Use of rnf20 gene / protein as a target in screening drugs for preventing or treating senecavirus

Abstract

The present application relates to the field of biotechnology, in particular to the use of RNF20 gene / protein as a target in screening of drugs for preventing or treating Senecavirus, and the use of an expression activator or activity enhancer of RNF20 gene or protein in the preparation of a drug for preventing or treating Senecavirus infection. The present application first proves that RNF20 can play an anti-SVV role by inhibiting SVV virus titer and structural protein expression, and provides a new target and strategy for the prevention and treatment of SVV infection.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the use of the RNF20 gene / protein as a target in screening drugs for the prevention or treatment of Seneca virus. Background Technology

[0002] Seneca virus (SVV), the only non-foot-and-mouth disease virus in the Picornaviridae family capable of causing porcine vesicular disease, has become a significant pathogen affecting the healthy development of the pig industry since its outbreak in large-scale pig farms in my country in 2015. Seneca virus (SVV), also known as type A Seneca virus (SVA), is a non-enveloped, single-stranded, positive-sense RNA virus. Its viral particles have an icosahedral symmetry structure and a diameter of approximately 28-30 nm. The genome is approximately 7.2 kb in length and contains a large open reading frame (ORF) encoding a polyprotein, which can be further cleaved into structural proteins (VP1-VP4) and non-structural proteins (2A-2C, 3A-3D). The structural proteins constitute the viral capsid, protecting the viral genome and mediating viral adhesion and invasion of host cells; the non-structural proteins participate in viral replication, transcription, and regulation of the host cell's immune response.

[0003] SVV primarily infects pigs, especially adult sows, causing vesicular lesions. Infection in newborn piglets can lead to acute death, severely impacting the economic benefits of pig farming. The virus is shed through oral and nasal secretions and feces, with peak shedding occurring 1-5 days after infection. The virus spreads rapidly within pig herds. Current SVV control systems have significant shortcomings: firstly, the highly variable nature of RNA viruses leads to continuous antigenic mutations in SVV strains, resulting in a declining cross-protective effect of traditional inactivated vaccines; secondly, no specific antiviral drugs against SVV have been approved globally, and clinical control relies solely on passive measures such as isolating infected pigs and environmental disinfection, which are insufficient to prevent the virus's cyclical transmission within pig herds. Summary of the Invention

[0004] To address the serious impact of Seneca virus on the healthy development of the swine industry, the continuous antigenic mutations of the virus strain, the declining cross-protective efficacy of traditional inactivated vaccines, and the lack of approved specific antiviral drugs against SVV globally, clinical control of the epidemic relies solely on passive measures such as isolating infected pigs and disinfecting the environment, which are insufficient to prevent the virus from circulating and spreading within pig herds, this invention proposes the use of the RNF20 gene / protein as a target in screening drugs for the prevention or treatment of Seneca virus, thus solving the aforementioned problems.

[0005] The technical solution of the present invention is as follows:

[0006] This invention provides the application of the RNF20 gene or the protein it encodes in the fight against Seneca virus.

[0007] This invention provides the use of the RNF20 gene or the protein it encodes as a target in screening drugs for the prevention or treatment of Seneca virus infection.

[0008] Preferably, the drug is a compound, biological agent, or genetically engineered product that can upregulate RNF20 gene expression, enhance RNF20 protein activity, stabilize RNF20 protein, or inhibit RNF20 protein degradation.

[0009] Preferably, the drug has at least one of the following functions:

[0010] (a) Reduces the viral titer of SVV in host cells, and the inhibitory effect increases with the duration of action;

[0011] (b) Inhibit VP3 protein expression in SVV and block the cumulative effect of VP3 protein over time of infection;

[0012] (c) Upregulates the mRNA level of RNF20 in host cells, with a relative increase of at least 50%;

[0013] (d) Maintain inhibitory activity against SVV replication in porcine, hamster, or human cells.

[0014] Preferably, the screening includes the following steps:

[0015] (a) Provide a cell model expressing RNF20;

[0016] (b) Contact the candidate drug with the cell model;

[0017] (c) Detect SVV viral titer, VP3 protein expression level, RNF20 expression level or RNF20 protein activity after infection;

[0018] (d) Select candidate drugs that can reduce viral titer, inhibit VP3 expression, upregulate RNF20 expression, or enhance RNF20 protein activity as drugs for the prevention or treatment of SVV infection.

[0019] Preferably, the cell model is BHK-21 cells, HEK-293T cells, or PK-15 cells.

[0020] The present invention provides a pharmaceutical composition for the prevention or treatment of SVV infection, the composition comprising an RNF20 activator and a pharmaceutically acceptable carrier, wherein the RNF20 activator is selected from RNF20 overexpression vectors, RNF20 protein stabilizers or RNF20 transcription activators.

[0021] Preferably, the RNF20-based activator includes an expression activator or activity enhancer of the RNF20 gene or the protein it encodes, which is at least one of nucleic acid molecules, small molecule compounds, peptides, proteins, or antibodies.

[0022] Preferably, the nucleic acid molecule is an RNF20 overexpression plasmid or a viral vector containing the RNF20 gene.

[0023] Preferably, the RNF20 overexpression plasmid is an RNF20 overexpression plasmid fused with an HA tag, and its nucleotide sequence corresponds to the complete coding region of the RNF20 gene (GenBank accession number: AF265230.1).

[0024] This invention provides a siRNA for silencing the RNF20 gene, the sequence of which is selected from any one of the following pairs:

[0025] For the pig sequence pair RNF20-Sus-1:

[0026] The justice chain is 5'-GCCAAGUUGAGCUCAUUGATT-3' (SEQ ID NO: 1).

[0027] The antisense chain is 5'-UCAAUGAGCUCAACUUGGCTT-3' (SEQ ID NO: 2);

[0028] Or, for the sequence pair RNF20-Sus-2 targeting porcine RNF20:

[0029] The justice chain is 5'-GACCCUUGCUGCCAAUGAATT-3' (SEQ ID NO: 3).

[0030] The antisense chain is 5'-UUCAUUGGCAGCAAGGGUCTT-3' (SEQ ID NO: 4).

[0031] This invention provides a siRNA for silencing the RNF20 gene, the sequence of which is selected from any one of the following pairs:

[0032] Sequence pair RNF20-Auratus-1 for hamster RNF20:

[0033] Justice Chain 5'- GCUGCAUGCAGUCACAGUUTT -3' (SEQ ID NO: 5)

[0034] Antisense chain 5'-AACUGUGACUGCAUGCAGCTT-3' (SEQ ID NO: 6);

[0035] RNF20-Auratus-2:

[0036] Justice Chain 5'- GAGGUACAAUCACCAUCAATT -3' (SEQ ID NO:7).

[0037] Antisense chain 5'-UUGAUGGUGAUUGUACCUCTT-3' (SEQ ID NO:8).

[0038] This invention provides a siRNA for silencing the RNF20 gene, the sequence of which is selected from any one of the following pairs:

[0039] Sequence pairing of RNF20 with RNF20-Homo-1 for human cells:

[0040] Justice Chain 5'- GCGGCACAAUCACUAUCAATT-3' (SEQ ID NO: 9).

[0041] Antisense chain 5'- UUGAUAGUGAUUGUGCCGCTT -3' (SEQ ID NO:10)

[0042] RNF20-Homo-2:

[0043] Justice Chain 5'- GGCGGCACAAUCACUAUCATT -3' (SEQ ID NO:11)

[0044] Antisense chain 5'-UGAUAGUGAUUGUGCCGCCTT-3' (SEQ ID NO:12).

[0045] The beneficial effects of this invention are as follows:

[0046] This invention utilizes a triple experimental design involving silencing, overexpression, and cross-cell line validation. Systematic validation was conducted in hamster (BHK-21), porcine (PK-15), and human (HEK-293T) cell lines, demonstrating for the first time that RNF20 exerts its anti-SVV effect by inhibiting SVV viral titer and structural protein expression. The target is innovative, revealing for the first time the function of RNF20 as a key host factor in anti-SVV, filling a research gap in the RING ubiquitin ligase family in SVV control, and providing a novel specific target for anti-SVV drug development. The functional mechanism is clearly defined, demonstrating that RNF20 can block SVV replication by inhibiting the time-dependent accumulation of VP3 protein, and that the inhibitory effect on viral titer increases over time, providing experimental evidence for optimizing drug efficacy. With strong species applicability, the anti-SVV function of RNF20 has been verified in hamster (BHK-21), pig (PK-15), and human (HEK-293T) cells, especially its effectiveness in pig cells, laying a solid foundation for subsequent in vivo experiments and clinical applications in pigs. The technical solution has a high degree of industrialization potential, with a clear siRNA silencing efficiency, a mature overexpression plasmid construction method, and a lyophilized powder injection formulation for the drug composition, which has good stability, convenient administration, and is suitable for large-scale production. The application scenarios are diversified, including the development of therapeutic drugs based on RNF20, the use of gene editing technology for breeding SVV-resistant pigs, and the construction of standardized SVV infection models using the RNF20 silencing reagent, providing a tool for screening anti-SVV drugs, thus covering multiple scenarios such as treatment, prevention, and research.

[0047] The host ubiquitination system is a crucial immune defense against viral infection. Members of the RING finger ubiquitin ligase family act as "molecular switches" in key stages such as viral invasion, genome replication, and assembly by precisely regulating the ubiquitination modification of target proteins. RNF20 (Ring Finger Protein 20), a key member of this family, functions primarily by forming a complex with RNF40 to mediate histone H2B monoubiquitination, thereby regulating the cell cycle and gene transcription. In recent antiviral research, RNF20 has been identified as a novel host target for the SARS-CoV-2 main protease 3CLpro. 3CLpro cleaves RNF20, preventing the degradation of sterol regulatory element binding protein 1 (SREBP1) mediated by RNF20, thus promoting viral replication. Currently, no studies have revealed the expression dynamics, functional localization, and mechanism of action of RNF20 during SVV infection, and there are no reports on the development of anti-SVV technologies based on RNF20. This invention, starting from the host-virus interaction mechanism, explores key host factors that regulate SVV replication, providing a novel direction for the prevention and control of Seneca virus. Attached Figure Description

[0048] Figure 1The effects of RNF20 silencing efficiency, silencing, and overexpression of RNF20 on SVV viral titer in PK-15 cells were investigated. A: Western blot analysis of the silencing effect of siRNA on RNF20 protein; B: qRT-PCR analysis of the silencing effect of siRNA on RNF20 mRNA; C: Western blot results of VP3 protein dynamics at 16 and 24 hours in PK-15 cells; D: TCID50 results of SVV at 6 and 12 hours after RNF20 silencing; E: TCID50 results of SVV at 6 and 12 hours after Flag-RNF20 overexpression.

[0049] (Note: **P<0.01, compared with the NC siRNA group or the Flag empty vector group; #P<0.05, compared with the same group at 16 hours).

[0050] Figure 2 The effects of RNF20 silencing efficiency, silencing, and overexpression of RNF20 on SVV viral titer in BHK-21 cells were investigated. A represents the silencing effect of siRNA on RNF20 protein as detected by Western blotting; B represents the silencing effect of siRNA on RNF20 mRNA as detected by qRT-PCR; C represents the TCID50 results of SVV at 3, 6, 9, and 12 hours after RNF20 silencing; D represents the TCID50 results of SVV at 3, 6, 9, and 12 hours after Flag-RNF20 overexpression; and E represents the WB results of VP3 protein dynamics expression at 16 and 24 hours in BHK-21 cells (Note: **P<0.01, compared with the NC siRNA group or the Flag empty vector group; #P<0.05, compared with the same group at 16 hours).

[0051] Figure 3 The effects of RNF20 silencing efficiency, silencing, and overexpression of RNF20 on SVV viral titer in HEK-293T cells were investigated. A: AWB assay of the silencing effect of siRNA on RNF20 protein; B: qRT-PCR assay of the silencing effect of siRNA on RNF20 mRNA; C: WB results of VP3 protein dynamics expression at 16 and 24 hours in HEK-293T cells; D: TCID50 results of SVV at 6 and 12 hours after RNF20 silencing; E: TCID50 results of SVV at 6 and 12 hours after Flag-RNF20 overexpression (Note: **P<0.01, compared with the NC siRNA group or the Flag empty vector group; #P<0.05, compared with the same group at 16 hours). Detailed Implementation

[0052] The technical solution of the present invention will be described in detail below with reference to embodiments. It should be understood that the following embodiments are only used to explain and illustrate the present invention, and are not intended to limit the scope of the present invention.

[0053] In the following examples, reagents not specifically mentioned are all conventional reagents in the art, commercially available or prepared according to conventional methods in the art, and of laboratory purity grade. Vectors, cells, and experimental animals not specifically mentioned are all commercially available. Experimental methods and conditions not specifically mentioned are conventional experimental methods and conditions in the art, and can be found in relevant experimental manuals, publicly available literature, or manufacturer's instructions. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0054] Example 1: Validation experiment on the anti-SVV function of RNF20 in PK-15 cells

[0055] 1. Experimental Materials

[0056] Cells: PK-15 cells.

[0057] Virus: The standard SVV strain (SVV CHhb17 strain) was provided by the laboratory of the High Technology Research Office of Livestock and Poultry Biological Agents, Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agricultural and Forestry Sciences;

[0058] Reagents: RNF20-Sus-1, RNF20-Sus-2, and negative control siRNA (NC siRNA) were all synthesized by Suzhou Jima Company; Liposome 2000 / Lip2000 transfection reagent was from Biosharp, catalog number: BL623B; cDNA first-strand synthesis kit was from Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number: 11121ES60; 2x Realab Green PCR Fast mixture was from Beijing Lamborghide Trading Co., Ltd., catalog number: R0202; Anti-SVV VP3 rabbit polyclonal antibody was prepared and preserved by the High-Tech Laboratory of Animal Biological Agents, Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agricultural and Forestry Sciences, with a titer of 1:1000; anti-RNF20 rabbit polyclonal antibody was from Proteintech, catalog number: 21625-1-AP; β-actin mouse monoclonal antibody was purchased from Wuhan Saiwei Biotechnology Co., Ltd., catalog number: GB1500; 1-100; HRP-labeled goat anti-rabbit secondary antibody was from Beijing Lamborghide Trading Co., Ltd., catalog number: S0101; Western blot chemiluminescence substrate kit was purchased from Beijing Lamborghide Trading Co., Ltd., catalog number: E1070.

[0059] 2. Experimental methods:

[0060] (1) Silencing RNF20

[0061] Cell transfection: PK-15 cells were seeded in 12-well plates and cultured to a density of 60%-70%. RNF20-Sus-1 (20 pmol), RNF20-Sus-2 (20 pmol), and NC siRNA (20 pmol) were transfected respectively. The transfection procedure was performed according to the Lipo2000 instruction manual. Samples were collected 36 hours after transfection.

[0062] The RNF20-Sus-1 sequence is as follows:

[0063] F: 5'-GCCAAGUUGAGCUCAUUGATT-3' (SEQ ID NO: 1),

[0064] R: 5'- UCAAUGAGCUCAACUUGGCTT-3' (SEQ ID NO: 2); The RNF20-Sus-2 sequence is as follows: F: 5'- GACCCUUGCUGCCAAUGAATT-3' (SEQ ID NO: 3), R: 5'- UUCAUUGGCAGCAAGGGUCTT-3' (SEQ ID NO: 4).

[0065] qRT-PCR detection: 36 h after transfection, total RNA was extracted from cells using the TRIzol method, and cDNA was synthesized by reverse transcription using a cDNA first-strand synthesis kit; using cDNA as a template, qPCR was performed using RNF20 primers and internal control β-actin primers. -ΔΔCt The relative expression level of mRNA was calculated using this method.

[0066] The RNF20 primer sequences are as follows:

[0067] F: 5'-TCCATGATTGATGACCTGCA-3' (SEQ ID NO: 13),

[0068] R: 5'-TTCTGAGCCAACTCTTTGTT-3' (SEQ ID NO: 14).

[0069] The primer sequences for the internal reference β-actin are as follows:

[0070] F: 5'-TTCAACACCCCAGCCATGTA-3' (SEQ ID NO: 15),

[0071] R: 5'-AGCCAGGTCCAGACGCAGGAT-3' (SEQ ID NO: 16).

[0072] Viral titer determination: SVVCHhb17 strain was infected with MOI=1 36 hours after transfection. Cell supernatant was collected at 3 h, 6 h, 9 h, and 12 h post-infection. Viral titer was determined by TCID50 method.

[0073] Western blot analysis: Total protein was extracted from cells using RIPA lysis buffer (containing protease inhibitors), quantified using the BCA method, and then subjected to 10% SDS-PAGE electrophoresis. The protein was then transferred to a PVDF membrane. The membrane was blocked with 5% skim milk for 1 hour, incubated overnight at 4°C with RNF20 (1:1000) and anti-β-actin (1:5000), and then incubated at room temperature for 1 hour with HRP-labeled secondary antibody (1:10000). The membrane was then developed using ECL chemiluminescence, and the gray values ​​of the bands were analyzed using Image J.

[0074] (2) Overexpression of RNF20:

[0075] Plasmid construction: Total RNA was extracted from PK-15 cells and reverse transcribed into cDNA. Primers containing EcoRI and KpnI restriction sites were designed for RNF20, and the complete coding region of RNF20 was amplified by PCR using these primers as templates (GenBank: AF265230.1). The product was double-digested with the p3×Flag-CMV-10 vector and ligated with homologous recombinase at 50℃ for 15 min. The ligation was performed on LB agar plates containing ampicillin, and single clones were picked, plasmids were extracted, and sequenced for verification.

[0076] The RNF20 primer sequences containing EcoRI and KpnI restriction sites are as follows:

[0077] F: 5'-CAAGCTTGCGGCCGCGAATTCAATGTCAGGAATTGGAAATAAAA -3'

[0078] (EcoR I site) (SEQ ID NO: 17);

[0079] R: 5' - CCTCTAGAGTCGACTGGTACCTCAACCAATGTAGATGCGATGA -3'

[0080] (Kpn I site) (SEQ ID NO: 18).

[0081] Transfection and Infection: PK-15 cells were seeded in 6-well plates and transfected when confluence reached 80%. Plasmid was diluted with Opti-MEM (3 μg / well) and mixed with Lip2000 (1 μg: 2 μl), incubated for 15 min, and then added to the cells. SVVCHhb17 cells were infected 48 h later, and TCID50 was measured at 6 and 12 h post-infection.

[0082] (3) Experimental results:

[0083] Compared with the NC siRNA group, after transfection with porcine siRNA, the levels of RNF20 mRNA and protein in the RNF20-Sus-1 and RNF20-Sus-2 groups decreased by more than 50%, indicating that the siRNA designed for porcine sequences is highly specific and can significantly downregulate the expression of RNF20 in PK-15 cells (Figure 1A, Figure 1B).

[0084] Compared with the NC siRNA control group, silencing RNF20 in PK-15 cells significantly increased SVV VP3 protein expression, with levels at 16h and 24h significantly higher than the control group, confirming that RNF20 can block the time-dependent accumulation of VP3 in porcine cells. Figure 1 C).

[0085] Compared with the NC siRNA control group, the SVV viral titer (TCID50) in PK-15 cells was significantly increased after silencing RNF20. The increase was time-dependent, with the most significant increase at 12 h, reaching up to 10 times that of the control group (Figure 1D).

[0086] Compared with the control group (pCMV-Flag empty vector), PK-15 cells overexpressing Flag-RNF20 showed significantly lower viral titers (TCID50) at all time points after infection, demonstrating that RNF20 has strong antiviral potential in porcine natural host cells. Figure 1 E).

[0087] Example 2: Verification of RNF20 anti-SVV function in BHK-2 cells

[0088] 1. Experimental materials:

[0089] Cells: BHK-21 cells.

[0090] Reagents: RNF20-Auratus-1 and RNF20-Auratus-2 were synthesized by Suzhou Jima Company, and the remaining reagents were the same as in Example 1.

[0091] 2. Experimental methods:

[0092] (1) Silencing experiment: BHK-21 cells were silencing at a concentration of 1×10⁻⁶. 6 10 cells / well were seeded in 12-well plates at a density of 60%. 36 hours after transfection, hamster-specific RNF20-Auratus-1 / 2 (20 pmol) was introduced. SVV was then infected with MOI=1 36 hours after transfection.

[0093] The RNF20-Auratus-1 sequence is as follows:

[0094] F: 5'-GCUGCAUGCAGUCACAGUUTT-3' (SEQ ID NO: 5),

[0095] R: 5'-AACUUGACUGCAUGCAGCTT-3' (SEQ ID NO: 6);

[0096] The RNF20-Auratus-2 sequence is as follows:

[0097] F: 5'-GACCCUUGCUGCCAAUGAATT-3' (SEQ ID NO: 7), R: 5'-UUCAUUGGCAGCAAGGGUCTT-3' (SEQ ID NO: 8).

[0098] qRT-PCR detection, viral titer determination, and WB detection were performed in accordance with Example 1.

[0099] (2) Overexpression experiment: Following the method in Example 1, Flag-RNF20 plasmid was transfected into BHK-21 cells, and SVV was infected 48 hours later. TCID50 was detected at 3, 6, 9, and 12 h post-infection.

[0100] 3. Experimental Results:

[0101] Compared with the NC siRNA group, the RNF20-Auratus-1 group showed a decrease in both RNF20 mRNA and protein levels; the RNF20-Auratus-2 group also showed a decrease in both mRNA and protein levels. The silencing efficiency of both siRNAs was >50%, indicating that RNF20-Auratus-1 and RNF20-Auratus-2 are highly specific and can significantly reduce the expression level of RNF20 (Figure 2A, Figure 2B).

[0102] Compared with the NC siRNA control group, silencing RNF20 significantly increased SVV viral titer. The increase was time-dependent. Figure 2 C).

[0103] Compared with the control group (pCMV-Flag empty vector), cells overexpressing Flag-RNF20 showed significantly lower viral titers (TCID50) at all time points after SVV infection. Figure 2 D).

[0104] Compared with the NC siRNA control group, silencing RNF20 significantly increased SVV VP3 protein expression, and the increase was time-dependent, with VP3 protein accumulating further with prolonged infection time. Figure 2E).

[0105] Example 3: Verification of RNF20's anti-SVV function in HEK-293T cells

[0106] 1. Experimental materials:

[0107] Cells: Human embryonic kidney cells HEK-293T.

[0108] Virus: SVV CHhb17 strain.

[0109] Reagents and models: RNF20-Homo-1, RNF20-Homo-2, the other reagents are the same as in Example 1.

[0110] 2. Experimental methods:

[0111] (1) Silence experiment: Following the method in Example 1, RNF20-Homo-1 and RNF20-Homo-2 were transfected, and SVV was infected with MOI=1 after 36 hours.

[0112] The RNF20-Homo-1 sequence is as follows:

[0113] F: 5'- GCGGCACAAUCACUAUCAATT -3' (SEQ ID NO: 9),

[0114] R: 5'-UUGAUAGUGAUUGUGCCGCTT-3' (SEQ ID NO: 10).

[0115] The RNF20-Homo-2 sequence is as follows:

[0116] F: 5'- GGCGGCACAAUCACUAUCATT-3' (SEQ ID NO: 11),

[0117] R: 5'-UGAUAGUGAUUGUGCCGCCTT-3' (SEQ ID NO: 12).

[0118] qRT-PCR detection, viral titer determination, and WB detection were performed in accordance with Example 1.

[0119] (2) Overexpression experiment: Following the method in Example 1, Flag-RNF20 was overexpressed in HEK-293T cells and then infected with SVV. TCID50 was detected at 6h and 12h after infection.

[0120] 3. Experimental Results:

[0121] Compared with the NC siRNA group, the levels of RNF20 mRNA and protein in both the RNF20-Homo-1 and RNF20-Homo-2 groups were significantly decreased, and the silencing efficiency of both siRNAs was greater than 50%, indicating that the siRNAs designed for human sequences are highly specific and can significantly reduce the expression of RNF20 in HEK-293T cells. Figure 3 A, Figure 3 B).

[0122] Compared with the NC siRNA control group, silencing RNF20 in HEK-293T cells significantly increased SVV VP3 protein expression, with higher levels at 16h and 24h post-infection compared to the control group, and the expression showed a cumulative trend with prolonged infection time. Figure 3 C).

[0123] Compared with the NC siRNA control group, silencing RNF20 significantly increased SVV viral titer (TCID50) at both 6 h and 12 h post-infection, and the increase was time-dependent, confirming that RNF20 deficiency promotes viral replication. Figure 3 D).

[0124] Compared with the control group (pCMV-Flag empty vector), overexpression of Flag-RNF20 in HEK-293T cells significantly reduced the viral titer (TCID50) of SVV at all time points, confirming that RNF20 also has significant antiviral activity in human cells. Figure 3 E).

[0125] Example 4: Application of RNF20 siRNA in the construction of an SVV-infected cell model

[0126] PK-15 cells were seeded in 12-well plates and cultured to a density of 60%. They were then transfected with RNF20-Sus-1 / 2 (20 pmol) or NC siRNA (20 pmol) and infected with SVV at an MOI of 0.5 after 36 hours. 24 hours after infection, viral titer was detected by TCID50 and VP3 expression was detected by Western blotting. It was confirmed that the viral titer in the siRNA group was 10-fold higher than that in the NC siRNA group and that VP3 expression was also increased, thus establishing a standardized SVV infection model.

[0127] This model can be used for screening anti-SVV drugs: the drug to be screened is added to model cells, incubated at a concentration with no significant toxicity to the cells until a predetermined time point, and then detected. If, compared with the untreated infected control group, the viral titer in the drug-treated group is reduced by ≥1 order of magnitude, and the VP3 expression level is significantly inhibited, it is identified as a potential anti-SVV drug.

Claims

1. Application of the RNF20 gene or its encoded protein in the fight against Seneca virus.

2. The use of the RNF20 gene or its encoded protein as a target in screening drugs for the prevention or treatment of Seneca virus infection.

3. The use according to claim 2, characterized in that, The drug is a compound, biological agent, or genetically engineered product that can upregulate RNF20 gene expression, enhance RNF20 protein activity, stabilize RNF20 protein, or inhibit RNF20 protein degradation.

4. The use according to claim 2 or 3, characterized in that, The drug has at least one of the following functions: (a) Reduces the viral titer of Seneca virus in host cells, and the inhibitory effect increases with the duration of action; (b) Inhibit the expression of VP3 protein of Seneca virus and block the effect of VP3 protein accumulation over time of infection; (c) Upregulates the mRNA level of RNF20 in host cells, with a relative increase of at least 50%; (d) Maintain inhibitory activity against Seneca virus replication in porcine, hamster, or human cells.

5. The use according to any one of claims 2-4, characterized in that, The screening process includes the following steps: (a) Provide a cell model expressing RNF20; (b) Contact the candidate drug with the cell model; (c) Detect Seneca virus titer, VP3 protein expression level, RNF20 expression level or RNF20 protein activity after infection; (d) Select candidate drugs that can reduce viral titer, inhibit VP3 protein expression, upregulate RNF20 expression, or enhance RNF20 protein activity as drugs for the prevention or treatment of Seneca virus infection.

6. The use according to claim 5, characterized in that, The cell models are BHK-21 cells, HEK-293T cells, or PK-15 cells.

7. A pharmaceutical composition for the prevention or treatment of Seneca virus infection, characterized in that, The composition comprises an RNF20 activator and a pharmaceutically acceptable vector, wherein the RNF20 activator is selected from RNF20 overexpression vectors, RNF20 protein stabilizers, or RNF20 transcription activators.

8. A siRNA for silencing the RNF20 gene, characterized in that, Its sequence is selected from any of the following pairs: For the pig sequence pair RNF20-Sus-1: the positive strand is 5'-GCCAAGUUGAGCUCAUUGATT-3' (SEQ ID NO: 1), and the antisense strand is 5'-UCAAUGAGCUCAACUUGGCTT-3' (SEQ ID NO: 2); or for the pig RNF20 sequence pair RNF20-Sus-2: the positive strand is 5'-GACCCUUGCUGCCAAUGAATT-3' (SEQ ID NO: 3), and the antisense strand is 5'-UCAUUGGCAGCAAGGGUCTT-3' (SEQ ID NO: 4).

9. A siRNA for silencing the RNF20 gene, characterized in that, Its sequence is selected from any of the following pairs: the sequence pair RNF20-Auratus-1 for hamster RNF20: Justice Chain 5'- GCUGCAUGCAGUCACAGUUTT -3' (SEQ ID NO: 5) Antisense chain 5'-AACUGUGACUGCAUGCAGCTT-3' (SEQ ID NO: 6); RNF20-Auratus-2: Justice Chain 5'- GAGGUACAAUCACCAUCAATT -3' (SEQ ID NO:7). Antisense chain 5'-UUGAUGGUGAUUGUACCUCTT-3' (SEQ ID NO:8).

10. A siRNA for silencing the RNF20 gene, characterized in that, Its sequence is selected from any of the following pairs: the sequence pair RNF20-Homo-1 for human cells: Justice Chain 5'- GCGGCACAAUCACUAUCAATT-3' (SEQ ID NO: 9). Antisense chain 5'- UUGAUAGUGAUUGUGCCGCTT -3' (SEQ ID NO:10) RNF20-Homo-2: Justice Chain 5'- GGCGGCACAAUCACUAUCATT -3' (SEQ ID NO:11) Antisense chain 5'-UGAUAGUGAUUGUGCCGCCTT-3' (SEQ ID NO:12).

Images