Molecular marker for identifying early-budded lignum and application thereof

By developing SNP molecular markers for the early resin formation trait in Aquilaria sinensis, the problems of long harvesting cycle and difficult identification of Aquilaria sinensis have been solved, enabling rapid identification and genetic improvement of the early resin formation trait, and improving breeding efficiency and commercial identification accuracy.

CN122235371APending Publication Date: 2026-06-19RES INST OF TROPICAL FORESTRY CHINESE ACAD OF FORESTRY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610694488.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-20
Publication Date
2026-06-19

Smart Images

  • Figure CN122235371A_ABST
    Figure CN122235371A_ABST
Patent Text Reader

Abstract

This invention relates to the field of molecular marker technology, specifically to molecular markers for identifying early-forming medicinal agarwood. Using these molecular markers, it is possible to identify agarwood with early-forming characteristics, which is of great significance for the identification of agarwood germplasm resources and molecular marker breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to molecular markers for identifying early-forming medicinal agarwood and their applications. Background Technology

[0002] Agarwood has high medicinal value and is widely used in the treatment of digestive, respiratory, cardiovascular, and rheumatic diseases. It is also a fragrance, with agarwood essential oil and perfumes highly prized in Middle Eastern countries. Furthermore, agarwood has significant cultural and collectible value.

[0003] Agarwood Aquilaria sinensis [Lour.) Spreng.], commonly known as agarwood or white agarwood, is the only source plant for agarwood production in China. Artificial cultivation has a history of 40 years, but systematic evaluation and breeding of its genetic resources have not yet been carried out. Most seeds used for seedling cultivation come from cultivated or wild mature plants, resulting in inconsistent germplasm quality. Ordinary agarwood requires more than 5 years of growth before it can be artificially harvested to meet the pharmacopoeia's requirements for medicinal grade. How to shorten the harvesting cycle of medicinal agarwood is a pressing technical problem that needs to be solved in this field.

[0004] Currently, although some researchers have developed SNP markers for the identification of Aquilaria species, no practical SNP markers have been reported for early-forming medicinal Aquilaria. Therefore, developing molecular markers for the identification of early-forming medicinal Aquilaria and applying them to marker-assisted selection (MAS) and genomic selection (GS) could accelerate the genetic improvement of Aquilaria varieties. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention has developed a set of molecular markers for evaluating the early resin-forming trait of Aquilaria sinensis. Specifically, high-throughput sequencing technology was used to develop SNP molecular markers for evaluating the early resin-forming trait of Aquilaria sinensis, which were then validated in genetic and natural populations. These markers can be used for the commercial identification of commercially available Aquilaria sinensis (seedlings). Furthermore, applying them to marker-assisted selection (MAS) and genomic selection (GS) can accelerate the genetic improvement of Aquilaria sinensis varieties.

[0006] The primary objective of this invention is to identify SNP molecular markers associated with the early resin formation trait. These markers are located on the Aquilaria sinensis genome (http: / / gigadb.org / dataset / 100702), and the specific SNP information is as follows: Table 1 SNP locus information The nucleotide sequence of SNP1 is shown in SEQ ID NO.1, and its mutation type is the A>G mutation at position 301 of SEQ ID NO.1, where G / G is the early argan trait; The nucleotide sequence of SNP2 is shown in SEQ ID NO.2, and its mutation type is the T>C mutation at position 301 of SEQ ID NO.2, where C / C is the early argan trait; The nucleotide sequence of SNP3 is shown in SEQ ID NO.3, and its mutation type is the A>G mutation at position 301 of SEQ ID NO.3, where G / G is the early argan trait; The nucleotide sequence of SNP4 is shown in SEQ ID NO.4, and its mutation type is the A>G mutation at position 301 of SEQ ID NO.4, where G / G is the early argan trait; The nucleotide sequence of SNP5 is shown in SEQ ID NO.5, and its mutation type is the T>A mutation at position 301 of SEQ ID NO.5, where A / A is the early resin formation trait.

[0007] This invention also provides a method for evaluating the early resin-forming trait of Aquilaria sinensis using molecular markers. This method can quickly predict the early resin-forming trait and is especially suitable for commercial identification of seedlings in the market. The method includes the following steps: detecting the genotype of the aforementioned SNP molecular markers using any method, and evaluating the early resin-forming trait of Aquilaria sinensis based on the detected genotype results.

[0008] Specifically, a method for assessing whether agarwood exhibits early-forming characteristics includes the following steps: 1) Determine the genotypes of molecular marker sites related to the early resin formation trait of Aquilaria sinensis in the Aquilaria sinensis resource population, wherein the molecular marker sites are the aforementioned SNP sites.

[0009] 2) Determine the early resin formation trait of the agarwood sample based on the genotype of the molecular marker.

[0010] Step 1) includes the following steps: 1.1) Extract genomic DNA from the agarwood samples to be tested; 1.2) Genotyping of the agarwood in the soil to be tested was performed; 1.3) Based on the test results, determine the genotype of the tested agarwood at SNP1~SNP5 loci; Step 2) determining the early resin-forming trait of the Aquilaria sinensis sample based on the genotype of the molecular marker includes at least one of the following steps: 2.1) In the above-mentioned Aquilaria sinensis population, if the genotype of the Aquilaria sinensis sample at the SNP1 locus is G / G, then the sample is determined to be an early-forming agarwood type sample. 2.2) In the above-mentioned Aquilaria sinensis population, if the genotype of the Aquilaria sinensis sample at the SNP2 locus is C / C, then the sample is determined to be an early-forming agarwood type sample. 2.3) In the above-mentioned Aquilaria sinensis population, if the genotype of the Aquilaria sinensis sample at the SNP3 locus is G / G, then the sample is determined to be an early-forming agarwood type sample.

[0011] 2.4) In the above-mentioned Aquilaria sinensis population, if the genotype of the Aquilaria sinensis sample at the SNP4 locus is G / G, then the sample is determined to be an early-forming agarwood type sample.

[0012] 2.5) In the above-mentioned Aquilaria sinensis population, if the genotype of the Aquilaria sinensis sample at the SNP5 locus is A / A, then the sample is determined to be an early-forming aquilaria type sample.

[0013] Preferably, in order to more accurately evaluate the early resin formation trait, step 2) includes the following steps: In the aforementioned Aquilaria sinensis population, if the Aquilaria sinensis sample contains any two or more of the genotypes described in steps 2.1 to 2.5, then the sample is determined to be an early-forming aquilaria type sample.

[0014] Preferably, in step 1.2), KASP, first-generation sequencing, second-generation sequencing, or any other genotyping technique is used to detect the genotype of the agarwood in the soil to be tested.

[0015] The accuracy of the prediction results has been verified to be high through population testing, and it can provide a reliable basis for seedling transactions.

[0016] This invention further provides a genetic breeding method for the early resin formation trait of Aquilaria sinensis. This method can accurately achieve targeted selection of the early resin formation trait and significantly improve breeding efficiency. The method includes the following core steps: using any method to detect the genotype of the aforementioned SNP molecular markers, and selecting individuals with different genotypes as parents according to the breeding objectives.

[0017] Specifically, a method for genetically improving the early resin-forming trait of Aquilaria sinensis includes the following steps: 1) Determine the genotypes of molecular marker sites related to the early resin formation trait of Aquilaria sinensis in the Aquilaria sinensis resource population, wherein the molecular marker sites are the aforementioned SNP sites.

[0018] 2) Make appropriate selections based on the genotype of the molecular marker and the breeding objectives.

[0019] Step 1) includes the following steps: 1.1) Extract genomic DNA from the agarwood samples to be tested; 1.2) Genotyping of the agarwood in the soil to be tested was performed; 1.3) Based on the test results, determine the genotype of the tested agarwood at SNP1~SNP5 loci; Step 2) includes at least one of the following steps: 2.1) In the aforementioned Aquilaria sinensis resource population, individuals with the G / G type at the SNP1 locus of Aquilaria sinensis are retained to increase the frequency of the G / G genotype at this locus generation by generation, thereby increasing the proportion of individuals with the early resin formation trait in the offspring Aquilaria sinensis population.

[0020] 2.2) In the above-mentioned Aquilaria sinensis resource population, individuals with the C / C type at the SNP2 locus of Aquilaria sinensis are retained to increase the C / C genotype frequency at this locus generation by generation, thereby increasing the proportion of individuals with early resin formation traits in the offspring Aquilaria sinensis population. 2.3) In the above-mentioned Aquilaria sinensis resource population, individuals with the G / G type at the SNP3 locus of Aquilaria sinensis are retained to increase the frequency of the G / G genotype at this locus generation by generation, thereby increasing the proportion of individuals with the early resin formation trait in the offspring Aquilaria sinensis population.

[0021] 2.4) In the above-mentioned Aquilaria sinensis resource population, individuals with the G / G type at the SNP4 locus of Aquilaria sinensis are retained to increase the frequency of the G / G genotype at this locus generation by generation, thereby increasing the proportion of individuals with the early resin formation trait in the offspring Aquilaria sinensis population. 2.5) In the above-mentioned Aquilaria sinensis resource population, individuals with the A / A type at the SNP5 locus are retained to increase the frequency of the A / A genotype at this locus generation by generation, thereby increasing the proportion of individuals with the early resin formation trait in the offspring Aquilaria sinensis population.

[0022] Preferably, in order to perform molecular marker-assisted genetic breeding more accurately, step 2) includes the following steps: Individuals with any two or more of the genotypes described in steps 2.1 to 2.5 are retained in the aforementioned agarwood resource population, thereby increasing the proportion of individuals with early resin formation traits in the offspring agarwood population.

[0023] Preferably, in step 1.2), KASP, first-generation sequencing, second-generation sequencing, or any other genotyping technique is used to detect the genotype of the agarwood in the soil to be tested.

[0024] Beneficial effects: The SNP molecular markers of this invention have significant application value in breeding related to or predicting the early resin formation trait of Aquilaria sinensis. Applying them to MAS breeding enables precise seed selection at the seedling stage, eliminating individuals with non-target genotypes and reducing breeding costs. Integrating them into the GS model can improve the predictive accuracy of multi-trait aggregation breeding and accelerate the process of variety genetic improvement. The SNP molecular markers of this invention can be widely applied to early screening in breeding units, identification of early resin formation traits in seedling enterprises, and resource evaluation in research institutions, providing the Aquilaria sinensis industry with full-chain technical support from variety cultivation to commercial circulation. Attached Figure Description

[0025] The present invention and its beneficial effects will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0026] Figure 1 It is a statistical analysis of the proportion of each genotype in samples with different traits at the SNP1 locus.

[0027] Figure 2 It is a statistical analysis of the proportion of each genotype in samples with different traits at the SNP2 locus.

[0028] Figure 3 It is a statistical analysis of the proportion of each genotype in samples with different traits at the SNP3 locus.

[0029] Figure 4 It is a statistical analysis of the proportion of each genotype in samples with different traits at SNP4 loci.

[0030] Figure 5 It is a statistical analysis of the proportion of each genotype in samples with different traits at the SNP5 locus. Detailed Implementation

[0031] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0032] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0033] Example 1 Resequencing Analysis 1. Experimental Materials Using 15-month-old seedlings as rootstock, semi-lignified branches from mature trees of the current year were selected for grafting. After 6 months of cultivation, the grafted seedlings were planted and nurtured for 2 years. Then, an artificial physical method of inducing resin formation was used, involving drilling holes with an electric drill, and this treatment was continued for 20 months. Germplasm that produces medicinal agarwood meeting pharmacopoeia standards according to this method is classified as early-forming agarwood germplasm; germplasm that cannot produce medicinal agarwood meeting pharmacopoeia standards is classified as non-early-forming agarwood germplasm.

[0034] A total of 188 Aquilaria sinensis germplasm samples were collected, as shown in Table 2. Among them, 20 samples (SXY01-SXY20) were early-forming medicinal Aquilaria sinensis, and the rest were non-early-forming medicinal Aquilaria sinensis. Samples SXY01-SXY10 and samples 1-95 were used for molecular marker development, and then molecular markers were validated on all 188 samples.

[0035] Table 2 Sample Information 2. Sample DNA extraction, library construction, and sequencing First, the leaf samples were preserved in liquid nitrogen. Genomic DNA was extracted from the samples using a kit and then sequenced using whole-genome resequencing technology.

[0036] 3. Data quality control (1) Remove the header sequence from the reads and remove the reads that have no inserted segments due to reasons such as header self-connection; (2) Trim the low-quality (quality value less than 20) bases at the end (3' end) of the sequence. If there are still bases with a quality value less than 10 in the remaining sequence, remove the entire sequence; otherwise, retain it. (3) Remove reads containing more than 10% N; (4) Discard sequences whose length is less than 100bp after removing the adapter and quality trimming.

[0037] 4. Population variation detection In this invention, we used the genome of Aquilaria sinensis as the reference genome (http: / / gigadb.org / dataset / 100702), used BWA alignment software to align the sequencing fragments back to the reference genome, and then used Picard-tools to remove the sequencing fragments generated by PCR-duplication.

[0038] Based on the alignment results, and considering factors such as data characteristics, sequencing quality, and experimental aspects, a Bayesian model (GATK HaplotypeCaller) was used to calculate the probability of each possible genotype based on the observed data. The genotype with the highest probability was selected as the genotype at a specific locus for the sequenced individual, and a quality value reflecting the accuracy of this genotype was assigned, resulting in a consistent sequence. Based on the consistent sequence, GATK was used for SNP calling, and the results were filtered to obtain highly accurate variants. The filtering criteria are as follows: a. Within-group missing rate ≤20%.

[0039] b. Retain SNPs with completely different genotypes between groups.

[0040] Ultimately, five loci were found on chromosomes 1, 2, 3, 5, and 7 that were completely different between early-formed and non-early-formed samples, as shown in Table 3: Table 3. Screened SNP sites The sequence of the molecular marker is as follows (R / Y / W are degenerate bases): SEQ ID NO.1 ACCTTTTGCCCACTAGGTAAAATTTTGGCCTAGATGTTAAGAACATGAACCTTCCAAGTACCATTTAGGAAAATTTCTAAATTTTAGCATATTTTCTAATTTTCTTCCTTACTAACATTTTGTAGGACCATGCTTATGGTCGGTATCACGTAACGCCCCAAATTTTATAAACCTTAATTTTAAAAGATATCTTAAAATTCCCAGAATTAGAAAGCATTTAATTAAAATAATTTAAGAAATGTGAGGTAAAACATTTTATTTTAAATTATTTTCCAAACAATAAGAGTATTAAATGAAATCA RATGAGTAAGTGACAATCCCAGGAAAACTAATATGCGGATAAGGTGCCAATTTAAACAAACCATATGTTTCTTTAGAAATCAAATAACACAAAGTTAAAACCCAGTCCCAGCCAGTTCTACTTTCGAGGGGCTACAGCGTACTCTCACTCAGTCTGCTCCACATCTTGAACCTCGTTATATGGTTCAGTGTACTCTGTCTCCTCATAGTACTCACCTAGAAAAACATGTTAAGAGGAGGGATGAGCACAACTTGCTCAGTAAGAGGGAAGTATCAGGCCCATCACGTGGGTCCTAATATT SEQ ID NO.2 GATGGTTAGCTTGATTTGCTGCATTTTGCTGAGCAGGATCACCACGCCCTTGTCCTGTTAGTTGGGCAATCGGGACATTGTCATCATTTCTTTCATCTTCCAGATCCCGAAGAATGATACACCTAGGTGCCATACGTCTGCCGAAGATAATCGTATCCTTGATTAAAGAGAGGATGAGAGGAAGAAGATGAAAGACTTATTACCTAAGCATAACAAAAGTCTAGTCCTATAACCCAAACCCAAGGCCTCACGGATAATCGAACCTATTGCTCTGATACCACTTCTGTCACGCCCTAAAACYCACCCTAGGAGTTTCGGGACGATGACATGACGCGCACTCGAGAAAATAGTATTTCCTCGAACATGCAAAGGCTACAAATATTCCAAATAAATCCAAATGACCATAACTTATAATTCCAACTTATTCTTGTCATCGAAATCAAGTGATAGAGCGACTACAATTTAAAATCTCATACAAAATATCTCTAACCTAAAAGTGTCTATTACATCCCACTTTAATATTATCCCAAACTTTGAGCTCTTGTAGTCATTCCCAAATCCGGCCAACCTCGCTACTACATTTGCGCCGCTGAAGGGGAAA SEQ ID NO.3 AAAATCTAATATGCTCCCTAATACTTACTTTTAACAATTCAATTGTTAATTTGAAACTATAATACTTTCCCTGATTTTTTTTATTAATTTGTTCATGTAGACAATCTCAGGTTCTTCCTTCAAGAAATAATGAAGCTTGCTTGTAATCCATTTAACATTTACATTAGAGTTCTTGGTGGGTCTAAGACAACTATGTTGGCCATTCAGGTTTTTACCATAAAAGTTCTCTTATCAAGCATGATTGATACAAGTGTACACCATGGACACCCTTCCCTAGACAAATTGCCCTCACCCTTGGA RGCTCATTTTAACCCTTTTCAACTCATACACTTTCTCAAATGAGTCATCCTTCAATACTTCCTTGAAGTAGTTCACATTTTGAAAACATTGAACCTTTTAAACTCAATTTTACCATATGAGTTCTTCTCAAACTCTTACCCTTCCTTCACAAATTCTATAGTCCTTTCATTGGTTAGGTATCACCATGTGAAGTGTCACTCCCTAAGTCACTAATATCGTGATTATCCTCATCCACTTCTCCCCTAAGATCATTTACATTCTCATCTTCAAAACTTGCACTCCTCTACTTTTCCTCCCC SEQ ID NO.4 GCCTTTCGAATCTGCTATTCCTGTTTCCTCAGATTCGTGTTTCCCTTTTAACCGAAGGTCCTTGTTGGAGCTGCTCCCCTTGTCACGTGATGGCCTGCGTTGACTCTCCCGGAATTCCGCTGCCAATTCAGCTTTCCCATATTCCAAAGCATCTTCGTCTCCACCTGTTCTTCTGTTCTCCATGTCTACTTCCGGCGACTCATCTTCTTCCTCTGCACTTTCTTCTTCCCAACTCGCTACCTCATTAACGGAGTAAGTCGATTCTTCAGACTGATATCTCGGCCCGAAATCCACCTTAAGRCTGATGTCTTCCGAGACTCTAACATCATACTCTTTACCCATGACTTTCACTTTTAACACCGTAATAATCTGCTCCAAGTTCTGAGAAATGACACAGACTCTTCCGACGTGAATCTGAACCTTTTCCCGAGTGAACTCTTCAACTACTATGATTTTTCCCCACTTGCTCGCAATGGCAGCCAAATTTTCGGCACACCAGGCATGCAGCGGTAAGCCTTCGATATTCAACCAGACAGCTCTACCGGCTTGCTTCAACTCCATCGACCATGGTGCTATCCACTCAAACCATTGATGGAACCAC SEQ ID NO.5 AGGACAGTGGACTGGTGATCCCCCCGTCACAGCCTGAGATACAACCGTTGCTAAGCAAACACTCCTGTGGACTCTCGTTCGAGGAAGACCCGCCGCCCTCTGGTAGTCAATGCCTATGAAGCTCTTTTGAGGGACTTCTAGCGTTCGACC GTGTCTGAAAATGACATGTAGTAGATCGGCCGAAGGTAAATAGCAAGCACAGTCTAGAGACCCCCCTCACCGACACGCCCTCGGGAGCCCCAAGTCCACACATCGCAGTTCGGGGAATGGAGACCCTCGCGAAGAATCATCCACAGAAA WTATGGCCCTCGGGAAACGTTCTGTGGGACAAACCAGGTCCAAGCAGCCGAGAGTCTCACAGCGAAGCAGTTCGTCACCTGAGGCGAGGTCCTTGTCCCCTCAGCGCCGAACTCGCCCCCCGAAGAGGCGCCGACGATCTCCATTCCCTG AAGAAGGCCCTAGCGCCACAGTGCTCATGGAGAAGATATTAGCACGGCTGGACAGAGTGGAAAAACAAGTGGCCAGAAGATCCGTTTGGGCCAGACCCTCGGGAACATCCTGCGAAGATGACCCCCTTTTCACCACTCAGGCTGCCGCTGA Example 2: Correlation analysis of phenotype and genotype in a genetic population Next-generation sequencing was used to detect and verify the above five loci in 188 Aquilaria sinensis samples. Statistical analysis and chi-square tests were performed on the early resin formation trait of individuals with different genotypes. The results are shown in Table 4 and... Figures 1-5 As shown: Table 4. Association statistics between mutation site genotype and early fruit formation trait. Note: ZJX group represents the early-forming group, FZJX group represents the non-early-forming group, and the statistical results exclude individuals whose genotypes were not detected.

[0041] From Table 4 and Figures 1-5It can be seen that (ZJX represents the early resin-forming group, and FZJX represents the non-early resin-forming group), the G / G genotype at SNP1, the C / C genotype at SNP2, the G / G genotype at SNP3, the G / G genotype at SNP4, and the A / A genotype at SNP5 are all early resin-forming agarwood, while the other genotypes are non-early resin-forming agarwood.

[0042] Further statistical analysis of different genotype combinations at the above loci yielded results shown in Table 5. The genotypes at the five SNP loci were completely linked, meaning that any two or more combinations of the following genotypes were early-forming agarwood: G / G at SNP1, C / C at SNP2, G / G at SNP3, G / G at SNP4, and A / A at SNP5. Other genotype combinations were non-early-forming agarwood.

[0043] Table 5. Association statistics between genotype combinations of mutation sites and early fruit formation trait. Example 3: Method for evaluating the early resin formation characteristics of Aquilaria sinensis A method for assessing whether agarwood exhibits early-forming characteristics, the method comprising the following steps: 1) Determine the genotypes of molecular marker sites related to the early resin formation trait of Aquilaria sinensis in the Aquilaria sinensis resource population, wherein the molecular marker sites are the sites in the aforementioned embodiments.

[0044] 2) Determine the early resin formation trait of the agarwood sample based on the genotype of the molecular marker.

[0045] Step 1) includes the following steps: 1.1) Extract genomic DNA from the agarwood samples to be tested; 1.2) Genotyping of the agarwood in the soil to be tested was performed; 1.3) Based on the test results, determine the genotype of the tested agarwood at SNP1~SNP5 loci; Step 2) determining the early resin-forming trait of the Aquilaria sinensis sample based on the genotype of the molecular marker includes at least one of the following steps: 2.1) In the above-mentioned Aquilaria sinensis population, if the genotype of the Aquilaria sinensis sample at the SNP1 locus is G / G, then the sample is determined to be an early-forming agarwood type sample. 2.2) In the above-mentioned Aquilaria sinensis population, if the genotype of the Aquilaria sinensis sample at the SNP2 locus is C / C, then the sample is determined to be an early-forming agarwood type sample. 2.3) In the above-mentioned Aquilaria sinensis population, if the genotype of the Aquilaria sinensis sample at the SNP3 locus is G / G, then the sample is determined to be an early-forming agarwood type sample.

[0046] 2.4) In the above-mentioned Aquilaria sinensis population, if the genotype of the Aquilaria sinensis sample at the SNP4 locus is G / G, then the sample is determined to be an early-forming agarwood type sample.

[0047] 2.5) In the above-mentioned Aquilaria sinensis population, if the genotype of the Aquilaria sinensis sample at the SNP5 locus is A / A, then the sample is determined to be an early-forming aquilaria type sample.

[0048] Preferably, in order to more accurately evaluate the early resin formation trait, step 2) includes the following steps: In the aforementioned Aquilaria sinensis population, if the Aquilaria sinensis sample contains any two or more of the genotypes described in steps 2.1 to 2.5, then the sample is determined to be an early-forming aquilaria type sample.

[0049] Example 4: Genetic breeding method for early resin formation in Aquilaria sinensis. This invention further provides a genetic breeding method for the early resin formation trait of Aquilaria sinensis. This method can accurately achieve targeted selection of the early resin formation trait and significantly improve breeding efficiency. The method includes the following core steps: using any method to detect the genotype of the aforementioned SNP molecular markers, and selecting individuals with different genotypes as parents according to the breeding objectives.

[0050] Specifically, a method for genetically improving the early resin-forming trait of Aquilaria sinensis includes the following steps: 1) Determine the genotypes of molecular marker sites related to the early resin formation trait of Aquilaria sinensis in the Aquilaria sinensis resource population, wherein the molecular marker sites are the sites in the aforementioned embodiments.

[0051] 2) Make appropriate selections based on the genotype of the molecular marker and the breeding objectives.

[0052] Step 1) includes the following steps: 1.1) Extract genomic DNA from the agarwood samples to be tested; 1.2) Genotyping of the agarwood in the soil to be tested was performed; 1.3) Based on the test results, determine the genotype of the tested agarwood at SNP1~SNP5 loci; Step 2) includes at least one of the following steps: 2.1) In the aforementioned Aquilaria sinensis resource population, individuals with the G / G type at the SNP1 locus of Aquilaria sinensis are retained to increase the frequency of the G / G genotype at this locus generation by generation, thereby increasing the proportion of individuals with the early resin formation trait in the offspring Aquilaria sinensis population.

[0053] 2.2) In the above-mentioned Aquilaria sinensis resource population, individuals with the C / C type at the SNP2 locus of Aquilaria sinensis are retained to increase the C / C genotype frequency of this locus generation by generation, thereby increasing the proportion of individuals with early resin formation traits in the offspring Aquilaria sinensis population.

[0054] 2.3) In the above-mentioned Aquilaria sinensis resource population, individuals with the G / G type at the SNP3 locus of Aquilaria sinensis are retained to increase the frequency of the G / G genotype at this locus generation by generation, thereby increasing the proportion of individuals with the early resin formation trait in the offspring Aquilaria sinensis population.

[0055] 2.4) In the above-mentioned Aquilaria sinensis resource population, individuals with the G / G type at the SNP4 locus of Aquilaria sinensis are retained to increase the frequency of the G / G genotype at this locus generation by generation, thereby increasing the proportion of individuals with the early resin formation trait in the offspring Aquilaria sinensis population.

[0056] 2.5) In the above-mentioned Aquilaria sinensis resource population, individuals with the A / A type at the SNP5 locus are retained to increase the frequency of the A / A genotype at this locus generation by generation, thereby increasing the proportion of individuals with the early resin formation trait in the offspring Aquilaria sinensis population.

[0057] Preferably, in order to perform molecular marker-assisted genetic breeding more accurately, step 2) includes the following steps: In the aforementioned Aquilaria sinensis resource population, individuals with any two or more genotypes from steps 2.1 to 2.5 are retained, thereby increasing the proportion of individuals with early resin formation traits in the offspring Aquilaria sinensis population.

[0058] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to the above embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A SNP molecular marker associated with the early bud character of Aquilaria sinensis, characterized in that, The molecular marker is at least one of SNP1 to SNP5, and the nucleotide sequence of SNP1 is shown in SEQ ID NO.

1. Its mutation type is the A>G mutation at position 301 of SEQ ID NO.1, where G / G is the early argan trait. The nucleotide sequence of SNP2 is shown in SEQ ID NO.2, and its mutation type is the T>C mutation at position 301 of SEQ ID NO.2, where C / C is the early argan trait; The nucleotide sequence of SNP3 is shown in SEQ ID NO.3, and its mutation type is the A>G mutation at position 301 of SEQ ID NO.3, where G / G is the early argan trait; The nucleotide sequence of SNP4 is shown in SEQ ID NO.4, and its mutation type is the A>G mutation at position 301 of SEQ ID NO.4, where G / G is the early argan trait; The nucleotide sequence of SNP5 is shown in SEQ ID NO.5, and its mutation type is the T>A mutation at position 301 of SEQ ID NO.5, where A / A is the early resin formation trait.

2. A method of evaluating the early lacing trait of A. crassa, characterized by, The method includes the following steps: (1) Extract genomic DNA from the agarwood sample to be tested; (2) Detect the genotype of the agarwood in the soil to be tested; (3) Based on the detection results, determine the genotype of the tested agarwood, wherein the genotype is the genotype of the SNP molecular marker described in claim 1; (4) Predict the early agarwood formation trait based on the genotype results obtained from the test. The criteria for judgment are that individuals with any of the following genotypes are early agarwood formation trait, and individuals with other genotypes are non-early agarwood formation trait: individuals with the genotype G / G at SNP1, individuals with the genotype C / C at SNP2, individuals with the genotype G / G at SNP3, individuals with the genotype G / G at SNP4, and individuals with the genotype A / A at SNP5.

3. The method of claim 2, wherein, In step (2), KASP, first-generation sequencing, and second-generation sequencing were used to detect the genotype of the agarwood in the test soil.

4. The method of claim 3, wherein, In step (4), the criteria for judgment are that individuals with any combination of genotypes at the following loci are considered to have the early-maturing trait, while individuals with other genotype combinations at the corresponding loci are considered to have the non-early-maturing trait: the genotype at SNP1 is G / G, the genotype at SNP2 is C / C, the genotype at SNP3 is G / G, the genotype at SNP4 is G / G, and the genotype at SNP5 is A / A.

5. A genetic breeding method for improving the early-blossoming property of Melia azedarach, characterized by, The method includes the following steps: (1) Extract genomic DNA from the Aquilaria sinensis resource population to be tested; (2) Detect the genotype of the agarwood in the soil to be tested; (3) Based on the detection results, determine the genotype of the tested agarwood, wherein the genotype is the genotype of the SNP molecular marker described in claim 1; (4) Select individuals with different genotypes as parents according to the breeding goal. When the breeding goal is to breed varieties with early fragrance, retain individuals with any of the following genotypes: Individuals with the genotype G / G at SNP1, C / C at SNP2, G / G at SNP3, G / G at SNP4, and A / A at SNP5.

6. The method of claim 5, wherein, In step (2), KASP, first-generation sequencing, second-generation sequencing or any other genotyping technique is used to detect the genotype of the agarwood in the soil to be tested.

7. The method of claim 6, wherein, In step (4), when the breeding goal is to select varieties with the early-aroma trait, individuals with any number of the following genotype combinations at various loci should be retained: The genotypes at SNP1 are G / G, SNP2 are C / C, SNP3 are G / G, SNP4 are G / G, and SNP5 are A / A.

8. The application of the SNP molecular marker as described in claim 1 in breeding related to the early resin formation trait of Aquilaria sinensis or in predicting the early resin formation trait of Aquilaria sinensis.