E gridmax[), where w1 and w2 are weighting coefficients, for example, both can be 0.5. Q ranges from 0 to 1; a larger Q indicates a more regular arrangement. A pre-set regularity threshold Q is used. th For example, it can be 0.8 or 0.85. When Q... th At that time, the goldfish was determined to have the standard pearl scale trait. In existing technologies, the selection of pearl scales mainly relies on manual visual inspection, which lacks quantitative standards for whether the scale protrusions are regular and whether they cover a sufficient area. This easily leads to misjudging individuals with indistinct protrusions or disordered arrangements as standard pearl scales. This embodiment establishes a multi-level quantitative evaluation system through instance segmentation and morphological quantitative analysis, from the roundness, height ratio, and curvature uniformity of individual scales to the overall coverage and arrangement regularity. This makes the determination of pearl scale traits more scientific and accurate, ensuring the scale quality of the selected individuals.
[0038] In one embodiment, the specific operations of orthogonal and reciprocal crosses are carried out during the goldfish breeding season. The breeding season is typically during the spring when the water temperature naturally rises to 17°C–22°C (when the water temperature reaches 17°C), at which time the gonads of the parent goldfish are mature and possess the physiological basis for sperm release and spawning. The conditions that trigger this step are: the breeder observes that the female fish's abdomen is swollen and soft, the male fish exhibits obvious tubercles, and confirms that both the orthogonal and reciprocal crosses have reached the reproductive state.
[0039] Artificial wet insemination was used. The process was carried out by breeding personnel, and the specific steps are as follows: First, prepare several clean hatching basins (e.g., enamel or plastic basins with a diameter of 30cm), each filled with tap water that has been aerated for 24 hours. "Aeration for 24 hours" means placing the tap water in an open container and continuously aerating it with an air stone for 24 hours to remove residual chlorine and increase dissolved oxygen levels. This provides a non-toxic, oxygen-rich liquid environment for fertilization. The aeration water temperature should be consistent with the parent stocking water temperature, with a difference not exceeding 1℃.
[0040] Next, the operator gently holds the female parent fish to prevent it from struggling and getting injured, and gently squeezes its abdomen from front to back to spread the eggs evenly at the bottom of the hatching basin filled with aerated tap water. At the same time, the same procedure is performed on the male parent fish, releasing sperm into the same hatching basin. The fish are then left to stand still for 30 minutes. This settling time ensures that the sperm have sufficient time to combine with the eggs, complete fertilization, and allow the eggs to develop. This 30-minute period is an optimized duration.
[0041] After fertilization, a rinsing procedure is performed: the operator uses a wash bottle or hose to gently rinse the surface of the fertilized eggs with a slow, clean stream of water (approximately 0.5 L / min) for about 1 minute to remove excess semen, blood, and impurities. After rinsing, carefully pour out the old water from the basin and add fresh tap water that has been aerated for 24 hours, at the same temperature as before.
[0042] The hatching basin is then semi-suspended in the hatching pond. The large water volume and heat capacity of the hatching pond are used to maintain a stable water temperature within the basin. During incubation, the water temperature in the hatching pond is controlled within the range of 17℃ to 22℃ (for example, a constant 20℃, or allowing diurnal fluctuations between 18℃ and 21℃). At this temperature, the goldfish embryos develop normally, and the incubation time is approximately 4 to 7 days. No additional oxygenation or water changes are required during natural incubation; the fry hatch naturally in the still water environment.
[0043] Both orthogonal and reciprocal crosses have at least two replicate breeding groups. In each replicate group, the male and female parents are paired one-to-one, meaning only one female and one male are used for each breeding. The output is fertilized eggs with clear family tags and the subsequent F1 generation fry. The input conditions are the parental pairing information for the orthogonal cross group (e.g., female *Gymnocalycium mihanovichii* × male *Gymnocalycium chinense*) and the reciprocal cross group (female *Gymnocalycium chinense* × male *Gymnocalycium mihanovichii*).
[0044] In one embodiment, after the second candidate individuals are raised to 10 months of age, an image acquisition pipeline is set up for automated screening. This pipeline consists of a first acquisition station and a second acquisition station, with a temporary storage pool between them. The first acquisition station is equipped with a top camera for capturing top-down images; the second acquisition station is equipped with a side camera for capturing side-down images. The specific operation process is as follows: the goldfish to be screened are placed one at a time into the first acquisition station. The first acquisition station is a transparent observation channel; when a goldfish passes through, the top camera is triggered to automatically capture a clear top-down image. The acquired top-down image is transmitted to a computer in real time, where an algorithm is run to calculate the angle θ of the left eye turning upwards. L and the angle θ of the right eyeball turning upwards R Preset the angle threshold θ th and symmetry deviation threshold Δθ th For example, θ th It can be 80°, Δθ th It can be 5°. If θ L ≥θ th And θ R ≥θ th And |θ L -θ R |≤Δθ th If the angle of the goldfish does not reach the threshold or the left and right eyes are asymmetrical, the individual is deemed to have met the criteria for the "sky-eye" trait. At this point, the release gate of the first collection station opens, and the goldfish is released into a temporary holding tank to await entry into the second collection station. If the angle does not reach the threshold or the left and right eyes are asymmetrical, the diversion gate opens, and the individual is removed from the breeding population. The goldfish in the temporary holding tank then enter the second collection station in sequence. The second collection station is equipped with a side-view camera, which captures side-view images as the goldfish pass by. The computer first calculates the ratio of the total area of the effective hemispherical protrusions to the goldfish's body surface area, R=A, based on the side-view images.valid / A body Pre-set area ratio threshold R th For example, it could be 60%. If R <R th If R ≥ R, then the diversion gate is opened directly to remove the individual. th Then, continue calculating the spatial arrangement regularity score Q of the effective hemispherical protrusions. A pre-set regularity threshold Q is used. th For example, it can be 0.8. When Q ≥ Q th When the individual is deemed to have qualified pearl scale characteristics, it is automatically output as a candidate for the Wangtianzhu strain; if Q th If so, then they will be eliminated in the same way.
[0045] In existing technologies, phenotypic screening of individuals raised to 10 months of age typically requires manual observation of each individual, which is not only inefficient but also prone to visual fatigue and judgment errors due to prolonged operation. This embodiment addresses this by establishing a streamlined dual-station image acquisition system, decomposing the determination of "eye-shaped" and "pearl scale" characteristics into two independent automated stages. The first station quickly removes unqualified individuals based on their eyes, while the second station performs detailed scale analysis on qualified individuals. The entire process requires no manual intervention, significantly improving screening throughput and consistency while reducing labor costs.
[0046] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and embodiments shown and described herein.
Claims
1. A marker-assisted breeding method for goldfish, characterized in that, include: S1: Goldfish with the "Sky-eye" trait and homozygous for both the first and second molecular markers were selected as the first parent, and goldfish with the "Pearl Scale" trait were selected as the second parent. The first molecular marker was the termination mutation site chr9: 28,575,379 C>T located in exon 38 of the LRP2 gene on chromosome 9, and the second molecular marker was the missense mutation site chr9: 28575713 G>A located in exon 38 of the LRP2 gene on chromosome 9. S2: Perform orthogonal and reciprocal crosses between the first parent and the second parent to construct two hybrid families and obtain the F1 generation; S3: The F1 generation of the two hybrid families is interbred with siblings within the same family to obtain the F2 generation; S4: Extract fin DNA from each individual in the F2 generation of the two hybrid families, detect the genotype of each individual at the first molecular marker, and screen out individuals that are homozygous for the first molecular marker as the first candidate individuals; S5: Detect the genotype of the first candidate individual at the second molecular marker, and screen out individuals that are homozygous for the second molecular marker as second candidate individuals; S6: The second candidate individuals were raised to 10 months of age, and individuals that simultaneously possessed the traits of "Sky Eye" and "Pearl Scale" were selected as candidate Sky Pearl strains. S7: Crossbreed the candidate Wangtianzhu strains selected from two families through S6 to obtain the F3 generation, which is the target new goldfish strain.
2. The goldfish molecular marker-assisted breeding method according to claim 1, characterized in that, The method for detecting the genotype of each individual at the first molecular marker in S4 is as follows: PCR amplification is performed using the first primer pair, the sequence of which is shown in SEQ ID NO: 1-2. The first amplified fragment is obtained, and the first amplified fragment is digested with the restriction endonuclease DdeI. If the digestion product consists of two bands of 139 bp and 222 bp, the individual is determined to be homozygous for the first molecular marker.
3. The goldfish molecular marker-assisted breeding method according to claim 1, characterized in that, The method for detecting the genotype of the first candidate individual at the second molecular marker in S5 is as follows: PCR amplification is performed using the second primer pair, the sequence of which is shown in SEQ ID NO: 3-4, to obtain the second amplified fragment. The second amplified fragment is then digested with the restriction endonuclease BsrFI. If the digestion product is a 278 bp band, the individual is determined to be homozygous for the second molecular marker.
4. The goldfish molecular marker-assisted breeding method according to claim 1, characterized in that, In S1, the standard Sky Eye morphology and standard Pearl Scale morphology are determined using the following image recognition method: Collect side and top views of the goldfish to be identified; The acquired side view and top view images are input into a pre-trained first neural network model, which includes at least an eye feature extraction branch and a scale feature extraction branch. The eye feature extraction branch outputs the angle value of the goldfish's eyes turning upwards. When the angle value reaches or exceeds the predetermined angle threshold, it is judged as the standard sky-gazing eye characteristic. The scale feature extraction branch outputs a calcification deposition feature map of the goldfish's body surface scales. When the scales present a regular arrangement of hemispherical protrusions and the area covering the body surface reaches or exceeds a predetermined area ratio threshold, it is judged as a standard pearl scale trait.
5. The goldfish molecular marker-assisted breeding method according to claim 4, characterized in that, Perform eye region detection on the input top-view image and extract the regions of interest for the left and right eyes; Heatmap regression networks are used to predict the coordinates of key points on the eyeball for the regions of interest of the left and right eyes, respectively. The key points include at least the center point of the eyeball, the vertex of the upper edge of the eyeball, and the outermost point of the eyeball in the horizontal direction. Calculate the upward rotation angle θ of the left eyeball based on the coordinates of the key points of the left eye. L Calculate the upward rotation angle θ of the right eyeball based on the coordinates of the key points of the right eye. R ; When θ L and θ R All reached or exceeded the predetermined angle threshold, and θ L With θ R When the absolute difference between them does not exceed the predetermined symmetry deviation threshold, it is judged as the standard Sky Eye characteristic.
6. The goldfish molecular marker-assisted breeding method according to claim 4, characterized in that, Perform scale instance segmentation on the input side view and top view images, and output the contour mask and class confidence of each scale protrusion; For each scale protrusion, its morphological quality parameters are calculated, including: contour roundness, the ratio of protrusion height to base diameter, and surface curvature uniformity. When the outline roundness of the scale protrusion is greater than or equal to a first predetermined threshold, the ratio of the protrusion height to the base diameter is within a predetermined range, and the surface curvature uniformity is greater than or equal to a second predetermined threshold, the scale protrusion is determined to be an effective hemispherical protrusion. Calculate the ratio of the total area of effective hemispherical protrusions to the total surface area of the goldfish. When this ratio reaches or exceeds a predetermined area ratio threshold, further calculate the spatial arrangement regularity score of the effective hemispherical protrusions. The spatial arrangement regularity score is calculated based on the variance of the spacing between adjacent protrusions and the grid arrangement deviation of the protrusion centers. When the spatial arrangement regularity score reaches or exceeds the predetermined regularity threshold, it is judged as a standard pearl scale morphology.
7. The goldfish molecular marker-assisted breeding method according to claim 1, characterized in that, In S2, both orthogonal and reciprocal crosses are conducted during the goldfish breeding season, and artificial wet insemination is used. The eggs and sperm are simultaneously released into a hatching basin containing tap water that has been aerated for 24 hours by squeezing the abdomen of the male and female fish. After fertilization, the eggs are left to stand for 30 minutes, rinsed, and then fresh tap water that has been aerated for 24 hours is added. The hatching basin is then suspended in the hatching pond to maintain a natural incubation temperature range of 17-22℃. Both orthogonal and reciprocal cross families have at least two repeat breeding groups, and in each repeat group, the male and female parents are paired in a one-male-one-female pairing.
8. The goldfish molecular marker-assisted breeding method according to claim 6, characterized in that, In S6, after the second candidate individuals are raised to 10 months of age, an image acquisition pipeline is set up, with a first acquisition station and a second acquisition station set up in sequence. The first acquisition station is equipped with a top camera, and the second acquisition station is equipped with a side camera. A temporary storage pool is set up between the two stations. Goldfish are allowed to enter the first collection station one by one in turn. Top-view images are collected, and the angles of the left and right eyeballs turning upwards are calculated. If the angles of the left and right eyes both reach or exceed the predetermined angle thresholds and the absolute difference between the two does not exceed the predetermined symmetry deviation threshold, the individual is judged to be qualified for the "sky-gazing eye" trait and is released to the temporary storage pool and enters the second collection station; otherwise, it is directly diverted and rejected. When goldfish enter the second collection station and are viewed from the side, the proportion of the total area of effective hemispherical protrusions to the surface area of the goldfish's body is first calculated. If this proportion does not reach the predetermined area proportion threshold, the goldfish is directly eliminated. If it does reach the threshold, the spatial arrangement regularity score of the effective hemispherical protrusions is calculated. When the score reaches or exceeds the predetermined regularity threshold, the goldfish is judged to be qualified for the pearl scale trait and the individual is output as a candidate for the Wangtianzhu strain. If the regularity score does not reach the threshold, the goldfish is eliminated.
Citation Information
Patent Citations
Breeding method of biond-eye goldfish
CN116868927A
Koi-TAT gene related to golden and silver scale character of koi, SNP molecular marker, primer pair and application
CN121294473A