A spatially encoded single-cell spatial transcriptome sequencing method

Abstract

This invention discloses a single-cell spatial transcriptome sequencing method based on spatial coding, belonging to the field of spatial transcriptome sequencing technology. Two microfluidic chips with mutually perpendicular channels are used to add two sets of spatial coding sequences to tissue slices. Unique spatial coding combinations are formed at the intersection of the two channels, marking the spatial location information of cells. After coding, cell nuclei are extracted from the tissue slices, and high-throughput single-cell nuclear sequencing is performed to add cellular coding to single cells. Through sequencing analysis, transcripts are mapped to spatial locations according to spatial coding, and to single cells according to cellular coding, reconstructing a single-cell spatial transcriptome atlas. This method achieves single-cell spatial coding in a simple and low-cost manner, belonging to spatial transcriptome sequencing technology with single-cell resolution.

Description

Technical Field

[0001] This invention relates to single-cell sequencing technology and the field of spatial omics, and particularly to a single-cell spatial transcriptome sequencing method based on spatial coding. Background Technology

[0002] In multicellular organisms, the environment and spatial location of cells are closely related to their functions. Understanding the spatial location of gene expression is crucial for studying normal physiological processes and disease development. The emergence of spatial transcriptomics has helped obtain molecular atlases of cellular transcriptomes with spatial location information, providing a powerful technical tool for more in-depth research on cellular function and the tissue structure of multicellular organisms.

[0003] Currently, spatial omics sequencing methods are mainly divided into two categories. One category involves in situ hybridization or in situ sequencing, which performs in situ analysis of transcripts in tissues. This type of method requires advanced operational techniques and expensive equipment, severely limiting its development and application. The other category is based on spatial coding, which significantly reduces operational difficulty and cost. Various commercial products have been developed, and it has been widely used in the life sciences and biomedicine fields. Spatial coding-based methods first add spatial codes to transcripts in tissue sections to identify their spatial location. Then, sequencing libraries are constructed for sequencing analysis. Based on the spatial codes, the transcripts are remapped back to their corresponding locations, thereby obtaining a spatial transcriptome map.

[0004] Techniques exemplified by the commercially available 10X Genomics Visium array create coding arrays by densely linking spatial coding sequences onto a substrate the size of a glass slide. These arrays are then used to capture transcripts, add spatial information to them, and finally collect all transcripts for sequencing. The size of the information points (pixels) in the spatial coding array determines the spatial resolution of spatial omics detection. The first method for spatial transcriptome sequencing used a spatial coding array with each pixel having a diameter of 100 μm, which could only obtain average gene expression results from a few dozen cells. Subsequently, the commercially available 10X Genomics Visium array reduced the pixel diameter to 55 μm, but this still falls far short of single-cell resolution. The Slide-seq method uses arrays made of microbeads with a diameter of 10 μm, further improving the resolution to near-single-cell scale. HDST (high-definition spatial transcriptomics) technology uses arrays made of even smaller microbeads, achieving a spatial resolution of 2 μm, thus realizing subcellular resolution. In 2022, the commercially available spatial omics sequencing technology Stereo-seq further improved the resolution to several hundred nanometers using DNA nanosphere technology, achieving ultra-high spatial resolution. However, because spatial information points do not correspond to single-cell outlines, these methods require the use of bioinformatics methods to separate mixed cellular information or divide virtual cell regions, making it impossible to obtain true single-cell gene expression results. Secondly, the high cost and technical complexity of manufacturing these spatial array chips hinder the widespread application of the technology.

[0005] Therefore, there is a need to develop a low-cost, simple-to-operate spatial coding scheme with single-cell resolution to achieve single-cell spatial transcriptome sequencing, thereby meeting the growing needs of basic research and precision medicine. Summary of the Invention

[0006] This invention addresses the shortcomings of existing spatial transcriptome sequencing technologies by providing a single-cell spatial transcriptome sequencing method based on spatial coding. Utilizing a low-cost and simple microfluidic chip with dozens of parallel microchannels, two microfluidic chips (horizontal and vertical) are hybridized on the surface of tissue sections to generate spatial coding array sites with dual molecular markers. This spatial coding is then loaded into tissue cells, and single-cell nuclei are extracted for sequencing to obtain a single-cell transcriptome map with spatial location information. This method significantly reduces the cost and difficulty of fabricating spatial location coding chips and achieves single-cell resolution spatial transcriptome sequencing.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides a single-cell spatial transcriptome sequencing method based on spatial coding, comprising the following steps: (1) Obtain tissue section samples, fix them with fixative, and then permeabilize them with permeabilizing solution; (2) Cover the tissue slice processed in step (1) with the first microfluidic chip, wherein the first microfluidic chip contains multiple first microfluidic channels arranged in parallel with each other; add a first set of spatially encoded oligonucleotide sequences to the tissue slice through the multiple first microfluidic channels, so that the first set of spatially encoded oligonucleotide sequences hybridizes with the RNA molecules in the tissue slice along the first direction; (3) Remove the first microfluidic chip and wash the tissue slices to remove the unhybridized first set of spatially encoded oligonucleotide sequences; (4) Cover the tissue slice with a second microfluidic chip, the second microfluidic chip containing multiple second microfluidic channels arranged parallel to each other, and the second microfluidic channels are spatially perpendicular to the first microfluidic channels; apply a second set of spatially encoded oligonucleotide sequences to the tissue slice through the multiple second microfluidic channels, so that the second set of spatially encoded oligonucleotide sequences hybridizes with the RNA molecules in the tissue slice along the second direction; (5) Remove the second microfluidic chip and wash the tissue slices to remove the unhybridized second set of spatially encoded oligonucleotide sequences; (6) Extract cell nuclei from tissue section samples and prepare cell nucleus suspensions; (7) Construct single-cell transcriptome sequencing libraries using a single-cell transcriptome sequencing platform; (8) Perform high-throughput sequencing on the single-cell transcriptome sequencing library to obtain sequencing data containing spatial coding sequences, cell coding tag sequences and transcript sequences; (9) Single-cell spatial transcriptome maps were obtained by analyzing sequencing data; The intersection region of the first group of spatially encoded oligonucleotide sequences and the second group of spatially encoded oligonucleotide sequences in the tissue slice forms a unique spatial coding combination, which is used to mark the spatial location of cells in that region.

[0008] Preferably, in step (1), the fixative contains one or more of formaldehyde, paraformaldehyde, glutaraldehyde, ethanol, methanol, and acetone; and the permeation solution contains one or more of IGEPA CA-630, Triton X-100, Tween 20, NP-40, Digitonin, Saponin, SDS, and sodium deoxycholate.

[0009] More preferably, the fixative is formaldehyde or paraformaldehyde; the permeation solution is a nonionic surfactant, more preferably IGEPEAL CA-630, Triton X-100 or NP-40.

[0010] Preferably, the first set of spatially encoded oligonucleotide sequences and the second set of spatially encoded oligonucleotide sequences are introduced into the microfluidic channel in the form of a spatially encoded hybridization solution, wherein the spatially encoded hybridization solution is a 1×PBS solution containing 0.2% Triton X-100 with a concentration of 50 nM to 2.5 μM of the spatially encoded oligonucleotide sequences.

[0011] Preferably, the first set of space-coding oligonucleotide sequences and the second set of space-coding oligonucleotide sequences each independently contain an RNA hybridization sequence, a space-coding sequence, and a fixed adapter sequence connected sequentially from the 5' end to the 3' end.

[0012] Preferably, the spatial coding sequence is a degenerate sequence of 4 to 12 nucleotides in length; the RNA hybridization sequence is a random sequence or a poly(T) sequence; and the fixed adapter sequence is used to complementarily pair with the capture sequence in the sequencing chip or sequencing kit.

[0013] More preferably, the random sequence consists of 4 to 15 nucleotides, wherein each position is independently selected from adenine (A), thymine (T) and guanine (G); the poly(T) sequence consists of 8 to 40 thymine nucleotides.

[0014] Preferably, the first microfluidic chip and the second microfluidic chip are made of hydrophobic materials.

[0015] More preferably, the hydrophobic material is polydimethylsiloxane or plastic.

[0016] Preferably, the first microfluidic chip includes at least two first microfluidic channels, and the second microfluidic chip includes at least two second microfluidic channels.

[0017] More preferably, the width of the first microfluidic channel is 10~100 μm, and the channel spacing is equal to or similar to the channel width; the width and spacing of the second microfluidic channel are the same as or independently set as the first microfluidic channel.

[0018] Preferably, in step (6), the method for extracting the cell nucleus includes enzymatic hydrolysis, mechanical dissociation, and ultrasonic dissociation.

[0019] Preferably, in step (7), the single-cell transcriptome sequencing platform includes a 10×Genomics sequencing platform or a Drop-seq platform. Those skilled in the art will understand that any platform capable of single-cell transcriptome sequencing can be used in the method of this invention.

[0020] Preferably, the first set of space-coding oligonucleotide sequences and the second set of space-coding oligonucleotide sequences are used as primers to initiate the synthesis of cDNA in the reverse transcription reaction.

[0021] Preferably, the first microfluidic chip has n channels and the second microfluidic chip has m channels, where n and m are each an independent integer ≥2. The first set of spatially encoded oligonucleotide sequences and the second set of spatially encoded oligonucleotide sequences form n×m cross regions in the tissue slice. Each cross region corresponds to a unique spatial coding combination, which is used to indicate the spatial location of the cell in that region.

[0022] The present invention also provides the application of the above method in single-cell spatial transcriptome sequencing.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows: 1) Low cost and easy operation: This invention uses a microfluidic chip with parallel channels to directly add spatial codes to tissue slices, without the need for complex chip fabrication processes or expensive decoding equipment. The chip is reusable, which greatly reduces the implementation cost and technical threshold of spatial transcriptome sequencing.

[0024] 2) Achieving single-cell resolution: This invention applies two sets of orthogonally distributed spatial codes sequentially to form n×m spatial code intersection regions in tissue slices, with each intersection region corresponding to a unique spatial code combination; subsequently, by extracting single cell nuclei and using a single-cell transcriptome sequencing platform, the spatial location information (indicated by spatial code combination) and transcriptome information of a single cell can be obtained simultaneously, truly achieving single-cell resolution spatial transcriptome analysis.

[0025] 3) Strong compatibility: The method of this invention is compatible with a variety of single-cell transcriptome sequencing platforms (such as 10×Genomics, Drop-seq, etc.), and has good versatility and scalability, making it suitable for spatial transcriptome studies of different types of tissue samples. Attached Figure Description

[0026] Figure 1 This is a schematic diagram of a method for achieving single-cell spatial transcriptome sequencing based on spatial coding using microfluidic chips.

[0027] Figure 2 A diagram illustrating the principle of spatially encoded oligonucleotide sequences entering the cell nucleus and hybridizing with transcripts.

[0028] Figure 3 Fluorescence pattern of tissue labeled with spatially encoded oligonucleotide sequences containing fluorescent markers.

[0029] Figure 4 The image shows a single-cell spatial map (a) of a mouse olfactory bulb coronal section obtained by sequencing in Example 1 of this invention, and its corresponding HE staining image (b).

[0030] Figure 5The image shows a single-cell spatial map (a) of a mouse hippocampal coronal section obtained by sequencing in Example 2 of this invention and its corresponding HE staining image (b). Detailed Implementation

[0031] The following embodiments are further illustrations of the present invention, intended to further demonstrate the problems that the technical solution of the present invention can solve and the beneficial effects it can achieve.

[0032] Unless otherwise specified, all techniques or conditions described in this invention embodiment are performed in accordance with the literature or product instructions. Reagents or instruments whose manufacturers are not specified are all commercially available, conventional products.

[0033] The flowchart of the single-cell spatial transcriptome sequencing method based on spatial coding described in this invention is as follows: Figure 1 As shown, it includes the following steps: Step S10: After obtaining tissue sections and fixing them with fixative, permeabilize the tissue sections with permeabilizing solution; Step S20: Cover the tissue slice with a first microfluidic chip, the first microfluidic chip containing multiple first microfluidic channels arranged parallel to each other; apply a first set of spatially encoded oligonucleotide sequences to the tissue slice through the multiple first microfluidic channels, so that the first set of spatially encoded oligonucleotide sequences hybridizes with RNA molecules in the tissue slice along a first direction; Step S30: Remove the first microfluidic chip and wash the tissue slice to remove the unbound first set of spatially encoded oligonucleotide sequences; Step S40: Cover the tissue slice with a second microfluidic chip. The second microfluidic chip contains multiple second microfluidic channels arranged parallel to each other, and the second microfluidic channels are spatially perpendicular to the first microfluidic channels. Apply a second set of spatially encoded oligonucleotide sequences to the tissue slice through the multiple second microfluidic channels, so that the second set of spatially encoded oligonucleotide sequences hybridizes with RNA molecules in the tissue slice along a second direction. Step S50: Remove the second microfluidic chip and wash the tissue slice to remove unbound second set of spatially encoded oligonucleotide sequences; Step S60: Extract cell nuclei from tissue section samples and prepare a cell nucleus suspension; Step S70: Construct a single-cell transcriptome sequencing library using a single-cell transcriptome sequencing platform; Step S80: Perform high-throughput sequencing on the single-cell transcriptome sequencing library to obtain sequencing data containing spatial coding sequences, cell coding tags, and transcript sequences; Step S90: Analyze the sequencing data to obtain a single-cell spatial transcriptome map.

[0034] In some embodiments, the principle by which the spatially encoded oligonucleotide sequence described in steps S20 and S40 enters the cell nucleus of the tissue section and hybridizes with the transcript is as follows: Figure 2 The first and second groups of spatially encoded oligonucleotide sequences include an RNA hybridization sequence, a spatial coding sequence, and a fixed adapter sequence linked sequentially from the 5' end to the 3' end.

[0035] The RNA hybridization sequence is either a random sequence or a poly(T) sequence. The random sequence consists of 4 to 15 nucleotides, with each position independently selected from adenine (A), thymine (T), and guanine (G). The poly(T) sequence consists of 8 to 40 thymine nucleotides. The spatial coding sequence is a degenerate sequence of 4 to 12 nucleotides in length. The fixed adapter sequence is used for complementary pairing with the capture sequence in the sequencing chip or sequencing kit.

[0036] Example 1: This example utilizes a first and second microfluidic chip made of PDMS material with 40 horizontal channels to add codes to frozen mouse olfactory bulb tissue sections, obtaining 40 x 40 = 1600 spatial coding location coordinates. After extracting single cell nuclei, the transcripts and spatial coding sequences in the single cell nuclei were simultaneously sequenced using the 10 X Genomics single-cell transcriptome sequencing platform, thereby obtaining a spatial transcriptome atlas of the mouse olfactory bulb.

[0037] 1. Fabrication of PDMS microfluidic chips The masks for a first and second microfluidic chip with 40 parallel channels were drawn using AutoCAD software. Each channel has an independent inlet and outlet, and is not interconnected with the other channels. The channel width is 50 μm, and the distance between channels is 50 μm. The channels on the first and second microfluidic chips are perpendicular to each other. The PDMS microfluidic chip was fabricated using soft photolithography, and the inlet and outlet of the channels were punched using a punch.

[0038] 2. Fixation and permeabilization of tissue sections Frozen mouse olfactory bulb tissue was sectioned using a cryostat to a thickness of 20 μm. 100 μL of 4% PFA (paraformaldehyde) solution was added to each section, and the sections were incubated at room temperature for 10 min for fixation. The sections were then rinsed with PBS buffer. Permeation buffer (containing 0.2% Triton X-100 and 1X PBS) was added to each section, and the sections were incubated on ice for 5 min. The sections were then rinsed with PBS buffer.

[0039] 3. Addition of the first set of spatially encoded oligonucleotide sequences Cover the tissue slice with the channel surfaces of the first microfluidic chip, face to face, and press firmly with your fingers to remove air bubbles. Clamp the spatially encoded chip and the slice with clips. Prepare 40 different first-group spatially encoded hybridization solutions, each containing a unique first-group spatially encoded oligonucleotide sequence: the hybridization solution corresponding to channel 1 contains spatially encoded sequence A1, the hybridization solution corresponding to channel 2 contains spatially encoded sequence A2, and so on, with the hybridization solution corresponding to channel 40 containing spatially encoded sequence A50. The final concentration of the spatially encoded oligonucleotide sequence in all hybridization solutions is 1000 nM, and the solvent is 1×PBS containing 0.2% Triton X-100. Add the corresponding hybridization solution to the inlet of each channel, connect a syringe to the outlet of the channel, pull the syringe to use negative pressure to draw the solution towards the outlet, filling the channel with solution, and incubate at room temperature for 10 min to perform hybridization.

[0040] Remove the microfluidic chip and wash the tissue sections twice with 1X PBS solution.

[0041] The general structural formula of the first group of spatially encoded oligonucleotide sequences is: SEQ ID NO.1: 5'-ROX-TTTTTTTTTTNNNNNGCTTTAAGGCCGGTCCTAGCAA-3' Wherein, NNNNN is a spatial coding sequence, and each base is selected from any one of the A, T, C, and G bases. TTTTTTTTTT is an RNA hybridization sequence. GCTTTAAGGCCGGTCCTAGCAA is a fixed connector sequence that is complementary to the capture sequence on the 10 X Chromium Next GEM SingleCell 3′ Reagent Kits v3.1 (Dual Index).

[0042] 4. Addition of the second set of spatially encoded oligonucleotide sequences The first microfluidic chip was covered onto the tissue slice in the manner described in step 3), and the second set of spatially encoded oligonucleotide sequences was added in the same way.

[0043] This yields tissue slices with spatial coordinate markings.

[0044] The general structural formula of the second group of spatially encoded oligonucleotide sequences is: SEQ ID NO.2: 5'-FAM-TTTTTTTTTTNNNNNGCTTTAAGGCCGGTCCTAGCAA-3', where NNNNN is a spatial coding sequence, each base is selected from any one of A, T, C, or G, and the NNNNN sequence is different from the sequence in the first group of spatial coding oligonucleotide sequences.

[0045] The second set of spatial coding sequences also contains 40 different sequences: the hybridization solution corresponding to channel 1 of the second microfluidic chip contains spatial coding sequence B1, the hybridization solution corresponding to channel 2 contains spatial coding sequence B2, and so on, the hybridization solution corresponding to channel 40 contains spatial coding sequence B40.

[0046] Because the 5' ends of the first and second group of spatially encoded oligonucleotide sequences are labeled with ROX and FAM fluorescent markers, respectively, after hybridization with RNA in tissue sections, images of the tissue sections taken under a fluorescence microscope show parallel fluorescent bands, such as... Figure 3 As shown.

[0047] 5. Extraction of cell nuclei Remove the microfluidic chip and wash the tissue slide twice with 1X PBS solution. Use a cell scraper to scrape the tissue cells from the slide and collect them in a 5 mL centrifuge tube. Add 1000 μL of 1X PBS solution to the centrifuge tube and sonicate for 30 s in an ultrasonic cell disruptor to extract the cell nuclei. Centrifuge at 800 g for 10 minutes, discard the supernatant, and resuspend the cells in 250 μL of NSB (containing 10 mM Tris / HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 1% v / v superase inhibitor, and 1% v / v BSA). Mix well and centrifuge again at 800 g for 6 minutes. Add 1 mL of NSB to resuspend the cell nuclei.

[0048] 6. Construction of single-cell transcriptome sequencing libraries Single-cell transcriptome sequencing libraries were constructed using the 10X Genomics platform. Transcripts from single-cell nuclei and the permeated spatially coding oligonucleotide sequences were simultaneously processed, single-cell coding tags were added, and sequencing libraries were constructed. Each cDNA molecule in this library carries three types of information: a spatially coding sequence, indicating the 2D spatial location of the tissue; a cell-coding tag, indicating the single-cell origin; and a transcript sequence, which, through alignment, identifies the gene it represents.

[0049] 7. Analysis of Spatial Location Information of Transcripts Sequencing is used to examine spatially coding oligonucleotide sequences against single-cell coding sequences on transcripts. Transcripts with the same single-cell coding tag and spatially coding oligonucleotide sequences originate from the same single-cell nucleus. Based on this, transcripts in the single-cell nucleus are mapped to spatially coding information points determined by the corresponding spatially coding oligonucleotide sequences, i.e., the original spatial location of the transcript. Following this principle, a spatial single-cell atlas of mouse olfactory bulb slices is reconstructed, such as... Figure 4 As shown, the resulting spatial single-cell atlas corresponds consistently with the HE staining map of the mouse olfactory bulb section.

[0050] Example 2: This example utilizes a first and second microfluidic chip made of PDMS material with 50 horizontal channels to add codes to frozen mouse hippocampal tissue slices, obtaining 50 x 50 = 2500 spatial coding location coordinates. After extracting single cell nuclei, the DroNc-seq single-nucleus transcriptome sequencing platform was used to simultaneously sequence transcripts and spatial coding sequences in the single cell nuclei, thereby obtaining a spatial transcriptome atlas of the mouse hippocampus.

[0051] 1. Fabrication of PDMS microfluidic chips The masks for a first and second microfluidic chip with 50 parallel channels were drawn using AutoCAD software. Each channel has an independent inlet and outlet, and is not interconnected with the other channels. The channel width is 70 μm, and the distance between channels is 70 μm. The channels on the first and second microfluidic chips are perpendicular to each other. The PDMS microfluidic chip was fabricated using soft photolithography, and the inlet and outlet of the channels were punched out using a punch.

[0052] 2. Fixation and permeabilization of tissue sections Frozen mouse hippocampal tissue was sectioned using a cryostat to a thickness of 10 μm. 100 μL of 4% PFA (paraformaldehyde) solution was added to each section and incubated at room temperature for 5 min for fixation. The sections were then rinsed with PBS buffer. Permeation buffer (containing 0.2% Triton X-100 and 1X PBS) was added to each section and incubated on ice for 5 min. The sections were then rinsed with PBS buffer.

[0053] 3. Addition of the first set of spatially encoded oligonucleotide sequences Cover the tissue slice with the channel surfaces of the first microfluidic chip, face to face, and press firmly with your fingers to remove air bubbles. Clamp the spatially encoded chip and the slice with clips. Prepare 50 different first-group spatially encoded hybridization solutions, each containing a unique first-group spatially encoded oligonucleotide sequence: the hybridization solution corresponding to channel 1 contains spatially encoded sequence A1, the hybridization solution corresponding to channel 2 contains spatially encoded sequence A2, and so on, with the hybridization solution corresponding to channel 50 containing spatially encoded sequence A50. The final concentration of the spatially encoded oligonucleotide sequence in all hybridization solutions is 100 nM, and the solvent is 1×PBS containing 0.2% Triton X-100. Add the corresponding hybridization solution to the inlet of each channel, connect a syringe to the outlet of the channel, pull the syringe to use negative pressure to draw the solution towards the outlet, filling the channel with solution, and incubate at room temperature for 10 min to perform hybridization.

[0054] Remove the microfluidic chip and wash the tissue sections twice with 1X PBS solution.

[0055] The general structural formula of the first group of spatially encoded oligonucleotide sequences is: SEQ ID NO.3: 5'-GATGGATATGTAGTNNNNNNAAAAAAAAAAAAAAA-3' Wherein, NNNNNN is a spatial coding sequence, and each base is selected from any one of the A, T, C, and G bases. GATGGATATGTAGT is an RNA hybridization sequence. AAAAAAAAAAAAAAA is a fixed connector sequence that is complementary to the capture sequence on the DroNc-seq encoded microbeads.

[0056] 4. Addition of the second set of spatially encoded oligonucleotide sequences The first microfluidic chip was covered onto the tissue slice in the manner described in step 3), and the second set of spatially encoded oligonucleotide sequences was added in the same way.

[0057] This yields tissue slices with spatial coordinate markings.

[0058] The general structural formula of the second group of spatially encoded oligonucleotide sequences is shown in SEQ ID NO.3; The NNNNN sequence is different from the sequence in the first group of spatially encoded oligonucleotide sequences.

[0059] 5. Extraction of cell nuclei Remove the microfluidic chip and wash the tissue slide twice with 1X PBS solution. Use a cell scraper to scrape the tissue cells from the slide and collect them in a 5 mL centrifuge tube. Add 1000 μL of 1X PBS solution containing 1% collagenase to the centrifuge tube and sonicate for 10 s in an ultrasonic cell disruptor to extract the cell nuclei. Centrifuge at 800 g for 10 minutes, discard the supernatant, and resuspend the cells in 250 μL of NSB (containing 10 mM Tris / HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 1% v / v superase inhibitor, and 1% v / v BSA). Mix well and centrifuge again at 800 g for 6 minutes. Add 1 mL of NSB to resuspend the cell nuclei.

[0060] 6. Construction of single-cell transcriptome sequencing libraries Single-cell transcriptome sequencing libraries were constructed using the DroNc-seq platform. Transcripts from single-cell nuclei and the permeated spatially encoded oligonucleotide sequences were simultaneously processed, single-cell coding tags were added, and sequencing libraries were constructed. Each cDNA molecule in this library carries three types of information: a spatially encoded sequence indicating the 2D spatial location of the tissue; a cell-coding tag indicating the single-cell origin; and a transcript sequence, which, through alignment, identifies the gene it represents.

[0061] 7. Analysis of Spatial Location Information of Transcripts Sequencing is used to examine spatially coding oligonucleotide sequences against single-cell coding sequences on transcripts. Transcripts with the same single-cell coding tag and spatially coding oligonucleotide sequences originate from the same single-cell nucleus. Based on this, transcripts in the single-cell nucleus are mapped to spatially coding information points determined by the corresponding spatially coding oligonucleotide sequences, i.e., the original spatial location of the transcript. Spatial single-cell atlases of mouse hippocampal slices are reconstructed according to this principle, such as... Figure 5 As shown, the resulting spatial single-cell atlas corresponds consistently with the HE staining map of mouse hippocampal sections.

[0062] The embodiments of this application have been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of this application. The descriptions of the embodiments above are only for the purpose of helping to understand the method and core ideas of this application. Furthermore, any changes or modifications made by those skilled in the art based on the ideas of this application, and on the specific implementation methods and application scope of this application, are all within the scope of protection of this application. Therefore, the content of this specification should not be construed as a limitation of this application.

Claims

1. A single-cell spatial transcriptome sequencing method based on spatial coding, characterized in that, Includes the following steps: (1) Obtain tissue section samples, fix them with fixative, and then permeabilize them with permeabilizing solution; (2) Cover the tissue slice processed in step (1) with the first microfluidic chip, wherein the first microfluidic chip contains a plurality of first microfluidic channels arranged in parallel with each other; A first set of spatially encoded oligonucleotide sequences is added to the tissue slices through the multiple first microfluidic channels, so that the loaded first set of spatially encoded oligonucleotide sequences hybridize with the RNA molecules in the tissue slices along a first direction. (3) Remove the first microfluidic chip and wash the tissue slices to remove the unhybridized first set of spatially encoded oligonucleotide sequences; (4) Cover the tissue slice with a second microfluidic chip, the second microfluidic chip containing multiple second microfluidic channels arranged parallel to each other, and the second microfluidic channels are spatially perpendicular to the first microfluidic channels; add a second set of spatially encoded oligonucleotide sequences to the tissue slice through the multiple second microfluidic channels, so that the loaded second set of spatially encoded oligonucleotide sequences hybridize with the RNA molecules in the tissue slice along the second direction; (5) Remove the second microfluidic chip and wash the tissue slices to remove the unhybridized second set of spatially encoded oligonucleotide sequences; (6) Extract cell nuclei from tissue section samples and prepare cell nucleus suspensions; (7) Construct single-cell transcriptome sequencing libraries using a single-cell transcriptome sequencing platform; (8) Perform high-throughput sequencing on the single-cell transcriptome sequencing library to obtain sequencing data containing spatial coding sequences, single-cell coding tag sequences and transcript sequences; (9) Single-cell spatial transcriptome maps were obtained by analyzing sequencing data; In this case, the intersection region of the first group of spatially encoded oligonucleotide sequences and the second group of spatially encoded oligonucleotide sequences in the tissue slice forms a unique spatial coding combination, which is used to mark the spatial location of cells in that region.

2. The single-cell spatial transcriptome sequencing method according to claim 1, characterized in that, In step (1), the fixative is one or more of formaldehyde, paraformaldehyde, glutaraldehyde, ethanol, methanol, and acetone; the permeation solution is one or more of IGEPARCA-630, Triton X-100, Tween 20, NP-40, Digitonin, Saponin, SDS, and sodium deoxycholate.

3. The single-cell spatial transcriptome sequencing method according to claim 1, characterized in that, The first group of spatially encoded oligonucleotide sequences and the second group of spatially encoded oligonucleotide sequences are introduced into the microfluidic channel in the form of a spatially encoded hybridization solution, which is a 1×PBS solution containing 0.2% Triton X-100 with a concentration of 50 nM to 2.5 μM of the spatially encoded oligonucleotide sequences.

4. The single-cell spatial transcriptome sequencing method according to claim 1, characterized in that, The first set of spatially encoded oligonucleotide sequences and the second set of spatially encoded oligonucleotide sequences are connected sequentially from the 5' end to the 3' end to an RNA hybridization sequence, a spatially encoded sequence, and a fixed adapter sequence; wherein, the spatially encoded sequence is a degenerate sequence of 4 to 12 nucleotides in length; the RNA hybridization sequence is a random sequence or a poly(T) sequence; and the fixed adapter sequence is used to complementarily pair with the capture sequence in the sequencing chip or sequencing kit.

5. The single-cell spatial transcriptome sequencing method according to claim 4, characterized in that, The random sequence consists of 4 to 15 nucleotides, each of which is independently selected from adenine, thymine, and guanine; the poly(T) sequence consists of 8 to 40 thymine nucleotides.

6. The single-cell spatial transcriptome sequencing method according to claim 1, characterized in that, The first and second microfluidic chips are made of hydrophobic materials.

7. The single-cell spatial transcriptome sequencing method according to claim 1, characterized in that, The first microfluidic chip and the second microfluidic chip each contain at least two microfluidic channels.

8. The single-cell spatial transcriptome sequencing method according to claim 1, characterized in that, In step (6), the method for extracting the cell nucleus includes enzymatic hydrolysis, mechanical dissociation, and ultrasonic dissociation.

9. The single-cell spatial transcriptome sequencing method according to claim 1, characterized in that, In step (7), the single-cell transcriptome sequencing platform is a 10×Genomics sequencing platform, a Drop-seq platform, or a different platform that can meet the requirements for mRNA or total RNA detection.

10. The application of the method according to any one of claims 1-9 in single-cell spatial transcriptome sequencing.

Images