A composite hydrogel loaded with laminin alpha 5-e8 and miRNAs and preparation and application thereof
By using a composite hydrogel loaded with Laminin α5-E8 and miRNAs, the problem of short retention time of miRNAs in vivo was solved, achieving continuous release and promoting cell adhesion and angiogenesis, thus significantly accelerating the healing of diabetic wounds.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- EAST CHINA UNIV OF SCI & TECH
- Filing Date
- 2026-05-13
- Publication Date
- 2026-06-12
Smart Images

Figure CN122182467A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical materials technology, and in particular to a composite hydrogel loaded with Laminin α5-E8 and miRNAs, its preparation and application. Background Technology
[0002] Diabetes has become a major global public health challenge in the 21st century. According to the International Diabetes Federation, there were 537 million people with diabetes worldwide in 2021, and this number is projected to reach 783 million by 2045. Diabetic wounds, especially diabetic foot ulcers, are among the most serious chronic complications of diabetes, and their prevention and treatment are facing increasingly severe challenges. Studies show that approximately 50% to 70% of non-traumatic lower limb amputations are related to diabetes, and about 1.6 million people worldwide undergo amputations annually due to diabetic foot ulcers. Furthermore, the 5-year mortality rate for amputees is as high as 39% to 68%.
[0003] The wound healing process in diabetes involves the microenvironment and the synergistic effect of multiple signaling pathways. The obstacle lies in the high-glucose environment, which activates multiple pro-inflammatory signaling pathways such as NF-κB, PI3K / AKT, and JAK-STAT, promoting the continuous release of inflammatory factors such as IL-6 and TNF-α, and inducing the accumulation of large amounts of reactive oxygen species, preventing the transition to the proliferative phase. Simultaneously, the Wnt / β-catenin signaling pathway is inhibited, affecting the migration and proliferation of keratinocytes, fibroblasts, and endothelial cells, resulting in a chronic ischemic and hypoxic state in the wound and slowing granulation tissue formation.
[0004] In recent years, hydrogels have become a research hotspot as a novel medical material due to their excellent properties. Researchers at home and abroad are constantly developing new hydrogels loaded with different drugs and active substances according to application scenarios. Developing new methods for the treatment of diabetic wounds remains a constant pursuit for researchers worldwide. Summary of the Invention
[0005] To address the aforementioned problems, the present invention aims to provide a composite hydrogel loaded with Laminin α5-E8 and miRNAs, as well as its preparation and application. The present invention crosslinks Laminin α5-E8, miRNA-126, and miRNA-132-3p with a chitosan / hyaluronic acid hydrogel matrix to prepare a composite hydrogel with a three-dimensional network structure. The composite hydrogel provided by the present invention can slowly release Laminin α5-E8 and miRNAs small molecule nucleic acids in the acidic microenvironment of wounds, reducing the production of inflammatory factors, promoting angiogenesis, accelerating the healing of chronic diabetic wounds, improving therapeutic efficacy, and is convenient to use.
[0006] The objective of this invention can be achieved through the following technical solutions: The first objective of this invention is to provide a composite hydrogel loaded with Laminin α5-E8 and miRNAs, the composite hydrogel comprising an active ingredient, a functional small molecule, and a hydrogel matrix (safe and non-toxic). The active ingredient is the E8 fragment of the laminin α5 chain, and the functional small molecule is miRNAs; The nucleotide sequence of the E8 fragment of the laminin α5 chain is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2; The miRNAs are a mixture of miRNA-126 and miRNA-132-3p; The nucleotide sequence of miRNA-126 is shown in SEQ ID NO.7, and the nucleotide sequence of miRNA-132-3p is shown in SEQ ID NO.8.
[0007] Laminin molecules are typically found in the native basement membrane, while the E8 fragment specifically refers to a recombinant fragment containing the C-terminal LG1-3 domain and triple-helix region of the α-chain. The E8 fragment of the laminin α5 chain, as a core functional component of the basement membrane, possesses highly conserved integrin-binding motifs and heparin sulfate binding sites. It can activate the integrin α6β1 and α3β1 pathways, possessing key functions of the full-length laminin, and playing a role in promoting cell adhesion and maintaining stem cell stemness in the construction of the cellular microenvironment.
[0008] miRNAs are short, non-coding RNA molecules that regulate gene expression by targeting mRNAs, either by inhibiting translation or promoting degradation. miRNA-126, in particular, promotes VEGF expression by targeting and inhibiting negative regulators such as SPRED1 and PIK3R2, thereby promoting budding angiogenesis. miRNA-132-3p acts on the NF-κB pathway, reducing the release of pro-inflammatory factors such as IL-6 and TNF-α, and works synergistically with miRNA-126 to provide a low-inflammatory microenvironment for angiogenesis.
[0009] In existing technologies, while Lipo3000 can efficiently mediate the in vitro transfection of miRNAs, its in vivo application is limited by problems such as short local retention time, easy dilution by tissue fluid, and blood clearance. A single dose is insufficient to maintain the sustained exposure time required for the synergistic regulation of miRNA-126 and miRNA-132, while repeated injections increase the risk of tissue damage and inflammation. This invention proposes for the first time to load the Lipo3000-miRNA complex into a chitosan / hyaluronic acid hydrogel with optimized charge ratio. A two-step gelation method ensures the stability of the complex, and the gradient degradation characteristics of the gel network enable the programmed release of miRNA-126 and miRNA-132. Simultaneously, Laminin α5-E8 is co-loaded to construct an ECM biomimetic microenvironment, overcoming the technical contradiction that efficient transfection and sustained release are mutually exclusive.
[0010] In one embodiment of the present invention, the E8 fragment of the laminin α5 chain was obtained by an Escherichia coli prokaryotic expression system, using BL21(DE3) as the expression strain.
[0011] In the composite hydrogel, the concentration of the active ingredient is 1~5 mg / mL; The concentration of the functional small molecule is 50~200 μmol / L.
[0012] In vitro cell experiments showed that the optimal total concentration of the recombinant laminin E8 protein in the hydrogel was 1 mg / mL, which demonstrated the best effect in promoting HUVEC cell proliferation and adhesion, increasing the effect by 50%-82% compared to the blank control group. p <0.0001); Preferably, in the composite hydrogel, the concentration of the active ingredient is 1 mg / mL; The concentration of the functional small molecule is 100 μmol / L.
[0013] Preferably, the molar ratio of miRNA-126 to miRNA-132-3p is 1:9 to 9:1.
[0014] More preferably, the molar ratio of miRNA-126 to miRNA-132-3p is 1:1.
[0015] In one embodiment of the present invention, the hydrogel matrix is a chitosan-hyaluronic acid complex; The mass ratio of chitosan to hyaluronic acid is 3:7 to 7:3; Preferably, the mass ratio of chitosan to hyaluronic acid is 1:1.
[0016] A second objective of this invention is to provide a method for preparing a composite hydrogel loaded with Laminin α5-E8 and miRNAs, comprising the following steps: The E8 fragment of the laminin α5 chain, miRNAs, and hydrogel matrix were mixed to obtain a composite hydrogel loaded with Laminin α5-E8 and miRNAs.
[0017] In one embodiment of the present invention, the E8 fragment of the laminin α5 chain is prepared by the following method: (1) Construct a recombinant expression vector containing the E8 fragment sequence of the laminin α5 chain; (2) The recombinant expression vector obtained in step (1) is introduced into the host cell and strains that stably express recombinant protein E8 are screened. (3) Cultivate the strain that stably expresses recombinant protein E8 obtained in step (2), induce expression and purify to obtain the E8 fragment of laminin α5 chain; Preferably, the recombinant protein with the His tag is purified by affinity chromatography; the purified protein is identified by mass spectrometry to determine the sequence correctness of the target protein; the concentration of the E8 fragment of the identified laminin α5 chain is detected, and the concentration of the E8 fragment of the laminin α5 chain added to the hydrogel matrix is determined by cytotoxicity and adhesion experiments.
[0018] In one embodiment of the present invention, the temperature during the crosslinking process is 0~26 ℃ and the time is 10~20 min.
[0019] A third objective of this invention is to provide the application of the above-mentioned composite hydrogel loaded with Laminin α5-E8 and miRNAs in the preparation of a medicament for treating chronic wounds of diabetes.
[0020] A fourth objective of this invention is to provide a medicament for treating chronic diabetic wounds, the medicament comprising the aforementioned composite hydrogel loaded with Laminin α5-E8 and miRNAs.
[0021] The composite hydrogel prepared by this invention has good blood compatibility, biocompatibility and antibacterial properties, and can significantly promote cell adhesion and proliferation, angiogenesis and accelerate the healing of chronic diabetic wounds. The preparation method of this composite hydrogel is simple and environmentally friendly, with low biotoxicity, providing a new method for the treatment of diabetic wounds.
[0022] Compared with the prior art, the present invention has the following beneficial effects: The composite hydrogel loaded with Laminin α5-E8 and miRNAs provided by this invention has certain adhesion and antibacterial properties, as well as excellent biocompatibility and blood compatibility. This composite hydrogel can provide a physical barrier and moist environment for chronic wounds, and releases recombinant E8 protein, miRNA-126 and miRNA-132-3p, which can promote cell proliferation, angiogenesis and granulation tissue formation, thereby promoting rapid and efficient wound healing in multiple ways. Attached Figure Description
[0023] Figure 1 This is the plasmid map of the recombinant vector pET-28a-Laminin α5-E8 in Example 1 of this invention; Figure 2 This is a graph showing the expression results of Laminin α5-E8 in Example 1 of the present invention; Figure 3 This is a mass spectrometry identification result of Laminin α5-E8 in Example 1 of the present invention; Figure 4 This is a diagram showing the proliferation and adhesion results of HUVEC cells treated with different concentrations of Laminin α5-E8 for 24 h in Example 2 of this invention. Figure 5 This is a graph showing the release results of Laminin α5-E8 in the composite hydrogel in Example 4 of the present invention; Figure 6 This is a diagram showing the release results of miRNAs in the composite hydrogel in Example 5 of the present invention; Figure 7 This is a schematic diagram showing the results of treating HUVEC cells with composite hydrogel in Example 6 of the present invention; Figure 8 This is a comparison chart of the healing of diabetic chronic wounds treated with composite hydrogel in Example 7 of the present invention; Figure 9 H&E staining images of the composite hydrogel used to treat diabetic chronic wound tissue in Example 7 of the present invention (n=4 per group). Figure 10 Masson's chromatogram of the composite hydrogel used to treat diabetic chronic wound tissue in Example 7 of the present invention (n=4 per group). Figure 11 This is a data analysis diagram obtained from H&E staining maps and Masson detection maps in Embodiment 7 of the present invention (n=4 for each group). Detailed Implementation
[0024] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.
[0025] Unless otherwise specified, all reagents used in the following embodiments are commercially available reagents, and all detection methods and techniques used are conventional detection methods and techniques in the art.
[0026] Example 1 This embodiment provides a method for preparing Laminin α5-E8, as detailed below: (1) Preparation of Laminin α5-E8 protein ① Construction of expression strain: The sequence of Laminin α5-E8 (nucleotide sequence of Laminin α5-E8 is shown in SEQ ID NO.1, amino acid sequence is shown in SEQ ID NO.2) was obtained through literature review. The pET-28a-Laminin α5-E8 plasmid was constructed using gene synthesis (e.g., pET-28a-Laminin α5-E8 plasmid is shown in SEQ ID NO.2). Figure 1 (As shown).
[0027] Laminin α5-E8 was amplified using primers F1 (nucleotide sequence as shown in SEQ ID NO.3) and R1 (nucleotide sequence as shown in SEQ ID NO.4) to obtain fragment 1; pET-28a plasmid was amplified using primers F2 (nucleotide sequence as shown in SEQ ID NO.5) and R2 (nucleotide sequence as shown in SEQ ID NO.6) to obtain fragment 2; fragment 1 and fragment 2 were ligated using homologous recombinase to obtain the recombinant plasmid: pET-28a-Laminin α5-E8 plasmid.
[0028] 2 μL of recombinant plasmid was gently mixed with 100 μL of BL21(DE3), incubated on ice for 30 min, heat-shocked for 90 s, and then incubated on ice again for 2 min. 900 μL of LB medium was added for recovery at 37 ℃ and 200 rpm for 50 min. The recovered recombinant product was centrifuged at 4000 rpm for 2 min, and the 900 μL supernatant was removed and the product was resuspended. The resuspended product was then plated on LB agar plates containing kanamycin and incubated at 37 ℃ for 16 h. The next day, colonies were picked and expanded on plates (single colonies were picked and added to LB liquid medium, incubated at 37 ℃ and 200 rpm until the logarithmic growth phase). 100 μL of the bacterial culture was used for nucleic acid sequencing. The correctly sequenced strain (pET-28a-Laminin-α5-E8 strain) was selected for further research. ②Induction of expression: Add 100 μL of the pET-28a-Laminin-α5-E8 strain obtained in step ① to 100 mL of LB liquid medium and incubate at 37 ℃ and 200 rpm until OD. 600The concentration of the culture medium was 0.6-0.8. IPTG was added to a final concentration of 0.1 M, and expression was induced for 18 h at 18 ℃ and 200 rpm. The cultured bacterial solution was collected, centrifuged at 8000 rpm for 10 min, and the bacterial cells were obtained. The bacterial cells were resuspended in Tris-HCl-100 mM NaCl-8 M urea buffer (pH=8.0). The bacterial cells were disrupted using a cell disruptor, centrifuged at 8000 rpm for 30 min, and the supernatant was collected. The supernatant was filtered through a 0.45 μm filter membrane and used for later use.
[0029] ③ Affinity chromatography purification: The prepared supernatant obtained in step ② was loaded onto a nickel column equilibrated with Tris-HCl-100 mM NaCl (pH=8.0) (column volume 5 mL, flow rate 2 mL / min). After loading, the nickel column was reequilibrated with Tris-HCl-100 mM NaCl (pH=8.0), and gradient elution was performed with 50 mM, 100 mM, 200 mM, and 500 mM imidazole Tris-HCl-100 mM NaCl (pH=8.0) buffers, respectively. The eluents were collected and analyzed by SDS-PAGE. Based on the SDS-PAGE results, the corresponding gradient eluents were subjected to gradient renaturation treatment, and then concentrated using a 30 kDa ultrafiltration tube to obtain the target protein at a concentration of 5.1 mg / mL, which was then stored at -80℃.
[0030] (2) Identification of target protein The corresponding bands were cut from the SDS-PAGE, dehydrated with acetonitrile, and then digested with FASP. After desalting with a desalting column, the peptides were analyzed and identified by Q Exactive HF-X mass spectrometry.
[0031] Figure 2 The results of target protein expression and purification are shown. It can be seen that 100 mM and 200 mM imidazole can elute the target protein with high purity. Figure 3 The image shows the mass spectrometry identification results of the target protein. The sequence coverage of the target protein reached 82%. This protein had the highest abundance in the analyzed samples, and a total of 29 unique peptides were matched, which greatly ensured the accuracy and uniqueness of the protein inference and eliminated the interference of other homologous proteins, proving that the purified sample was Laminin α5-E8.
[0032] SEQ ID NO.1 is shown below (5'-3'): SEQ ID NO. 2 is specifically as follows: AAEDAAGQALQQADHTWATVVRQGLVDRAQQLLANSTALEEAMLQEQQRLGLVWAALQGARTQLRDVRAKKDQLEAHIQAAQAMLAMDTDETSKKIAHAKAVAAEAQDTATRVQSQLQAMQENVERWQGQYEGLRGQDLGQAVLDAGHSVSTLEKTLPQLLAKLSILENRGVHNASLALSASIGRVRELIAQARGAASKVKVPMKFNGRSGVQLRTPRDLADLAAYTALKFYLQGPEPEPGQGTEDRFVMYMGSRQATGDYMGVSLRDKKVHWVYQLGEAGPAVLSIDEDIGEQFAAVSLDRTLQFGHMSVTVERQMIQETKGDTVAPGAEGLLNLRPDDFVFYVGGYPSTFTPPPLLRFPGYRGCIEMDTLNEEVVSLYNFERTFQLDTAVDRPCARSKSTGDPWLTDGSYLDGTGFARISFDSQISTTKRFEQELRLVSYSGVLFFLKQQSQFLCLAVQEGSLVLLYDFGAGLKKAVPLQPPPPLTSASKAIQVFLLGGSRKRVLVRVERATVYSVEQDNDLELADAYYLGGVPPDQLPPSLRRLFPTGGSVRGCVKGIKALGKYVDLKRLNTTGVSAGCTADLLVGRAMTFHGHGFLRLALSNVAPLTGNVYSGFGFHSAQDSALLYYRASPDGLCQVSLQQGRVSLQLLRTEVKTQAGFADGAPHYVAFYSNATGVWLYVDDQLQQMKPHRGPPPELQPQPEGPPRLLLGGLPESGTIYNFSGCISNVFVQRLLGPQRVFDLQQNLGSVNVSTGCAPALQAQTPGLGPRGLQATARKASRRSRQPARHPA SEQ ID NO. 3 is specifically as follows (5'-3'): GCGCGGCAGCCATATGGCAGCAGAAGATGCCGCAGG; SEQ ID NO. 4 is specifically as follows (5'-3'): TTGTTAGCAGCCGGATCTTATTATGCAGGGTGACGTGCAG SEQ ID NO.5 is shown below (5'-3'): TAAGATCCGGCTGCTAACAAAGCC SEQ ID NO.6 is shown below (5'-3'): CCATATGGCTGCCGCGCGGCACCAGGCCGCTG Example 2 This example provides activity verification (CCK-8 assay) of Laminin α5-E8 (prepared in Example 1), as detailed below: ① Experimental group (α-E8): The 5.1 mg / mL protein solution was thawed, sterilized and impurities were removed using a 0.22 μm filter membrane, and Laminin α5-E8 was diluted with serum-free DMEM to prepare Laminin α5-E8 solutions with final concentrations of 0.1 mg / mL, 0.5 mg / mL, and 1 mg / mL for later use.
[0033] Use a pipette to add 100 μL of Laminin α5-E8 solution of different concentrations (0.1 mg / mL, 0.5 mg / mL, 1 mg / mL) to a 96-well plate and coat it for 12 h at 37℃ and 5% CO2 (5 replicates per group); the next day, discard the remaining liquid in the 96-well plate.
[0034] ② Positive control group (RGD group): RGD short peptide was used, and it was also diluted with serum-free DMEM to prepare RGD solutions with concentration gradients of 0.1 mg / mL, 0.5 mg / mL, and 1 mg / mL for later use.
[0035] RGD is a tripeptide composed of arginine, glycine, and aspartic acid. It can recognize and bind proteins such as integrins, which is beneficial for cell adhesion. Therefore, RGD is used as a positive control in this embodiment.
[0036] Use a pipette to add 100 μL of Laminin α5-E8 solution of different concentrations (0.1 mg / mL, 0.5 mg / mL, 1 mg / mL) to a 96-well plate and coat it for 12 h at 37℃ and 5% CO2 (5 replicates per group); the next day, discard the remaining liquid in the 96-well plate.
[0037] ③CK group: blank 96-well plate, without coating treatment (5 parallels per group).
[0038] When HUVEC cells are stably adherent and grow with a confluence of 80-90%, they are digested at a concentration of 1×10⁻⁶.4 Cells were seeded at a density of [number] cells / well in the three sets of 96-well plates mentioned above, gently agitated to ensure even distribution, and incubated at 37 ℃ in a 5% CO2 incubator for 24 h. The culture medium was then aspirated from each well, and each well was gently rinsed with 100 μL of PBS, which was then discarded. A mixture of CCK-8 solution and serum-free DMEM medium (volume ratio of CCK-8 solution to serum-free DMEM medium was 1:10) was added to each well, and the mixture was incubated at 37 ℃ for approximately 1 h. The absorbance was then measured using a microplate reader at a wavelength of 450 nm (e.g., [data missing]). Figure 4 (As shown).
[0039] The formula for calculating cell viability is as follows: Cell viability (%) = ; The experimental group consisted of a group containing protein solution, CCK-8 solution, and cells; a blank group and a control group were also set up: the blank group consisted of a group containing only CCK-8 solution and no cells; the control group consisted of a group containing no protein solution but containing CCK-8 solution and cells.
[0040] pass Figure 4 It was found that Laminin α5-E8 at concentrations of 0.1–1 mg / mL promoted cell proliferation, with a more significant promoting effect compared to the positive control group RGD. The promoting effect became more pronounced with increasing Laminin α5-E8 concentration; at a concentration of 1 mg / mL, the cell adhesion rate reached 282%, which was 1.82 times that of the CK group and 1.1 times that of the RGD group.
[0041] Example 3 This embodiment provides the preparation of a hydrogel matrix and a composite hydrogel, as detailed below: ① Preparation of hydrogel matrix: Chitosan and hyaluronic acid were cut into fine particles using surgical scissors in an EP tube and mixed at a mass ratio of 1:1 to obtain a mixed raw material. The mixed raw materials were added to PBS and mixed well to obtain a hydrogel matrix (in the hydrogel matrix, the mass percentage of chitosan and hyaluronic acid is 2%, and the same applies below).
[0042] ② Preparation of a composite hydrogel loaded with Laminin α5-E8 and miRNAs (miRNA-126, abbreviated as "mi-126"): Chitosan and hyaluronic acid were cut into fine particles using surgical scissors in an EP tube and mixed at a mass ratio of 1:1 to obtain a mixed raw material. The mixed raw materials were first mixed with 1 mg / mL Laminin α5-E8 solution (solvent: PBS, pH=7.4), and then the miRNA-126-lipid complex (the miRNA-126-lipid complex is a complex obtained by mixing lipo3000 and miRNA-126 at a ratio of 1 μL:1 μg; in the miRNA-126-lipid complex, the final concentration of miRNA-126 is 100 μmol / L, and the nucleotide sequence of miRNA-126 is shown in SEQ ID NO.7, and the same applies below) was added dropwise. The mixture was vortexed and allowed to stand at 4°C to prepare a composite hydrogel loaded with Laminin α5-E8 and miRNAs.
[0043] ③ Preparation of composite hydrogels loaded with Laminin α5-E8 and miRNAs (miRNA-132-3p, abbreviated as "mi-132"): Compared with step ② in this embodiment, only miRNA-126 is replaced with miRNA-132-3p, and everything else is the same as step ②; The nucleotide sequence of miRNA-132-3p is shown in SEQ ID NO.8.
[0044] ④ Preparation of composite hydrogels loaded with Laminin α5-E8 and miRNAs (miRNA-126-132, abbreviated as "mi-126-132"): Compared with step ② in this embodiment, only miRNA-126 is replaced with miRNA-126-132 (a mixture of miRNA-126 and miRNA-132-3p, with a molar ratio of miRNA-126 to miRNA-132-3p of 1:1), and everything else is the same as step ②.
[0045] The composite hydrogel loaded with Laminin α5-E8 and miRNAs (miRNA-126-132, abbreviated as "mi-126-132") is a light yellow transparent colloidal substance with certain viscosity and stretchability.
[0046] ⑤ Preparation of a composite hydrogel loaded with Laminin α5-E8 and miRNAs (in-mi-126 inhibitor, or simply "in-mi-126"): Compared with step ② in this embodiment, only miRNA-126 is replaced with an inhibitor of miRNA-126: in-mi-126, and everything else is the same as step ②; The nucleotide sequence of in-mi-126 is shown in SEQ ID NO.9.
[0047] ⑥ Preparation of a composite hydrogel loaded with Laminin α5-E8 and miRNAs (inhibitor of miRNA-132-3p: miRNA-132-3pinhibitor, abbreviated as "in-mi-132"): Compared with step ② in this embodiment, only miRNA-126 is replaced with an inhibitor of miRNA-132-3p: in-mi-132, and everything else is the same as step ②; The nucleotide sequence of in-mi-132 is shown in SEQ ID NO.10.
[0048] ⑦ Preparation of a composite hydrogel loaded with Laminin α5-E8 and miRNAs (in-miRNA-126-132, an inhibitor of miRNA-126-132, abbreviated as "in-mi-126-132"): Compared with step ② in this embodiment, only miRNA-126 is replaced with in-miRNA-126-132 (a mixture of in-mi-126 and in-mi-132, with a molar ratio of in-mi-126 to in-mi-132 of 1:1), and everything else is the same as step ②.
[0049] Table 1. Summary Table of Sequences Example 4 This embodiment provides the detection of the release rate of Laminin α5-E8 in a composite hydrogel loaded with Laminin α5-E8 and miRNAs (prepared in Example 3), as detailed below: The hydrogel matrix and composite hydrogel (a composite hydrogel loaded with Laminin α5-E8 and miRNAs (miRNA-126-132)) prepared in Example 3 were placed in PBS buffer solutions at pH 5.0 and pH 7.4, respectively (the ratio of hydrogel matrix or composite hydrogel to PBS was 1 mL: 5 mL), and reacted at 37 ℃ and 120 rpm. The solutions were taken out at 1 h, 3 h, 5 h, 7 h, 9 h, 12 h, 18 h, 24 h, 30 h, 36 h, 48 h, 60 h and 72 h, and centrifuged at 10000 rpm for 5 min to remove any potentially degraded colloids. The supernatant was incubated with BCA reagent (20 μL: 200 μL, 5 parallel samples) at 37 ℃ for 30 min. The absorbance at 560 nm was measured using a microplate reader. The hydrogel matrix group was used as a blank control to eliminate background colloid interference.
[0050] The formula for calculating the release rate is as follows: in, Q n This represents the cumulative release of Laminin α5-E8 at the nth time. C n This represents the concentration of Laminin α5-E8 at the nth sampling, and V represents the total volume of the release medium. V i Indicates the sampling volume.
[0051] The cumulative release rates of Laminin α5-E8 loaded on the composite hydrogel under acidic (pH=5.0) and neutral (pH=7.4) conditions are as follows: Figure 5 As shown, through Figure 5 It can be observed that under acidic conditions, the Schiff base bonds hydrolyze rapidly, and the three-dimensional network structure of the hydrogel dissociates, which accelerates the release rate of Laminin α5-E8 embedded in the network structure. The cumulative release rate can reach 68.9% in about 24 hours.
[0052] Example 5 This embodiment provides the detection of miRNA release rate in composite hydrogels, as detailed below: The hydrogel matrix and the composite hydrogel (a composite hydrogel loaded with Laminin α5-E8 and miRNAs (miRNA-126-132)) prepared in Example 3 were placed in PBS buffer solutions of pH 5.0 and pH 7.4 respectively (the ratio of hydrogel matrix or composite hydrogel to PBS was 1 mL: 5 mL), and reacted at 37 °C and 120 rpm. The solution was removed at 0.5 h, 1 h, 3 h, 5 h, 7 h, 9 h, 12 h, 18 h, 24 h, 30 h, 36 h, 48 h, 60 h, and 72 h of reaction. It was centrifuged at 10,000 rpm for 5 min to remove any potentially degraded colloids. The supernatant was then incubated with RNA fluorescence detection reagent (the ratio of supernatant to RNA fluorescence detection reagent was 10 μL:190 μL, with 5 parallel samples) at room temperature in the dark for 2 min. The fluorescence value at 630 / 660 nm was detected using an ELISA reader. The hydrogel matrix group was used as a blank control to eliminate background colloid interference.
[0053] The formula for calculating the release rate is as follows: in, This represents the cumulative amount of miRNA released at time point t. Let represent the concentration of the i-th sample. Ct V represents the miRNA concentration measured at time point t, V0 represents the total volume of the release medium, and m represents the initial total amount of miRNA loaded on the hydrogel.
[0054] The cumulative release rates of miRNAs loaded on the composite hydrogel under acidic (pH=5.0) and neutral (pH=7.4) conditions are as follows: Figure 6 As shown, through Figure 6 It can be observed that under acidic conditions, the Schiff base bonds hydrolyze rapidly, and the three-dimensional network structure of the hydrogel dissociates, which promotes the rapid release of miRNAs embedded in the network structure. The cumulative release rate can reach 67.4% in about 18 hours, which is similar to the trend of protein release rate.
[0055] Example 6 This embodiment provides verification of the miRNA upregulation effect after treating HUVEC cells with composite hydrogel, as detailed below: HUVEC cells with a confluence of 90% were digested and processed at a concentration of 2.5 × 10⁻⁶. 5 Cells were seeded at a density of 1 / mL in 24-well plates and incubated overnight to allow for adherent growth. 500 μL of the composite hydrogels prepared in Example 3 (the composite hydrogels prepared in steps ②, ③, ④, ⑤, ⑥, and ⑦) were placed in Transwell chambers, which were then placed in 24-well plates and incubated for 24 h. The hydrogel matrix group served as a blank control (NC). After incubation, RNA was extracted from the cells in the wells and validated by qPCR.
[0056] miRNAs regulate SPRED and RASA1 expression in HUVEC cells. Results are as follows: Figure 7 As shown. (Through) Figure 7 It was observed that after treating cells with hydrogels loaded with different miRNAs, the levels of the corresponding mRNAs within the cells increased, indicating that the miRNAs were successfully released and exerted their effects. miRNA-126 successfully targeted and downregulated SPRED, activated the VEGF / VEGFR2 signaling pathway, and enhanced angiogenesis and endothelial repair; miRNA-132-3p successfully targeted and downregulated RASA1, promoting cell migration; the combined effect of the two was synergistic.
[0057] Example 7 This embodiment provides a therapeutic evaluation of composite hydrogel on diabetic full-cortical lesions in mice, as detailed below: Thirty C57BL / 6 mice with type 1 diabetes, weighing 22–25 g, were used. After acclimatization, they were anesthetized with intraperitoneal injection of sodium pentobarbital (60 mg / kg). The hair on the backs of the mice was shaved, and after disinfection with iodine, a circular mark was made on the back of each mouse using an 8 mm punch. A standard circular wound was then created along the mark using surgical scissors. A wound pad was attached to the wound edge using bio-adhesive to prevent wound contraction. The control group received no treatment, while the experimental group received 200 μL of a composite hydrogel (the composite hydrogel prepared in Example 3, loaded with Laminin α5-E8 and miRNAs (mi-126-132)) evenly spread on the wound surface. Both groups used the same bandaging technique. The composite hydrogel was changed and the bandage was reapplied every other day. The wound healing area was photographed and recorded on days 0, 3, 7, and 14, and the wound healing status was analyzed using ImageJ software.
[0058] On postoperative days 3, 7 and 14, four mice from each group were randomly selected for euthanasia and samples were taken for H&E and Masson histological analysis.
[0059] Treatment effect Figure 8 As shown, through Figure 8 It was observed that on day 0 of the model, the wound areas of the control group and the composite hydrogel treatment group were similar, approximately in the early healing stage (3-5 days). The control group showed more exudate, a more severe inflammatory response, and slower wound contraction; while the composite hydrogel treatment group showed milder inflammatory response, reduced exudate, and earlier epithelialization at the wound margins. In the mid-healing stage (7-9 days), the control group still showed large areas of exposed wound, but the treatment group showed new granulation tissue and scab formation, with a significantly reduced wound area. Calculations showed that the wound healing area in the composite hydrogel treatment group reached 70.3%, far exceeding the 44.6% in the control group. On day 14, there was no significant difference between the control and experimental groups. These results indicate that the composite hydrogel mainly plays a role in the early stage of wound healing, accelerating the healing speed and quality of the early wound.
[0060] H&E staining was performed on tissue samples taken on days 7 and 14 of treatment to assess epidermal growth and granulation tissue formation. Results are as follows: Figure 9 and Figure 11 As shown. (Through) Figure 9 It was observed that on day 7, both groups showed inflammatory cell infiltration and early loose granulation tissue formation. However, the control group had a large number of inflammatory cells in the wound and no obvious epithelialization; the composite hydrogel treatment group had relatively fewer inflammatory cells, and the epidermis began to migrate towards the center of the wound, showing a faster epithelialization process. On day 14, the control group entered the remodeling phase, with epidermal reconstruction, but the collagen fibers in the dermis were arranged in a more disordered manner; the epidermis in the treatment group was completely continuous, with the appearance of accessory structures such as hair follicles, indicating stronger tissue regeneration capacity.
[0061] Masson staining was performed on tissue samples taken on days 7 and 14 of treatment to assess collagen deposition. The results are as follows: Figure 10 and Figure 11 As shown in the diagram, on day 7, the collagen in the control group (blue) was sparse and disorganized, with an average collagen coverage of 31.33%. By day 14, collagen fibers increased, mainly reticular fibers, with the collagen coverage increasing to 50.09%, although maturity was still insufficient. Compared to the treatment group on day 14, the collagen fibers were more regular and robust, with a collagen content of 71.29%, resulting in higher wound healing quality.
[0062] In summary, the composite hydrogel loaded with Laminin α5-E8 and miRNAs prepared in this invention can significantly promote the treatment of chronic wound healing in diabetic patients.
[0063] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the interpretation of the present invention, without departing from the scope of the invention, should be within the protection scope of the present invention.
Claims
1. A composite hydrogel loaded with Laminin α5-E8 and miRNAs, characterized in that, The composite hydrogel includes active ingredients, functional small molecules, and a hydrogel matrix; The active ingredient is the E8 fragment of the laminin α5 chain: Laminin α5-E8, and the functional small molecule is miRNAs; The nucleotide sequence of the Laminin α5-E8 is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2; The miRNAs are a mixture of miRNA-126 and miRNA-132-3p; The nucleotide sequence of miRNA-126 is shown in SEQ ID NO.7, and the nucleotide sequence of miRNA-132-3p is shown in SEQ ID NO.
8.
2. The composite hydrogel loaded with Laminin α5-E8 and miRNAs according to claim 1, characterized in that, In the composite hydrogel, the concentration of the active ingredient is 1~5 mg / mL; The concentration of the functional small molecule is 50~200 μmol / L.
3. The composite hydrogel loaded with Laminin α5-E8 and miRNAs according to claim 2, characterized in that, In the composite hydrogel, the concentration of the active ingredient is 1 mg / mL; The concentration of the functional small molecule is 100 μmol / L.
4. The composite hydrogel loaded with Laminin α5-E8 and miRNAs according to claim 3, characterized in that, The molar ratio of miRNA-126 to miRNA-132-3p is 1:9 to 9:
1.
5. The composite hydrogel loaded with Laminin α5-E8 and miRNAs according to claim 4, characterized in that, The molar ratio of miRNA-126 to miRNA-132-3p is 1:
1.
6. The composite hydrogel loaded with Laminin α5-E8 and miRNAs according to claim 1, characterized in that, The hydrogel matrix is a chitosan-hyaluronic acid complex. The mass ratio of chitosan to hyaluronic acid is 3:7 to 7:
3.
7. A method for preparing a composite hydrogel loaded with Laminin α5-E8 and miRNAs as described in any one of claims 1 to 6, characterized in that, Includes the following steps: The E8 fragment of the laminin α5 chain, miRNAs, and hydrogel matrix were mixed and cross-linked to obtain a composite hydrogel loaded with Laminin α5-E8 and miRNAs.
8. The method for preparing a composite hydrogel loaded with Laminin α5-E8 and miRNAs according to claim 5, characterized in that, During the crosslinking process, the temperature is 0~26 ℃ and the time is 10~20 min.
9. The use of a composite hydrogel loaded with Laminin α5-E8 and miRNAs as described in any one of claims 1 to 6 in the preparation of a medicament for treating chronic wounds of diabetes.
10. A medicine for treating chronic wounds in diabetic patients, characterized in that, The drug contains a composite hydrogel loaded with Laminin α5-E8 and miRNAs as described in any one of claims 1 to 6.