Perilla pfchlh gene, virus-induced gene silencing vector and application thereof

By constructing a VIGS silencing system for the PfCHLH gene in perilla, the problem of unclear formation patterns of active substances in perilla was solved, enabling rapid identification of perilla gene function and analysis of metabolic pathways, and providing a stable yellowing phenotype for evaluating the silencing effect.

CN122256379APending Publication Date: 2026-06-23NANJING UNIV OF TRADITIONAL CHINESE MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610363813.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2026-02-26
Filing Date
2026-03-24
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

The formation and accumulation patterns of the main active substances in perilla are not fully elucidated in the existing technology, which limits the breeding of superior perilla varieties, quality evaluation and standardized production. Furthermore, the VIGS silencing efficiency is unstable, making it difficult to effectively verify the functional genes of the perilla monoterpene synthesis pathway.

Method used

The PfCHLH gene and its encoded product of Perilla frutescens were constructed, and a VIGS silencing system was established using PfCHLH as a reporter gene. A silencing vector of the PfCHLH gene of Perilla frutescens was constructed by PCR amplification and homologous recombination, and the synthesis of the H subunit of magnesium protoporphyrin IX chelate of Perilla frutescens was regulated by the TRV vector.

Benefits of technology

This method enables rapid identification of the function of perilla genes and analysis of metabolic pathways, provides a stable yellowing phenotype for evaluating silencing effects, simplifies the operation process, and improves silencing efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256379A_ABST
    Figure CN122256379A_ABST
Patent Text Reader

Abstract

The application relates to a genetically engineered body, and particularly discloses a perilla frutescens PfCHLH gene and a virus-induced gene silencing system, a construction method and application of the gene silencing system. PfCHLH The nucleotide sequence of the gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2. PfCHLH The gene silencing fragment is cloned into a virus carrier pTRV2 to obtain a pTRV2- PfCHLH silencing carrier, and the pTRV2 carrier and the pTRV1 carrier are respectively transformed into agrobacterium GV3101 to prepare infection bacterial liquid; the infection bacterial liquid is mixed according to a volume ratio of 1:1 and then injected into perilla frutescens cotyledons to induce gene silencing. PfCHLH qRT-PCR verification shows that the expression amount is significantly down-regulated and a stable yellowing phenotype is generated; preferably, the OD 600 of the infection bacterial liquid is 0.6, the silencing phenotype is more significant, and the consistency is better. The perilla frutescens VIGS system established in the application is simple in operation, short in cycle, and high in efficiency, and can be used for rapid identification of perilla frutescens gene functions and verification and application of key genes in related metabolic pathways.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to perilla. PfCHLH Methods for constructing gene and VIGS silencing systems. Background Technology

[0002] Perilla leaves are derived from the plant Perilla frutescens, belonging to the Lamiaceae family. Perilla frutescens The dried leaves (or with tender branches) of *L.) Britt. are pungent and warm in nature. They enter the lung and spleen meridians, and have the effects of relieving exterior syndromes, dispersing cold, regulating qi, and harmonizing the stomach. They are used for colds due to wind-cold, coughs and nausea, vomiting during pregnancy, and fish and crab poisoning. As one of the first batches of substances with both medicinal and edible properties, perilla leaves are rich in protein, carotenoids, vitamin C, and other bioactive components. They can be used as fresh vegetables or food additives, and also have high medicinal and economic value. However, the formation and accumulation patterns of the main active substances in perilla and their molecular regulatory mechanisms have not been fully elucidated, limiting the in-depth development of superior perilla varieties, quality evaluation, and standardized production. To ensure the quality stability of perilla medicinal materials and medicinal and edible products, it is necessary to analyze the biosynthetic pathways and key gene functions related to the main active components of perilla from a molecular biology perspective. Therefore, it is necessary to establish an efficient and rapid gene function research system suitable for perilla.

[0003] Virus-induced gene silencing (VIGS) is a reverse genetics method that uses plant viruses to mediate and trigger host RNA silencing pathways, thereby inhibiting the expression of endogenous genes in plants, achieving gene loss of function, and inducing phenotypic or physiological changes. Compared with stable genetic transformation, VIGS has advantages such as low cost, short experimental cycle, relatively simple operation, rapid phenotypic emergence, and the ability to conduct high-throughput screening, and has been widely used for plant gene function identification. However, the silencing efficiency and phenotypic consistency of VIGS are easily affected by factors such as host material, environmental conditions, viral vector type, insert length and sequence characteristics, resulting in problems such as unstable infection efficiency, low silencing efficiency, and poor reproducibility. Further systematic optimization of the system construction and infection conditions is needed to improve silencing efficiency and expand its application scope.

[0004] Tobacco rattle virus (TRV) vectors have advantages such as a wide host range, high infection efficiency, long silencing time, generally no obvious viral symptoms, and ease of modification, making them one of the most widely used VIGS vectors. To evaluate and monitor the silencing effect of the VIGS system, endogenous genes that produce readily observable phenotypes are typically selected as reporter genes. The H subunit of magnesium protoporphyrin IX chelate (CHLH) is involved in chlorophyll biosynthesis, and its silencing often results in etiolation phenotypes in plants; in addition, silencing genes related to the carotenoid synthesis pathway can lead to photobleaching phenotypes.

[0005] Based on the above background, this invention establishes a VIGS system suitable for perilla and uses reporter genes to achieve rapid determination of silencing effect, which is of great significance for the verification of functional genes and the analysis of metabolic pathways in perilla. Summary of the Invention

[0006] Purpose of the invention: This invention aims to address the lack of methods for validating functional genes involved in the monoterpene synthesis pathway of perilla in existing research, and to provide perilla... PfCHLH Genes and their encoded products and related applications, and with PfCHLH A VIGS silencing system for perilla was constructed to rapidly identify the function of perilla genes. PfCHLH Genetic modulation of chlorophyll synthesis in perilla leaves.

[0007] Technical solution: To achieve the above objectives, this invention discloses perilla leaves. PfCHLH The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

[0008] The present invention also discloses the above-mentioned perilla. PfCHLH The product encoded by the gene, the amino acid sequence of which is shown in SEQ ID NO. 2.

[0009] The present invention also discloses the above-mentioned perilla. PfCHLH Specific primers for silencing fragment cloning, including the upstream primer: PfCHLH -F: 5'-cgtgagctcggtaccggatccGGATGATTGGAGTTAGGCCAGTA-3'; Downstream primer: PfCHLH -R: 5'-gtgagtaaggttaccgaattcGTCGAATGCAAACGACTTTCG-3'.

[0010] This invention can screen the perilla leaves PfCHLH The gene and its virus-induced gene silencing vector were used to regulate the synthesis of the H subunit of perilla magnesium protoporphyrin IX chelate synthase.

[0011] Specifically, this includes transferring perilla into cells. PfCHLH Gene- or virus-induced gene silencing vectors can promote or inhibit the growth of Perilla frutescens in host cells. PfCHLH Gene expression, thereby regulating the synthesis of the H subunit of perilla magnesium protoporphyrin IX chelate synthase.

[0012] The method for constructing a gene silencing vector according to the present invention includes the following steps: (1) Perilla PfCHLH Cloning of silent fragments PfCHLH Cloning of silent fragments using primers: Upstream primer: PfCHLH-F: 5'-cgtgagctcggtaccggatccGGATGATTGGAGTTAGGCCAGTA-3'; Downstream primer: PfCHLH -R: 5'-gtgagtaaggttaccgaattcGTCGAATGCAAACGACTTTCG-3', to perilla PfCHLH Using the full-length coding gene sequence as a template, PCR amplification was performed to obtain perilla seeds. PfCHLH Cloning of silent fragments; genes PfCHLH The nucleotide sequence is shown in SEQ ID NO.1; (2) Perilla PfCHLH Construction of gene silencing vector pTRV2 vector selection Bam HⅠ and Eco The pTRV2 vector was obtained by digestion with RⅠ restriction endonuclease, and then constructed using homologous recombination. PfCHLH Gene silencing vector was constructed to obtain perilla. PfCHLH Gene silencing vector.

[0013] As a preferred embodiment, the method for constructing the gene silencing vector described above includes the following steps: (1) Perilla PfCHLH Cloning of silent fragments PfCHLH Cloning of silent fragments utilizes primers, upstream primer: PfCHLH -F: 5'-cgtgagctcggtaccggatccGGATGATTGGAGTTAGGCCAGTA-3'; Downstream primer: PfCHLH -R: 5'-gtgagtaaggttaccgaattcGTCGAATGCAAACGACTTTCG-3', to perilla PfCHLH PCR amplification was performed using the full-length coding gene sequence as a template. The amplification system was as follows: 2×Rapid Taq Master Mix enzyme 5μL, primers... PfCHLH -F and PfCHLH - 0.4 μL of each of the R and 1 μL of template were added, and the remainder was made up with sterile double-distilled water; reaction conditions: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, 35 cycles followed by 72℃ extension for 5 min, and storage at 4℃ to obtain perilla. PfCHLH Cloning of silent fragments; genes PfCHLH The nucleotide sequence is shown in SEQ ID NO.1; (2) Perilla PfCHLH Construction of gene silencing vector pTRV2 vector selection BamHⅠ and Eco The enzyme was digested with RⅠ restriction endonuclease. The digestion reaction system was as follows: 4 μL of pTRV2 vector. Bam HⅠ and Eco 1 μL of each RⅠ restriction endonuclease, 2 μL of 10×K buffer, and the remainder was made up with sterile double-distilled water; reaction conditions: 37℃ for 1 hour digestion, thus obtaining the linearized pTRV2 vector. The vector was then used to construct the *Perilla frutescens* vector using homologous recombination. PfCHLH Gene silencing vector; reaction system: PfCHLH 3.5 μL of gene silencing fragment, 1.5 μL of linearized pTRV2 vector, and 5 μL of 2 XMultiF Seamless Assembly Mix were used; the reaction conditions were 50 °C for 15 min.

[0014] The present invention also discloses a method for silencing the above-described scheme. PfCHLH The bacterial culture containing the gene, the bacterial culture including the pTRV1 vector; the OD of the bacterial culture 600 The values ​​are 0.6 and 1.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: The perilla provided by this invention PfCHLH The gene line was cloned from perilla for the first time. PfCHLH The gene is a key functional gene in the chlorophyll biosynthesis pathway. Promoting its expression can promote chlorophyll synthesis; silencing its expression can produce a stable and intuitive etiolation phenotype. It can be used as a reporter gene for the construction of the perilla VIGS system and the evaluation of the silencing effect.

[0016] This invention is based on PfCHLH Based on this, a VIGS silencing system suitable for perilla was established and optimized. It has the advantages of simple operation, short experimental cycle, rapid phenotype appearance and good reproducibility. It can be used for rapid identification of perilla gene function and verification and application of key genes in related metabolic pathways. Attached Figure Description

[0017] Figure 1 For perilla PfCHLH Agarose gel electrophoresis image of gene silencing fragments; Figure 2 For perilla PfCHLH Phenotypic changes in infected plants; Figure 3 Perilla frutescens under different Agrobacterium tumefaciens concentrations PfCHLH Analysis of relative gene expression levels. Specific implementation methods

[0018] The above-mentioned and other technical features and advantages of the present invention will be described in more detail below with reference to the accompanying drawings.

[0019] The technical means used in the embodiments are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0020] Non-toxic Super GelBlue TM Nucleic acid dyes were purchased from Shanghai Bioscient Biotechnology Co., Ltd.; the GeneJET Gel Extraction Kit was purchased from Thermo Fisher Scientific; 2×Rapid Taq MasterMix (P222), FastPure Plant Total RNA Isolation Kit (Polysaccharides & Polyphenolics–rich) (RC401), HiScript III 1stStrand cDNA Synthesis Kit (+gDNA wiper) (R312-01 / 02), and DH5α chemicompetent cells (C502) were purchased from Novizan Biotechnology Co., Ltd.; GV3101 competent cells (AC1001) were purchased from Shanghai Weidi Biotechnology Co., Ltd. Eco RⅠ(1040A), Bam Restriction endonucleases such as HⅠ(1010S) were purchased from TaKaRa; sequence primers were synthesized by Shanghai Sangon Biotech Co., Ltd.; other reagents were either imported or domestically produced analytical grade reagents.

[0021] Example 1

[0022] 1. Perilla PfCHLH Cloning of silent gene fragments PfCHLH Cloning of silent fragments using primers: Upstream primer: PfCHLH -F: 5'-cgtgagctcggtaccggatccGGATGATTGGAGTTAGGCCAGTA-3'; Downstream primer: PfCHLH -R: 5'-gtgagtaaggttaccgaattcGTCGAATGCAAACGACTTTCG-3'. Perilla PfCHLH The full-length gene sequence was used as a template for PCR amplification. The amplification system was as follows: 2×Rapid Taq Master Mix enzyme 5μL, primers... PfCHLH -F and PfCHLH - 0.4 μL of each of the R and 1 μL of template were added, and the remainder was made up with sterile double-distilled water; reaction conditions: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, 35 cycles, followed by 72℃ extension for 5 min. Thus, perilla was obtained.PfCHLH Cloning of silent segments.

[0023] 2. Perilla PfCHLH Construction of gene silencing vector pTRV2 vector selection Bam HⅠ and Eco The enzyme was digested with RⅠ restriction endonuclease. The digestion reaction system was as follows: 4 μL of pTRV2 vector. Bam HⅠ and Eco 1 μL of each RⅠ restriction endonuclease, 2 μL of 10×K buffer, and the remainder was made up with sterile double-distilled water; reaction conditions: 37℃ for 1 hour digestion, thus obtaining the linearized pTRV2 vector. The vector was then used to construct the *Perilla frutescens* vector using homologous recombination. PfCHLH Gene silencing vector. Reaction system: PfCHLH 3.5 μL of the gene-silenced fragment, 1.5 μL of the linearized pTRV2 vector, and 5 μL of 2X MultiF Seamless Assembly Mix were added. Reaction conditions: 50℃ for 15 min. This yielded Perilla frutescens. PfCHLH Gene silencing vector.

[0024] Perilla PfCHLH The gene silencing vector was transformed into Agrobacterium GV3101 competent cells. The transformation method was as follows: after the competent cells were thawed on ice, perilla leaves were added to them. PfCHLH 5 μL of the gene silencing vector was added, and the cells were incubated on ice for 5 min. After incubation, the cells were reacted in liquid nitrogen for 5 min, immediately transferred to a 37°C water bath for 5 min, and incubated on ice for 2 min. Then, 900 μL of antibiotic-free LB liquid medium was added, and the cells were incubated at 28°C and 200 rpm for 3 h. The incubated cells were then plated on LB agar plates containing 50 mg / L kanapenem and 20 mg / L rifampin, and cultured at 28°C for 60 h.

[0025] 3. Perilla PfCHLH Gene silencing Transformation of perilla PfCHLH The GV3101 strain with the gene silencing vector was cultured in 20 mL of LB liquid medium containing 50 mg / L kanaciline at 28 °C with shaking until OD. 600 The OD value was 0.6. The bacterial culture was centrifuged at 5000 rpm for 10 min at room temperature, the culture medium was discarded, and the bacterial cells were collected. The bacterial cells were resuspended in a buffer containing 10 mM MgCl2 and 10 mM MES, and the OD value was adjusted. 600 The concentration was 0.6, and acetylsyleugenone was added to bring the final concentration to 200 μM. The mixture was activated by standing in the dark at 25°C for 3 hours. The activated bacterial solution was then mixed with GV3101 bacterial solution containing pTRV1 activated under the same conditions at a 1:1 ratio. This was used to transform bacteria that did not contain perilla. PfCHLHThe GV3101 bacterial culture containing the silent fragment pTRV2 was used as a negative control for further comparative analysis.

[0026] Using perilla plants sown for 7 days as infection material, Agrobacterium tumefaciens bacterial solution was injected into the perilla plants from the back of the leaves using a 1 mL syringe. After injection, the perilla plants were placed in the dark at 25°C for 24 hours. After standing, they were cultured normally in an incubator for 15 days. The leaves of the silenced plants were then collected for expression level verification.

[0027] 4. Perilla PfCHLH Silencing efficiency and gene expression level verification Silent perilla plant leaves were flash-frozen in liquid nitrogen for RNA extraction. Total RNA was extracted according to the instructions of a plant polysaccharide and polyphenol RNA extraction kit. First-strand cDNA libraries were obtained by reverse transcription using the total RNA as a template. qRT-PCR was then used to verify the perilla plant's RNA content. PfCHLH The silencing efficiency was determined. The PCR amplification system consisted of: 5 μL Hieff® qPCR SYBR Green Master Mix (Low Rox Plus), 1 μL cDNA template, upstream primer: GGCTAACGGTCGCGGATAC; downstream primer: 0.2 μL each of CGATCGACTCCTTCAATCTTGTCTT, and sterile water to a final volume of 10 μL. The reaction conditions were: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 10 s, 60℃ extension for 30 s, for 40 cycles; the melting curve was set to the instrument's default program. β-actin from Perilla frutescens was used as an internal reference gene, and the relative expression level of the gene was calculated using the 2^(-ΔΔCT) method.

[0028] like Figure 2 As shown in -A, when the Agrobacterium tumefaciens bacterial solution OD 600 When =0.6, PfCHLH After 15 days of infection, the entire leaf of perilla showed a yellowing phenotype.

[0029] like Figure 3 As shown in -A, when the Agrobacterium tumefaciens bacterial solution OD 600 When =0.6, PfCHLH A significant decrease in gene expression levels indicates high gene silencing efficiency.

[0030] Comparative Example 1 A method similar to Example 1, the only difference being that the OD of the bacterial culture is adjusted in step 3. 600 Up to 1, compare the effects of different concentrations of Agrobacterium tumefaciens bacterial solutions on perilla. PfCHLH The impact of gene silencing rate.

[0031] like Figure 2 -B, when Agrobacterium tumefaciens bacterial solution OD 600 When the ratio is 1, the yellowing phenotype of perilla leaves only appears in local areas or on the veins.

[0032] like Figure 3 -B, when Agrobacterium tumefaciens bacterial solution OD 600 When =1, perilla PfCHLH Gene expression levels decreased significantly, but not as much as OD. 600 =0.6.

[0033] The above description is merely a preferred embodiment of the present invention and is illustrative rather than restrictive. Those skilled in the art will understand that many changes, modifications, and even equivalents can be made within the spirit and scope defined by the claims of the present invention, all of which will fall within the protection scope of the present invention.

Claims

1. The regulatory gene of the H subunit of perilla magnesium protoporphyrin IX chelase, characterized in that, The regulatory gene is perilla. PfCHLH Gene , Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The perilla as described in claim 1 PfCHLH The encoded product is characterized by, The amino acid sequence of the product is shown in SEQ ID NO.

2.

3. The product according to claim 2, characterized in that, The product may include RNA, polypeptides, or proteins.

4. The perilla as described in claim 1 PfCHLH Specific primers for silencing fragment cloning, characterized in that, Including upstream primers: PfCHLH -F: 5'-cgtgagctcggtaccggatccGGATGATTGGAGTTAGGCCAGTA-3'; Downstream primer: PfCHLH -R: 5'-gtgagtaaggttaccgaattcGTCGAATGCAAACGACTTTCG-3'.

5. Perilla frutescens as described in claim 1 PfCHLH Virus-induced gene silencing vectors.

6. The perilla as described in claim 1 PfCHLH The application of its virus-induced gene silencing vector in regulating the synthesis of the H subunit of perilla magnesium protoporphyrin IX chelate.

7. The application as described in claim 6, characterized in that, Including the transfer of perilla into cells PfCHLH Or a virus-induced gene silencing vector, inhibiting the growth of perilla in host cells. PfCHLH It expresses and regulates the synthesis of the H subunit of perilla magnesium protoporphyrin IX chelate.

8. The method for constructing the gene silencing vector according to claim 5, characterized in that, Includes the following steps: (1) Perilla PfCHLH Cloning of silent fragments PfCHLH Cloning of silent fragments using primers: Upstream primer: PfCHLH -F: 5'-cgtgagctcggtaccggatccGGATGATTGGAGTTAGGCCAGTA-3'; Downstream primer: PfCHLH -R: 5'-gtgagtaaggttaccgaattcGTCGAATGCAAACGACTTTCG-3', to perilla PfCHLH Using the full-length coding gene sequence as a template, PCR amplification was performed to obtain perilla seeds. PfCHLH Cloning of silent fragments; genes PfCHLH The nucleotide sequence is shown in SEQ ID NO.1; (2) Perilla PfCHLH Construction of gene silencing vector pTRV2 vector selection Bam HⅠ and Eco The pTRV2 vector was obtained by digestion with RⅠ restriction endonuclease, and then constructed using homologous recombination. PfCHLH Gene silencing vector was constructed to obtain perilla. PfCHLH Gene silencing vector.

9. The method for constructing a gene silencing vector according to claim 8, characterized in that, Includes the following steps: (1) Perilla PfCHLH Cloning of silent fragments PfCHLH Cloning of silent fragments utilizes primers, upstream primer: PfCHLH -F: 5'-cgtgagctcggtaccggatccGGATGATTGGAGTTAGGCCAGTA-3'; Downstream primer: PfCHLH -R: 5'-gtgagtaaggttaccgaattcGTCGAATGCAAACGACTTTCG-3', to perilla PfCHLH PCR amplification was performed using the full-length coding gene sequence as a template. The amplification system was as follows: 2×Rapid Taq Master Mix enzyme 5μL, primers... PfCHLH -F and PfCHLH - 0.4 μL of each of the R and 1 μL of template were added, and the remainder was made up with sterile double-distilled water; reaction conditions: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, 35 cycles followed by 72℃ extension for 5 min, and storage at 4℃ to obtain perilla. PfCHLH Cloning of silent fragments; genes PfCHLH The nucleotide sequence is shown in SEQ ID NO.1; (2) Perilla PfCHLH Construction of gene silencing vector pTRV2 vector selection Bam HⅠ and Eco The enzyme was digested with RⅠ restriction endonuclease. The digestion reaction system was as follows: 4 μL of pTRV2 vector. Bam HⅠ and Eco 1 μL of each RⅠ restriction endonuclease, 2 μL of 10×K buffer, and the remainder was made up with sterile double-distilled water; reaction conditions: 37℃ for 1 hour digestion, thus obtaining the linearized pTRV2 vector. The vector was then used to construct the *Perilla frutescens* vector using homologous recombination. PfCHLH Gene silencing vector; reaction system: PfCHLH 3.5 μL of gene silencing fragment, 1.5 μL of linearized pTRV2 vector, and 5 μL of 2 X MultiFSeamless Assembly Mix; reaction conditions: 50 °C for 15 min.

10. The perilla as described in claim 1 PfCHLH Application of genes in regulating chlorophyll synthesis in perilla leaves.