Application of maize gene Jmj1 in regulating maize photoperiod

Abstract

This invention belongs to the field of epigenetics, and specifically relates to a maize gene. Jmj1 Applications in regulating maize photoperiod. (Gene) Jmj1 The coding region sequence is shown in SEQ ID No. 1, knockout Jmj1 Arabidopsis thaliana strains with genes ( Jmj1 The bolting time of Zm-KO was significantly advanced, indicating an earlier flowering initiation process; Jmj1 Multiple knockout lines (such as Zm‑Jmj1 The tasseling time of ko*1, ko*2, and ko*10 / 11 / 12 was significantly advanced, and the development process of the male spike was significantly accelerated; enzyme activity detection proved that this gene can significantly reduce the modification level of histone H3K36me3. This invention reveals Jmj1 The key role of genes in the regulation of maize photoperiod provides crucial gene resources for breeding early-maturing maize varieties adapted to different photoperiod environments, and has significant application value and industrialization prospects in maize molecular breeding and agricultural quality improvement and yield enhancement.

Description

Technical Field

[0001] This invention belongs to the field of epigenetics, and specifically relates to the application of a gene in regulating maize growth and development. Background Technology

[0002] corn( Zea mays As an important food crop, maize is mainly used in food, feed, and industrial raw materials, playing a vital role in ensuring food security and agricultural economic development. The growth and development of maize are susceptible to both abiotic and biotic stresses, such as drought, waterlogging, high temperature, low temperature, pests, and environmental stress. These factors adversely affect maize's growth, yield, and quality. Abiotic stresses, including high temperature, cold, drought, high salinity, and nutrient deficiency, have a significant impact on agricultural yields, leading to yield reductions of more than 50% for most major crops.

[0003] Maize is a typical short-day photoperiod sensitive crop. Day length directly determines the transition from vegetative to reproductive growth and is a core environmental signal regulating flowering time, ear and female development, and grain filling efficiency. In high-latitude temperate spring-sown areas, long summer days significantly delay the flowering transition in maize, prolonging the vegetative growth period and leading to delayed bolting, delayed tasseling, and an extended flowering cycle. This results in production problems such as inability to mature properly before frost, insufficient pollination, and inadequate grain filling. Appropriate flowering time regulation can coordinate the synchronicity of ear and female development, shorten the entire growth cycle, and adapt to multi-regional introduction and early-maturing maize variety breeding. Therefore, elucidating the molecular pathways of maize photoperiod-mediated flowering time regulation is a core research direction in the field of maize genetic improvement, providing theoretical support for breeding high-yielding and high-quality maize varieties.

[0004] Epigenetic modification is a key pathway for plants to respond to external light signals and regulate the timing of growth and development. The JmjC domain is a protein domain present in many different organisms, playing an important role in regulating gene expression and chromatin modification. However, research on the maize JmjC domain gene family is limited, restricting the development and utilization value of this type of epigenetic in molecular breeding of early-maturing maize. Patent CN111235180A discloses a sequence of a gene controlling maize flowering time. Using CRISPR editing breeding methods, a specific flowering regulatory gene in maize is knocked out at a specific location, resulting in a maize mutant line with advanced flowering time, which can be used to improve maize flowering trait. The gene controlling maize flowering time used is a traditional photoperiod transcription factor gene; the function of the JmjC histone demethylase family genes in the maize photoperiod response has not been explored or verified.

[0005] Therefore, it is urgent to discover new target genes for regulating maize photoperiod and flowering period, clarify their functions in regulating the flowering period and photoperiod response mechanisms, fill existing technological gaps, and provide new genetic resources and technical support for breeding new early-maturing maize varieties. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention proposes a maize gene. Jmj1 Application in regulating maize growth and development.

[0007] The technical solution of this invention is implemented as follows: This invention has discovered a JmjC histone demethylase gene. Jmj1 (Zm00001d030108) is related to the flowering time of corn and can be controlled. Jmj1 Genes can be used to regulate the photoperiod of corn, promoting early flowering and thus saving on crop growth costs.

[0008] On the one hand, this invention provides a maize gene Jmj1 The gene's application in regulating maize photoperiod. Jmj1 The coding region sequence is shown in SEQ ID No. 1.

[0009] Preferably, the above-mentioned regulation of maize photoperiod includes shortening or extending the maize flowering period.

[0010] Preferably, the above-mentioned shortening of the maize flowering cycle is achieved by adjusting the maize gene... Jmj1 The lack of function can advance the tasseling time of corn, thereby shortening the corn flowering cycle.

[0011] Preferably, the above-mentioned extension of the maize flowering cycle is achieved by making maize genes... Jmj1 Overexpression of this function delays the tasseling time of maize, thereby extending the maize flowering cycle.

[0012] Secondly, this invention applies for protection of a method for cultivating transgenic plants with shortened flowering cycles, the steps of which include: selecting... Jmj1 Gene knockout targets, construction Jmj1 The CRISPR / Cas9 knockout vector of the gene was transferred into the plant to be improved through Agrobacterium-mediated transformation, and transgenic plants with shortened flowering cycles were obtained.

[0013] Preferably, the above Jmj1 The coding region sequence of the gene is shown in SEQ ID No. 1, and the knockout target sequence is shown in SEQ ID No. 2 and SEQ ID No. 3. The plant is maize or Arabidopsis thaliana.

[0014] Under 12-hour day / 12-hour night conditions, wild-type (WT) and Jmj1 Overexpression lines ( Jmj1 -OE1、 Jmj1 -OE2、 Jmj1The bolting process of wild-type (WT) and OE3 (OE3) was similar, with no significant differences. However, as the growth period progressed to the completion of bolting, the bolting process of wild-type (WT) and OE3 (OE3) showed significant differences. Jmj1 The bolting time of the overexpression lines remained at around 40 days, while Jmj1 Knockout strains ( Jmj1 The bolting time of the -KO group was significantly earlier, showing a clear difference in bolting progress compared to the other groups, indicating an earlier flowering start.

[0015] Zm- Jmj1 Phenotypic validation at maize tasseling time, in the Beijing area, the control material (B104) and various Zm- Jmj1 Knockout strains (Zm- Jmj1 -ko1、Zm- Jmj1 The growth processes of Zm- (e.g., -ko2) were similar, with no significant differences. However, as growth progressed to the completion of emasculation, the emasculation time of the control material (B104) remained at approximately 88 days, while some Zm- Jmj1 Knockout strains (such as Zm- Jmj1 -ko*1、Zm- Jmj1 -ko*2、Zm- Jmj1 -ko*10、Zm- Jmj1 -ko*11andZm- Jmj1 The tasseling time of the -ko*12) was significantly earlier, and the difference in tasseling progress between it and the control material was obvious, showing an earlier tasseling development process.

[0016] Thirdly, this invention also applies for protection of a method for cultivating transgenic plants with extended flowering cycles, the steps of which are: constructing... Jmj1 Gene overexpression vectors were transferred into plants via Agrobacterium-mediated transformation, resulting in transgenic plants with extended flowering cycles.

[0017] Preferably, the above Jmj1 The coding region sequence of the gene is shown in SEQ ID No. 1, and the plant is maize or Arabidopsis thaliana.

[0018] The present invention has the following beneficial effects: This invention provides a maize gene Jmj1 Applications in regulating maize photoperiod, genes Jmj1 The coding region sequence is shown in SEQ ID No. 1. This application successfully constructed the knockout vector pEGOsCas9Pubi-B-Zm00001d030108; it was then transformed into maize and Arabidopsis thaliana to obtain transgenic lines, with Arabidopsis thaliana... Jmj1 Knockout strains ( Jmj1 -KO) bolting time was significantly earlier, showing an earlier flowering initiation process; maize Zm- Jmj1 Knockout strains (such as Zm- Jmj1 -ko*1、Zm- Jmj1 -ko*2、Zm- Jmj1 -ko*10、Zm- Jmj1 -ko*11andZm- Jmj1 The tasseling time of -ko*12) was significantly earlier, showing a more advanced tassel development process. Zm- Jmj1 Subcellular localization indicated that the location was within the cell nucleus. mCherry and GFP served as fluorescent signals, and under laser confocal microscopy, the red and green fluorescent signals were observed to completely overlap. Zm- Jmj1 Demethylase activity assays showed that with the addition of the full-length His:Zm-JMJ1 fusion protein, the modification level of histone H3K36me3 gradually and significantly decreased compared to histone H3. This invention confirms that the provided... Jmj1 Histone demethylase genes are involved in regulating maize photoperiod, providing a scientific basis for the development of novel biotechnology products that are expected to play an important role in agricultural production. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The enzyme digestion pattern of the vector pEGOsCas9Pubi-B-Zm00001d030108.

[0021] Figure 2 The plasmid map of the knockout vector pEGOsCas9Pubi-B-Zm00001d030108.

[0022] Figure 3 Zm- Jmj1 Subcellular localization map, scale bar 10 μm.

[0023] Figure 4 Validation of short-day phenotype in Arabidopsis thaliana; Figure A is... Jmj1 In the short-day phenotype validation of Arabidopsis thaliana, B was determined to be wild-type (WT). Jmj1 Overexpression lines ( Jmj1 -OE1、 Jmj1 -OE2、 Jmj1 -OE3), knockout strains ( Jmj1 The bolting process of -KO.

[0024] Figure 5Phenotypic validation of maize tasseling time; Figure A shows Zm- Jmj1 Phenotypic verification at maize tasseling time showed that B was Zm- Jmj1 The emasculation process of knockout strains.

[0025] Figure 6 Zm- Jmj1 Demethylase activity assay. Detailed Implementation

[0026] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0027] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0028] Prokaryotic expression vector: pET-30a(+), containing a His tag for protein expression and purification.

[0029] Transgenic plant expression vector: pCAMBIA3301 was used to obtain transgenic Arabidopsis thaliana overexpression plants;

[0030] PYBA series vectors: pYBA1152 and pYBA1138 are used for subcellular localization experiments.

[0031] Example 1: Planting and stress treatment of plant materials

[0032] (1) Soil cultivation of corn seeds

[0033] Uniform and plump maize inbred line B73 seeds were selected as experimental material. The maize seeds were soaked in a 5% NaClO solution for 30 min. They were then rinsed three times with 75% alcohol for 5 min each time. Next, they were rinsed five times with sterile ddH2O. The washed seeds were then soaked in saturated CaSO4 for 5 h. They were placed in small pots containing a 1:1 mixture of potting soil and vermiculite and incubated in the dark for 2-3 days, then transferred to a light incubator (16 h light, 8 h dark) at 28℃. Two weeks after seedling emergence, uniformly grown seedlings at the three-leaf stage were selected for subsequent experimental procedures.

[0034] (2) Soil culture and drought stress treatment of Arabidopsis thaliana

[0035] Arabidopsis seeds were soaked in 75% ethanol for 1 min, followed by washing with 6% NaClO for 10 min, and finally washing with sterile ddH2O 4-5 times. The washed Arabidopsis seeds were then soaked in 1 mL of sterile ddH2O overnight at 4°C in the dark. The treated Arabidopsis seeds were germinated on 1% MS medium. A mixture of peat moss and vermiculite (1:1) was placed in small pots and weighed, with each pot weighing approximately 65 g. Five-day-old Arabidopsis seedlings were transplanted into these pots, with five seedlings planted per pot. After watering, the pots were covered with plastic wrap to prevent moisture evaporation and then transferred to a culture room for further growth. Each treatment included three replicates, with five Arabidopsis plants planted in each replicate. The overexpressing Arabidopsis lines were cultured until bolting (approximately 14 days), then thoroughly watered before stopping watering and initiating drought stress treatment. The control group received consistent daily watering. After 12 days of drought stress treatment, the growth status and recovery ability of Arabidopsis thaliana plants were observed.

[0036] (3) Soil culture and photoperiod treatment of Arabidopsis thaliana

[0037] The initial disinfection treatment of Arabidopsis seeds was the same as above. After disinfection, the Arabidopsis seeds were placed on 1% / 3% MS medium and cultured for 5 days in a medium-day (12 h light, 12 h dark) incubator at 20℃. A mixture of peat moss and vermiculite (1:1) was placed in small pots and weighed, with each pot weighing approximately 65 g. Five Arabidopsis seedlings, grown under long-day and short-day conditions respectively for 5 days, were transplanted into each pot. After watering, the pots were covered with plastic wrap and transferred to the corresponding light incubators for further cultivation. The flowering status of the Arabidopsis was observed.

[0038] (4) Sprouting and planting of tobacco

[0039] Fill the bottom of small, perforated pots with a 1:1 mixture of substrate and vermiculite, and place the pots on a tray. Water the tray until the substrate is saturated. Sow tobacco seeds evenly in the pots, then cover the pots with plastic wrap. Cultivate the seeds at 24°C with a 16-hour light and 8-hour darkness period. Once the tobacco has germinated (approximately 15 days), carefully transplant the seedlings using tweezers, maintaining the same substrate and environmental conditions, transplanting one seedling per pot. When the tobacco has grown to 4-5 leaves, remove the top leaf and select the third leaf for further experiments.

[0040] Example 2: Plant nucleic acid extraction, reverse transcription and genomic DNA extraction

[0041] 1. RNA extraction and validation using the Trizol method

[0042] Preparation: Place the mortar and pestle in an oven and heat to 180°C for 6 hours (skip this step if using a grinder). Pre-cool the isopropanol and ethanol to 4°C overnight.

[0043] (1) Take an appropriate amount of corn seedling leaves, put them into a 2.0 mL RNase-free centrifuge tube, freeze them quickly, and then grind them into powder using a grinder, or grind them in a mortar and transfer them into a 2.0 mL centrifuge tube.

[0044] (2) Add 1 mL Trizol, shake well to mix thoroughly, and place in an ice bath for 10 min.

[0045] (3) Centrifuge at 4℃ and 12000 g for 10 min.

[0046] (4) Transfer the supernatant to a new 1.5 mL RNase-free centrifuge tube, add 200 μL of chloroform, and shake thoroughly.

[0047] (5) Centrifuge at 4℃ and 12000 g for 10 min.

[0048] (6) Take 500-600 μL of supernatant and transfer it to a new 1.5 mL RNase-free centrifuge tube. Add an equal volume of pre-cooled isopropanol, mix by inverting the tube, and let it stand on ice for 10 min.

[0049] (7) Centrifuge at 4℃ and 12000 g for 15 min.

[0050] (8) Discard the supernatant and add 1 mL of 75% ethanol to wash the precipitate.

[0051] (9) Centrifuge at 4℃ and 10000 g for 5 min.

[0052] (10) Discard the supernatant, dry the precipitate, and dissolve it in 25 μL of RNase-free ddH2O.

[0053] (11) Perform DNA digestion (40 μL reaction system): 25 μL dissolving solution, 4 μL 10×DNaseI buffer, 1 μL LDNaseI, 10 μL RNase-free ddH2O, digest at 37 ℃ for 30 min.

[0054] (12) Add 20 μL of 3M sodium acetate, mix gently, and then add RNase-free ddH2O to a total volume of 200 μL.

[0055] (13) Add 200 μL of water-saturated phenol:chloroform (24:1) and shake.

[0056] (14) Centrifuge at 4℃ and 13000 g for 5 min, and transfer the supernatant to a new centrifuge tube.

[0057] (15) Add 200 μL of chloroform and extract again.

[0058] (16) Centrifuge at 4℃ and 13000 g for 5 min, and transfer the supernatant to a new centrifuge tube.

[0059] (17) Add pre-cooled isopropanol and incubate on ice for 20 min.

[0060] (18) Centrifuge at 4℃ and 13000 g for 15 min and discard the supernatant.

[0061] (19) Wash the precipitate with 1 mL of 75% ethanol.

[0062] (20) After centrifuging at 10000 g for 5 min, discard the supernatant and the precipitate is the total RNA.

[0063] 2. Reverse transcription of cDNA

[0064] Reverse transcription was performed using the Takara reverse transcription kit. The extracted maize RNA was transferred to 200 μL EP tubes and the culture medium was prepared according to the table below. Program: 37℃, 15 min; 85℃, 5 s. The resulting cDNA was stored at -20℃ for later use.

[0065] Table 1 Reverse transcription system

[0066]

[0067] 3. Extraction of maize / Arabidopsis thaliana genomic DNA using the CTAB method

[0068] Place an appropriate amount of Arabidopsis thaliana leaves into a 2 mL centrifuge tube and rapidly freeze in liquid nitrogen. Grind the sample into powder using a grinder. Preheat CTAB to 65°C and add 50 mL of CTAB and 1.5 mL of β-mercaptoethanol. Place the Arabidopsis thaliana leaves into a 1.5 mL centrifuge tube, rapidly freeze the sample in liquid nitrogen, grind it into powder, and add 650 μL of CTAB. Then, place the sample in a 65°C water bath for 60 min, inverting the centrifuge tube 5 times every 10 min during this process to ensure complete reaction. Add an equal volume (approximately 650 μL) of chloroform-isoamyl alcohol to the centrifuge tube, gently shake for 15 min, and then centrifuge (4°C, 12000 r, 10 min). Transfer the supernatant to a new 1.5 mL centrifuge tube, add 800 μL of anhydrous ethanol, freeze at -20°C for 5 min, and then centrifuge (4°C, 12000 r, 10 min). Discard the supernatant, wash twice with 70% anhydrous ethanol for 7 minutes each time. Discard the supernatant, air dry overnight, dissolve the DNA in DEPC H2O, and store in a 4°C refrigerator.

[0069] Example 3: Vector construction, target gene amplification, and DNA purification and recovery

[0070] 1. Primer design

[0071] The primers used in this application were designed using Primer 5.0 software and synthesized by Qingke Biotechnology Co., Ltd.

[0072] 2. Amplification of the target gene fragment

[0073] The steps for amplifying the target gene fragment using 2×PhantaMax Master Mix (Dye Plus) high-fidelity polymerase from Novizan Biosciences Inc. are as follows:

[0074] a. Prepare cDNA or other vectors containing the target gene as amplification template.

[0075] b. Add the designed primers to the amplification reaction system.

[0076] c. Add deionized water (ddH2O) to the specified volume to complete the reaction.

[0077] d. Add the mixture to the PCR tube and place it in the PCR instrument for amplification reaction (Table 2).

[0078] Table 2 PCR amplification system

[0079]

[0080] PCR amplification procedure for the target gene (Table 3):

[0081] Table 3 PCR amplification program

[0082]

[0083] 3. Gel recovery of PCR products / enzyme digestion products

[0084] The steps for recovering PCR products using the gel recovery kit (catalog number: DC301) are as follows:

[0085] (1) Quickly cut the agarose gel containing the target DNA fragment under UV light, remove as much excess gel as possible, and calculate based on 100 mg of gel being equivalent to 100 μL volume.

[0086] (2) Add an equal volume of Buffer GDP and incubate in a water bath at 50℃-55℃ for 7-10 min to ensure that the gel block is completely dissolved.

[0087] (3) After dissolving, transfer the solution to the adsorption column and centrifuge at 12000 r for 0.5-1 min.

[0088] (4) Discard the filtrate, put the adsorption column into the collection tube, add 300 µL of Buffer GDP to the adsorption column, let stand for 1 min, and then centrifuge at 12000 r for 0.5-1 min.

[0089] (5) Discard the filtrate, place the adsorption column into the collection tube, add 700 µL of Buffer GW containing anhydrous ethanol to the adsorption column, and centrifuge at 12000 r for 0.5-1 min.

[0090] (6) Repeat the above steps.

[0091] (7) Discard the filtrate, put the adsorption column back into the collection tube, and centrifuge at 12000 r for 2 min.

[0092] (8) Place the adsorption column into a labeled 1.5 mL sterile centrifuge tube, add 20-30 µL ddH2O to the center of the adsorption column, let stand for 2 min, and centrifuge at 12000 rpm for 1 min.

[0093] (9) Repeat the above steps.

[0094] (10) Discard the adsorption column and store the DNA at -20°C.

[0095] 4. Connecting carrier

[0096] The ligation of the target vector included two methods: enzyme digestion and gene fusion. T4 DNA ligase was used, specifically the NEB product (catalog number: M0202). The enzyme digestion and ligation reaction mixture (5 μL) is shown in Table 4 below:

[0097] Table 4 Enzyme digestion and ligation reaction system

[0098]

[0099] The fusion reaction system does not require enzyme digestion of the PCR product; only vector linearization is needed. The recombinase used in the fusion reaction is Exnase II (catalog number: C112) from Novizan Biosciences. The reaction system (5 μL) is as follows (Table 5):

[0100] Table 5 Enzyme digestion and ligation reaction system

[0101]

[0102] 5. Construction of CRISPR / Cas9 knockout vector pEGOsCas9Pubi-B-Zm00001d030108

[0103] (1) Target sequence of the target gene:

[0104] Target 1: GCTCTAGTGTCTCCCAGCT (PAM AGG) (SEQ ID No. 2)

[0105] Target 2: GCAGGATGTCAGCTCGTATA (PAM AGG) (SEQ ID No. 3)

[0106] (2) Amplification of sgRNA expression cassette

[0107] 1) The primers for amplifying the sgRNA expression cassette are as follows:

[0108] Cas-9-gRT1:CTCTAGTTGTCTCCCAGCTgttttagagctagaaat (SEQ ID No. 4)

[0109] Cas-9-OsU6a:AGCTGGGAGACAACTAGAGCggcagccaagccagca (SEQ ID No.5)

[0110] Cas-9-gRT2:CAGGATGTCAGCTCGTATAgttttagagctagaaat (SEQ ID No. 6)

[0111] Cas-9-OsU6b:TATACGAGCTGACATCCTGCaacacaagcggcagc (SEQ ID No.7)

[0112] UF:CTCCGTTTTACCTGTGGAATCG (SEQ ID No.8)

[0113] gRNA-R:CGGAGGAAAATTCCATCCAC (SEQ ID No.9)

[0114] Pps-R:TTCAGAggtctcT accg ATGGAATCGGCAGCAAAGG (SEQ ID No. 10)

[0115] Pgs-2:AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC (SEQ ID No. 11)

[0116] Pps-2:TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG (SEQ ID No. 12)

[0117] Pgs-L:AGCGTGggtctcG ctcg ATCCATCCACTCCAAGCTC (SEQ ID No. 13)

[0118] Detection primers

[0119] SP-L:GCGGTGTCATCTATGTTACTAG (SEQ ID No.14)

[0120] SP-R:TGCAATAACTTCGTATAGGC (SEQ ID No.15)

[0121] 2) Overlap PCR and nested PCR amplification of sgRNA expression cassettes

[0122] The first round of PCR amplification of the U6 promoter and gRNA, and the amplification system and reaction parameters are shown in Table 6-7.

[0123] Table 6 PCR Amplification System

[0124]

[0125] Table 7 PCR reaction parameters

[0126]

[0127] Second round of PCR amplification of the sgRNA expression cassette;

[0128] The sgRNA expression cassette amplification system is shown in Table 8, and the reaction parameters are shown in Table 9.

[0129] Table 8 PCR amplification system

[0130]

[0131] Table 9 PCR reaction parameters

[0132]

[0133] Cut off the 500-600 bp electrophoretic fragment and recover the target fragment using a gel recovery kit.

[0134] 3) Enzyme digestion-ligation reaction, reaction system and reaction parameters are shown in Table 10-11.

[0135] Table 10 Enzyme digestion-ligation reaction system

[0136]

[0137] Table 11 Enzyme digestion-ligation reaction parameters

[0138]

[0139] 4) Transformation of recombinant plasmids

[0140] Take 100 μL of DH5α competent E. coli cells and mix with 2-5 μL of ligation product, incubate on ice for 30 min; quickly place in a 42℃ constant temperature water bath, heat shock for 90 s, then incubate on ice for 2 min; add 500 μL of LB liquid medium and mix well; incubate at 37℃ and 200 rpm for 45 min to allow the cells to recover to normal growth state; spread the bacterial solution evenly on Kana-resistant LB solid medium plates; after 30 min, incubate overnight at 37℃.

[0141] 5) Microbial testing

[0142] Colony PCR was performed using primers SP-L and SP-R, with band sizes approximately 1248 bp. Positive colonies were picked and cultured. The colony PCR amplification system and reaction parameters are shown in Tables 12-13.

[0143] Table 12 Colony PCR Amplification System

[0144]

[0145] Table 13 Colony PCR Reaction Parameters

[0146]

[0147] 6) Plasmid extraction

[0148] ① Pick a single colony from an LB solid medium plate and inoculate it into LB liquid medium with a final concentration of 50 μg / mL for kanamycin resistance, and incubate overnight at 37°C; ② Take 4 mL of activated bacterial solution, centrifuge at 10,000 rpm for 2 min at room temperature, and discard the supernatant completely; ③ Take 250 μL of Solution I reagent containing ribonuclease A to completely resuspend the bacterial block; ④ Take 250 μL of Solution II reagent to lyse the bacterial block, gently inverting it several times until the bacterial cells are transparent; ⑤ Take 350 μL of Solution III reagent, inverting it several times until a white, firm flocculent substance is formed; ⑥ Centrifuge at 12,000 rpm for 10 min at room temperature, and collect the supernatant; ⑦ Take the nucleic acid purification column from the kit and place it on a collection tube; ⑧ Take the clear supernatant from step 6 above into the nucleic acid purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and discard the filtrate; ⑨ Take 500 μL of Buffer W1 into the nucleic acid purification column, centrifuge at 12,000 rpm for 30 min at room temperature. s, discard the filtrate; ⑩ Add 700 μL of Buffer W2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate; Repeat the above steps ⑩; Place the nucleic acid purification column on the collection tube and incubate at 12,000 rpm for 2 min at room temperature to remove as much residual liquid as possible. Discard the collection tube, place the nucleic acid purification column into a 1.5 mL EP tube, and add 50 μL of elution buffer to elute the DNA attached to the nucleic acid purification column membrane (the elution buffer can be preheated in a 65℃ constant temperature water bath to help elute the DNA), and let stand at room temperature for 2 min; Centrifuge at 12,000 rpm for 2 min at room temperature to elute the DNA adhering to the nucleic acid purification column membrane, and store at -40℃ for later use. A trace amount of the recovered product was taken, and the plasmid extraction quality was detected by agarose gel electrophoresis at a concentration of 1%.

[0149] The plasmid extracted from the above positive plaques was subjected to Sanger sequencing using SP-L / SP-R primers. The sequencing result sequence matched the target fragment sequence, indicating that the knockout vector was successfully constructed. Figure 1 The plasmid map of the knockout vector pEGOsCas9Pubi-B-Zm00001d030108 is shown below. Figure 2 As shown.

[0150] Example 4: Plasmid DNA Extraction and Transformation of Competent Cells

[0151] 1. Plasmid DNA extraction

[0152] The steps for plasmid extraction using the Fast Pure Plasmid Mini Kit (catalog number: DC201) from Nanjing Novizan Biotechnology Co., Ltd. are as follows:

[0153] (1) Add RNase A to Buffer P1 and store at 4°C.

[0154] (2) Label the Buffer PW2 dilution and store it at room temperature.

[0155] (3) Collect the bacterial cells from 5 mL-10 mL of overnight culture by centrifugation at 10000 r for 5 min, remove the culture medium and remove the residual liquid.

[0156] (4) Add 250 μL Buffer P1 to the bacterial cells, mix well and transfer to a 2 mL centrifuge tube.

[0157] (5) Add 250 μL Buffer P2 and gently invert 10 times to fully lyse the cells.

[0158] (6) Add 350 μL Buffer P3, gently invert 10 times to neutralize Buffer P2, centrifuge to produce white flocculent precipitate, centrifuge at 12000 r for 10 min.

[0159] (7) Place the adsorption column into the collection tube, add the supernatant, centrifuge at 12000 r for 30 s, and remove the waste liquid.

[0160] (8) Add 500 μL Buffer PW1, centrifuge for 30 s, and discard the waste liquid.

[0161] (9) Add 600 μL Buffer PW2, centrifuge for 30 s, and discard the waste liquid.

[0162] (10) Repeat the previous step.

[0163] (11) Place the adsorption column into the collection tube and centrifuge for 2 min to remove the residual liquid. If necessary, let it stand at room temperature for 2 min to allow the alcohol to evaporate.

[0164] (12) Place the adsorption column into a new 1.5 mL centrifuge tube, add Elution Buffer or ddH2O (usually 30 μL-50 μL) to the center of the adsorption column membrane, let stand at room temperature for 2 min, and centrifuge at 12000 r for 30 s to elute plasmid DNA.

[0165] (13) Discard the adsorption column, label it, and store the plasmid DNA at -20℃.

[0166] 2. Transformation of competent cells: Steps for DH5α / Rosetta(DE3) / TOP10 competent cell transformation:

[0167] (1) After melting competent cells on ice, add 1 μg of plasmid DNA and mix gently.

[0168] (2) Let it stand on ice for 30 minutes.

[0169] (3) Thermal shock at 42℃ for 60 s.

[0170] (4) Let it stand on ice for 2 minutes.

[0171] (5) Add 500 μL of sterile antibiotic-free LB liquid culture medium and revive at 37℃ and 200 r for 60 min.

[0172] (6) Take an appropriate amount of bacterial solution and spread it on LB solid medium containing the corresponding resistance. Incubate at 37°C upside down for 12-16 hours. Transformant colonies will grow.

[0173] 3. Transformation steps of EHA105 / GV3101 Agrobacterium competent cells (transform the constructed CRISPR knockout recombinant plasmid and overexpression vector into EHA105 Agrobacterium competent cells for subsequent maize and Arabidopsis genetic transformation):

[0174] (1) After melting competent cells on ice, add 1 μg of plasmid DNA and mix gently.

[0175] (2) Let it stand on ice for 5 minutes.

[0176] (3) Place the centrifuge tube in liquid nitrogen for rapid freezing for 5 min, then immediately place it in a 37°C warm water bath for 5 min, and then let it stand on ice for 5 min again.

[0177] (4) Add 800 μL of sterile antibiotic-free YEB liquid culture medium and revive at 28℃ and 200 rpm for 2-3 h.

[0178] (5) Collect the bacterial cells by centrifugation at 5000 r for 1 min, remove the excess YEB medium to about 100 μL, resuspend the bacterial cells and spread them on YEB solid medium containing the corresponding resistance, and incubate upside down at 28°C for about 72 h. The transformant colonies will gradually grow.

[0179] Transformation of E. coli competent cells

[0180] The transformation procedure for competent E. coli cells was performed according to the instructions provided by Biomed Biotechnology Co., Ltd., and the competent E. coli cells were stored at -80°C.

[0181] To confirm whether the target gene has been successfully ligated into the vector, experimental methods such as colony PCR verification, plasmid enzyme digestion verification, and plasmid sequencing are usually performed.

[0182] Example 5: Extraction and Western Blot of Total Protein from Arabidopsis thaliana

[0183] 1. Extraction of total protein from Arabidopsis thaliana

[0184] Take an appropriate amount of Arabidopsis thaliana leaves, rapidly freeze them in liquid nitrogen, and thoroughly grind the sample until it becomes powder. Place approximately 0.5 mL of the sample into a 2 mL centrifuge tube, add 0.5 mL of protein extraction buffer, and incubate on ice for 30 min. Centrifuge at 14000 g for 15 min at 4°C. Collect the supernatant and centrifuge again at 14000 g for 15 min at 4°C. The supernatant obtained in this step is the extracted total protein.

[0185] The protein extraction solution formula is as follows:

[0186] Non-denatured protein extract: 50 mM Tris-MES (pH=8.0), 0.5 M sucrose, 1 mM MgCl2, 10 mM EDTA (pH=8.0), 5 mM DTT, and Protease Inhibitor Cocktail Complete Minitablets (purchased from Roche, added before use).

[0187] 2. Western Blot

[0188] (1) Extraction of total protein from leaves: As described above, the obtained protein was stored in a -80 ℃ refrigerator.

[0189] (2) Sample preparation: Add an appropriate amount of 6×protein loading buffer to the protein and incubate in a 100 ℃ water bath for 5 min to denature the protein.

[0190] (3) Protein loading: Centrifuge at 12000 r for 2 min, take the supernatant for SDS-PAGE detection, and aspirate 10 μL-50 μL of sample into the loading well. Set the voltage to 120 V and the electrophoresis time to about 80-90 min.

[0191] (4) Coomassie brilliant blue staining: Place the gel in a clean small plastic box, add an appropriate amount of staining solution, and stain on a horizontal shaking incubator at 80 r for 1 h. Then decolorize with decolorizing solution until the bands are clear (skip this step if staining is not required).

[0192] (5) Electrophoresis: Take an appropriate size PVDF membrane and place it in methanol for 15 s. Place the gel in the electrophoresis solution and assemble the equipment according to the sandwich transfer method. During the process, pay attention to avoid air bubbles. Set the instrument to constant voltage of 100 V and transfer time of 1.5 h-4 h. Surround the electrophoresis tank with ice.

[0193] (6) Blocking: Take out the PVDF membrane and transfer it to PBST containing 5% skim milk powder. Shake horizontally for 2 hours to block.

[0194] (7) Primary antibody incubation: The primary antibody was added to a PBST solution containing 3% skim milk powder at a ratio of 1:1000. The PVDF membrane was placed in the solution and incubated at 4°C for 12 h. The membrane was then washed three times at room temperature with PBST solution for 10 min each time.

[0195] (8) Secondary antibody incubation: The secondary antibody was added to a PBST solution containing 3% skim milk powder at a ratio of 1:10000. The PVDF membrane was placed in the solution and shaken horizontally on a shaker for 1 h. After the incubation, the secondary antibody was recovered (it can be reused 3 times) and washed in the same way.

[0196] (9) Development: Mix reagents A and B in the developing reagent in a 1:1 ratio, drop the mixture evenly onto the PVDF membrane, and then develop it in a fully automated chemiluminescence analyzer.

[0197] Example 6: Injection and Subcellular Localization of Benzodiazepines

[0198] Agrobacterium preparation:

[0199] (1) Pick a single clone from the YEB plate into 5 mL of YEB liquid medium containing the corresponding antibiotic and incubate at 28°C and 200 r for about 24 h;

[0200] (2) Transfer the bacterial culture to 10 mL of YEB liquid medium containing acetylcholine, 10 mM MES (pH=5.6) and 40 mM AS (acetylsylcholine) at a ratio of 1:100, and incubate at 28℃ and 200 r for 18 h.

[0201] (3) When the optical density (OD) of the bacterial solution 600 When the concentration reaches 1.0, centrifuge at 4000 r for 10 min at room temperature to collect the bacterial cells.

[0202] (4) Resuspend the bacterial cells in 10 mM MgCl2 and adjust the OD. 600 Around 1.0-1.5.

[0203] (5) Mix the Agrobacterium strain containing the target gene with the P19 strain in an appropriate ratio and adjust the strain concentration to about 0.3-0.5.

[0204] (6) After mixing the bacterial solution, add AS (100 mM) at a ratio of 2 μL / mL of bacterial solution.

[0205] (7) Let the bacterial solution stand in the dark for 2-3 hours.

[0206] Agrobacterium injection into Fumiganthus benthamiana:

[0207] (1) Before injecting Agrobacterium, transfer the prepared tobacco seedlings to a low light condition for one day and add sufficient water.

[0208] (2) Agrobacterium injection uses a 1 mL syringe. When injecting, remove the needle, draw up the bacterial solution and inject from the back of the leaf. Depending on the experimental requirements, you can choose to inject part of the leaf or inject the whole leaf.

[0209] (3) After injection, place the fumes under light and incubate for 48 h.

[0210] (4) Select laser confocal microscope (ZEISS) to detect fluorescence.

[0211] Figure 3 Zm- Jmj1 Subcellular localization, by Figure 3 It was determined that the location was the cell nucleus, with mCherry and GFP serving as fluorescent signals. Under a laser confocal microscope, the red and green fluorescent signals were observed to completely overlap.

[0212] Example 7: Prokaryotic protein expression and purification

[0213] 1. Expression and small-scale detection of prokaryotic proteins

[0214] (1) The constructed prokaryotic expression vector was transformed into the Escherichia coli protein expression strain Rosetta, spread on LB solid selection plates containing the corresponding antibiotics, and cultured at 37°C for 12 h.

[0215] (2) Select single clones (usually 3), inoculate them into LB liquid medium containing the corresponding antibiotics, and culture at 37°C for 12 h.

[0216] (3) Take a sterile 10 mL EP test tube, add 3 mL of LB liquid culture medium containing the corresponding antibiotic and 100 μL of bacterial solution. Two test tubes are required for each single clone. The tubes are labeled to distinguish whether an inducing agent has been added.

[0217] (4) Shake the bacteria at 37℃ and 220 r, and measure the OD value during the process.

[0218] (5) When OD 600 When the concentration is approximately 0.6, add 0.5 M IPTG to the labeled test tube until the final concentration is 0.5 mM.

[0219] (6) Continue induction at 37℃ and 220 r to find the optimal induction time (generally about 3 h).

[0220] (7) Then, centrifuge at 4℃ and 4000 r for 15 min to collect the bacterial cells.

[0221] (8) Take 1 mL of the bacterial solution from the test tube into a 1.5 mL centrifuge tube, centrifuge at 12000 r for 5 min, and retain the strain without the inducer.

[0222] (9) Resuspend the bacterial pellet in 2-3 mL of pre-cooled buffer (for 6×His fusion protein, use Lysisbuffer A: 50 mM NaH2PO4 and 300 mM NaCl, adjust pH to 8.0 with HCl, and add 1 mM PMSF for pretreatment).

[0223] (10) Discard the supernatant, add 20 μL of deionized water and 5 μL of 6× protein loading buffer, mix well, and then perform SDS-PAGE and Coomassie Brilliant Blue staining to observe protein expression.

[0224] 2. Purification of prokaryotic proteins

[0225] (1) Add the strain without inducer to 10 mL of LB liquid medium containing the corresponding antibiotic and culture at 37°C with shaking for 12 h.

[0226] (2) Prepare 1 L LB liquid culture medium and sterilize it, then store it at 4℃ for later use.

[0227] (3) Add the corresponding antibiotic to the LB liquid culture medium and add 8 mL of the cultured bacterial solution. Shake and culture at 37℃ and 220 r, and measure the OD value during the process.

[0228] (4) OD 600 When the value is approximately 0.6, add 1 mL of IPTG and 730 μL of chloramphenicol (25 mg / mL) to each 1 L of bacterial culture and allow for an appropriate induction time (i.e., the optimal induction time mentioned above).

[0229] (5) Centrifuge the bacterial culture at 4000 r for 15 min to collect the bacterial cells, and resuspend each protein that needs to be purified using 30 mL of lysis buffer.

[0230] (6) Use an ultrasonic disruptor to disrupt the resuspended cells at a frequency of 10 s / 30 s intervals until the bacterial solution becomes clear.

[0231] (7) Transfer the lysate to a new 50 mL centrifuge tube and centrifuge at 12000 r and 4 °C for about 1 h.

[0232] (8) After centrifugation, immediately transfer the supernatant to a new 50 mL centrifuge tube (take 50 μL of supernatant as input and pick a small amount of precipitate as inclusion body).

[0233] (9) Pipette 800 μL of Ni-NTA resin into a 10 mL gravity column, add 15 mL of washing buffer and pass through the column to equilibrate the Ni-NTA resin.

[0234] (10) Pour the supernatant into the gravity column and combine it with Ni-NTA resin, and invert the column for about 2 hours.

[0235] (11) Pass the washing buffer through the column 3 times, 50 mL each time, to wash away non-specific binding proteins.

[0236] (12) Add elution buffer, let stand for about 5 minutes and collect the elution solution to obtain the purified protein. Add an appropriate amount of elution buffer according to the experimental requirements.

[0237] (13) Take out 20 μL of protein and perform SDS-PAGE and Coomassie Brilliant Blue staining together with Input, Inclusion body and FT to observe protein expression.

[0238] The buffer solution formulation is as follows:

[0239] Ultrasonic buffer (40 mL): 400 μL Tris-HCl (pH=8.0, 1 M), 80 μL EDTA (pH=8.0, 0.5 M), 0.35064 g NaCl, 400 μL PMSF (0.1 M), 40 μL DTT (1 M), dissolve a cocktail tablet in 1 mL DMSO, add 500 μL, and bring the total volume to 40 mL with deionized water.

[0240] His-wash buffer (200 mL): 2 mL Tris-HCl (pH=8.0, 1 M), 400 μL EDTA (pH=8.0, 0.5 M), 1.7532 g NaCl, 4 mL imidazole (1 M), and bring the volume to 200 mL with deionized water.

[0241] His-elution buffer (50 mL) is prepared fresh: Tris-HCl (pH=8.0, 1 M) 0.5 mL, EDTA (pH=8.0, 0.5 M) 100 μL, NaCl (0.4383 g), imidazole (1 M) 12.5 mL, and deionized water is added to bring the total volume to 50 mL.

[0242] Imidazole (1 M): Weigh 3.404 g imidazole and add deionized water to a final volume of 50 mL.

[0243] Example 8: Obtaining transgenic positive Arabidopsis thaliana

[0244] The pEGOsCas9Pubi-B-Zm00001d030108 knockout vector and overexpression vector constructed in this application were transformed into Arabidopsis wild-type Col-0, respectively, to create... Jmj1 The steps for knockout and overexpression lines are as follows: (1) Select healthy Arabidopsis thaliana WT plants that have bolted and flowered from 1% MS medium, remove the pods and flower buds, and ensure that the plants have sufficient water.

[0245] (2) Activated Agrobacterium was transferred from bacterial cultures that tested positive for both the Bar gene and the target gene at a ratio of 1:100 into YEB medium containing rifampicin and kanamycin. The culture was incubated with shaking at 28°C and 200 rpm until the optical density (OD) reached its maximum. 600 It is approximately 1.5.

[0246] (3) After shaking stops, centrifuge the bacterial cells at 4℃ and 5000 r for 15 min and collect the bacterial cells.

[0247] (4) Adjust the OD value of the bacterial suspension to about 0.8-1.0 using an appropriate amount of 1 / 2 MS medium and 5% sucrose permeate, and then add 0.02% of the adsorbent SilwetL-77 to the suspension for transfection.

[0248] (5) Pour the Agrobacterium tumefaciens solution into a petri dish and immerse the Arabidopsis thaliana flower buds in the solution for about 1 minute.

[0249] (6) After treating Arabidopsis thaliana in the dark at 16°C for 24 h, it was then transferred to normal growth conditions.

[0250] (7) After about a week, repeat the above conversion process. You can repeat it 2-3 times to ensure effective conversion.

[0251] (8) The wild-type Arabidopsis thaliana of the Col-0 generation was successfully transformed by the flower dipping method, and the seeds of the T0 generation plants were harvested.

[0252] (9) T0 generation seeds were sown on MS agar medium containing herbicide (PPT) resistance, and the surviving plants were transplanted into soil mixed with vermiculite and nutrient soil.

[0253] (10) Extract genomic DNA from Arabidopsis thaliana leaves and perform PCR detection of the herbicide bar gene and the target gene.

[0254] (11) Select T1 generation transgenic plants that are positive by PCR and collect their seeds.

[0255] (12) The T1 generation transgenic plants harvested from single plants were sown again on MS medium containing PPT (7.5 mg / L) resistance for screening and isolation until homozygous lines of transgenic Arabidopsis were obtained (up to T2 or T3 generation), after which no further screening was performed.

[0256] Figure 4 for Jmj1 In the validation of the short-day phenotype in Arabidopsis thaliana, under 12 h day / 12 h night conditions, the wild type (WT) and... Jmj1 Overexpression lines ( Jmj1 -OE1、 Jmj1 -OE2、 Jmj1 The bolting process of wild-type (WT) and OE3 (OE3) was similar, with no significant differences. However, as the growth period progressed to the completion of bolting, the bolting process of wild-type (WT) and OE3 (OE3) showed significant differences. Jmj1 The bolting time of the overexpression lines remained at around 40 days, while Jmj1 Knockout strains ( Jmj1 The bolting time of the -KO group was significantly earlier, showing a clear difference in bolting progress compared to the other groups, indicating an earlier flowering start.

[0257] Figure 5 Zm- Jmj1 Phenotypic validation at maize tasseling time, in the Beijing area, the control material (B104) and various Zm- Jmj1 Knockout strains (Zm- Jmj1 -ko1、Zm- Jmj1 The growth processes of Zm- (e.g., -ko2) were similar, with no significant differences. However, as growth progressed to the completion of emasculation, the emasculation time of the control material (B104) remained at approximately 88 days, while some Zm- Jmj1 Knockout strains (such as Zm- Jmj1 -ko*1、Zm- Jmj1 -ko*2、Zm- Jmj1 -ko*10、Zm- Jmj1 -ko*11andZm- Jmj1 The tasseling time of the -ko*12) was significantly earlier, and the difference in tasseling progress between it and the control material was obvious, showing an earlier tasseling development process.

[0258] Example 9: In vitro verification of demethylase activity

[0259] The full-length protein of the JmjC domain gene family was obtained by prokaryotic expression and protein purification. Using calf thymic histone as a substrate, ferrous sulfate, ascorbic acid and α-ketoglutarate were added as cofactors. Then, the in vitro purified full-length or truncated JmjC domain protein was added and reacted at 37°C for 4-6 h.

[0260] Western blot analysis was performed using different histone modification antibodies (H3K4me3, H3K9me3, H3K27me3, and H3K36me3) to observe changes in histone terminal methylation modifications.

[0261] Figure 6 Zm- Jmj1Demethylase activity assays showed that with the addition of the full-length His:Zm-JMJ1 fusion protein (2-6 μg), the modification level of histone H3K36me3 gradually decreased significantly compared to histone H3, while the signal intensities of H3K4me3, H3K9me3, and H3K27me3 showed no significant changes. These results indicate that ZmJMJ1 can specifically remove the trimethylation modification of H3K36 in vitro, while showing no significant demethylation activity at other detected methylation sites.

[0262] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Maize genes Jmj1 Its application in regulating the photoperiod of maize is characterized by: The gene Jmj1 The coding region sequence is shown in SEQ ID No.

1.

2. The application according to claim 1, characterized in that: The regulation of maize photoperiod includes shortening or lengthening the maize flowering period.

3. The application according to claim 2, characterized in that: The shortening of the corn flowering cycle is achieved by modifying corn genes. Jmj1 The lack of function can advance the tasseling time of corn, thereby shortening the corn flowering cycle.

4. The application according to claim 2, characterized in that: The extension of the corn flowering cycle is achieved by modifying corn genes. Jmj1 Overexpression of this function delays the tasseling time of maize, thereby extending the maize flowering cycle.

5. A method for cultivating transgenic plants with shortened flowering cycles, characterized in that, The steps are as follows: Select Jmj1 Gene knockout targets, construction Jmj1 The CRISPR / Cas9 knockout vector of the gene was transferred into the plant to be improved through Agrobacterium-mediated transformation, and transgenic plants with shortened flowering cycles were obtained.

6. The method according to claim 5, characterized in that: The Jmj1 The coding region sequence of the gene is shown in SEQ ID No. 1, and the knockout target sequence is shown in SEQ ID No. 2 and SEQ ID No.

3.

7. The method according to claim 6, characterized in that: The plant is either maize or Arabidopsis thaliana.

8. A method for cultivating transgenic plants with extended flowering cycles, characterized in that, The steps are: build Jmj1 Gene overexpression vectors were transferred into plants to be improved via Agrobacterium-mediated transformation, resulting in transgenic plants with extended flowering cycles.

9. The method according to claim 8, characterized in that: The Jmj1 The coding region sequence of the gene is shown in SEQ ID No.

1.

10. The method according to claim 9, characterized in that: The plant is either maize or Arabidopsis thaliana.

Images