A tumor therapy target of MIB1-p53 R175H and its application

Abstract

The application belongs to the technical field of biological medicine, and discloses MIB1-p53 R175H interaction or MIB1 as a target point in the preparation of a drug for preventing and / or treating tumors, and / or a product for prognosis evaluation. The application proposes a brand-new and highly selective anticancer drug action target point-MIB1-p53 R175H interaction interface and MIB1. By inhibiting the interaction or MIB1, the carcinogenic oligomerization of p53 R175H can be specifically blocked, so that the functional gain activity is reduced. Through systematic in-vitro cell experiments, in-vivo animal models and clinical sample correlation analysis, the sgRNA and shRNA targeting MIB1 verify that the MIB1-p53 R175H axis has a clear effect on inhibiting tumor growth and improving the prognosis of patients, and has great clinical significance and social value.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a MIB1-p53 R175H Tumor therapeutic targets and their applications. Background Technology

[0002] Mind Bomb 1 (MIB1), an E3 ubiquitin ligase, plays a crucial role in key physiological processes such as cell cycle regulation, differentiation, and cell death by catalyzing the ubiquitination of substrate proteins and mediating their degradation. While ubiquitination typically targets protein degradation, certain specific ubiquitin chain types (such as K63 ligases) may also be involved in signal transduction or protein complex assembly. Despite mounting evidence of MIB1 overexpression in tumors, its role in tumor progression remains unclear.

[0003] p53 tumor suppressor protein, by TP53 Genes play a central role in preventing malignant transformation of cells, and are therefore widely regarded as the "guardians of the genome." Under normal physiological conditions, the activity of p53 is subject to extremely precise multi-level regulation to ensure that it is activated when necessary, while remaining quiescent under non-stress conditions. TP53 It is the gene most frequently mutated in human cancers, and most are associated with cancer. TP53 Mutations are missense mutations located within the DNA-binding domain, resulting in the expression of full-length but functionally abnormal recombinant proteins. These mutations not only disrupt the ability of p53 protein to bind to DNA, leading to the loss of its wild-type tumor suppressor function, but more importantly, they often endow mutant proteins with new, tumor-promoting "gain-of-function" properties. Common "hotspot" mutations, such as R175H, R248Q, R273H, and R282W, inactivate p53 structurally through different mechanisms (such as disrupting zinc ion coordination, directly affecting DNA contact, or causing abnormal overall structural folding).

[0004] Recent studies have revealed that a key underlying mechanism of gain-of-function in mutant p53 is its tendency to form stable, higher-order oligomers and even insoluble amyloid fibrillary aggregates. Unlike the dynamic, tightly regulated wild-type p53 tetramer, certain mutants (especially common p53) exhibit this tendency. R175HDue to the structural destabilization of the DNA-binding domain, hydrophobic residues that are usually buried inside the protein are exposed, leading to abnormal and uncontrollable self-binding and the formation of large oligomeric complexes. This pathological aggregation process has characteristics similar to protein misfolding diseases and directly drives pro-tumorigenic signals: 1) Isolating key tumor suppressor proteins: Mutant p53 aggregates can act like a "sponge," intercepting and inactivating other important tumor suppressor factors in the cell, such as p63, p73, and even wild-type p53 (in the case of heterozygous mutations), amplifying their loss-of-function effects through abnormal protein interactions; 2) Acting as an abnormal transcription platform: These oligomers can act as a scaffold, recruiting and enriching various transcriptional coactivators and chromatin remodeling complexes, forming abnormal "super enhancers" at specific genomic sites, strongly driving the expression program of a set of oncogenes; 3) Enhancing cellular stress survival pathways: Aggregated mutant p53 can interact with components of stress-sensing kinases (such as ATM and ATR), continuously activating downstream survival and repair signals, making tumor cells more resistant to the stress of chemotherapy, radiotherapy, and other treatments.

[0005] Although oligomerization of mutant p53 plays a clearly important role in tumorigenesis it drives, the intrinsic cellular mechanisms regulating this process remain unclear. Therefore, elucidating the specific regulatory pathways controlling mutant p53 oligomerization has significant biological and clinical translational value, and targeting the regulatory links of its oligomerization offers a novel and potentially highly effective therapeutic approach. Summary of the Invention

[0006] This invention aims to address at least one of the technical problems existing in the prior art, providing a novel and precise therapeutic strategy targeting p53 mutant-driven cancer. This invention is the first to elucidate at the molecular level the effect of the E3 ubiquitin ligase MIB1 on p53... R175H Specific regulatory mechanisms of gain-of-function in mutants. Through analysis of "MIB1-p53" R175H Intervention at the "interaction interface" or "MIB1" target provides a new and precise intervention paradigm for the prevention / treatment of cancers carrying high-frequency p53 mutations, and has extremely high clinical application value.

[0007] A first aspect of the present invention aims to provide the use of a reagent for detecting MIB1 in the preparation of products for tumor prognostic assessment, wherein the tumor includes tumors carrying p53. R175H Mutated tumor.

[0008] A second aspect of the present invention aims to provide a MIB1 inhibitor for the preparation of drugs carrying p53. R175H Application in the treatment of mutated tumors.

[0009] A third aspect of the present invention is to provide an RNA.

[0010] A fourth aspect of the present invention is to provide RNA-related biological materials as described in the third aspect of the present invention.

[0011] A fifth aspect of the present invention is to provide a medicine.

[0012] A sixth aspect of the present invention aims to provide the use of MIB1 as a target in screening drugs for the prevention or treatment of tumors, said tumors including those carrying p53. R175H Mutated tumor.

[0013] To achieve the above objectives, the technical solution adopted by the present invention is as follows: This invention first utilizes CRISPR-Cas9 genome editing technology to construct a stable p53 expression system. R175H cell line (HCT116-p53) R175H ), in HCT116-p53 R175H and HCT116-p53 WT Immunoprecipitation-mass spectrometry analysis targeting p53 was performed in cells to screen for cells that are related to p53. R175H Specifically bound protein molecules. The role of MIB1 in maintaining p53 was validated using the NanoBiT reporter system. R175H The dimer plays a crucial role. Further, it is found in various endogenous expressions of p53. R175H Native-PAGE was performed on cancer cell lines to confirm that MIB1 specifically binds to p53. R175H It does not interact with wild-type p53 or other mutants. Finally, through systematic in vitro cell experiments, in vivo animal models (including xenograft models and PDX models), and clinical sample correlation analysis, the targeting of MIB1-p53 was validated using sgRNA and / or shRNA targeting MIB1. R175H The axis has a clear effect in inhibiting tumor growth and improving patient prognosis.

[0014] A first aspect of the invention provides the use of a reagent for detecting MIB1 in the preparation of a product for tumor prognostic assessment, said tumor comprising tumors carrying p53. R175H Mutated tumor.

[0015] The inventors were the first to discover and confirm that the E3 ubiquitin ligase MIB1 regulates p53 R175H MIB1, a key upstream factor for mutant gain-of-function, can specifically recognize and bind to p53. R175HThe protein, rather than wild-type p53 or other common mutants, catalyzes a unique K27-linked polyubiquitination modification at its 139th lysine residue. This specific modification does not guide protein degradation but acts as a molecular "switch," directly promoting p53 degradation. R175H The formation of higher-order dimer / oligomer complexes is crucial for acquiring oncogenic activities such as excessive transcriptional activation.

[0016] In some embodiments of the present invention, the reagent for detecting MIB1 includes reagents for quantitative detection of MIB1 and / or reagents for detecting MIB1 and p53. R175H Interacting reagents.

[0017] In some embodiments of the present invention, the reagent includes reagents for detecting MIB1 at the gene level and / or protein level.

[0018] In some preferred embodiments of the present invention, the reagents include those for detecting MIB1 by enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, radioimmunoassay, immunoprecipitation assay, immunoblotting, high-performance liquid chromatography (HPLC), capillary gel electrophoresis, near-infrared spectroscopy, mass spectrometry, immunochemiluminescence assay, colloidal gold immunochromatography, fluorescence immunochromatography, surface plasmon resonance (SIP), PCR, immuno-PCR, microarray assay, or biotin-avidin assay.

[0019] In some embodiments of the present invention, the reagent for detecting MIB1 includes a substance specific to MIB1.

[0020] In some embodiments of the present invention, the substance specific to MIB1 includes at least one of MIB1-specific probes, gene chips, PCR primers, and antibodies.

[0021] In some embodiments of the present invention, the prognostic assessment product further includes the detection of p53. R175H The reagent.

[0022] In some preferred embodiments of the present invention, the reagent includes a p53 detector. R175H Reagents for oligomerization.

[0023] In some embodiments of the present invention, the detection p53 R175H Oligomerization reagents include detection of p53 by non-denaturing polyacrylamide gel electrophoresis, size exclusion chromatography, blue-native (BN-PAGE) and clear-native (CN-PAGE) electrophoresis. R175H Reagents for oligomerization.

[0024] A second aspect of the present invention provides a MIB1 inhibitor for the preparation of a drug carrying p53. R175H In the application of drugs for the treatment of mutated tumors, the MIB1 inhibitor is at least one of the following: a substance that inhibits MIB1 activity, a substance that degrades MIB1, a substance that reduces the expression level of MIB1, or a substance that knocks out / knocks down the expression of MIB1.

[0025] Based on the fact that the E3 ubiquitin ligase MIB1 regulates p53 R175H The inventors proposed "MIB1-p53" as a key upstream factor for gain-of-function in mutants. R175H A novel intervention strategy targeting the "interaction interface" or "MIB1 E3 ligase activity" aims to disrupt this ubiquitination regulatory axis (e.g., inhibiting the interaction between MIB1 and p53). R175H (Binding or MIB1 enzyme activity), can effectively inhibit p53. R175H Oligomerization and its downstream carcinogenic signals can be targeted for precise treatment.

[0026] In some embodiments of the present invention, the MIB1 inhibitor is at least one of a1) to a4): a1) siRNA, dsRNA, miRNA, sgRNA, ribozyme, or shRNA that target MIB1; a2) Nucleic acid molecules encoding the siRNA, dsRNA, miRNA, sgRNA, ribozyme, or shRNA that targets MIB1 as described in a1); a3) An expression cassette, vector, or transgenic cell line containing the nucleic acid molecules described in a2); a4) Small molecule drugs that target MIB1.

[0027] In some embodiments of the present invention, the transgenic cell line does not contain propagation material.

[0028] In some preferred embodiments of the present invention, the MIB1 inhibitor is at least one of b1) to b6): b1) sgRNA targeting MIB1; b2) A nucleic acid molecule encoding the sgRNA targeting MIB1 described in b1); b3) Expression cassettes, vectors, or transgenic cell lines containing the nucleic acid molecules described in b2); b4) shRNA targeting MIB1; b5) A nucleic acid molecule encoding the shRNA targeting MIB1 described in b4); b6) Expression cassettes, vectors, or transgenic cell lines containing the nucleic acid molecules described in b5).

[0029] In some embodiments of the present invention, the transgenic cell line does not contain propagation material.

[0030] In some embodiments of the present invention, the nucleotide sequence of the sgRNA targeting MIB1 is shown in SEQ ID NO:27 or SEQ ID NO:28.

[0031] In some embodiments of the present invention, the sense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:19, and the antisense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:20; or the sense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:21, and the antisense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:22.

[0032] In some embodiments of the present invention, the p53 carrier R175H Mutated tumors include at least one of the following: breast cancer, bile duct cancer, squamous cell carcinoma of the tongue, colon cancer, lung cancer, stomach cancer, ovarian cancer, melanoma, hematologic malignancies, prostate cancer, endometrial cancer, and hemangiopericytoma.

[0033] In some preferred embodiments of the present invention, the p53 carrier R175H Mutated tumors include breast cancer, bile duct cancer, squamous cell carcinoma of the tongue, colon cancer, and lung cancer.

[0034] A third aspect of the present invention provides an RNA comprising at least one of c1) to c2): c1) sgRNA targeting MIB1, the nucleotide sequence of which is shown in SEQ ID NO:27 or SEQ ID NO:28; c2) shRNA targeting MIB1, wherein the sense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:19 and the antisense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:20; or the sense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:21 and the antisense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:22.

[0035] A fourth aspect of the present invention provides RNA-related biological materials in accordance with the fourth aspect of the present invention.

[0036] In some embodiments of the present invention, the biomaterial includes any one of 1) to 12): 1) A nucleic acid molecule encoding the RNA of the third aspect of this invention; 2) An expression cassette containing the nucleic acid molecule described in 1); 3) A carrier containing the nucleic acid molecule described in 1); 4) A carrier containing the expression box described in 2); 5) Transgenic cell lines containing the nucleic acid molecules described in 1); 6) A transgenic cell line containing the expression cassette described in 2); 7) A transgenic cell line containing the vector described in 3); 8) A transgenic cell line containing the vector described in 4); 9) Recombinant microorganisms containing the nucleic acid molecules described in 1); 10) Recombinant microorganisms containing the expression cassette described in 2); 11) Recombinant microorganisms containing the vector described in 3); 12) Recombinant microorganisms containing the vector described in 4).

[0037] In some embodiments of the present invention, the transgenic cell line does not contain propagation material.

[0038] In a fifth aspect, the present invention provides a medicament comprising RNA of the third aspect of the present invention and / or biological material of the fourth aspect of the present invention.

[0039] In some embodiments of the present invention, the drug is used in combination with chemotherapy drugs and / or biological agents.

[0040] In some embodiments of the present invention, the chemotherapy drugs include paclitaxel, docetaxel, cisplatin, carboplatin, oxaliplatin, 5-fluorouracil, gemcitabine, doxorubicin, and cyclophosphamide.

[0041] In some embodiments of the present invention, the biological agents include monoclonal antibodies, antibody-drug conjugates, cytokines, hormones, enzymes, and cell therapies.

[0042] In a sixth aspect, the invention provides the use of MIB1 as a target in screening drugs for the prevention or treatment of tumors, said tumors including those carrying p53. R175H Mutated tumor.

[0043] The beneficial effects of this invention are: This invention elucidates for the first time at the molecular level the effect of the E3 ubiquitin ligase MIB1 on p53 R175H Specific regulatory mechanisms of mutant gain-of-function. Specifically, this invention demonstrates that MIB1 can specifically recognize p53. R175H Instead of wild-type p53 or other common mutants, it catalyzes non-degradable K27 site polyubiquitination modification, thereby directly promoting p53R175H The formation of dimers / oligomers with transcriptional activation activity fills a gap in the understanding of the regulatory mechanism of abnormal aggregation of mutant p53.

[0044] Based on the above mechanism, this invention proposes a novel and highly selective anticancer drug target—MIB1-p53. R175H The interaction interface and the E3 ligase activity of MIB1. Inhibition of this interaction or enzyme activity can specifically block p53. R175H The carcinogenic oligomerization of these molecules reduces their gain-of-function activity, providing a novel and precise technical pathway for developing drugs to treat cancers carrying this specific high-frequency mutation.

[0045] This invention also designed sgRNA and shRNA targeting MIB1, and verified the targeting of MIB1-p53 through systematic in vitro cell experiments, in vivo animal models, and correlation analysis with clinical samples. R175H The axis has a clear effect in inhibiting tumor growth and improving patient prognosis, and its effect has been confirmed by high p53. R175H Its dependence and selectivity have significant clinical and social value. Attached Figure Description

[0046] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 The results of screening key upstream factors that specifically bind to p53R175H and regulate its oligomerization are shown in the following diagrams: A is the result of Western blotting detection of the oligomerization level of p53R175H and wild-type p53 after cross-linking; B is the screening flowchart of protein molecules that specifically bind to p53R175H; C is the result of detecting the effect of candidate genes on p53R175H dimers; D is the result of Native-PAGE detection of the effect of knockdown of MIB1 and p53 on SK-BR3 (p53R175H) cells and knockdown of MIB1 on p53R175H dimers / multimers in HuCCT1 (p53R175H) cells; E is the result of Native-PAGE detection of the p53R175H oligomerization level in Cal-33 (p53R175H) cells and HCT116 (p53R175H) cells after knocking out the MIB1 gene with CRISPR-Cas9. In the picture, This means P < 0.01.

[0047] Figure 2 For the detection of MIB1 and p53 by immunoprecipitation assay R175H The result of the direct binding is shown in the figure, where A represents the detection of p53 expression. R175HMIB1 and p53 of HCT116 (colorectal cancer), SK-BR3 (breast cancer), HuCCT1 (cholangiocarcinoma), and Cal-33 (squamous cell carcinoma of the tongue) R175H The result diagram shows the binding situation, where B represents the detection of p53 expression. R273H HT29 (colon adenocarcinoma) expresses p53 R249S BT-549 (breast cancer), A549 expressing normal p53 (non-small cell lung cancer), and p53-expressing... R248W The image shows the binding of MIB1 and p53 in H1170 (human non-small cell lung cancer). C represents the detection of Cal-33 (p53) after PRIMA-1 treatment. R175H ) cells and HuCCT1 (p53) R175H MIB1 and p53 cells R175H The result diagram shows the combination of these components, where D represents the detection of Cal-33 (p53) after ZMCI treatment. R175H ) cells and HuCCT1 (p53) R175H MIB1 and p53 cells R175H The result diagram shows the binding situation between them. E represents the detection that MIB1 can recognize and bind to the catalytic p53. R175H The result of polyubiquitination modification of which lysine residue in the protein.

[0048] Figure 3 For MIB1 and p53 R175H Single or combined knockout of Cal-33 (p53) R175H Cells and MIB1 knockdown and p53 R175H Knockout of single or combined transfections of SK-BR3 (p53) R175H The results of tumor spheroidization and clonogenic assays of cells are shown in the figure, where A represents MIB1 and p53. R175H Single or combined knockout of Cal-33 (p53) R175H The image shows the results of a tumor spheroidization assay for cells, with B representing MIB1 and p53. R175H Single or combined knockout of Cal-33 (p53) R175H The image shows the results of a cell colony formation assay. The 6-well plate was 35 mm in diameter. C represents MIB1 knockdown and p53. R175H Knockout of single or combined transfections of SK-BR3 (p53) R175H The image shows the results of a tumor spheroidization assay for cells, where D represents MIB1 knockdown and p53. R175H Knockout of single or combined transfections of SK-BR3 (p53) R175H The image shows the results of a cell clonogenic assay. The plate has 6 wells and a diameter of 35 mm. represent P <0.05, represent P <0.01.

[0049] Figure 4 For MIB1 and p53 R175H Single or combined knockout of Cal-33 (p53) R175H Figure 1 shows the tumor size and volume of a nude mouse subcutaneous xenograft model of cells. In the figure, NS represents no significant difference. represent P <0.01, represent P <0.001.

[0050] Figure 5 Figure 1 shows the tumor size and volume of subcutaneous xenograft models in nude mice using MIB1-knockdown HCT116 (p53R175H), HCT116 (p53- / -), and HCT116 (p53WT) cells. In the figure, NS represents no significant difference. This means P < 0.01. This means P < 0.001.

[0051] Figure 6 The figure shows the results of the clinical correlation analysis, where A represents the correlation between MIB1 protein level and p53 in the Pearson correlation analysis. R175H Figure B shows the results of oligomerization degree, while B shows the Kaplan-Meier survival analysis results for different MIB1 expression levels, and C shows the p53 results. R175H The results of Kaplan-Meier survival analysis with two-parameter grouping of oligomerization level and MIB1 expression level. Detailed Implementation

[0052] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0053] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0054] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0055] Example 1: Construction of HCT116-p53 R175HCell lines and detection of intracellular p53 oligomerization In order to study p53 R175H The oligomerization regulation mechanism of mutants was investigated using CRISPR-Cas9 genome editing technology to target p53. R175H The mutated sequence (5'-AGCACATGACGGAGGTTGTG-3' (SEQ ID NO:1)) was knocked into the Trp53 locus of human colorectal cancer cells HCT116 (ATCC, CCL-247) to construct a stable p53 expression structure. R175H cell line (HCT116-p53) R175H ), as detailed below: Targeting the mutation site p53 R175H The flanking sequences were screened to obtain a highly cleavage-active sgRNA with the sequence: 5'-AGCACATGACGGAGGTTGTG-3' (SEQ ID NO:1), which was then cloned into the PX459 vector (addgene:Plasmid#62988) to construct a recombinant plasmid.

[0056] Construction of recombinant plasmids: (1) Based on the sgRNA synthesis of the pre- and post-primers, a 100 μM storage solution was prepared using ddH2O. (2) Primer phosphorylation: The reaction system was as follows: 1 μL of pre-primer + 1 μL of post-primer + 1 μL of 10×T4 Ligation Buffer (containing ATP) + 0.5 μL of T4PNK (polynucleotide kinase) + 6.5 μL of ddH2O, 37℃ for 30 min, 95℃ for 5 min, and annealed to 25℃. Take 1 μL of the product and add 99 μL of ddH2O to obtain double-stranded Oligo, which was used for subsequent ligation. (3) Enzyme digestion and purification of PX459 vector: The enzyme digestion reaction system was as follows: 5 μg of PX459 vector + 5 μL of 10×CutSmart Buffer (NEB) + 1-2 μL of BbsI-HF (NEB, R3539) + ddH2O to 50 μL, and incubated at 37℃ for 2 h. Take a small amount of the enzyme digestion product for agarose gel electrophoresis to confirm whether the vector is linearized. Purify the enzyme digestion product using a gel recovery kit to obtain the linearized PX459 vector. (4) Insert the annealed double-stranded Oligo into the linearized vector. The reaction system is: 1 μL of linearized PX459 vector (about 50 ng / μL) + 1 μL of diluted annealed Oligo + 1 μL of 10×T4 Ligase Buffer + 1 μL of T4 DNA Ligase + ddH2O to 10 μL. Ligate overnight at 16℃. (5) Transform and plate. Take competent DH5α cells from -80℃ and thaw them on ice. Take 10 μL of ligation product and add it to 100 μL of competent cells. Mix gently and incubate on ice for 30 min. Heat shock at 42℃ for 90 s, then immediately incubate on ice for 2 min. Add 500~900 μL of antibiotic-free SOC or LB medium and incubate at 37℃ and 200 rpm for 60 min. Centrifuge the revived bacterial culture at 6000 rpm for a few minutes, discard some of the supernatant, and resuspend the bacterial cells in 200 μL. Spread the bacterial culture evenly on LB agar plates containing ampicillin. Invert the plates and incubate at 37°C for 16 hours. Pick 3-5 single colonies and inoculate them into LB liquid medium containing ampicillin. Shake overnight and extract plasmids.

[0057] Subsequently, a DNA repair template containing homologous arms on both sides was designed, with the mutation to be introduced located in the center of the template. The sequence is: 5'-GTGAGGAATCAGAGGCCTGGGGACCCTGGGCAACCAGCCCTGTCGTCTCTCCAGCCCCAGCTGCTCACCATCGCTATCTGAGCAGCGCTCATGGTGGGGGCAGTGTCTCACAACCTCCGTCATGTGCTGTGACTGCTTGTAGATGGCCATGGCGCGGACGCGGGTGCCGGGCGGGGTGTGGAATCAACCCACAGCTGCACAGGGCAGGTCTTGGCCAGTT-3' (SEQ ID NO:2). The recombinant plasmid and repair template were co-transfected into the HCT116 cell line using electroporation. After the HCT116 cells reached 80% confluence, they were trypsinized, and the cells were collected to prepare 1×10⁻⁶ cells. 6 Single-cell suspension. 100 μL system, total DNA 10 μg, plasmid:repair template = 1:1 (mass ratio). Resuspend in 100 μL of Celetrix-specific electroporation buffer (1×10⁶ cells / mL). 6 For each cell, add the mixed plasmid DNA to the cell suspension and mix well. Transfer the cell and DNA mixture to a pre-chilled electroporation cuvette, Cell Line mode, 560V. After electroporation, immediately remove the cuvette and add approximately 1 mL of preheated (37°C) fresh complete culture medium in a clean bench, gently mixing. Incubate at 37°C with 5% CO2.

[0058] After transfection, positive cells were selected using 1 μg / mL puromycin, and single clones were cultured and sequenced to verify mutation status. Clones with homozygous mutations were selected as positive clones for amplification culture, thus obtaining HCT116-p53. R175H Cell lines.

[0059] Pancreatic enzyme digestion of HCT116-p53 R175HAfter cell division, the cell pellet was collected, and lysis buffer containing protease inhibitors was added. The mixture was then sonicated at 4°C for 15 min. 50% glutaraldehyde (G810414, Shanghai Maclean Biochemical Technology Co., Ltd.) was diluted with the cell lysis buffer to concentrations of 0.005%, 0.015%, 0.025%, 0.05%, and 0.1%. The cell lysis buffer was divided into six equal portions, and different concentrations of glutaraldehyde were added to each. The mixture was incubated at 4°C with rotation for 10 min, followed by the addition of 2% glycine and incubation at 4°C with rotation for another 10 min to terminate the cross-linking. Glutaraldehyde can penetrate the cell membrane and cross-link with adjacent amino groups in proteins, thereby stabilizing protein-protein interactions and oligomer structures. The cross-linked cell lysis buffer was subjected to SDS-PAGE electrophoresis, followed by Western blotting analysis to determine oligomer levels.

[0060] The results are as follows Figure 1 As shown in Figure A, compared to wild-type p53, p53 R175H After cross-linking, it is more likely to form oligomeric bands with higher molecular weight, and its oligomerization level is significantly higher than that of wild-type p53, suggesting that there may be specific factors in the cell that promote or stabilize p53. R175H Oligo-aggregation.

[0061] Example 2: Screening for specific binding p53 R175H And regulate the key upstream factors of its oligomerization To identify any specific factors that may exist in Example 1, this example first examines HCT116-p53. R175H and HCT116-p53 WT Immunoprecipitation-mass spectrometry analysis targeting p53 was performed in cells, followed by a series of screening and validation procedures, as detailed below: Specific binding p53 R175H And screen for key upstream factors that regulate oligomerization. Using p53-specific antibodies in HCT116-p53 R175H and HCT116-p53 WT Immunoprecipitation targeting p53 was performed in the cells. HCT116-p53 was collected. R175H and HCT116-p53 WTCells were added to a lysis buffer containing a protease inhibitor (lysis buffer, 20118ES60, Yisheng Biotechnology (Shanghai) Co., Ltd.; protease inhibitor, 20124ES03, Yisheng Biotechnology (Shanghai) Co., Ltd.; protease inhibitor: lysis buffer = 1:100), and sonicated at 4°C for 15 min. A small amount was used as an Input control. 4 μL of p53-specific antibody (10442-1-AP, Thermo Fisher Scientific (China) Co., Ltd.) was added to the remaining cell lysis buffer and incubated overnight at 4°C. A small amount was used for Input (positive control) detection. Magnetic beads were added to the remaining supernatant and incubated on a shaker at 4°C for 2 h. The magnetic beads were placed on a magnetic rack, and the solution was discarded. Loading buffer was added, and the mixture was boiled at 100°C for 10 min. The complexes were collected and identified by liquid chromatography-tandem mass spectrometry to screen for antibodies against p53. R175H Protein molecules that bind specifically.

[0062] Considering that protein oligomerization is affected by various post-translational modifications, including phosphorylation, ubiquitination, and acetylation, molecules possessing these functional characteristics were further selected as candidate proteins for a second round of screening and validation. Figure 1 (B) The NanoBiT (Nano-Luciferase Binary Interaction Technology) reporting system is used to monitor p53 in real time. R175H The dimerization process: constructing SmBiT-p53 respectively R175H With p53 R175H -LgBiT fusion expression vector, co-transfected into p53 homozygous deletion HCT116-p53 / Cells, HCT116-p53 / The cells were obtained using CRISPR / Cas9 technology, resulting in a p53 knockout cell line.

[0063] SmBiT-p53 R175H With p53 R175H The process of using the LgBiT fusion expression vector is as follows: the LgBiT vector pGL3-Basic vector is digested with two enzymes, and the linearized vector backbone is recovered after digestion. p53 R175H PCR amplification of the coding region, and the obtained p53 R175H The PCR products were subjected to the same double enzyme digestion, followed by purification and recovery. The digested p53 DNA was then ligated using T4 DNA ligase. R175H The fragment was ligated to the LgBiT vector backbone. The exact same steps were followed to ligate the p53 fragment. R175H Inserted into the SmBiT vector to construct p53R175H -SmBiT fusion expression vector.

[0064] Cells were collected after transfection and 100 μL of lysis buffer was added to each well of a 96-well plate. The plates were incubated on ice for 5 min. 20 μL of the lysis buffer was then added to each well, with three replicates. 100 μL of firefly luciferase reaction solution was added and the plates were shaken to mix. Firefly luciferase activity was detected using a multi-mode microplate reader. 100 μL of Renaissance luciferase reaction solution was added and the plates were shaken to mix. Renaissance luciferase activity was detected using a multi-mode microplate reader. Background F: Untransfected cells + firefly luciferase assay reagent; Background R: Untransfected cells + firefly luciferase assay reagent + Renaissance luciferase assay reagent. Experimental group ratio = (Experimental group F luminescence intensity - Background F luminescence intensity) / (Experimental group R luminescence intensity - Background R luminescence intensity); Control group ratio = (Control group F luminescence intensity - Background F luminescence intensity) / (Control group R luminescence intensity - Background R luminescence intensity); Expression fold = Experimental group ratio / Control group ratio.

[0065] When p53 R175H When dimerization occurs, SmBiT and LgBiT approach each other and reconstruct luciferase activity, generating a luminescent signal.

[0066] After knocking down candidate genes one by one using siRNA, the luminescence intensity of the cells was detected using a multifunctional microplate reader. The siRNA sequences are shown in Table 1. (HCT116-p53) R175H Cells (2×10) 5 Add 1000 μL of Opti-MEM medium (31985070, Gibco) to each well and incubate until the density reaches about 70%. Then, discard the old medium and wash twice with PBS. Incubate for 30 min in an incubator.

[0067] Add 30 pmol siRNA to an EP tube containing 150 μL Opti-MEM and mix gently. Add 9 μL RNAiMAX to another EP tube containing 150 μL Opti-MEM and mix gently. Incubate at room temperature for 5 min. Mix the diluted siRNA and diluted RNAiMAX thoroughly to form a transfection complex and incubate for 20 min. Add the complex by rotary drop into a six-well plate and incubate for 6 h. Change the medium after incubation. Monitor p53 levels in real time using a NanoBiT (Nano-Luciferase Binary Interaction Technology) reporter system. R175H The dimerization process.

[0068] Table 1 siRNA sequences

[0069] The results are as follows Figure 1As shown in Figure C, luminescence intensity detection revealed a significant increase in signal in the co-transfected group. Knockdown of candidate genes one by one using siRNA showed that the luminescence signal was significantly weakened only when MIB1 was knocked down, indicating that MIB1 is crucial for maintaining p53. R175H Dimers play a crucial role.

[0070] Example 3: Verification of MIB1 on p53 R175H The regulatory role of oligomerization To further verify the regulatory role of MIB1 in p53-R175H oligomerization, the inventors performed Native-PAGE (non-denaturing polyacrylamide gel electrophoresis) on various cancer cell lines endogenously expressing p53-R175H (including SK-BR3 (breast cancer), HuCCT1 (cholangiocarcinoma), and Cal-33 (squamous cell carcinoma of the tongue)). The details are as follows: Collect SK-BR3 and HuCCT1 cells with siRNA knockdown of MIB1, add non-denaturing lysis buffer (R0030, Solarbio), and sonicate for 20 min. Mix the lysed cell buffer with non-denaturing loading buffer without boiling. Prepare an 8% non-denaturing polyacrylamide gel and load the cells. Perform electrophoresis at constant voltage under ice bath conditions. The stacking gel stage is 80 V, and after bromophenol blue enters the separating gel, adjust the voltage to 120 V. Stop electrophoresis when the bromophenol blue migrates to 1 cm from the bottom of the gel. Transfer the gel to a PVDF membrane at a constant current of 250 mA for 1.5 h and block with skim milk powder for 2 h. Primary antibodies (MIB1 antibody, 83718-5-RR, 1:8000; p53 antibody, 10442-1-AP, 1:5000; GAPDH, 60004-1-Ig, 1:50000) were incubated overnight at 4°C on a shaker. The PVDF membrane was washed four times with TTBS for 5 min each time, and then incubated at room temperature on a shaker with secondary antibodies (HRP-conjugated Goat Anti-Mouse IgG (H+L), SA00001-1, 1:10000; HRP-conjugated Goat Anti-Rabbit IgG (H+L), SA00001-2, 1:10000) for 2 h, followed by four times with TTBS for 5 min each time. Protein bands were visualized using High-SIG ECL assay kit (Tanon, China).

[0071] Experimental results are as follows Figure 1 China D and Figure 1 As shown in E. After knocking down MIB1, p53 R175H The dimer and polymer bands decreased significantly, while the monomer bands increased, and the total protein level remained unchanged. Figure 1 (D); Using the method of Example 1, consistent results were also obtained by knocking out the MIB1 gene in SK-BR3 and HCT116 cells using CRISPR-Cas9 ( Figure 1 (E).

[0072] Example 4: Verification of MIB1 and p53 R175H direct combination To confirm MIB1 and p53 R175H To directly bind with the virus, the inventors conducted an immunoprecipitation experiment, as detailed below: (1) Collect cells with different p53 mutants (expressing p53) R175H SK-BR3 (breast cancer cells, ATTC, HTB-30), HuCCT1 (cholangiocarcinoma cells, Pronosai, CL-0725), and Cal-33 (tongue squamous cell carcinoma cells, ATTC, CCL-247) express p53. R273H HT29 (colon adenocarcinoma cells, ATTC, HTB-38) express p53. R249S BT-549 (breast cancer cells, ATTC, HTB-122), A549 (non-small cell lung cancer cells, ATTC, CCL-185) expressing normal p53, and p53-expressing... R248W H1170 (non-small cell lung cancer cells, ATTC, CRL-589) were added to protein lysis buffer (P0013B, Shanghai Beyotime Biotechnology Co., Ltd.), sonicated for 20 min, and 50 μL of supernatant was taken out as the Input group. (2) Mix 500 μL of IP cell lysis buffer (P0013, Shanghai Beyotime Biotechnology Co., Ltd.) with 30 μL of magnetic beads, invert and mix at 4°C for 10 min, discard the supernatant, and repeat this step 3 times. Mix the remaining supernatant with the prepared magnetic beads, invert and mix at 4°C for 3 h. (3) Centrifuge the pre-conjugated product at 28000rpm for 30s at 4℃, discard the magnetic beads, take 200μL of supernatant as the control group and 200μL of supernatant as the experimental group. Add IgG antibody (10284-1-AP, Proteintech Group, Inc) to the control group and add p53 antibody (10442-1-AP, Proteintech Group, Inc) to the experimental group. Mix by inverting at 4℃ for 1h. (4) The prepared magnetic beads were placed in the control group and experimental group respectively, and incubated overnight at 4℃. Centrifuged at 28000rpm for 30s at 4℃, and the supernatant was discarded. 1mL of IP lysis buffer was added, and the mixture was inverted and mixed for 5min. Centrifuged at 28000rpm for 30s at 4℃, and the supernatant was discarded. This step was repeated 5 times. IP lysis buffer and 5× loading buffer were added, and the mixture was incubated in a metal bath at 100℃ for 10min. The supernatant was then collected by centrifugation. Western blotting was performed to verify the specific binding of MIB1.

[0073] The results showed that MIB1 specifically binds to p53. R175H It does not interact with wild-type p53 or other mutants. Figure 2 (A and B in the middle).

[0074] Further investigation was conducted into the specific recognition of p53 by MIB1. R175H The structural basis. (p53) R175H The mutation causes loss of zinc ion coordination and decreased stability of the L2 ring structure, leading to a conformational transition from disorder to order in this region, accompanied by local structural collapse. To clarify p53... R175H To investigate the role of conformational specificity induced by mutations in MIB1 binding, the inventors treated HuCCT1 (cholangiocarcinoma) and Cal-33 (tongue squamous cell carcinoma) cells with the compound PRIMA-1 (a mutant p53 activator that can restore the wild-type p53 conformation). PRIMA-1 was prepared by dissolving in ddH2O at low concentrations of 20 µM and high concentrations of 200 µM. After 24 hours, cells were collected for immunoprecipitation experiments to detect the binding of MIB1 and p53. R175H The combination of.

[0075] The results showed that PRIMA-1 treatment significantly reduced the effects of MIB1 and p53. R175H The combination between ( Figure 2 (C)

[0076] The inventors also verified whether zinc ion reconstruction could eliminate p53. R175H Combination with MIB1. Utilizing ZMC1 (a p53...) R175H A reactivator (with no effect on wild-type p53, this molecule can restore the structural integrity of zinc-deficient p53 mutants) was used to treat HuCCT1 (cholangiocarcinoma) and Cal-33 (tongue squamous cell carcinoma) cells. ZMC1 was dissolved and diluted with DMSO at low concentrations of 2.5 nM and high concentrations of 20 nM. Cells were collected 24 h after addition for immunoprecipitation experiments.

[0077] The results showed that ZMCI significantly reduced MIB1 and p53. R175H The combination between ( Figure 2 (Middle D). It is evident that the results of Examples 2-4 collectively confirm that MIB1 regulates p53. R175H A key upstream factor in oligomerization. This was achieved by constructing p53 cells with different tyrosine residue mutations. R175H Plasmids containing the Flag, MIB1 containing His, and Ub containing HA were transfected, and cells were then collected for immunoprecipitation. The results showed that MIB1 can specifically recognize and bind to p53. R175H The protein (not wild-type p53 or other common mutants) catalyzes a unique K27-linked polyubiquitination modification at its 139th lysine residue. Figure 2 (E). This specific modification does not guide protein degradation, but rather acts as a molecular "switch" to directly promote p53. R175H The formation of higher-order dimer / oligomer complexes is crucial for acquiring oncogenic activities such as excessive transcriptional activation.

[0078] Example 5 Preparation of MIB1 and p53 R175H Single or combined knockout of Cal-33 (p53) R175H Cells, MIB1 and p53 R175H Single knockdown of SK-BR3 (p53) R175H ) cells and MIB1 knockdown and p53 R175H Knockout of single or combined transfections of SK-BR3 (p53) R175H )cell (1) Prepare 293T cells that have grown to about 80% (cell count is 5 × 10⁻⁶). 5 (each cell), replaced with serum-free Opti-MEM medium 2 hours before transfection; (2) Mix the packaging plasmid (psPAX2, JY03029, Nanjing Jiangyuan Biotechnology Co., Ltd.): the envelope plasmid (pMD2.G, JY03027, Nanjing Jiangyuan Biotechnology Co., Ltd.) and the transfer plasmid (lentiCRISPER-v2 vector containing sgRNA or pLKO.1 vector containing shRNA, the transfer plasmid was constructed according to the method in Example 1) in a ratio of 2:1:2, and mix with the transfection reagent Lipofectamine 3000 (Invitrogen, L3000008). Tube 1: 125 μL Opti-MEM medium + 7.5 μL Lipofectamine 3000 reagent, mix gently. Tube 2: 125 μL Opti-MEM medium + 2.5 μg DNA + 5 μL P3000 reagent. Mix gently. Add tube 2 to tube 1 and incubate at room temperature for 10 min. (3) The transfection complex was added dropwise to 293T cells. After culturing for 48 hours, the cell supernatant containing virus particles was collected. Cell debris was removed by filtration through a 0.45 μm filter, purified by ultracentrifugation, and the virus titer was determined by real-time PCR. (4) Cal-33 (p53) R175H ) and SK-BR3 (p53) R175H Cells were seeded into 6-well plates, with the cell concentration controlled at approximately 50%. The MOI for MIB1 infection was 5, and p53 was [missing information]. R175HThe multiplicity of infection (MOI) was 8. The required viral volume (μL) was calculated as follows: MOI value × cell number / viral titer (TU / mL) × 1000. Lentiviral virus and transfection reagents were added, and the cells were cultured in serum-free medium for 12 hours, then replaced with complete medium. Fluorescence was observed under a fluorescence microscope after 48 hours. 0.1 μL of 1 μg / mL puromycin solution was added, and the medium was changed every two days, with the amount of puromycin solution gradually increased by 0.2 μL each time. Stably transfected cells were screened. The shRNA sequence is shown in Table 2. The sgRNA sequence is shown in Table 3.

[0079] Table 2 shRNA sequences

[0080] Table 3 sgRNA sequences

[0081] Example 6: Preparation of HCT116-p53 with stable MIB1 knockdown R175H HCT116-p53 WT and HCT116-p53 - / - Three stable cell lines Prepare 293T cells that have grown to approximately 80% confluence. Two hours before transfection, replace the medium with serum-free Opti-MEM. Mix the packaging plasmid, envelope plasmid, and transfer plasmid (pLKO.1 vector containing MIB1 shRNA, constructed according to Example 1) at a ratio of 2:1:2. Mix with the transfection reagent Lipofectamine 3000 and incubate at room temperature for 15 minutes. Add the transfection complex dropwise to the 293T cells. After culturing for 48 hours, collect the cell supernatant containing viral particles. Filter through a 0.45 μm filter to remove cell debris, purify by ultracentrifugation, and determine the viral titer using quantitative real-time PCR. HCT116-p53 R175H HCT116-p53 WT and HCT116-p53 - / - Cells were seeded into 6-well plates at a concentration of approximately 50%, with a lentiviral multiplicity of infection (MOI) of 10. The lentiviral volume was calculated, and lentiviral and transfection reagents were added. Cells were cultured in serum-free Opti-MEM medium (31985070, Gibco) for 12 hours, then replaced with complete medium. After 48 hours, fluorescence was observed under a fluorescence microscope. 0.1 μL of 1 μg / mL puromycin solution was added, and the medium was changed every two days, with the amount of puromycin solution gradually increased by 0.2 μL each time. Stably transfected cells were screened.

[0082] Example 7: Cellular Function Studies of MIB1 - Clonogenesis and Tumor Spheroidization Assays To evaluate MIB1's effect on p53 R175HTo investigate the role of mutant tumor cells, the inventors conducted clonogenic experiments and tumor spheroidization experiments, as detailed below: (1) Cloning experiment Preparation of MIB1 and p53 R175H Single or combined knockout of Cal-33 (p53) R175H Single-cell suspensions were prepared to induce MIB1 knockdown and p53 inhibition. R175H Knockout of single or combined transfections of SK-BR3 (p53) R175H Single-cell suspension; add 2000 cells to each well of a six-well plate and culture until more than 50 cells per cell clone. Discard the culture medium, add 4% paraformaldehyde for fixation for 20 min, discard the paraformaldehyde, add 1% crystal violet staining solution for staining for 20 min, discard the staining solution, wash twice with PBS, and air dry.

[0083] (2) Tumor spheroidization experiment Dissolve 1.5 g of agarose in 100 mL of ddH2O, and after sterilization and slight cooling, quickly add the solution to a 96-well plate, keeping it horizontal for 30 min until the agarose solidifies; prepare MIB1 and p53. R175H Single or combined knockout of Cal-33 (p53) R175H Single-cell suspensions were prepared to induce MIB1 knockdown and p53 inhibition. R175H Knockout of single or combined transfections of SK-BR3 (p53) R175H Single-cell suspension; add the cell suspension to agarose-coated 96-well plates at a density of 100 cells per well, centrifuge, and then incubate the 96-well plates in an incubator.

[0084] The results are as follows Figure 3 As shown, knocking out MIB1 or p53 separately. R175H Both significantly inhibited cell colony formation and spheroidization ability; while at p53 R175H In the absence of p53, knockout of MIB1 did not produce a further inhibitory effect, indicating that the pro-proliferative function of MIB1 depends on p53. R175H The existence of.

[0085] Example 8: Subcutaneous tumor transplantation experiment in nude mice To assess the effect of MIB1 on tumor growth in vivo, a subcutaneous xenograft model in nude mice was constructed in this embodiment, as detailed below: (1) MIB1 knockout group, p53 R175H Knockout group, and MIB1 / p53 R175H Subcutaneous tumorigenesis of Cal-33 cells in mice with double knockout group Cal-33 cells (endogenously expressing p53) were selected. R175H Four groups were set up to construct a subcutaneous xenograft model in nude mice: control group (shNC), MIB1 knockout group, p53 group, and control group.R175H Knockout group, and MIB1 / p53 R175H Double knockout group, 5 male BALB / c nude mice (4–6 weeks old) in each group; cells stably transfected with the corresponding shRNA (1×10⁻⁶ cells) were used. 6 (One tumor sample) was suspended in Matrigel (40183ES10, Yisheng Biotechnology (Shanghai) Co., Ltd.) and injected subcutaneously into the right side of mice; the long and short diameters of the tumor were measured weekly using calipers, and the results were calculated using the formula (long × short). 2 The tumor volume was calculated as () / 2; after 5 weeks, the mice were sacrificed, the tumors were removed, weighed, and photographed.

[0086] Experimental results are as follows Figure 4 As shown, compared with the control group, MIB1 knockout or p53 R175H Knockout significantly inhibited tumor growth; however, the double knockout group and p53 significantly inhibited tumor growth. R175H There was no significant difference in the single knockout group, indicating that MIB1 mainly activates p53. R175H It exerts a tumor-promoting effect.

[0087] (2) MIB1 stably knocked down HCT116-p53 R175H HCT116-p53 WT and HCT116-p53 - / - Subcutaneous tumorigenesis in mice using three stable cell lines HCT116-p53 was selected for stable knockdown of MIB1. R175H HCT116-p53 WT and HCT116-p53 - / - Three stable cell lines were used to construct a subcutaneous xenograft model in nude mice. Five male BALB / c nude mice (4–6 weeks old) were used in each group. Cells (1×10⁻⁶) were... 6 (Number of tumors) suspended in Matrigel were injected subcutaneously into the right side of mice; the long and short diameters of the tumors were measured weekly using calipers, and the results were calculated according to the formula (length × short diameter). 2 The tumor volume was calculated as () / 2; after 5 weeks, the mice were sacrificed, the tumors were removed, weighed, and photographed.

[0088] Experimental results are as follows Figure 5 As shown, MIB1 knockdown only inhibits HCT116-p53. R175H The tumors derived from this source had no significant effect on wild-type or p53-deficient tumors, further confirming the selectivity of MIB1's action.

[0089] Example 9 Clinical Relevance Analysis To investigate MIB1 and p53 R175H Regarding the relevance in clinical samples, the inventors collected 72 cases confirmed by genetic testing to be p53. R175HMutated non-small cell lung cancer tissue samples (from the Cancer Hospital of the Chinese Academy of Medical Sciences). After extracting tissue proteins, the expression level of MIB1 was detected by Western blotting, and the expression level of p53 was detected by native-PAGE. R175H The level of oligomerization.

[0090] Protein extraction: Wash cells twice with PBS, digest with trypsin, centrifuge at 1000 rpm for 2 min, discard supernatant, wash with PBS, centrifuge at 1000 rpm for 2 min, discard supernatant, add lysis buffer containing PMSF, sonicate for 15 min, add loading buffer, and incubate in a metal bath at 100°C for 10 min.

[0091] Western Blot: An 8% gel was prepared using the Beyotime reagent kit. Samples were loaded, and electrophoresis was performed at 80V for 20 min, then at 120V to the bottom. Transfer was performed at 250mA on ice for 1 h 30 min. Blocking was done with 5% skim milk powder for 2 h. Primary antibody was incubated overnight, followed by 4 washes with TBST for 5 min each. Secondary antibody was incubated at room temperature for 1 h 30 min, followed by 4 washes with TBST for 5 min each. Protein bands were visualized using High-SIG ECL assay kit (Tanon, China).

[0092] Native-PAGE: Trypsin digestion, collect cell pellet, use lysis buffer without denaturant, sonicate for 15 min, add non-denaturing PAGE loading buffer, and do not heat. Prepare an 8% gel using a non-denaturant formulation, and perform electrophoresis at 80V on ice. After electrophoresis, wash away the electrophoresis buffer with ddH2O. Stain with Coomassie Brilliant Blue G-250 at room temperature with shaking for 1 h, and wash overnight with destaining solution at room temperature with shaking, changing the destaining solution several times during the process.

[0093] Experimental results are as follows Figure 6 As shown, Pearson correlation analysis revealed that MIB1 protein levels were correlated with p53 levels. R175H The degree of oligomerization is significantly positively correlated ( Figure 6 (A). Based on the best cutoff value of MIB1 expression level, the samples were divided into a high MIB1 expression group and a low MIB1 expression group. Kaplan-Meier survival analysis showed that at p53... R175H In patients with mutations, the overall survival of the MIB1 high-expression group was significantly shorter than that of the low-expression group. Figure 6 (Middle B). Further on, click p53. R175H Two-parameter grouping of oligomerization level and MIB1 expression level showed that p53 R175H Patients with high oligomerization and high MIB1 expression have the worst prognosis. Figure 6 (C)

[0094] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. The use of reagents for detecting MIB1 in the preparation of products for tumor prognostic assessment, wherein the tumors include those carrying p53. R175H Mutated tumor.

2. The application according to claim 1, characterized in that, The reagents for detecting MIB1 include reagents for quantitative detection of MIB1 and / or reagents for detecting MIB1 and p53. R175H Interacting reagents; Preferably, the reagent includes reagents for detecting MIB1 at the gene level and / or protein level; Preferably, the reagents include those for detecting MIB1 by enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, radioimmunoassay, immunoprecipitation assay, Western blotting, high performance liquid chromatography (HPLC), capillary gel electrophoresis, near-infrared spectroscopy, mass spectrometry, immunochemiluminescence assay, colloidal gold immunochromatography, fluorescence immunochromatography, surface plasmon resonance (SIP), PCR, immuno-PCR, microarray assay, or biotin-avidin assay. Preferably, the reagent for detecting MIB1 includes a substance specific to MIB1; Preferably, the substance specific to MIB1 includes at least one of MIB1-specific probes, gene chips, PCR primers, and antibodies; Preferably, the product for prognostic evaluation also includes testing for p53. R175H reagents; Preferably, the reagent includes a reagent for detecting p53. R175H Reagents for oligomerization.

3. MIB1 inhibitors in the preparation of p53-carrying... R175H Application in therapeutic drugs for mutated tumors, characterized by: The MIB1 inhibitor is at least one of the following: a substance that inhibits MIB1 activity, a substance that degrades MIB1, a substance that reduces MIB1 expression levels, or a substance that knocks out / down MIB1 expression.

4. The application according to claim 3, characterized in that, The MIB1 inhibitor is at least one of a1) to a4): a1) siRNA, dsRNA, miRNA, sgRNA, ribozyme, or shRNA that target MIB1; a2) Nucleic acid molecules encoding the siRNA, dsRNA, miRNA, sgRNA, ribozyme, or shRNA that targets MIB1 as described in a1); a3) An expression cassette, vector, or transgenic cell line containing the nucleic acid molecules described in a2); a4) Small molecule drugs targeting MIB1; Preferably, the MIB1 inhibitor is at least one of b1) to b6): b1) sgRNA targeting MIB1; b2) A nucleic acid molecule encoding the sgRNA targeting MIB1 described in b1); b3) Expression cassettes, vectors, or transgenic cell lines containing the nucleic acid molecules described in b2); b4) shRNA targeting MIB1; b5) A nucleic acid molecule encoding the shRNA targeting MIB1 described in b4); b6) An expression cassette, vector, or transgenic cell line containing the nucleic acid molecules described in b5); Preferably, the nucleotide sequence of the sgRNA targeting MIB1 is shown in SEQ ID NO:27 or SEQ ID NO:28; Preferably, the sense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:19, and the antisense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:20; or the sense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:21, and the antisense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:

22.

5. The application according to any one of claims 1 to 4, characterized in that, The carrying p53 R175H Mutated tumors include at least one of the following: breast cancer, bile duct cancer, squamous cell carcinoma of the tongue, colon cancer, lung cancer, stomach cancer, ovarian cancer, melanoma, hematologic malignancies, prostate cancer, endometrial cancer, and hemangiopericytoma.

6. An RNA, characterized in that, Including at least one of c1) to c2): c1) sgRNA targeting MIB1, wherein the nucleotide sequence of the sgRNA targeting MIB1 is shown in SEQ ID NO:27 or SEQ ID NO:28; c2) shRNA targeting MIB1, wherein the sense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:19 and the antisense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:20; or the sense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:21 and the antisense strand nucleotide sequence of the shRNA targeting MIB1 is shown in SEQ ID NO:

22.

7. The RNA-related biomaterial of claim 6, wherein the biomaterial comprises any one of 1) to 12): 1) A nucleic acid molecule encoding the RNA of claim 6; 2) An expression cassette containing the nucleic acid molecule described in 1); 3) A carrier containing the nucleic acid molecule described in 1); 4) A carrier containing the expression box described in 2); 5) Transgenic cell lines containing the nucleic acid molecules described in 1); 6) A transgenic cell line containing the expression cassette described in 2); 7) A transgenic cell line containing the vector described in 3); 8) A transgenic cell line containing the vector described in 4); 9) Recombinant microorganisms containing the nucleic acid molecules described in 1); 10) Recombinant microorganisms containing the expression cassette described in 2); 11) Recombinant microorganisms containing the vector described in 3); 12) Recombinant microorganisms containing the vector described in 4).

8. A drug, characterized in that, The drug comprises the RNA of claim 6 and / or the biological material of claim 7.

9. The drug according to claim 8 in the preparation of a drug carrying p53 R175H Application in drugs for treating mutated tumors.

10. The use of MIB1 as a target in screening drugs for the prevention or treatment of tumors, wherein the tumors include those carrying p53. R175H Mutated tumor.

Images