A high-efficiency cloning and temperature-inducible expression vector for 7alpha beta-hydroxysteroid dehydrogenase gene and a construction method thereof
By constructing a temperature-inducible expression vector of the 7α/β-hydroxysteroid dehydrogenase gene and pBV220 plasmid, the problems of toxic substance residues and high costs in existing technologies have been solved, and safe and efficient protease production has been achieved.
Patent Information
- Application Number
- CN202411967505.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2026-06-30
AI Technical Summary
In the existing technology, the engineered bacterial expression products of 7α/β-hydroxysteroid dehydrogenase contain toxic residues, and the use of chemical inducers such as IPTG is costly and has certain toxicity, which affects the production of pharmaceutical proteins.
A temperature-inducible expression vector was constructed by integrating the 7α/β-hydroxysteroid dehydrogenase gene with the pBV220 plasmid. Gene expression was controlled by temperature changes, avoiding the use of chemical inducers. Homologous recombination technology was used to simplify the integration process of the vector and the gene.
It reduces experimental costs and operational complexity, avoids the use of chemical inducers, improves process safety and efficiency, simplifies operating procedures, and reduces the risk of process failure.
Smart Images

Figure CN122303279A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of artificial bear bile powder technology, specifically to a highly efficient cloning of the 7αβ-hydroxysteroid dehydrogenase gene and a temperature-inducible expression vector and its construction method. Background Technology
[0002] Bear bile powder, as a Class I new drug, is currently scarce on the market and expensive.
[0003] Bear bile powder is a brownish-yellow or golden-yellow powder with a bitter taste and a slightly fishy smell. It possesses excellent hepatoprotective, choleretic, heat-clearing, detoxifying, liver-soothing, vision-improving, anti-inflammatory, analgesic, and litholytic effects. Clinically, it is used for epilepsy, convulsions, hemorrhoids, and externally for treating swelling. Its main component is tauroursodeoxycholic acid (TUDCA), and the Chinese Pharmacopoeia stipulates that the TUDCA content should not be less than 23%. Currently, researchers have used biotechnology to obtain the main precursor components for preparing bear bile powder from avian bile, including duck bile, goose bile, and chicken bile. These avian bile sources are not only easy to obtain and inexpensive, but also contain high levels of TCDCA, which can be converted into TUDCA through biotransformation.
[0004] The most crucial step in converting TCDCA to TUCDA using biotransformation technology is the enzymatic reduction reaction (involving 7α-hydroxysteroid dehydrogenase and 7β-hydroxysteroid dehydrogenase), and the optimal way to obtain these enzymes is through protease fermentation. Currently, researchers have constructed the 7α-hydroxysteroid dehydrogenase (7α-HSDH) and 7β-hydroxysteroid dehydrogenase (7β-HSDH) genes with the pET-28α expression vector, then introduced it into E. coli clones for amplification and screening. Plasmid extraction yields a large number of 7α-HSDH-pET-28α and 7β-HSDH-pET-28α recombinant plasmids. Further introduction of these recombinant plasmids into E. coli expression strains yields engineered bacteria carrying the target genes. Finally, fermentation induction of these engineered bacteria yields 7α / β-hydroxysteroid dehydrogenases. These two proteases are key to converting TCDCA in avian bile into TUCDA in bear bile. Currently, the methods for obtaining these two proteases using *E. coli* expression systems involve fermentation induction of engineered bacteria containing recombinant plasmids of 7α-HSDH-pET-28α and 7β-HSDH-pET-28α, with IPTG being the most commonly used inducer. While IPTG exhibits the best induction effect for protein expression, it is relatively expensive, resulting in high usage costs, and it also possesses a degree of toxicity. Therefore, the proteases induced by IPTG are not well-suited for converting TCDCA in avian bile to TUDCA in bear bile. Consequently, further optimization of the engineered expression system for hydroxysteroid dehydrogenases is urgently needed to avoid the introduction of toxic substances and improve process safety and efficiency. Summary of the Invention
[0005] The purpose of this invention is to provide a highly efficient cloning and temperature-inducible expression vector for the 7αβ-hydroxysteroid dehydrogenase gene, in order to solve the technical problem of toxic residues in the engineered bacterial expression products of hydroxysteroid dehydrogenase in the prior art.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0007] A highly efficient cloning and temperature-inducible expression vector for the 7αβ-hydroxysteroid dehydrogenase gene is provided, which is formed by integrating the hydroxysteroid dehydrogenase gene into the pBV220 plasmid; wherein the hydroxysteroid dehydrogenase gene is either the 7α-hydroxysteroid dehydrogenase gene or the 7β-hydroxysteroid dehydrogenase gene.
[0008] This technical solution also provides a method for efficient cloning of the 7αβ-hydroxysteroid dehydrogenase gene and construction of a temperature-inducible expression vector, comprising the following steps performed sequentially:
[0009] S1: Obtaining the target gene fragment and the linear vector fragment:
[0010] The hydroxysteroid dehydrogenase gene was amplified by PCR to obtain the hydroxysteroid dehydrogenase gene fragment.
[0011] The pBV220 expression vector was linearized by PCR amplification, and partial repeat sequences of the hydroxysteroid dehydrogenase gene were added to both ends of the vector to obtain a linear vector fragment.
[0012] S2: Obtaining the genetically engineered bacteria:
[0013] The linear vector fragment, hydroxysteroid dehydrogenase gene fragment, and competent cells were mixed, and ATP and MgCl2 were added to form a mixed system. The mixed system was then subjected to ice bath, heat shock, and ice bath in sequence, and then the cells were cultured in liquid culture medium. After screening by resistance plate culture, colonies were obtained.
[0014] S3: Colony identification:
[0015] Colonies grown on resistant plates were identified by PCR and sequencing. Qualified colonies contained pBV220 plasmids that integrated the hydroxysteroid dehydrogenase gene, thus obtaining engineered bacteria expressing the hydroxysteroid dehydrogenase gene.
[0016] Further, in S1, the 7α-hydroxysteroid dehydrogenase gene is amplified by PCR using the upstream primer as shown in SEQ ID NO.3 and the downstream primer as shown in SEQ ID NO.4, or the 7β-hydroxysteroid dehydrogenase gene is amplified by PCR using the upstream primer as shown in SEQ ID NO.5 and the downstream primer as shown in SEQ ID NO.6; thus obtaining the hydroxysteroid dehydrogenase gene fragment.
[0017] Further, in S1, the pBV220 expression vector is amplified by PCR using the upstream primer as shown in SEQ ID NO.7 and the downstream primer as shown in SEQ ID NO.8, or the pBV220 expression vector is amplified by PCR using the upstream primer as shown in SEQ ID NO.9 and the downstream primer as shown in SEQ ID NO.10; thus obtaining a linear vector fragment.
[0018] Furthermore, in S2, in the mixed system, the molar ratio of the linear vector fragment to the hydroxysteroid dehydrogenase gene fragment is 1:(3-8); after the linear vector fragment and the hydroxysteroid dehydrogenase gene fragment are mixed, a nucleic acid solution is formed; the ratio of the total volume of the nucleic acid solution, the volume of competent cells, the volume of ATP solution, and the volume of MgCl2 solution is 10:100:2:2;
[0019] The concentration of nucleic acid in the nucleic acid solution was 50 ng / 10 μL, and the density of competent cells was 102. 7 The concentrations of ATP solution and MgCl2 solution were 10 mM and 10 mM, respectively, at 10 μL / 100 μL. Further, in S2, the mixture was sequentially subjected to an ice bath for 30 min, a heat shock at 42°C for 90 s, and an ice bath for 2 min to obtain a heat-shocked mixture; the heat-shocked mixture was then added to LB liquid medium and incubated at 20°C for 2-3 h.
[0020] Furthermore, in S2, the type of competent cells is Escherichia coli DH5α.
[0021] Furthermore, in S3, the engineered bacteria expressing the hydroxysteroid dehydrogenase gene were induced to express the target gene by the following method: the engineered bacteria were inoculated into LB liquid medium and cultured at 30°C to obtain a seed culture; the seed culture was inoculated into fermentation medium and cultured at 30°C until OD... 600 =0.6-0.8; Induce target protein expression by heating to 42℃.
[0022] This technical solution also provides a highly efficient cloning of the 7αβ-hydroxysteroid dehydrogenase gene and a hydroxysteroid dehydrogenase obtained by a temperature-inducible expression vector.
[0023] Furthermore, impurities in hydroxysteroid dehydrogenase do not include IPTG.
[0024] The technical principle and beneficial effects of this technical solution are as follows:
[0025] This invention provides a method for efficiently expressing proteases using the 7α / β-HSDH gene via the pBV220 expression vector. The method utilizes genetic engineering techniques to ligate the 7α-HSDH and 7β-HSDH genes into the pBV220 expression vector, respectively, constructing temperature-inducible expression vectors 7α-HSDH-pBV220 and 7β-HSDH-pBV220. Addressing the problems of existing engineered expression systems for hydroxysteroid dehydrogenases, this invention employs a temperature-inducible expression system for induced fermentation to obtain the protease. This method utilizes the fact that the CIts DNA fragment in the pBV220 expression vector exhibits promoter-inhibiting activity at 30°C and inactivates it at 42°C, thus losing promoter-inhibiting activity. Therefore, the expression of the target gene can be controlled by changing the culture temperature of the engineered bacteria. This is more efficient and cost-effective compared to systems that require inducing agents, and its advantages are particularly evident in large-scale gene expression. In addition, chemical inducers (such as IPTG) are expensive, and some inducers have certain toxicity, which is detrimental to the production of medicinal proteins. However, heat-shock-inducible expression vectors do not require the addition of chemical inducers when expressing exogenous proteins, resulting in lower costs, simpler operation, and reduced risk of contamination from the inducer addition step. In actual operation, fermentation induction can be carried out simply by changing the culture temperature, which not only avoids the toxicity and cost issues associated with IPTG, but also simplifies the operation, reduces the experimental process of adding inducers, and lowers the risk of process failure.
[0026] Furthermore, most laboratories currently use restriction nucleases and DNA ligases when constructing recombinant vectors. The restriction enzyme sites used may differ each time a different recombinant vector is constructed, leading to the purchase of multiple restriction enzymes and increasing experimental costs in the long run. This technical solution employs homologous recombination technology in the process of obtaining the expression vector, and combines the integration of the vector and the target gene with the transformation of competent cells into a single step. This further reduces the difficulty and complexity of engineered bacteria preparation, and decreases the demand for restriction nucleases and DNA ligases in the process. Attached Figure Description
[0027] Figure 1 Electrophoresis images of the recombinant plasmids used as templates in Example 1 (1: 7α-HSDH-pET-28α recombinant plasmid; 2: 7β-HSDH-pET-28α recombinant plasmid).
[0028] Figure 2The results of nucleic acid electrophoresis of the 7α-HSDH gene fragment in Example 1 are shown.
[0029] Figure 3 The results of nucleic acid electrophoresis of the 7β-HSDH gene fragment in Example 1 are shown.
[0030] Figure 4 The image shows the electrophoresis results of the pBV220 plasmid PCR amplification product from Example 2 (M: Marker; Lane 1: pBV220 plasmid; Lane 2: pBV220-(7α-HSDH); Lane 3: pBV220-(7β-HSDH)).
[0031] Figure 5 This is a plate plot after screening of the 7α / β-HSDH recombinant plasmid in Example 3.
[0032] Figure 6 This is a diagram showing the nucleic acid electrophoresis results of colony PCR verification of the 7α-HSDH-pBV220 recombinant plasmid in Example 4.
[0033] Figure 7 This is a diagram showing the nucleic acid electrophoresis results of colony PCR verification of the 7β-HSDH-pBV220 recombinant plasmid in Example 4.
[0034] Figure 8 This is a biological sequencing result diagram showing whether the ligation of the 7α-HSDH-pBV220 recombinant plasmid in Example 4 was successful.
[0035] Figure 9 This is a biological sequencing result diagram showing whether the ligation of the 7β-HSDH-pBV220 recombinant plasmid in Example 4 was successful.
[0036] Figure 10 The image shows the results of shake-flask induced protein electrophoresis detection of the 7α / β-HSDH-pET28a plasmid and the 7α / β-HSDH-pBV220 plasmid in Example 5 and Comparative Example 1.
[0037] Figure 11 The image shows the 7α-HSDH-pET28a plasmid of Comparative Example 1.
[0038] Figure 12 The image shows the 7α-HSDH-pBV220 plasmid of Comparative Example 1.
[0039] Figure 13 The image shows the 7β-HSDH-pET28a plasmid of Comparative Example 1.
[0040] Figure 14 The image shows the 7β-HSDH-pBV220 plasmid of Comparative Example 1. Detailed Implementation
[0041] The present invention will be further described in detail below with reference to the embodiments, but the implementation of the present invention is not limited thereto. Unless otherwise specified, the technical means used in the following embodiments and experimental examples are conventional means well known to those skilled in the art, and the materials and reagents used can all be obtained commercially, including: pBV220 expression vector (Miaoling Biotechnology), PCR fidelity enzyme, plasmid extraction kit, DH5α competent cells (Invitrogen), gel extraction kit, ampicillin antibiotic, 1% agarose, protein gel electrophoresis reagents and other conventional reagents.
[0042] The following detailed description illustrates the specific implementation method:
[0043] Example 1: Cloning of 7α-HSDH and 7β-HSDH genes
[0044] Recombinant plasmids 7α-HSDH-pET-28α and 7β-HSDH-pET-28α were extracted from existing engineered E. coli strains in our laboratory. The extraction process followed the instructions in the Tiangen Plasmid Mini-Prep Kit. Two bands appearing in the electrophoresis results indicate the presence of open-circular or linear plasmids. Figure 1 As shown in the figure, number 1 is the 7α-HSDH-pET-28α recombinant plasmid, and number 2 is the 7β-HSDH-pET-28α recombinant plasmid.
[0045] Using the extracted 7α-HSDH-pET-28α and 7β-HSDH-pET-28α recombinant plasmids as templates, cloning was performed using the following primers (5 pmol each, 50 μl volume). PCR amplification was performed using Prime STAR Max Premix (2×) fidelity enzyme to obtain the 7α-HSDH and 7β-HSDH gene fragments. Nucleic acid electrophoresis was performed, and the fragments were then excised and recovered from the gel. The results of the 7α-HSDH gene fragment nucleic acid electrophoresis are shown below. Figure 2 As shown, the electrophoresis results of the 7β-HSDH gene fragment are as follows: Figure 3 As shown. The gel recovery process followed the Takara gel recovery kit, and the PCR cloning system followed the instructions for the Prime STAR Max Premix (2×) fidelity enzyme.
[0046] The sequence of 7α-HSDH is shown in SEQ ID NO.1, and the sequence of 7β-HSDH is shown in SEQ ID NO.2.
[0047] SEQ ID NO.1:
[0048] ATGGGCAGCAGCCATCATCATCATCATCACAAGAAACTGGAAGATAAAGTGGCAATTATTACCGCAGCCACCAAAGGTATTGGTCTGGCAAGTGCCGAAGTGCTGGCAGAAAATGGCGCCCTGGTGTATATTGCCGCCCGTAGTGAAGAACTGGCAAAAGAAGTTATTAGTAATATCGAAAGCAACGGCGGCCGTGCAAAATTTGTTTATTTTAATGCCCGCGAACCGCAGACCTATACCACAATGGTTGAAACCGTTGCCCAGAATGAAGGTCGCCTGGATATTCTGGTGAATAATTATGGCGAAACCAATGTTAAACTGGATCGTGATCTGGTGAATGGTGACACCGAAGAGTTCTTTCGCATTGTGCAGGATAATCTGCAGAGTGTTTATCTGCCGAGTAAAGCCGCCATTCCGCGTATGGCAAAGAATGGTGGCGGTAGTATTGTGAATATTAGTACCATTGGCAGTGTTGTTCCGGATCTGGGCCGTATTGCCTATTGTGTGAGCAAAGCAGCCATTAATAGTCTGACCCAGAATATTGCACTGCAGTATGCCCGTCAGGGCGTGCGCTGCAATGCCGTTCTGCCGGGCCTGATTGGTACCAAAGCCGCAATGGAAAATATGACCGATGAATTTCGTGATAGTTTTCTGCGCCATGTGCCGATTAATCGTGTTGGCAAACCGGAAGATATTGCCAAAGCCGTGCTGTATTATGCCAGCGATGATAGCGATTATGTGACCGGCATGATTCATGAAGTTGCAGGTGGCTATGCACTGGGCAGTCCGCAGTATGCAGAATTTTCTGCCATGATGGAACGTAGCCGTTAA。
[0049] SEQ ID NO.2:
[0050] ATGGGTAGTAGTCATCATCATCATCACCATAATATGAATCTGCGCGAAAAGTATGGTGAATGGGGTATTATTCTGGGCGCCACCGAAGGCGTGGGCAAAGCATTTTGCGAAAAGATTGCCGCAGGTGGTATGAATGTTGTGATGGTGGGTCGTCGCGAAGAAATGCTGAAAGATCTGGGCCGTGAAATTAGTAATAAGTATGGTGTGGAACATCTGGTTATTAAGGCAGATTTTGCAGATCCGAGCAGTGTTGATAAAATTTTCGAACAGACCAAAGAACTGGATATGGGTTTTATGAGTTATGTTGCATGCTTTCATACCTTTGGTAAACTGCAGGATACCCCGTGGGAAAAGCATGAACAGATGATTAATGTGAATGTTATCACCTTCTTTAAGTGCTTTTACCATTATATGGGCATTTTCGCAAAACAGGATCGCGGTGCCATTATTAATGTGAGTAGTCTGACCGGCATTAGCAGTAGCCCGTATAATGCACAGTATGGTGCCGGTAAAAGTTATATTCTGAAACTGACCGAAGCAGTGGCCTGCGAAGCAGCCAAAACCAATGTTGATGTGGAAGTTATTACCCTGGGTACCACCATTACCCCGAGCCTGCTGAAGAATCTGCCGGGCGGCCCGGCCGGTGAAGCAGTGATGAAAAGCGCCCTGACCCCGGAAGCCTGTGTGGATGAAGCATTTGAAAATCTGGGCAAAACCTTTAGCGTTATTGCCGGTGAACATAATAAGAAGAATGTTCATAACTGGAAGGCAAATCATACCGCAGATGAATATATTACCTATATGGGTAGCTTTTACGAAAAGTAG。
[0051] The primer information for 7α-HSDH and 7β-HSDH is as follows:
[0052] 7α-HSDH upstream primer - F: ATGGGCAGCAGCCATCATCATCATC (SEQ ID NO.3);
[0053] 7α-HSDH downstream primer-R: TTAACGGCTACGTTCCATCATGGCAG (SEQ ID NO.4);
[0054] 7β-HSDH upstream primer-F: ATGGGTAGTAGTCATCATCATCAT (SEQ ID NO.5);
[0055] 7β-HSDH downstream primer-R: CTACTTTTCGTAAAAGCTACCCAT (SEQ ID NO.6).
[0056] The PCR amplification procedures for the 7α-HSDH and 7β-HSDH gene cloning systems are detailed in Table 1.
[0057] Table 1: Gene Amplification Programs for 7α-HSDH and 7β-HSDH
[0058]
[0059] Example 2: Treatment of pBV220 expression vector
[0060] In this embodiment, the pBV220 expression vector was amplified, linearized, and partially overlapping regions of the 7α / β-HSDH gene were added to both ends.
[0061] The pBV220 expression vector was amplified using the following primers, with overlapping regions of the 7α-HSDH and 7β-HSDH genes added to both ends. The template was a self-extracted pBV220 expression vector. PCR amplification was performed using Prime STAR Max Premix (2×), with 5 pmol primers per 50 μl volume. The results of nucleic acid electrophoresis are shown below. Figure 4 As shown, the pBV220 expression vector with the overlapping regions of the 7α-HSDH gene added to both ends is named pBV220-(7α-HSDH), and the pBV220 expression vector with the overlapping regions of the 7β-HSDH gene added to both ends is named pBV220-(7β-HSDH).
[0062] pBV220-(7α-HSDH) upstream primer-F:
[0063] GGAACGTAGCCGTTAAGATCCGTCGACCTGCAG(SEQ ID NO.7);
[0064] pBV220-(7α-HSDH) downstream primer-R:
[0065] GATGGCTGCTGCCCATCCCTCCTTAATTTTTAACCAATGCTTCG (SEQ ID NO.8); pBV220-(7β-HSDH) upstream primer-F:
[0066] CTTTTACGAAAAGTAGGATCCGTCGACCTGCAG(SEQ ID NO.9);
[0067] pBV220-(7β-HSDH) downstream primer-R:
[0068] GATGACTACTACCCATCCCTCCTTAATTTTTAACCAATGCTT (SEQ ID NO. 10).
[0069] The PCR amplification procedure is detailed in Table 2.
[0070] Table 2: PCR amplification program for pBV220
[0071]
[0072] Example 3: In vivo ligation of pBV220 linear vector with 7α / β-HSDH gene fragment
[0073] Conventional vector construction involves double digestion of the target gene and plasmid followed by in vitro ligation using ligase. The method of this invention involves designing partially overlapping regions between the forward and reverse primers of the vector and the target gene; specifically, partially overlapping regions are designed between the 5' end of the linear vector and the 3' end of the target gene, and vice versa. Then, the linear vector fragment and the target gene fragment are simultaneously introduced into DH5α competent cells at a molar ratio of 1:(3-8). The cells are placed on ice for 30 min, heat-shocked at 42°C for 90 s, then incubated on ice for 2 min, and cultured in LB broth for 1-3 h (preferably 2-3 h). 100 μl of the culture is then spread onto LB plates containing ampicillin and cultured for 8-12 h. Ligation can be completed in vivo using the bacteria's own ligase (no additional ligase is needed). Competent cells are bacterial cells that, after treatment, can efficiently take up exogenous DNA. Competent cells can be prepared in-house or purchased. The preparation method of competent cells is a conventional method in the existing technology. Generally speaking, competent cells are obtained by treating DH5α cells with calcium chloride, which will not be described in detail here.
[0074] More specifically, three different methods are used for in vivo ligation in competent cells (using the pBV220 linear vector and the 7α-HSDH gene fragment as an example):
[0075] (1) The vector fragment and the target gene fragment were added together to competent cells. The molar ratio of pBV220 linear vector (obtained in Example 2) to the target gene fragment (obtained in Example 1) was 1:3. Approximately 10 μL of nucleic acid (the nucleic acid included the pBV220 linear vector and the target gene fragment, containing a total mass of approximately 50 ng of nucleic acid) was added to approximately 100 μL of competent cells (containing approximately 10 cells in total). 7 (The text appears to be a series of steps or instructions, possibly related to ligation. A direct translation isn't possible without further context or clarification.)
[0076] (2) The vector fragment and the target gene were added to competent cells, following the procedure in (1). In addition, 2 μl each of 10 mM ATP solution and 10 mM MgCl2 solution were added to the competent cells. The cells were then incubated on ice for 30 min, heat-shocked at 42°C for 90 s, incubated on ice for 2 min, and then cultured in LB liquid medium at 37°C for 1 h. Finally, the cells were plated on LB resistant plates and cultured at 37°C for 8-16 h to complete the ligation.
[0077] (3) Add the vector fragment and the target gene together to competent cells, following the procedure in (1). In addition, add 2 μl each of 10 mM ATP solution and 10 mM MgCl2 solution, incubate on ice for 30 min, heat shock at 42°C for 90 s, incubate on ice for 2 min, add LB liquid medium and incubate at 20°C for 2 h, then spread on LB resistance plates and incubate at 20°C for 8-16 h to complete the ligation.
[0078] No colonies grew on the plate in culture method (1), while a certain number of colonies grew on the plate in culture method (2), but the number of colonies was far less than 100 colonies / plate. The lack of colony growth indicates that the pBV220 linear vector was not effectively transferred into competent cells because the resistance gene is present on the vector. The small number of colonies growing on the plate indicates that the efficiency of pBV220 linear vector transfer into competent cells is relatively low. The inventors analyzed that the reason might be that in group (1), the lack of ATP and MgCl2 in the competent cells made it difficult for the pBV220 linear vector and gene fragment to connect and form a circular plasmid, and also made it difficult for exogenous nucleic acids to be effectively transferred into competent cells. The use of ATP and MgCl2 can promote the absorption of exogenous nucleic acids by competent cells and promote the connection between the pBV220 linear vector and gene fragment (homological recombination). In group (2), the short culture time (1 h) after adding LB liquid medium resulted in insufficient ligation time between the linear plasmid and the target gene; and the excessively high culture temperature (37℃) caused rapid bacterial growth, affecting the ligation process between the linear plasmid and the target gene. These two factors ultimately led to insufficient expression of the resistance gene in the bacteria, resulting in a low colony count on the resistance plate. Furthermore, the inventors selected colonies from the plate using the second culture method for colony PCR detection and found that only one out of ten colonies was positive for the target gene (the pBV220 linear vector and the target gene fragment were not properly ligated). This indicates that using the second culture method not only affects the number of colonies on the resistance plate after transgenic manipulation but also leads to a high false-positive rate.
[0079] In the third type of culture, a large number of colonies grow on the plate, and the number of bacteria on the plate is greater than 100 (colony count), such as Figure 5 As shown, this plate was selected for subsequent experiments.
[0080] Using the pBV220 linear vector and the 7β-HSDH gene fragment, the experimental procedures (1)-(3) were repeated. It was found that both (1) and (2) resulted in no colony growth or very little colony growth (far less than 100 colonies / plate). However, using (3), a large number of colonies grew on the plate, and the number of bacteria on the plate was greater than 100 (colony count). Figure 5 As shown, this plate was selected for subsequent experiments.
[0081] In this technical solution, after the pBV220 linear vector and the target gene fragment are transformed into competent cells, the bacteria use their own ligase to perform ligation and homologous recombination to obtain engineered bacteria that express the target gene.
[0082] In addition, for the construction of engineered bacteria using the pBV220 linear vector and the 7α-HSDH gene fragment, and for the construction of engineered bacteria using the pBV220 linear vector and the 7β-HSDH gene fragment, the inventors also tried to omit the addition of ATP solution or MgCl2 solution based on (3), while other operations were the same as (3). Experimental observations showed that in the above four cases, no colony growth or a very small number of colonies (far less than 100 colonies / plate) appeared on the plates. It can be seen that the combined use of ATP solution and MgCl2 solution is essential for the effective transfer of the pBV220 linear vector and the 7α / β-HSDH gene fragment into competent cells and for the ligation of gene fragments in the cells. It is one of the key factors for realizing this technical solution and has not been reported in the prior art.
[0083] After heat shock, the temperature setting of the LB liquid medium is also important. In this technical solution, the preferred culture temperature is 20℃. If the culture temperature is too high (for example, using the conventional 37℃ culture), even if the culture time is extended to 2-3 hours, a situation similar to the aforementioned "Cultivation Method (2)" will still occur, that is, the number of colonies growing on the resistance plate is small, and the positive rate of the target gene in the colonies growing on the resistance plate is very low (below 20%). In addition, the culture time of LB liquid medium after heat shock (around 20℃) can be set to 2-3 hours, which can achieve the ideal ligation effect.
[0084] Therefore, to ensure the ligation of the pBV220 linear vector with the 7α / β-HSDH gene fragment within the bacteria, and to guarantee the transfection efficiency of the nucleic acid against the engineered bacteria, it is necessary to add ATP and MgCl2 solutions to the transfection system and, after heat shock, culture at approximately 20°C for at least 2 hours. After completing the ligation of the expression vector and the target gene fragment, recombinant expression vectors 7α-HSDH-pBV220 and 7β-HSDH-pBV220 are obtained, pending further experimental verification.
[0085] Example 4: Colony PCR detection and biosequencing verification of the 7α / β-HSDH-pBV220 recombinant vector
[0086] PCR colony verification: PCR amplification was performed using Prime STAR Max Premix (2×), with 5 pmol primers per sample and a volume of 20 μl. Single colonies from screening plates using the 7α-HSDH-pBV220 and 7β-HSDH-pBV220 recombinant vectors were used as templates for PCR verification using the following primers. For the 7α-HSDH-pBV220 recombinant vector colony PCR verification, 23 colonies were selected, and 17 colonies showed positive bands. The nucleic acid electrophoresis results are shown below. Figure 6As shown; PCR colony verification of the 7β-HSDH-pBV220 recombinant vector: 23 colonies were selected, and 14 colonies showed positive bands. Nucleic acid electrophoresis results are shown below. Figure 7 As shown. The primers used for colony PCR are the same as those mentioned above. The colony PCR procedure is shown in Table 3.
[0087] Table 3: Program settings for PCR detection of 7α / β-HSDH-pBV220 recombinant plasmid colonies
[0088]
[0089] Biological sequencing validation: Single colonies were selected from PCR-positive colonies and amplified. The bacterial culture was then sent to Sangon Biotech for biological sequencing validation, and sequence alignment was performed using SnapGene software. Three colonies were selected from the 7α-HSDH-pBV220 recombinant vector selection plate, amplified, and sequenced. One colony was successfully sequenced. Figure 8 As shown; after selecting 5 colonies from the 7β-HSDH-pBV220 recombinant vector screening plate and amplifying them, sequencing was performed. Two colonies were successfully sequenced. Figure 9 As shown in the figure. The successfully sequenced colonies were amplified and preserved to obtain engineered bacteria.
[0090] Example 5: Temperature-Inducible Expression Vector Protein Expression
[0091] Fermentation culture: *E. coli* DH5α engineered bacteria containing the 7α / β-HSDH-pBV220 recombinant plasmid were inoculated at 1% into LB shake flasks and cultured overnight at 30°C and 200 rpm. The next day, the two seed cultures were inoculated at 5% into fermentation medium (LB medium) and cultured at 30°C and 200 rpm. 600 When the concentration is 0.6-0.8, the temperature is increased to 42℃, and the cells are collected by centrifugation after 8 hours of induction. SDS-PAGE protein electrophoresis results are as follows: Figure 10 As shown.
[0092] Comparative Example 1: Expression of the existing 7α / β-HSDH-pET28a expression vector protein
[0093] Fermentation culture: *E. coli* BL21(DE3) engineered bacteria containing the 7α / β-HSDH-pET28a recombinant expression vector were inoculated at 1% into LB shake flasks and cultured overnight at 37°C and 200 rpm. The next day, the prepared seed culture was inoculated at 5% into fermentation medium and cultured at 37°C and 200 rpm until OD (digestion / discharge) was achieved. 600 When the concentration of 1 mM IPTG was 0.6-0.8, the temperature was lowered to 20°C, and the cells were induced with 1 mM IPTG for 8 hours, followed by centrifugation to collect the bacterial cells. SDS-PAGE protein electrophoresis results are shown below. Figure 10 As shown.
[0094] The results of protein electrophoresis analysis are shown below. Figure 10 Lane M is the protein marker, and lanes 1-2 are respectively the expression vectors containing 7α-HSDH-pET28a (see details of the vector structure). Figure 11 The precipitate obtained after lysis of bacterial cells and the mixture of precipitate and supernatant in lanes 3-4 are, respectively, the 7α-HSDH-pBV220 expression vector (vector structure detailed in [link to vector description]). Figure 12 The precipitate obtained after bacterial cell lysis and the mixture of precipitate and supernatant; lanes 5-6 contain the 7β-HSDH-pET28a expression vector (vector structure details can be found in...). Figure 13 The precipitate obtained after bacterial cell lysis and the mixture of precipitate and supernatant; lanes 7-8 contain the 7β-HSDH-pBV220 expression vector (vector structure details can be found in...). Figure 14 The precipitate obtained after bacterial cell lysis and the mixture of precipitate and supernatant were analyzed. Electrophoresis results showed that, with consistent loading amounts, the protein expression levels after induction by the temperature-inducible expression vector and the existing pET28a expression vector were essentially the same, with no significant difference in expression levels. Using the temperature-inducible expression vector pBV220 to induce 7α / β-HSDH gene expression for protease production of intermediate products for transforming bear bile powder not only changes the induction method of the existing pET28a expression vector, avoiding the use of inducers and reducing costs, but also simplifies the experimental procedure, making it easier to operate, reducing experimental steps, and thus lowering the failure rate.
[0095] Based on the expression results of the two expression vectors mentioned above, the 7α / β-HSDH-pBV220 recombinant expression vector constructed in this patent has advantages that general protein expression vectors do not possess. It only requires changing the culture temperature to achieve the effect of inducing protein expression, making the experimental operation simple. Furthermore, the method used in constructing the expression vector in this invention is also quite unique. No enzymes are used in the plasmid linearization and ligation processes (no exogenous addition). Its main unique feature lies in the primer design, where a partially overlapping region is designed between the 5' end of the linear plasmid and the 3' end of the 7α / β-HSDH gene fragment; and the 3' end of the linear plasmid and the 5' end of the 7α / β-HSDH gene fragment are also partially overlapping. Then, the two fragments are introduced into DH5α competent cells in a certain ratio, and construction is completed automatically. The construction method of this invention does not require the use of restriction enzymes and ligases, which not only reduces experimental costs but also simplifies the experimental steps, thereby reducing the risks associated with each step of the experiment.
[0096] The above descriptions are merely embodiments of the present invention, and common knowledge regarding specific structures and characteristics is not elaborated upon here. It should be noted that those skilled in the art can make various modifications and improvements without departing from the structure of the present invention, and these should also be considered within the scope of protection of the present invention. These modifications will not affect the effectiveness of the implementation of the present invention or the practicality of the patent. The scope of protection claimed in this application should be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.
Claims
1. A highly efficient cloning and temperature-inducible expression vector for the 7αβ-hydroxysteroid dehydrogenase gene, characterized in that, It is formed by the integration of a hydroxysteroid dehydrogenase gene into the pBV220 plasmid; the hydroxysteroid dehydrogenase gene is either the 7α-hydroxysteroid dehydrogenase gene or the 7β-hydroxysteroid dehydrogenase gene.
2. The method for efficient cloning of the 7αβ-hydroxysteroid dehydrogenase gene and construction of a temperature-inducible expression vector according to claim 1, characterized in that: The following steps are performed sequentially: S1: Obtaining the target gene fragment and the linear vector fragment: The hydroxysteroid dehydrogenase gene was amplified by PCR to obtain the hydroxysteroid dehydrogenase gene fragment. The pBV220 expression vector was linearized by PCR amplification, and partial repeat sequences of the hydroxysteroid dehydrogenase gene were added to both ends of the vector to obtain a linear vector fragment. S2: Obtaining the genetically engineered bacteria: The linear vector fragment, hydroxysteroid dehydrogenase gene fragment, and competent cells were mixed, and ATP and MgCl2 were added to form a mixed system. The mixed system was then subjected to ice bath, heat shock, and ice bath in sequence, and then the cells were cultured in liquid culture medium. After screening by resistance plate culture, colonies were obtained. S3: Colony identification: Colonies grown on resistant plates were identified by PCR and sequencing. Qualified colonies contained pBV220 plasmids that integrated the hydroxysteroid dehydrogenase gene, thus obtaining engineered bacteria expressing the hydroxysteroid dehydrogenase gene.
3. The method for efficient cloning of the 7αβ-hydroxysteroid dehydrogenase gene and construction of a temperature-inducible expression vector according to claim 2, characterized in that: In S1, the 7α-hydroxysteroid dehydrogenase gene is amplified by PCR using the upstream primer as shown in SEQ ID NO.3 and the downstream primer as shown in SEQ ID NO.4, or the 7β-hydroxysteroid dehydrogenase gene is amplified by PCR using the upstream primer as shown in SEQ ID NO.5 and the downstream primer as shown in SEQ ID NO.6; thus obtaining the hydroxysteroid dehydrogenase gene fragment.
4. The method for efficient cloning of the 7αβ-hydroxysteroid dehydrogenase gene and construction of a temperature-inducible expression vector according to claim 3, characterized in that: In S1, the pBV220 expression vector is amplified by PCR using the upstream primer as shown in SEQ ID NO.7 and the downstream primer as shown in SEQ ID NO.8, or by PCR using the upstream primer as shown in SEQ ID NO.9 and the downstream primer as shown in SEQ ID NO.10; a linear vector fragment is obtained.
5. The method for efficient cloning of the 7αβ-hydroxysteroid dehydrogenase gene and construction of a temperature-inducible expression vector according to claim 2, characterized in that: In S2, in the mixed system, the molar ratio of the linear vector fragment and the hydroxysteroid dehydrogenase gene fragment is 1:(3-8); after the linear vector fragment and the hydroxysteroid dehydrogenase gene fragment are mixed, a nucleic acid solution is formed; the ratio of the total volume of the nucleic acid solution, the volume of competent cells, the volume of ATP solution, and the volume of MgCl2 solution is 10:100:2:
2. The concentration of nucleic acid in the nucleic acid solution was 50 ng / 10 μL, and the density of competent cells was 102. 7 The concentrations of ATP solution and MgCl2 solution were 10 mM and 10 mM, respectively, per 100 μL.
6. The method for efficient cloning of the 7αβ-hydroxysteroid dehydrogenase gene and construction of a temperature-inducible expression vector according to claim 5, characterized in that: In S2, the mixture is subjected to an ice bath for 30 min, a heat shock at 42°C for 90 s, and an ice bath for 2 min in sequence to obtain a heat-shocked mixture; the heat-shocked mixture is added to LB liquid medium and cultured at 20°C for 2-3 h.
7. The method for efficient cloning of the 7αβ-hydroxysteroid dehydrogenase gene and construction of a temperature-inducible expression vector according to claim 6, characterized in that: In S2, the competent cells are Escherichia coli DH5α.
8. The method for efficient cloning of the 7αβ-hydroxysteroid dehydrogenase gene and construction of a temperature-inducible expression vector according to claim 2, characterized in that: In S3, the engineered bacteria expressing the hydroxysteroid dehydrogenase gene were induced to express the target gene by the following method: the engineered bacteria were inoculated in LB liquid medium and cultured at 30°C to obtain seed culture; The seed culture was inoculated into the fermentation medium and cultured at 30°C until the OD reached [value missing]. 600 =0.6-0.8; Induce target protein expression by heating to 42℃.
9. Hydroxysteroid dehydrogenase obtained using the efficient cloning and temperature-inducible expression vector of the 7αβ-hydroxysteroid dehydrogenase gene as described in claim 1.
10. The hydroxysteroid dehydrogenase obtained by high-efficiency cloning of the 7αβ-hydroxysteroid dehydrogenase gene and temperature-inducible expression vector according to claim 9, characterized in that: Its impurities do not include IPTG.