Application of a KASP molecular marker in identifying soybean hundred-grain weight

CN122189222APending Publication Date: 2026-06-12NORTHEAST INST OF GEOGRAPHY & AGRIECOLOGY C A S +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NORTHEAST INST OF GEOGRAPHY & AGRIECOLOGY C A S
Filing Date
2026-01-27
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

In current soybean breeding, molecular markers for 100-seed weight have poor stability and low detection efficiency, resulting in long breeding cycles and low efficiency. In particular, the lack of stable markers with multi-environment verification in high-latitude regions limits the breeding of soybean varieties with high 100-seed weight.

Method used

We developed a KASP molecular marker targeting the soybean chromosome 8 SNP site Chr08_16160959 and its specific primer set. By amplifying KASP-PCR and detecting the fluorescence signal, we achieved genotyping of soybean seedlings and rapidly screened varieties with high 100-seed weight.

Benefits of technology

It enables early screening and precision breeding of high-grain-weight varieties, shortens the breeding cycle by 3-4 generations, increases breeding efficiency by 2-3 times, and achieves a genotype interpretation accuracy rate of 99%. It is applicable to high latitudes and different ecological regions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122189222A_ABST
    Figure CN122189222A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant molecular breeding, and particularly relates to application of a KASP molecular marker in identification of soybean hundred-grain weight. The molecular marker corresponds to a SNP site Chr08_16160959 (physical position 16,160,959 bp, reference genome is Williams 82 Wm82.a2.v1) on chromosome 8 of soybean, and the site has a G>A single nucleotide polymorphism (SNP). A specific KASP primer is designed based on the site, and the soybean hundred-grain weight genotype can be accurately identified through genotype detection, early screening of high hundred-grain weight soybean varieties and molecular marker assisted breeding are realized, the breeding cycle is significantly shortened, the breeding efficiency is improved, and an efficient genomic tool is provided for soybean yield improvement.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular breeding technology, specifically relating to the application of a KASP molecular marker in identifying the 100-seed weight of soybeans. Background Technology

[0002] Soybeans are an important oilseed crop and protein source in my country, and their yield is directly related to national food security and edible oil supply. 100-grain weight (HSW) is one of the core constituent traits of soybean yield, possessing high heritability and showing a significant positive correlation with yield, making it an important target trait for soybean breeding. However, traditional soybean breeding relies on phenotypic selection, which suffers from problems such as long cycles, low efficiency, and significant susceptibility to environmental influences. In particular, phenotypic identification of 100-grain weight must wait until soybeans are mature and harvested, resulting in a slow breeding process.

[0003] Molecular marker-assisted breeding (MAS) technology, by screening molecular markers closely associated with target traits, enables rapid genotyping at the seedling stage, significantly shortening the breeding cycle and improving selection accuracy. Genome-wide association analysis (GWAS) is an efficient method for mining trait-related molecular markers and has been widely used in soybean yield trait research. While some QTLs and SNPs associated with soybean 100-seed weight have been reported in existing technologies, most markers suffer from poor stability, low detection efficiency, and insufficient phenotypic explanatory power, making it difficult to meet practical breeding needs. Especially in high-latitude soybean germplasm resources, the lack of stable markers validated by multiple environments and models limits the breeding process of high-100-seed-weight soybean varieties.

[0004] Therefore, developing molecular markers that are closely related to the 100-seed weight of soybeans, have high stability, and are easy to detect is of great significance for promoting the development of soybean molecular breeding technology and improving breeding efficiency. Summary of the Invention

[0005] The purpose of this invention is to provide a KASP molecular marker related to soybean 100-seed weight, its specific primer set, detection method, and application, so as to solve the problems of poor stability and low detection efficiency of existing soybean 100-seed weight molecular markers, and to achieve rapid screening and precise breeding of high 100-seed weight soybean varieties.

[0006] To achieve the above objectives, the present invention is implemented through the following solution:

[0007] This invention provides an application of the KASP molecular marker in identifying the 100-seed weight of soybean, wherein the molecular marker targets the SNP site Chr08_16160959 located on soybean chromosome 8;

[0008] The physical location of the site is 16,160,959 bp, and the site exhibits a G>A single nucleotide polymorphism.

[0009] In this invention, the reference genome of the soybean is Williams 82 Wm82.a2.v1.

[0010] The present invention also provides a set of KASP primers for detecting SNP sites, wherein the nucleotide sequence of the upstream allele-specific primer K-08HSW-HEX (corresponding to the A allele, with a HEX fluorescent tag sequence at the 5' end) of the KASP primer set is shown in SEQ ID NO.1;

[0011] The nucleotide sequence of the upstream allele-specific primer K-08HSW-FAM (corresponding to the G allele, with a FAM fluorescent tag sequence at the 5' end) of the KASP primer set is shown in SEQ ID NO.2;

[0012] The nucleotide sequence of the downstream common primer K-08HSW-Common of the KASP primer set is shown in SEQ ID NO.3;

[0013] The SNP site is Chr08_16160959.

[0014] SEQ ID NO1:

[0015] GAAGGTCGGAGTCAACGGATTTTATCAGAAAGACCACTGAGTCTAA;

[0016] SEQ ID NO.2:

[0017] GAAGGTGACCAAGTTCATGCTTTATCAGAAAGACCACTGAGTCTAG;

[0018] SEQ ID NO.3:

[0019] CTCCCATGTGTTGAATCCAACCTCC.

[0020] This invention provides a method for detecting the genotype of 100-seed weight in soybeans, the method comprising the following steps:

[0021] (1) Extracting DNA from the soybean genome;

[0022] (2) Using DNA as a template, KASP-PCR amplification was performed using the KASP primer set described in claim 2;

[0023] (3) Obtain fluorescence typing results through FAM and HEX fluorescence signals, and determine the genotype of soybean samples based on the fluorescence typing results.

[0024] In this invention, the genotype determination criteria in step (3) are as follows:

[0025] When only FAM fluorescence signal is present, the genotype is determined to be G / G homozygous, i.e., high 100-grain weight;

[0026] When only HEX fluorescence signal is present, the genotype is determined to be A / A homozygous, i.e., low 100-grain weight;

[0027] When both FAM and HEX fluorescence signals are present, the genotype is determined to be G / A heterozygous.

[0028] This invention also provides the application of the above-mentioned molecular markers, primer sets, or detection methods in molecular marker-assisted soybean breeding.

[0029] This invention also provides the application of the above-mentioned molecular markers, primer sets, or detection methods in the identification of soybean 100-seed weight genotypes.

[0030] This invention also provides the application of the above-mentioned molecular markers, primer sets, or detection methods in the screening and evaluation of soybean germplasm resources.

[0031] This invention also provides the application of the above-mentioned molecular markers, primer sets, or detection methods in the identification of resistance genotypes in plants.

[0032] In this invention, the plants include monocotyledonous or dicotyledonous plants. In practice, the plants include, but are not limited to, soybeans, kidney beans, peas, milkvetch, Arabidopsis thaliana, wheat, rice, corn, cotton, and peanuts.

[0033] This invention also clarifies the core breeding application scenarios of the above-mentioned marking and detection methods.

[0034] The KASP molecular marker, its primer set, and detection method of this invention can be widely applied to marker-assisted breeding (MAS) and germplasm resource screening in soybean. Core application scenarios include:

[0035] (1) Early screening of high 100-grain weight soybean varieties: Extract leaf DNA during the soybean seedling stage (2-3 leaf stage), identify the genotype using the detection method of this invention, directly screen GG genotype single plants (high 100-grain weight), eliminate AA genotype single plants, without waiting for harvest identification at maturity, shortening the breeding cycle by 3-4 generations;

[0036] (2) Identification of high-latitude soybean germplasm resources: The materials in the Northeast high-latitude adapted soybean germplasm resource bank were classified in batches to quickly screen superior germplasm carrying the GG allele, providing a precise basis for the selection of breeding parents;

[0037] (3) Variety purity test: Genotyping of high-grain-weight soybean hybrids or conventional varieties is carried out to determine the variety purity (such as whether the proportion of GG genotype in hybrids meets expectations) and ensure seed quality.

[0038] This invention is applicable primarily to soybean (Glycine) plants within the genus *Glycine* (Fabaceae family), and is suitable for soybean germplasm resources and hybrids carrying the SNP site Chr08_16160959 (reference genome Williams 82 Wm82.a2.v1). For closely related genus *Glycine* such as common bean and pea, the invention can be used after verifying the presence of homologous functional sites and sequence conservation of this SNP in their genomes. In practical application, this invention involves dicotyledonous plants, including but not limited to soybean, common bean, pea, milkvetch, peanut, and other legumes, as well as cotton. Theoretically, the technical solution provided by this invention can also be applied to monocotyledonous plants, including but not limited to wheat, rice, and corn.

[0039] Compared with existing technologies, the present invention has the following advantages:

[0040] 1. High stability: The molecular markers in this invention are stably associated with the 100-grain weight of soybeans after being verified by two GWAS models and two independent environments, and are not affected by environmental interference, thus solving the problem of insufficient stability of existing markers.

[0041] 2. High detection efficiency: Using KASP technology, rapid detection can be performed at the seedling stage without the need for enzyme digestion, electrophoresis and other steps. The detection time for a single sample is ≤3h, and high-throughput detection (96-well / 384-well plate) can be achieved quickly and accurately, enabling batch screening and genotyping of germplasm resources.

[0042] 3. High specificity: The primer set is designed for conserved sequences flanking the SNP site, amplifying only the target region, with no non-specific bands, and the genotype interpretation accuracy rate is over 99%.

[0043] 4. High application value: It can be directly used for early screening of high 100-seed weight soybean varieties, molecular marker-assisted breeding and germplasm resource identification. Genotyping can be completed at the seedling stage, without waiting for soybean maturity and harvest, which greatly shortens the breeding cycle by 3 to 4 generations and increases breeding efficiency by 2 to 3 times, providing an efficient tool for soybean yield improvement.

[0044] 5. Applicable to soybean breeding scenarios in different ecological regions such as high latitudes;

[0045] 6. It can be used in conjunction with other yield trait markers to achieve aggregate breeding and efficiently cultivate soybean varieties with "high 100-grain weight + excellent overall quality".

[0046] In summary, the KASP molecular marker, its specific primer set, detection method, and application provided by this invention can directly solve the core pain points of "long phenotypic identification cycle, poor stability of existing markers, and low screening efficiency" in soybean 100-seed weight breeding. It provides an efficient tool for the precise breeding of high 100-seed weight soybean varieties, rapid screening of germplasm resources, and molecular marker-assisted breeding, and has clear innovation, outstanding practicality, and broad industrial promotion value. Attached Figure Description

[0047] Figure 1 Manhattan plot of genome-wide association analysis (CMLM model) for soybean 100-seed weight in JMS17 environment;

[0048] The horizontal axis in the figure represents the chromosome numbers of soybean 1 to 20, and the vertical axis is −log10(P) (the higher the value, the stronger the association between SNP and 100-grain weight). The green dashed line is the threshold line for the significance of association. The green dot on chromosome 8 is the target SNP site Chr08_16160959, whose value is significantly higher than the threshold and is highly significantly associated with 100-grain weight.

[0049] Figure 2 QQ plot of GWAS of CMLM model for soybean 100-seed weight under JMS17 environment;

[0050] The horizontal axis in the figure represents the theoretically expected −log10 (P) value, and the vertical axis represents the actual observed −log10 (P) value; the blue curve represents the distribution of actual observed values, the red line represents the distribution of theoretical expected values, and the gray area represents the confidence interval; points in the figure that deviate from the theoretical line (such as the upper right corner) correspond to SNP sites that are significantly associated with 100-grain weight.

[0051] Figure 3 A schematic diagram of the flanking sequence and primer design for the SNP site Chr08_16160959. Detailed Implementation

[0052] This invention aims to provide a KASP molecular marker targeting functional SNP sites of 100-seed weight in soybean and its application method. Its core application is for identifying superior germplasm resources and detecting the purity of high-yielding varieties in high-100-seed-weight soybean breeding. Compared with traditional methods, this invention eliminates the need to wait for soybean maturity for 100-seed-weight phenotypic identification, allowing for precise genotyping directly during the soybean seedling stage, significantly shortening the breeding cycle and improving the efficiency of screening high-100-seed-weight materials. The technical solution of this invention is described in detail below with reference to the accompanying drawings, primer sequences, and specific embodiments.

[0053] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions.

[0054] Example 1

[0055] SNP site screening and primer design

[0056] 1. SNP site selection

[0057] The experimental materials used to develop the molecular markers of this invention were 196 soybean high-latitude adapted germplasm resources covering five accumulated temperature zones in Northeast China. This population underwent field trials for three consecutive years from 2017 to 2019 in Jiamusi, Heilongjiang Province (46.82°N, 130.37°E), and the 100-seed weight phenotype data were systematically identified. The results showed that the broad-sense heritability of this trait reached 0.94, with both genotype and environmental effects being highly significant (P<0.0001), and the genotype × environment interaction was not significant, indicating that the 100-seed weight is genetically stable and suitable for molecular marker development.

[0058] 2.08 million high-quality SNPs were obtained through whole-genome resequencing. Association analysis using five GWAS models (CMLM, SUPER, FarmCPU, MLMM, and BLINK) in three independent environments (JMS17, JMS18, and JMS19) and a combined environment (CE) identified the SNP Chr08_16160959 on soybean chromosome 8 as a key site controlling 100-grain weight. This site is located at 16,160,959 bp (reference genome: Williams 82 Wm82.a2.v1), within the stable QTL qGW8 physical region (16,145,697~16,572,697 bp), and contains a G>A single nucleotide mutation. The phenotypic explained value (PVE) reached 41.35%. The site was stably detected in two environments and the combined environment, and its genetic effect was reliably validated by two GWAS models.

[0059] The genotype at this SNP locus corresponds to the soybean 100-seed weight phenotype as follows:

[0060] (1) G / G homozygous type: The soybean 100-seed weight is significantly higher, which is a good phenotype of high 100-seed weight;

[0061] (2) G / A heterozygous type;

[0062] (3) A / A homozygous type: The 100-seed weight of soybeans is significantly lower, which is a low 100-seed weight phenotype.

[0063] 2. Develop KASP markers for SNP sites and design primer sets for detecting these markers.

[0064] The KASP marker was developed for marker-assisted selection breeding of soybean 100-seed weight. The KASP primers corresponding to the SNP site Chr08_16160959 consist of two specific upstream primers K-08HSW-HEX (sequence as shown in SEQ ID NO.1) and K-08HSW-FAM (sequence as shown in SEQ ID NO.2) and one common downstream primer K-08HSW-Common (sequence as shown in SEQ ID NO.3). The specific sequences are as follows:

[0065] K-08HSW-HEX:

[0066] 5'- GAAGGTCGGAGTCAACGGATT TTATCAGAAAGACCACTGAGTCTAA-3' (SEQ ID NO. 1);

[0067] K-08HSW-FAM:

[0068] 5'- GAAGGTGACCAAGTTCATGCT TTATCAGAAAGACCACTGAGTCTAG-3' (SEQ ID NO. 2);

[0069] K-08HSW-Common:

[0070] 5'-CTCCCATGTGTTGAATCCAACCTCC-3' (SEQ ID NO. 3).

[0071] Specifically, K-08HSW-HEX has a HEX fluorescent tag sequence (underlined base) at its 5' end, which, when combined with a common upstream primer, can specifically amplify the fragment with SNP site A. The fluorescent signal of the HEX group can be detected by an ELISA reader or a quantitative PCR instrument. K-08HSW-FAM has a FAM fluorescent tag sequence (underlined base) at its 5' end, which, when combined with a common upstream primer, can specifically amplify the fragment with SNP site G. The fluorescent signal of the FAM group can be detected by an ELISA reader or a quantitative PCR instrument.

[0072] The sequence of the SNP site (Chr08_16160959) in the reference genome Williams 82 with G (including 200 bp flanking sequences upstream and downstream) is shown in SEQ ID NO.4, and the mutant (G>A) sequence is shown in SEQ ID NO.5.

[0073] TGTTGTTCATATTATTCTGAATGTAATTTTTGACTGAGGAGTAATTTGGTGATAGTGTGGAACCACACAATACGACGGCGTTTAAGAACTGGGTTCTTGATGGCGAGGCATTCGCACTGCCAGAGACTCTTAAAATGTACAACAAACTGTTGGCTCTCGGCATCAAGATTGTATTCTTATCAGAAAGACCACTGAGTCTA G GGGATGTAACAGCCAAGAACTTAAAGGAGGTTGGATTCAACACATGGGAGAAGTTAATTCTCAGGTGACTTTCCTTCTTCTTTTAAAACCTCTTAATTTACATTGTAAATGTAAAACATTTTAGAATTTGGTTTAGATGTGACATTAAAATAATTGTTAATCATGTGATGAACAATATGACACTAGTTGAGGTTAGTACA (SEQ ID NO.4);

[0074] TGTTGTTCATATTATTCTGAATGTAATTTTTGACTGAGGAGTAATTTGGTGATAGTGTGGAACCACACAATACGACGGCGTTTAAGAACTGGGTTCTTGATGGCGAGGCATTCGCACTGCCAGAGACTCTTAAAATGTACAACAAACTGTTGGCTCTCGGCATCAAGATTGTATTCTTATCAGAAAGACCACTGAGTCTA A GGGATGTAACAGCCAAGAACTTAAAGGAGGTTGGATTCAACACATGGGAGAAGTTAATTCTCAGGTGACTTTCCTTCTTCTTTTAAAACCTCTTAATTTACATTGTAAATGTAAAACATTTTAGAATTTGGTTTAGATGTGACATTAAAATAATTGTTAATCATGTGATGAACAATATGACACTAGTTGAGGTTAGTACA (SEQ ID NO.5).

[0075] Example 2

[0076] Verification of KASP molecular markers

[0077] Twenty soybean varieties with known 100-seed weights were selected (10 high-100-seed-weight varieties and 10 low-100-seed-weight varieties). DNA was extracted from soybean seedling leaves using the CTAB method, and its purity and concentration were tested before use. KASP-PCR amplification was performed according to the above system and procedure. The results showed that all 10 high-100-seed-weight varieties were identified as having the GG genotype; all 10 low-100-seed-weight varieties were identified as having the AA genotype. The genotype and phenotype match rate was 100%, indicating that the marker detection accuracy was extremely high (Table 1).

[0078] Table 1. Correspondence between KASP classification and soybean 100-seed weight for 20 soybean varieties with known 100-seed weight.

[0079] Variety number 100-seed weight (g) KASP fluorescence signal type Genotype FNGS157 22.93 FAM G / G FNGS161 22.51 FAM G / G FNGS170 25.68 FAM G / G FNGS173 23.84 FAM G / G FNGS174 23.65 FAM G / G FNGS175 23.38 FAM G / G FNGS177 23.34 FAM G / G FNGS178 22.95 FAM G / G FNGS179 23.73 FAM G / G FNGS180 25.37 FAM G / G FNGS203 13.33 HEX A / A FNGS204 16.12 HEX A / A FNGS214 17.11 HEX A / A FNGS295 20.48 HEX A / A FNGS312 19.11 HEX A / A FNGS333 17.36 HEX A / A FNGS338 19.31 HEX A / A FNGS341 19.21 HEX A / A FNGS345 19.65 HEX A / A FNGS357 18.93 HEX A / A

[0080] Example 3

[0081] Based on this SNP, high-grain-weight soybean varieties were screened from natural varieties.

[0082] The molecular markers, primer sets, and detection methods of this invention were used to identify the genotypes of 45 natural soybean varieties and screen for high 100-seed weight soybean varieties. KASP molecular marker detection revealed 41 varieties with only FAM fluorescence (GG genotype), with an average 100-seed weight of 23.52 g; and 4 varieties with only HEX fluorescence (AA genotype), with an average 100-seed weight of 17.34 g (Table 2). These results indicate that the 100-seed weight of the GG genotype varieties identified by this KASP molecular marker is significantly higher than that of the AA genotype varieties. The GG genotype varieties are the target high-100-seed-weight varieties for screening, consistent with the genotype prediction results. This example verifies the reliability of the KASP marker genotyping results.

[0083] Table 2. Correspondence between KASP typing of 45 natural soybean varieties and 100-seed weight of soybean.

[0084] Variety number 100-seed weight (g) KASP fluorescence signal type Genotype FNGS219 25.43 FAM G / G FNGS221 22.85 FAM G / G FNGS223 24.84 FAM G / G FNGS228 22.75 FAM G / G FNGS236 23.85 FAM G / G FNGS237 22.38 FAM G / G FNGS246 23.41 FAM G / G FNGS247 25.31 FAM G / G FNGS248 24.83 FAM G / G FNGS250 22.24 FAM G / G FNGS251 25.14 FAM G / G FNGS259 24.73 FAM G / G FNGS260 24.7 FAM G / G FNGS263 22.01 FAM G / G FNGS264 23.73 FAM G / G FNGS266 22.37 FAM G / G FNGS267 24.62 FAM G / G FNGS275 24.54 FAM G / G FNGS276 21.6 FAM G / G FNGS284 22.82 FAM G / G FNGS285 25.84 FAM G / G FNGS286 24.86 FAM G / G FNGS287 23.09 FAM G / G FNGS297 23.62 FAM G / G FNGS301 24.57 FAM G / G FNGS302 21.32 FAM G / G FNGS303 24.55 FAM G / G FNGS308 21.94 FAM G / G FNGS309 24.16 FAM G / G FNGS311 23.57 FAM G / G FNGS314 22.15 FAM G / G FNGS315 23.18 FAM G / G FNGS316 23.64 FAM G / G FNGS317 22.16 FAM G / G FNGS318 22.56 FAM G / G FNGS321 21.41 FAM G / G FNGS322 23.68 FAM G / G FNGS323 24.29 FAM G / G FNGS324 24.89 FAM G / G FNGS325 23.62 FAM G / G FNGS326 21.27 FAM G / G FNGS362 17.58 HEX A / A FNGS368 16.79 HEX A / A FNGS371 18.77 HEX A / A FNGS376 16.21 HEX A / A

[0085] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. The application of a KASP molecular marker in identifying the 100-seed weight of soybeans, characterized in that, The molecular marker targets the SNP site Chr08_16160959 located on soybean chromosome 8. The physical location of the site is 16,160,959 bp, and the site exhibits a G>A single nucleotide polymorphism.

2. A set of KASP primers for detecting SNP sites, characterized in that, The nucleotide sequence of the upstream allele-specific primer K-08HSW-HEX of the KASP primer set is shown in SEQ ID NO. 1; The nucleotide sequence of the upstream allele-specific primer K-08HSW-FAM of the KASP primer set is shown in SEQ ID NO.2; The nucleotide sequence of the downstream common primer K-08HSW-Common of the KASP primer set is shown in SEQ ID NO.3; The SNP site is Chr08_16160959.

3. A method for detecting the genotype of 100-seed weight in soybeans, characterized in that, The detection method includes the following steps: (1) Extracting DNA from the soybean genome; (2) Using DNA as a template, KASP-PCR amplification was performed using the KASP primer set described in claim 2; (3) Obtain fluorescence typing results through FAM and HEX fluorescence signals, and determine the genotype of soybean samples based on the fluorescence typing results.

4. The detection method according to claim 3, characterized in that, The genotype determination criteria mentioned in step (3) are as follows: When only FAM fluorescence signal is present, the genotype is determined to be G / G homozygous, i.e., high 100-grain weight; When only HEX fluorescence signal is present, the genotype is determined to be A / A homozygous, i.e., low 100-grain weight; When both FAM and HEX fluorescence signals are present, the genotype is determined to be G / A heterozygous.

5. The application of the molecular marker of claim 1, the primer set of claim 2, or the detection method of any one of claims 3 to 5 in molecular marker-assisted soybean breeding.

6. The application of the molecular marker of claim 1, the primer set of claim 2, or the detection method of any one of claims 3 to 5 in the identification of soybean 100-seed weight genotype.

7. The application of the molecular marker of claim 1, the primer set of claim 2, or the detection method of any one of claims 3 to 5 in the screening and evaluation of soybean germplasm resources.

8. The application of the molecular marker of claim 1, the primer set of claim 2, or the detection method of any one of claims 3 to 5 in the identification of resistance genotypes in plants.

9. The application according to claim 8, characterized in that, The plants include monocotyledonous plants or dicotyledonous plants.