Nucleic acid combination product, kit for detecting mycobacterium tuberculosis complex and drug resistance gene mutation and application thereof

By optimizing primer design and shingled amplification strategy, combined with multiplex PCR technology, we have achieved efficient identification of Mycobacterium tuberculosis complexes and detection of drug resistance gene mutations. This solves the problem of limited detection range in existing technologies and enables a high-sensitivity and high-accuracy end-to-end analysis.

CN122168781APending Publication Date: 2026-06-09广州市胸科医院 +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-17
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing technologies cannot simultaneously achieve efficient species identification and comprehensive drug resistance detection of Mycobacterium tuberculosis complexes, especially at the level of subspecies or variants. Furthermore, they rely on pathogen isolation and culture, which limits their application in clinical diagnosis.

Method used

This invention provides a nucleic acid combinatorial product, which includes optimized primer design and shingled amplification strategy. Through multiplex PCR amplification technology, it integrates bacterial identification and drug resistance gene mutation detection. The detection process is optimized using tag primers and barcode sequences to achieve efficient and economical end-to-end analysis.

Benefits of technology

It enables accurate identification of Mycobacterium tuberculosis complexes and comprehensive detection of multiple drug resistance gene mutations, with a detection sensitivity of 50 copies/mL and a drug resistance gene detection sensitivity of 500-1000 copies/mL. This significantly improves the comprehensiveness and accuracy of the detection, reduces costs, and completes the entire analysis process within 24 hours.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168781A_ABST
    Figure CN122168781A_ABST
Patent Text Reader

Abstract

This application belongs to the field of molecular biology technology, specifically relating to nucleic acid combinatorial products, kits for identifying Mycobacterium tuberculosis complexes and detecting drug resistance gene mutations, and their applications. This application provides a nucleic acid combinatorial product for tNGS detection of Mycobacterium tuberculosis complexes and related drug resistance genes, comprising at least one pair of primers selected from the nucleotide sequences shown in SEQ ID NO.1 to SEQ ID NO.344. Through optimized primer design, this product significantly improves multiplex PCR amplification efficiency and detection sensitivity. Compared to other NGS technologies such as single-molecule sequencing, this product significantly reduces detection costs while ensuring comprehensive detection, and can complete the entire analysis process from sample processing to result reporting within 24 hours. Furthermore, this nucleic acid combinatorial product also has species identification capabilities, accurately distinguishing Mycobacterium tuberculosis complexes and their species and variant levels, thereby achieving synergistic improvements in detection breadth, cost, timeliness, and identification accuracy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of molecular biology technology, specifically involving nucleic acid combinatorial products, kits for identifying Mycobacterium tuberculosis complexes and detecting drug resistance gene mutations, and their applications. Background Technology

[0002] Tuberculosis (TB) is a serious infectious disease caused by the Mycobacterium tuberculosis complex and remains a major challenge in global public health. According to the World Health Organization, the global burden of TB remains heavy, and the emergence and spread of drug-resistant TB, particularly multidrug-resistant and extensively drug-resistant TB, has made the clinical treatment and control of TB increasingly challenging. Currently, the identification of the Mycobacterium tuberculosis complex and its drug resistance testing mainly rely on traditional microbiological methods and molecular biological techniques, but these methods have significant limitations.

[0003] While existing molecular diagnostic technologies such as Xpert MTB / RIF enable rapid detection of Mycobacterium tuberculosis and its resistance to rifampin, they typically only detect a limited number of resistance gene mutations, potentially missing key resistance sites for other first- and second-line anti-tuberculosis drugs. Linear probe methods, although capable of detecting more resistance genes, still have a limited range of identified bacterial species and resistance sites, and cannot achieve precise identification at the subspecies or variant level. Furthermore, the incidence of nontuberculous mycobacterial infections is increasing annually, with clinical manifestations similar to tuberculosis but different treatment strategies. Therefore, rapid and accurate identification of the Mycobacterium tuberculosis complex from nontuberculous mycobacteria, and subsequent comprehensive drug resistance assessment, is of crucial clinical significance.

[0004] High-throughput sequencing technology, especially whole-genome sequencing, can provide the most comprehensive pathogen genome information, theoretically enabling the identification of bacterial species and prediction of all known and potential drug resistance sites in a single test. However, whole-genome sequencing technology requires high purity and concentration of pathogen DNA in the sample, is expensive, and involves complex data analysis. More importantly, it usually relies on the isolation and culture of pathogens, making it difficult to apply directly to clinical samples, which greatly limits its widespread use in routine clinical diagnosis.

[0005] Therefore, there is an urgent need in this field for a highly efficient detection solution that can integrate strain identification and comprehensive drug resistance analysis. Summary of the Invention

[0006] Based on this, one embodiment of this application provides a kit for identifying nucleic acid combination products, Mycobacterium tuberculosis complexes, and detecting drug resistance gene mutations, and their applications.

[0007] This application provides a nucleic acid combination product comprising one or more primer pairs with nucleotide sequences as shown in SEQ ID NO.1 to SEQ ID NO.344.

[0008] In some embodiments, each primer in the primer pair is also attached with a tag;

[0009] In some embodiments, the nucleotide sequence of the tag is as shown in SEQ ID NO.345 or SEQ ID NO.346.

[0010] In some embodiments, the primer pair is divided into a first primer pool and a second primer pool;

[0011] The first primer pool includes nucleotide sequences as shown in SEQ ID NO.1-SEQ ID NO.210;

[0012] The second primer pool includes nucleotide sequences as shown in SEQ ID NO.211-SEQ ID NO.344.

[0013] Another aspect of this application provides a kit for identifying Mycobacterium tuberculosis complexes and detecting drug resistance gene mutations, the kit comprising the aforementioned nucleic acid combination product.

[0014] In some embodiments, the kit further includes one or more of PCR amplification reagents, negative controls, and positive controls.

[0015] In some embodiments, the PCR amplification reagent includes one or more of PCR buffer, multiplex amplification enzyme, and dNTPs.

[0016] This application also provides a method for constructing a library of Mycobacterium tuberculosis complex genes and drug resistance genes, comprising the following steps:

[0017] Using the aforementioned nucleic acid combination product or the aforementioned kit for identifying Mycobacterium tuberculosis complex and detecting drug resistance gene mutations, PCR amplification reaction is performed on template DNA to obtain an amplicon library. The amplicon library is then mixed and purified to obtain a library of genes related to Mycobacterium tuberculosis complex.

[0018] In some embodiments, the PCR amplification reaction includes a first amplification reaction and a second amplification reaction.

[0019] In some embodiments, the reaction system for the first step amplification reaction includes one or more of the aforementioned nucleic acid combination product, the nucleic acid of the sample to be tested, and the PCR amplification reagent.

[0020] In some embodiments, the reaction system for the second amplification reaction includes one or more of the products of the first amplification reaction, tag primers, and PCR amplification reagents.

[0021] Another aspect of this application provides a library of Mycobacterium tuberculosis complex genes and drug resistance genes obtained by a method for constructing such a library.

[0022] This application provides a nucleic acid combo product for tNGS detection of Mycobacterium tuberculosis complex and related drug resistance genes, comprising at least one pair of primers selected from the nucleotide sequences shown in SEQ ID NO.1 to SEQ ID NO.344. This nucleic acid combo product, through optimized primer design, improves multiplex PCR amplification efficiency and detection sensitivity. Compared to other NGS technologies such as single-molecule sequencing, this product significantly reduces detection costs while ensuring comprehensive detection, and can complete the entire analysis process from sample processing to result reporting within 24 hours. Furthermore, this nucleic acid combo product also has species identification capabilities, accurately distinguishing Mycobacterium tuberculosis complex and its species and variant levels, especially effectively differentiating between BCG vaccination and actual tuberculosis infection. This achieves a synergistic improvement in detection breadth, cost, timeliness, and identification accuracy, providing an efficient and economical solution for rapid diagnosis and drug resistance analysis of tuberculosis. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of this application and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 A schematic diagram of traditional single or multiplex PCR amplification primer design;

[0025] Figure 2 A schematic diagram of the shingled design for ultramultiplex PCR amplification provided in this application;

[0026] Figure 3 This is a technical roadmap for identifying Mycobacterium tuberculosis complexes and detecting drug resistance gene mutations in Example 1 of this application;

[0027] Figure 4 The results of nucleic acid extraction, tNGS library construction, and sequencing of Mycobacterium tuberculosis strain 1 at a concentration of 5000 copies / mL are provided in one embodiment of this application.

[0028] Figure 5The results of nucleic acid extraction, tNGS library construction, and sequencing of Mycobacterium tuberculosis strain 2 at a concentration of 5000 copies / mL are provided in one embodiment of this application. Detailed Implementation

[0029] The present application will be further described in detail below with reference to the embodiments and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.

[0030] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0031] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0032] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").

[0033] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0034] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.

[0035] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.

[0036] In this application, terms such as "further," "even more," and "particularly" are used for descriptive purposes and to indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0037] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0038] In this application, the technical features described in an open-ended manner include both closed technical solutions composed of the listed features and open technical solutions composed of the listed features.

[0039] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0040] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.

[0041] In this application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass-volume percentage.

[0042] All references to documents mentioned in this application are incorporated herein by reference as if each document were individually incorporated herein by reference. Unless they conflict with the inventive purpose and / or technical solution of this application, all cited documents are incorporated herein by reference in their entirety and for all purposes. When citing documents in this application, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. When citing documents in this application, examples and preferred embodiments of the cited technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptably to the description in this application.

[0043] The term "primer pool" refers to a primer pool in this art, which is a combination of multiple primer pairs grouped and mixed according to specific rules. In this application, the primer pool has specific functional groupings, namely, primer pairs for identifying Mycobacterium tuberculosis complexes and detecting drug resistance genes are divided into a first primer pool and a second primer pool. This grouping design avoids interference between primers and improves the efficiency and specificity of multiplex PCR amplification. The primer pairs in the primer pool can be selected from primers specific to different target genes, such as primers for bacterial identification targeting the 16S rRNA gene, primers for rifampicin resistance detection targeting the rpoB gene, and primers for isoniazid resistance detection targeting the katG gene.

[0044] The term "multiplex PCR amplification reaction" refers to the technique of simultaneously amplifying multiple target fragments in the same reaction system. Compared with single PCR amplification, multiplex PCR has the advantages of high efficiency, speed, and saving samples and reagents. In this application, the multiplex PCR amplification reaction adopts a two-step strategy: the first step uses a specific primer pool to amplify the target sequence, and the second step uses tag primers to construct a library. This design ensures both the specificity of the amplification and the library construction required for high-throughput sequencing. The key to multiplex PCR amplification reaction lies in primer design, reaction system optimization, and amplification program settings to avoid primer dimer formation and non-specific amplification.

[0045] The term "tag sequence" refers to a known nucleotide sequence added to the 5' end of a primer, also known in the art as a universal sequence or adapter sequence. The main functions of a tag sequence include: 1) providing a binding site for subsequent sequencing reactions; 2) serving as an identification marker in data analysis; and 3) improving primer amplification efficiency. In this application, the tag sequence used is the MGI-UDB universal tag sequence, which has been optimized for compatibility with the BGI Genomics sequencing platform, ensuring the quality and accuracy of the sequencing data.

[0046] The term "shingled design" refers to an innovative primer design strategy that achieves comprehensive coverage of the target region by designing overlapping amplicons. Compared to traditional single-multiplex PCR amplification, shingled design avoids the problem of missed detection of variant sites at adjacent positions of two amplicons. In this application, the shingled design ensures comprehensive coverage of more than 3,500 common mutation sites across 9 species and variants of Mycobacterium tuberculosis complex and 21 drug resistance genes, significantly improving the comprehensiveness and accuracy of detection.

[0047] The term "Barcode sequence" refers to a short DNA sequence added to a sequencing library to identify different samples. In the art, barcode sequences are also called index sequences or tag sequences. Each barcode sequence typically consists of 10-12 bases, and combinations can generate a large number of unique sample identifiers. In this application, the barcode sequence is added to the amplification product in the second step of PCR amplification using tag primers, allowing multiple samples to be sequenced simultaneously in the same reaction, significantly improving detection efficiency and reducing costs. The design of the barcode sequence must avoid sequence similarity to ensure accurate sample identification.

[0048] To address the technical challenge of existing Mycobacterium tuberculosis detection technologies failing to achieve efficient integrated detection of both species identification and comprehensive drug resistance analysis, this application provides nucleic acid combination products, kits for identifying Mycobacterium tuberculosis complexes and detecting drug resistance gene mutations, and their applications.

[0049] This application provides a nucleic acid combo product comprising one or more primer pairs with nucleotide sequences as shown in SEQ ID NO.1 to SEQ ID NO.344. This nucleic acid combo product, through optimized primer design, significantly improves multiplex PCR amplification efficiency and detection sensitivity. Compared to other NGS technologies such as single-molecule sequencing, this product significantly reduces detection costs while ensuring comprehensive detection, and can complete the entire analysis process from sample processing to result reporting within 24 hours.

[0050] Specifically, the primer pairs cover more than 3,500 common mutation sites of Mycobacterium tuberculosis complex (including 9 species and varieties) and 21 drug resistance genes.

[0051] In some embodiments, each primer in the primer pair is also attached with a tag.

[0052] In some embodiments, the nucleotide sequence of the tag is as shown in SEQ ID NO.345 or SEQ ID NO.346.

[0053] In some embodiments, the primer pair is divided into a first primer pool and a second primer pool.

[0054] The first primer pool includes nucleotide sequences as shown in SEQ ID NO.1-SEQ ID NO.210.

[0055] The second primer pool includes nucleotide sequences as shown in SEQ ID NO.211-SEQ ID NO.344.

[0056] In some embodiments, each primer in the primer pair has a universal tag sequence attached to its 5' end. This universal tag sequence provides an identification basis for subsequent sequencing and data analysis, improving the accuracy and reliability of the detection. Specifically, the nucleotide sequence of the universal tag sequence is shown in SEQ ID NO. 345 or SEQ ID NO. 346.

[0057] SEQ ID NO. 345 is F-tag: TCACAGAACGACATGGCTACGATCCGACTT.

[0058] SEQ ID NO. 346 is R-tag: GTCTTCCTAAGACCGCTTGGCCTCCGACTT.

[0059] In some embodiments, the F primers of the two primer pools (i.e., SEQ ID NO.1-SEQ ID NO.105, SEQ ID NO.211-SEQ ID NO.277) are connected to the tag sequence shown in SEQ ID NO.345, and the R primers of the two primer pools (i.e., SEQ ID NO.106-SEQ ID NO.210, SEQ ID NO.278-SEQ ID NO.344) are connected to the tag sequence shown in SEQ ID NO.346.

[0060] The first and second primer pools contain primer pairs for identifying Mycobacterium tuberculosis complex and detecting drug resistance genes, respectively. These primer pairs can simultaneously achieve Mycobacterium tuberculosis complex species identification and drug resistance gene mutation detection through multiplex PCR amplification. This nucleic acid combination product, through innovative primer pool design and multiplex PCR amplification technology, can simultaneously and accurately identify Mycobacterium tuberculosis complex and comprehensively detect multiple drug resistance gene mutations in a single test, effectively solving the problems of limited detection range, inability to achieve subspecies-level identification, and reliance on pathogen isolation and culture in existing technologies. By dividing the primer pairs into two independent primer pools, mutual interference between primers is avoided, improving amplification efficiency and detection accuracy, achieving a detection sensitivity of 50 copies / mL and a drug resistance gene detection sensitivity of 500-1000 copies / mL, significantly superior to existing technologies.

[0061] This application also provides a kit for identifying Mycobacterium tuberculosis complexes and detecting drug resistance gene mutations, the kit comprising the aforementioned nucleic acid combination product. This kit integrates bacterial identification and drug resistance detection functions, enabling a complete process from sample to test result, greatly improving the convenience and efficiency of clinical applications.

[0062] In some embodiments, the kit also includes a tag primer.

[0063] In some embodiments, the tag primer has a barcode for identifying different samples.

[0064] In some embodiments, the kit further includes one or more of PCR amplification reagents, negative controls, and positive controls.

[0065] In some embodiments, the PCR amplification reagent includes one or more of PCR buffer, multiplex amplification enzyme, and dNTPs. Specifically, the PCR buffer may be selected from commercially available 5× reaction buffer, the multiplex amplification enzyme may be selected from DNA polymerase with high fidelity and high amplification efficiency, and the dNTPs are a mixture of deoxyribonucleoside triphosphates. In some embodiments, the PCR amplification reagent may also include auxiliary components such as MgCl2 and BSA to optimize the amplification effect.

[0066] In some embodiments, the negative control is a sample free of Mycobacterium tuberculosis DNA, and the positive control is a sample containing a known concentration of Mycobacterium tuberculosis DNA and a known drug resistance gene mutation. In some preferred embodiments, the positive control may contain different concentrations of Mycobacterium tuberculosis DNA, such as 10,000 copies / mL, 5,000 copies / mL, 1,000 copies / mL, etc., to verify the sensitivity and accuracy of the detection.

[0067] This application also provides a method for constructing a library of Mycobacterium tuberculosis complex genes and drug resistance genes, comprising the following steps:

[0068] Using the described nucleic acid combination product or the described kit, template DNA is subjected to PCR amplification to obtain an amplicon library. The amplicon library is then mixed and purified to obtain a library of genes related to the Mycobacterium tuberculosis complex. This library construction method achieves efficient and specific library construction through a two-step multiplex PCR amplification strategy, providing a high-quality template for subsequent sequencing and analysis.

[0069] In some embodiments, the PCR amplification reaction includes a first amplification reaction and a second amplification reaction.

[0070] In some embodiments, the reaction system for the first step amplification reaction includes one or more of the aforementioned nucleic acid combination product, the nucleic acid of the sample to be tested, and the PCR amplification reagent.

[0071] In some embodiments, the reaction system for the second amplification reaction includes one or more of the products of the first amplification reaction, tag primers, and PCR amplification reagents.

[0072] This application also provides a library of Mycobacterium tuberculosis complex genes and drug resistance genes obtained by the method for constructing such a library. This library contains identification information of the Mycobacterium tuberculosis complex and mutation information of various drug resistance genes, providing comprehensive molecular evidence for clinical diagnosis and treatment.

[0073] This solution achieves efficient integration of Mycobacterium tuberculosis complex species identification and drug resistance gene mutation detection through innovative primer pool design and multiplex PCR amplification technology, solving the problems of limited detection range and inability to perform two tests simultaneously in existing technologies.

[0074] This approach employs a shingled primer design strategy, which can comprehensively cover variant sites in the target region, avoiding the problem of missed detection of adjacent variant sites in traditional single and multiplex amplification, and improving the accuracy and comprehensiveness of detection.

[0075] This protocol enables direct detection from clinical samples through a two-step multiplex PCR amplification reaction, eliminating the need for pathogen isolation and culture. This greatly simplifies the detection process and improves the convenience and timeliness of clinical applications.

[0076] This method has high sensitivity and high specificity, with a detection limit of 50 copies / mL for Mycobacterium tuberculosis complex and 500-1000 copies / mL for drug resistance genes, which is significantly better than existing technologies and can meet the needs of early clinical diagnosis.

[0077] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0078] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0079] It should be understood that in the various embodiments of this application, the order of the above-mentioned processes does not imply the order of execution. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0080] Example 1

[0081] The specific technical solution adopted in this application is as follows:

[0082] 1. Primer design and synthesis

[0083] This application designed and screened 172 primer pairs covering more than 3,500 common mutation sites of Mycobacterium tuberculosis complex (as well as 9 species and variants) and 21 drug resistance genes.

[0084] The pathogens and drug-resistant genes are listed in Appendix 1, and the primer sequences are shown in Appendix 1.

[0085] Table 1: Primer sequences for species and drug resistance gene mutations

[0086]

[0087] Primers are synthesized based on the designed primer sequences and mixed into two pools according to pre-defined rules, named YK MTB1-1 panel and YK MTB1-2 panel. The 5' end of the primers must also include the MGI-UDB universal tag sequence.

[0088] Among them, SEQ ID NO.1-SEQ ID NO.105 and SEQ ID NO.211-SEQ ID NO.277 need to be marked with the F-tag: TCACAGAACGACATGGCTACGATCCGACTT (SEQ ID NO.345);

[0089] SEQ ID NO.106-SEQ ID NO.210 and SEQ ID NO.278-SEQ ID NO.344 need to be marked with an R-tag: GTCTTCCTAAGACCGCTTGGCCTCCGACTT (SEQ ID NO.346).

[0090] Primer design can employ a shingled design ( Figure 2 This allows for comprehensive coverage of the target site. In contrast, traditional single-multiplex amplification may result in the omission of variant sites at adjacent positions between two amplicones. Figure 1 ).

[0091] 2. Sample pretreatment and nucleic acid extraction

[0092] The sample types involved in this application mainly include bronchoalveolar lavage fluid, sputum, pleural effusion, ascites, cerebrospinal fluid, synovial fluid, ocular secretions, pus / drainage fluid, and various deep tissues (eyes, joints, etc.). It is recommended to collect samples according to the microbiological testing sample collection standards. For tissue samples, a sample size the size of a soybean is required; for bronchoalveolar lavage fluid, sputum, cerebrospinal fluid, synovial fluid, ocular secretions, and pus / drainage fluid, a sample size of at least 1 mL is required; and for pleural and ascites fluid, a sample size of at least 5 mL is required. Samples should be processed and stored at 2℃-8℃ within 24 hours of collection. For long-term storage, samples should be stored at -20℃ or -80℃.

[0093] Take 10 mL of pleural and peritoneal fluid sample and centrifuge it (12000 rpm, 10 min) before extraction. Remove the supernatant and take 800 μL of the lower precipitate.

[0094] Before nucleic acid extraction, the sample needs to be cell-wall ruptured: take out the grinding tube, add 1000μL of lysis buffer to the grinding tube, add 800μL of the sample to be tested; perform cell-wall rupture on the cell-wall breaker (power 165W; speed 18M / s) for 420s.

[0095] Nucleic acid extraction: Nucleic acid was extracted from the above samples using acid extraction or purification reagents (magnetic bead method) from Guangzhou Da An Gene Co., Ltd.

[0096] 1) Take the supernatant of the sample after cell wall disruption and place it in a 2mL centrifuge tube. Add 30μL of high-affinity silica-based magnetic beads and 40μL of proteinase K, and vortex thoroughly to mix.

[0097] 2) Place the centrifuge tubes in a constant temperature shaking metal bath and incubate at 70°C for 12 minutes (rotation speed of 1000 rpm / min). After standing, centrifuge briefly.

[0098] 3) Place the centrifuge tube on the magnetic rack. After the magnetic beads are completely attracted, carefully remove the liquid with a pipette, being careful not to pick up the magnetic beads.

[0099] 4) Add 800µL of washing solution 1 to the centrifuge tube, vortex to mix for 1 min, let stand, and then centrifuge briefly.

[0100] 5) Place the centrifuge tube on the magnetic rack. After the magnetic beads are completely attracted, carefully remove the liquid with a pipette, being careful not to pick up the magnetic beads.

[0101] 6) Add 800µL of washing solution 2 to the centrifuge tube, vortex to mix for 1 min, let stand, and then centrifuge briefly.

[0102] 7) Place the centrifuge tube on the magnetic rack. After the magnetic beads are completely attracted, carefully remove the liquid with a pipette, being careful not to pick up the magnetic beads.

[0103] 8) Repeat steps 6) and 7).

[0104] 9) Centrifuge the centrifuge tube briefly for 10 seconds, place the centrifuge tube on a magnetic rack, and after the magnetic beads are completely attracted, carefully remove the liquid with a pipette, being careful not to suck up the magnetic beads. Open the cap and let it air dry for 3-5 minutes.

[0105] 10) Add 100µL of elution buffer to the centrifuge tube, vortex to mix, incubate at room temperature for 5 min, place on a magnetic rack, and after the magnetic beads are completely adsorbed, transfer the nucleic acid solution to a new sterile centrifuge tube.

[0106] DNA quantification was performed using a Qubit 4.0 nucleic acid quantification instrument. If subsequent experiments are not immediately conducted after nucleic acid extraction, the extracted nucleic acid can be stored at -20℃ (within 1 month). A nucleic acid extraction concentration ≥0.1 ng / µL is considered acceptable; >0.01 ng / µL and <0.1 ng / µL indicates a risk assessment.

[0107] 3. Library construction and sequencing

[0108] Multiplex PCR library construction was performed using a multiplex library reconstruction kit. The extracted nucleic acids were divided into two parts, each subjected to two separate PCR amplification tubes. The primers used for the first amplification step were YK MTB1-1 panel mix and YK MTB1-2 panel mix, respectively, to amplify the target sequences of the Mycobacterium tuberculosis complex and drug resistance genes in the two pools. The second amplification step used MGI-UDB tag primers (containing both upstream and downstream primers) to add sample-specific barcode sequences to the amplified product sequences for identification of different samples. There are currently 288 numbered MGI-UDB tag primers, each containing at least one unique barcode sequence (10 bases). The library construction system described in this application is suitable for the MGISEQ or DNBSEQ sequencing platforms of BGI Genomics. The specific process is as follows: Figure 3 As shown

[0109] (1) The first step is amplification. The amount of DNA template amplified is 0.1ng-500ng. The reaction system is shown in Table 2 below.

[0110] Among the primers in YK MTB1-1 panel Mix and YK MTB1-2 panel Mix, the final concentration of the primers for microorganisms and drug resistance genes is 0.1 μM; the final concentration of the primers for human internal reference genes is 0.05 μM.

[0111] Table 2

[0112] The reaction procedure is shown in Table 3 below:

[0113] Table 3

[0114]

[0115] (2) Purification of the first step amplification product: The two products of the first step amplification were combined, 30 μl of Nuclease-free water was added, and the first step amplification product was adsorbed with 50 μl of MagPure A3 XP 1 beads (1.2× ) DNA purification magnetic beads. The product was washed twice with 200 μl of freshly prepared 80% ethanol, and the remaining 80% ethanol in the tube was discarded as much as possible. The tube was placed at room temperature until dry, and finally the magnetic beads were resuspended in 23 μl of nuclease-free water (NFW) and eluted to obtain the purified product. The tube was then placed in a -20℃ refrigerator.

[0116] (3) The second step of the amplification reaction, the reaction system is shown in the table below, where MGI-UDB is a universal amplification primer for the sample-specific barcode sequence, and the reaction system is shown in Table 4:

[0117] Table 4

[0118]

[0119] The reaction procedure is shown in Table 5:

[0120] Table 5

[0121]

[0122] (4) Second step of amplification product sorting: After the library amplification is completed, briefly centrifuge the reaction tube, add 40 μL of DNA purification magnetic beads to the PCR product, mix well, and incubate at room temperature for 5 min; briefly centrifuge, place on a magnetic rack, discard the supernatant, add 200 μL of 80% ethanol, let stand for 30 s, discard the supernatant, and repeat once; centrifuge for 5 s, place on a magnetic rack, and discard the residual liquid; air dry the magnetic beads, add 40 μL of Nuclease-free water to resuspend the magnetic beads, mix well, and let stand for 2 min; briefly centrifuge, place on a magnetic rack, and transfer 38 μL of supernatant to a new low-adsorption tube.

[0123] (5) The library concentration was determined using Qubit4.0. A concentration ≥0.1 ng / μL indicates that the library concentration is qualified. The elution product at this point is a library ready for use and should be stored in a -20°C refrigerator for long-term storage.

[0124] (6) Sequencing: Based on the throughput and total library volume requirements of the sequencer, as well as the concentration of the sample library, all libraries are mixed together, DNB amplification is performed, and then sequencing is performed. The amount of data is allocated according to 1 M reads, and the sequencing adopts a single-end 100bp (SE100) strategy.

[0125] 4. Data Analysis

[0126] (1) Data quality control filtering

[0127] The raw test data was filtered using Fastp software (v0.22.0). The filtering parameters were: a) removal of sequences containing adapters (dimers); b) removal of sequences with an average base quality control of less than 15 and sequences with an N-number greater than 5; c) a minimum polyG tail trimming length of 10 bp and a 3-terminal polyX trimming length of 10 bp. After the above processing, the filtered Clean FASTQ file was obtained.

[0128] (2) Database comparison

[0129] Clean FASTQ sequences are aligned with target amplified sequences using BWA mem (v0.7.17) to obtain alignment sam files. Statistical scripts are used to analyze the sam files, retaining results with a similarity of more than 90% to the target amplified sequences, and calculating the total number of each target amplified sequence.

[0130] (3) Drug resistance mutation analysis

[0131] The SAM file obtained in step 2 was subjected to mutation analysis using bcftools software. The results were matched with a database of known mutation sites to obtain the total number of mutation sequences and mutation frequency.

[0132] (4) Data statistics

[0133] The script annotates the database alignment results and mutation analysis results to the species information, obtaining the number of detected sequences, the total number of drug-resistant gene sequences, and the mutation frequency for each species.

[0134] Example 2

[0135] Based on the uniformity and coverage of the detection of drug resistance genes within the detection range in this application

[0136] Nucleic acid extraction, tNGS library construction, and sequencing were performed on two Mycobacterium tuberculosis strains at a concentration of 5000 copies / mL. The coverage and uniformity of drug resistance genes (ARGs) within the detection range were analyzed. The results showed that the data coverage and uniformity of tuberculosis drug resistance genes were good: the data coverage at 10× depth was >95%, and no high-frequency or important drug resistance mutations (mutations included in WHO and with a sample size of more than 20) were missed. Figure 4 The results show that: ARG_Coverage (%) (>=10x) 97.06%; Figure 5 The results show that ARG_Coverage(%) (>=10x) is 96.88%.

[0137] Example 3:

[0138] Based on the analytical sensitivity / limit of detection analysis of species within the detection range in this application.

[0139] Known concentrations of Mycobacterium tuberculosis positive reference material tNGS MIXA1-2 and negative reference material NC were used. tNGS MIXA was diluted to different final concentrations, with HeLa cells (concentration 2.00E+05 cells / mL) as the substrate. The pathogens and concentrations contained in all reference materials are shown in Table 6 below.

[0140] Table 6

[0141]

[0142] The MTB1 panel was tested using positive and negative references at all concentration gradients, with each gradient tested in triplicate. The limit of detection (LOD) / analytical sensitivity was analyzed based on the number of sequences analyzed and the judgment results. The statistical results of pathogen detection reads for each gradient of positive references are shown in Table 7 below.

[0143] Based on a positive threshold of ≥10 reads, the detection limits for various pathogens and drug resistance gene mutations were determined through comparative analysis of the above detection results:

[0144] Table 7

[0145]

[0146] The detection limit of the above test kit is 50 copies / mL for Mycobacterium tuberculosis complex and 500-1000 copies / mL for tuberculosis drug resistance genes.

[0147] Example 4:

[0148] Consistency analysis between MTB1 panel and Gene Xpert

[0149] Clinical samples (BALF and sputum, etc.) were tested using the above-mentioned MTB1 panel, and the consistency between the two methods was compared. The inclusion criteria for patients were: (1) patients suspected of tuberculosis by imaging examination and / or suspected of tuberculosis by immunological examination (including tuberculosis antibody, gamma interferon release test, etc.); (2) patients with a history of tuberculosis and symptoms of pneumonia infection; (3) patients who were clearly diagnosed with tuberculosis and whose rifampicin treatment was ineffective.

[0150] For results that are inconsistent between the two, qPCR validation is required. The qPCR validation result and the clinical diagnosis result shall prevail, and the positive / negative concordance rate shall be calculated. The final results are shown in Table 8 below:

[0151] Table 8: Comparison of TB-MTB / RIF species results with tNGS species results

[0152]

[0153] The above-mentioned test kits showed a positive concordance rate of 98.61% (142 / 144) for species detection, a negative concordance rate of 58.06% (18 / 31), and an overall concordance rate of 91.42% (160 / 175). Using clinical diagnostic results as the gold standard: the accuracy of the above-mentioned test kits in identifying Mycobacterium tuberculosis was 98.28% (172 / 175), and the accuracy in detecting TB-MTB / RIF was 93.14% (163 / 175). From a clinical perspective, the MTB1 panel kit outperforms the TB-MTB / RIF kit.

[0154] A total of 144 TB-MTB / RIF tuberculosis-positive samples were included for rifampicin resistance analysis. Clinical samples included bronchoalveolar lavage fluid (93 cases), sputum (48 cases), purulent fluid (2 cases), and lesion tissue (1 case). Of the 144 samples, 114 had a clear TB-MTB / RIF rifampicin result, and 30 had an unclear result. In the samples with a clear TB-MTB / RIF rifampicin result, the tNGS resistance gene detection concordance rate was 99.12% (113 / 114). The comparison between TB-MTB / RIF rpoB mutation results and tNGS rpob mutation results is shown in Table 9.

[0155] Table 9: Comparison of TB-MTB / RIF rpoB mutation results with tNGS rpob mutation results

[0156]

[0157] In addition, tNGS detection has the following advantages over TB-MTB / RIF:

[0158] (1) In 30 samples with unclear results for TB-MTB / RIF rifampicin, tNGS detected drug resistance mutations including the rpoB gene in 10 cases, of which 4 cases were rpoB mutations plus other gene mutations.

[0159] (2) Among the 114 cases of TB-MTB / RIF rifampicin, 27 cases showed other drug resistance mutations besides the rpoB gene.

[0160] (3) Among the 142 tuberculosis-positive samples, the detection rate of tNGS rifampicin resistance mutation (rpoB gene) was 27.46% (39 / 142).

[0161] Example 5:

[0162] Accuracy analysis of MTB1 panel in drug susceptibility assessment of Mycobacterium tuberculosis strains

[0163] Drug resistance concordance analysis was performed on 100 strains cultured and identified as Mycobacterium tuberculosis with phenotypic drug susceptibility testing (pDST) results. pDST and WGS results were used as the gold standard. The accuracy of tNGS tuberculosis drug resistance gene detection (at a concentration of 5000 copies / mL) was 100%. The results are shown in Table 10.

[0164] Table 10

[0165]

[0166] Using pDST as the gold standard, tNGS showed a sensitivity of 100% (36 / 36) and a specificity of 98.24% (56 / 57) for rifampicin resistance; a sensitivity of 92% (23 / 25) and a specificity of 88.23% (60 / 68) for isoniazid; a sensitivity of 86.36% (19 / 22) and a specificity of 94.37% (67 / 71) for ethambutol; and a sensitivity of 100% (19 / 19) and a specificity of 85.14% (63 / 74) for levofloxacin and moxifloxacin. The sensitivity and specificity of tNGS in assessing resistance to different drugs were largely consistent with WHO data, with higher sensitivity for rifampicin and levofloxacin than WHO data. Within the detection range of these four drugs, tNGS results were 100% consistent with WGS results.

[0167] In addition, outside the scope of pDST analysis, tNGS detected resistance mutations for multiple drugs, with detection rates of: streptomycin 29.03% (27 / 93), pyrazinamide 19.35% (18 / 93), ethionamide 8.6% (8 / 93), and delamethasone 2.15% (2 / 93). All of these mutations were confirmed as genuine by WGS.

[0168] The embodiments described above are merely illustrative of several implementation methods of this application, intended to facilitate a detailed understanding of the technical solutions of this application, but should not be construed as limiting the scope of protection of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the scope of protection of this application. Furthermore, it should be understood that after reading the above teachings of this application, those skilled in the art can make various alterations or modifications to this application, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided in this application through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this patent application should be determined by the content of the appended claims, and the specification can be used to interpret the content of the claims.

Claims

1. A nucleic acid combination product, characterized in that, The nucleic acid combination product includes one or more primer pairs with nucleotide sequences as shown in SEQ ID NO.1 to SEQ ID NO.

344.

2. The nucleic acid combination product according to claim 1, characterized in that, Each primer in the primer pair is also attached to a tag.

3. The nucleic acid combination product according to claim 2, characterized in that, The nucleotide sequence of the tag is shown in SEQ ID NO. 345 or SEQ ID NO.

355.

4. The nucleic acid combination product according to claim 3, characterized in that, The primer pair is divided into a first primer pool and a second primer pool; The first primer pool includes nucleotide sequences as shown in SEQ ID NO.1-SEQ ID NO.210; The second primer pool includes nucleotide sequences as shown in SEQ ID NO.211-SEQ ID NO.

344.

5. A kit for identifying Mycobacterium tuberculosis complexes and detecting drug resistance gene mutations, characterized in that, The kit comprises the nucleic acid combination product according to any one of claims 1 to 4.

6. The kit for identifying Mycobacterium tuberculosis complex and detecting drug resistance gene mutations according to claim 5, characterized in that, The kit also includes one or more of PCR amplification reagents, negative controls, and positive controls; Optionally, the PCR amplification reagent includes one or more of PCR buffer, multiplex amplification enzyme, and dNTPs.

7. A method for constructing a library of Mycobacterium tuberculosis complex genes and drug resistance genes, characterized in that, Includes the following steps: Using the nucleic acid combination product of any one of claims 1 to 4 or the kit for identifying Mycobacterium tuberculosis complex and detecting drug resistance gene mutations of any one of claims 5 to 6, the template DNA is subjected to PCR amplification to obtain an amplicon library. The amplicon library is then mixed and purified to obtain a library of genes related to Mycobacterium tuberculosis complex.

8. The method for constructing a library of Mycobacterium tuberculosis complex genes and drug resistance genes according to claim 7, characterized in that, The PCR amplification reaction includes a first amplification reaction and a second amplification reaction.

9. The method for constructing a library of Mycobacterium tuberculosis complex genes and drug resistance genes according to claim 7, characterized in that, The reaction system for the first-step amplification reaction comprises one or more of the following: the nucleic acid combination product as described in any one of claims 1 to 4, the nucleic acid of the sample to be tested, and the PCR amplification reagent; and / or The reaction system for the second-step amplification reaction includes one or more of the products from the first-step amplification reaction, tag primers, and PCR amplification reagents.

10. The library of Mycobacterium tuberculosis complex genes and drug resistance genes obtained by the library construction method of any one of claims 7 to 9.