A method for improving the haploid induction rate of rice

Abstract

The present application aims to disclose a method for improving haploid induction rate of rice, by simultaneously knocking out genes in rice OsMATL and OsPLDα2 or simultaneously reducing expression of genes OsMATL and OsPLDα2 to obtain rice plants with haploid induction ability. Simultaneous knockout or silencing of the two genes can improve the haploid induction rate of rice.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and specifically to a method for creating rice haploid inducible lines. More specifically, it involves inhibiting, silencing, or knocking out certain genes in the rice genome through methods including, but not limited to, simultaneous mutagenesis, RNAi interference, or gene editing. OsMATL and OsPLDα2 Two genes were used to increase the haploid induction rate in rice. Background Technology

[0002] Rice is my country's most important food crop, ranking first in both sown area and total output among all food crops in the country. It is the staple food for more than half of the Chinese population. It not only ensures national food security but also supports the livelihoods of hundreds of millions of farmers and the development of the rice industry chain. However, conventional rice breeding requires 6 to 8 generations of continuous self-pollination to obtain materials with relatively stable traits. The breeding cycle is long and inefficient, which seriously affects the progress of breeding.

[0003] Double haploid (DH) breeding technology can obtain genetically homozygous rice lines within one generation, shortening the traditional breeding cycle of 6-10 generations to 1-2 generations and significantly improving breeding efficiency. However, the frequency of haploid occurrence under natural conditions is only 0.1%, far from meeting the needs of breeding. In double haploid breeding, haploids are mainly generated through two pathways: in vivo induction and in vitro induction. In vivo induction relies on specific genetic materials or gene editing techniques to trigger parthenogenesis or chromosome exclusion mechanisms during hybridization, such as using maize. ZmDMP, ZmPLA1 Using a gene mutation-induced line as the male parent, hybridization with the female parent results in the elimination of the male parent's chromosomes during early embryonic development, leaving only the female parent's single set of chromosomes, thus directly producing haploid seeds. This method has been successfully applied in various crops such as rice, wheat, and tomato. In vitro induction mainly involves the in vitro culture of anthers or pollen, utilizing the totipotency of plant cells to induce microspores to develop into haploid plants, or inducing parthenogenesis of egg cells through the culture of unfertilized ovaries and ovules. Although this method is not limited by genotype, it suffers from technical complexity and low efficiency.

[0004] The development of haploid induction lines represents a revolutionary advancement in breeding technology, from accidental discovery to precise regulation. In 1922, Blakeslee first discovered natural haploids in datura, initiating related research, but the natural occurrence rate was extremely low, hindering practical application. In 1959, Coe discovered the maize mutant Stock6, which, when used as a male parent and crossed with ordinary maize, could induce 1–2% maternal haploid seeds, marking the formal birth of in vivo haploid induction technology and providing a feasible path for the artificial creation of haploids. In 2017, MTL / ZmPLA1 / NLDThe cloning of key inducible genes was a landmark breakthrough, revealing the molecular mechanism by which pollen-specific phospholipase mutations lead to paternal chromosome exclusion, solving a genetic puzzle that had plagued the breeding community for 60 years. In 2019, ZmDMP The gene was cloned, and the membrane protein it encoded could enhance the paternal chromosome's exclusion ability, and... MTL Synergistic effects can significantly improve induction efficiency. In 2021, ZmPLD3 The gene has been identified as the third maternal haploid induction gene, further refining the molecular basis of the induction system. In recent years, the research team has used gene editing technology to expand the haploid induction system from maize to various crops such as rice, wheat, and tomato, achieving cross-species application. Today, haploid induction lines have become one of the core technologies of modern bio-breeding, significantly shortening the breeding cycle and promoting the transformation of breeding from traditional experience-based models to precision scientific models. However, the haploid induction rate of these genes is far from meeting the current needs of rice breeding.

[0005] In 2018, Wang Kejian's team used CRISPR-Cas9 gene editing technology to simultaneously knock out the MiMe system in the hybrid rice 'Chunyou 84'. REC8, PAIR1, OSD1 ) and haploid-induced genes OsMATL This breakthrough marked the first successful apomixis reproduction in hybrid rice, yielding stably heritable cloned seeds and representing a crucial step "from 0 to 1." This achievement endows hybrid rice with the ability to self-replicate superior genotypes, theoretically allowing farmers to save their own seeds and significantly reduce seed production costs. Although the initial system suffered from low seed setting rates, it laid the foundation for subsequent optimizations of the Fix series of technologies and was hailed by Academician Yuan Longping as a "major breakthrough in the field of apomixis research." The main challenge of this method remains how to induce the formation of embryos and endosperm from egg cells; therefore, it is still far from commercial application.

[0006] Obtaining haploids through apomixis requires gene editing, a cumbersome and complex process. Self-pollination produces not only diploids but also a significant number of tetraploids, resulting in low efficiency. Anther culture also suffers from limitations such as material background dependence and high time and labor costs. Therefore, current research focuses on discovering new haploid induction genes in rice and constructing high-induction-rate rice haploid induction lines. Summary of the Invention

[0007] To overcome the aforementioned technical problems in the prior art, this invention provides the application of rice OsMATL and OsPLDα2 genes in the cultivation of rice haploid inducible lines.

[0008] The technical solution of this patent is as follows: Rice haploid-induced genes OsMATL and OsPLDα2 or genesOsMATL and OsPLDα2 Encoded proteins, or genes OsMATL and OsPLDα2 Knockout vectors or amplified genes OsMATL and OsPLDα2 The application of primers in genetic engineering for regulating the induction rate of haploids in rice.

[0009] Furthermore, simultaneously knocking out genes in rice OsMATL and OsPLDα2 or simultaneously reduce the gene content in rice OsMATL and OsPLDα2 The expression level of the encoded protein, or the introduction of a knockout gene into rice. OsMATL and OsPLDα2 The knockout vector can improve the efficiency of haploid induction in rice.

[0010] Furthermore, the gene OsMATL and OsPLDα2 The DNA molecule described in either 1) or 2) below: 1) OsMATL The genome sequence of the DNA molecule is shown in SEQ ID NO.1; OsPLDα2 The genome sequence of the DNA molecule is shown in SEQ ID NO.2; 2) OsMATL The CDS sequence of the DNA molecule is shown in SEQ ID NO.3; OsPLDα2 The CDS sequence of the DNA molecule is shown in SEQ ID NO.4.

[0011] Furthermore, the gene OsMATL The amino acid sequence of the encoded protein is shown in SEQ ID NO. 5; the gene OsPLDα2 The amino acid sequence of the encoded protein is shown in SEQ ID NO.6.

[0012] Furthermore, the gene OsMATL The knockout vector is a CRISPR-Cas9 vector targeting the target shown in SEQ ID NO.11; The gene OsPLDα2 The knockout vector is a CRISPR-Cas9 vector targeting the targets shown in SEQ ID NO.14 and / or SEQ ID NO.21 and / or SEQ ID NO.22. Beneficial effects

[0013] This invention utilizes CRISPR / Cas9 gene editing technology to edit endogenous rice cells. OsMATL and OsPLDα2Genes were used to create rice haploid induction lines with high induction rates, which can then be used for the rapid breeding of new rice varieties. Attached Figure Description

[0014] Figure 1 for OsMATL Gene mutants osmatl-cr1 and osmatl-cr2 middle OsMATL Mutation sites in genes.

[0015] Figure 2 for OsPLDα2 Gene mutants ospldα2-cr1 and ospldα2-cr2 middle OsPLDα2 Mutation sites in genes.

[0016] Figure 3 for OsMATL and OsPLDα2 Double mutant osmatl ospldα2 middle OsPLDα2 Mutation sites in genes.

[0017] Figure 4 for OsMATL Gene mutants osmatl-cr1 Phenotypes of haploid individuals in the offspring (A) and spike (B).

[0018] Figure 5 for OsMATL Gene mutants osmatl-cr1 Flow cytometry results of haploid individuals in offspring.

[0019] Figure 6 for OsMATL and OsPLDα2 Double mutant osmatl ospldα2 Phenotypes of haploid individuals in the offspring (A) and spike (B).

[0020] Figure 7 for OsMATL and OsPLDα2 Double mutant osmatl ospldα2 Flow cytometry results of haploid individuals in offspring. Detailed Implementation

[0021] The present invention will be further explained below with reference to the embodiments, but the embodiments do not limit the present invention in any way.

[0022] The materials and reagents used in the following examples are all commercially available, and the experimental methods used are all conventional methods unless otherwise specified.

[0023] The rice variety used in the following examples is the conventional variety Zhonghua 11.

[0024] Example 1: Rice OsMATL and OsPLDα2 Cloning of gene coding region (CDS) sequences Design the following primers: Primer 1: 5'-ATGGCGCGAGCTACTC-3' (SEQ ID NO.7); Primer 2: 5'-CTAACGCTTGCACGCCAC-3' (SEQ ID NO. 8).

[0025] Primer 3: 5'-ATGGCGAAGATCCTGCTCC -3' (SEQ ID NO.9); Primer 4: 5'-TTAAGTGGTCAAAATTGGCGG-3' (SEQ ID NO. 10).

[0026] Using the anther cDNA of the common rice variety Zhonghua 11 as a template, PCR amplification was performed using a primer pair consisting of primer 1 and primer 2 to obtain the target gene. OsMATL The CDS fragment of the target gene OsPLDα2 was obtained; PCR amplification was performed using primers consisting of primers 3 and 4 to obtain the CDS fragment. The PCR reaction system (50 μl) consisted of: 1 μl template cDNA (50 ng / μl), 2 μl primer F (10 μM), 2 μl primer R (10 μM), 1 μl dNTP Mix (10 mM), 25 μl 2×Phanta Max Buffer, 1 μl Phanta Max Super-Fidelity DNA Polymerase, and 18 μl ddH2O. The PCR amplification reaction was performed in a Bio-rad T100 PCR instrument with the following program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 59℃ (OsMATL) or 56℃ (OsPLDα2) annealing for 15 s, 72℃ extension for 1 min, for 35 cycles; 72℃ extension for 5 min; and storage at 4℃.

[0027] The PCR products were recovered and purified using a DNA purification kit (Nanjing Novizan Biotechnology Co., Ltd.), ligated into the expression vector pEASY-Blunt (Beijing TransGen Biotech Co., Ltd.), transformed into E. coli DH5α competent cells (Beijing Tiangen Biotech Co., Ltd.), and positive clones were selected and sent to Genscript Biotech Co., Ltd. for sequencing.

[0028] Sequencing results showed that the PCR amplification obtained OsMATLand OsPLDα2 The gene CDS fragment has the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4, which encode two proteins consisting of 432 and 824 amino acid residues, respectively (SEQ ID NO.5 and SEQ ID NO.6).

[0029] Example 2, Rice OsMATL, OsPLDα2 Construction and molecular identification of transgenic plants with single-gene mutants rice OsMATL, OsPLDα2 The construction sequence of the double-gene mutant transgenic plant is as follows: first construct... osmatl T0 generation seeds were obtained from transgenic plants with single-gene mutants, and molecular identification was performed after planting to the T2 generation. osmatlL Homozygous monogenic rice seeds, then homozygous... osmatl Single-strand rice callus was used as the recipient material for transformation via Agrobacterium-mediated transformation. OsPLDα2 The CRISPR / Cas9 editing vector was used to obtain a dual-gene mutant. PCR amplification of the target sites and sequencing verification confirmed that both genes underwent the expected base insertion or deletion, and no off-target effects were detected in the homozygous mutant.

[0030] one, OsMATL Construction of gene knockout vector according to OsMATL The genome sequence (SEQ ID NO.1) was used to design CRISPR-Cas9 gRNA targets using the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the targets were selected to target the Cas9 genome. OsMATL The target sequence for constructing the gene editing vector is: AACCGCTTCTACCTCGACAACGG (SEQ ID NO.11).

[0031] Based on the target sequence, Primer 5 and Primer 6 were synthesized; Primer 5 and Primer 6 were annealed at 95°C for 3 min in a PCR instrument, and then slowly cooled to 20°C at 0.2°C / s to obtain double-stranded DNA molecules.

[0032] Primer 5: 5'-TGTGTGAACCGCTTCTACCTCGACAA-3' (SEQ ID NO.12) Primer 6: 5'-AAACTTGTCGAGGTAGAAGCGGTCA -3' (SEQ ID NO. 13); Using the "CRISPR / Cas Vector Construction Kit (Catalog No.: BGK032)" from Baige Gene Technology (Jiangsu) Co., Ltd., double-stranded DNA molecules were constructed into the BGK032 vector according to the instructions.

[0033] The ligation product was transformed into E. coli DH5α, positive clones were identified by colony PCR, plasmids were extracted, and sequencing was performed.

[0034] Sequencing results showed that a recombinant vector containing the sequence shown in SEQ ID NO.11 was obtained and named BGK032-OsMATL.

[0035] two, OsPLDα2 Construction of gene knockout vector according to OsPLDα2 The genome sequence (SEQ ID NO. 6) was used to design CRISPR-Cas9 gRNA targets using the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the targets were selected to target the Cas9 genome. OsPLDα2 The target sequence for constructing the gene editing vector is: GTCCGCAGCGGCAAGTACCCCGG (SEQ ID NO.14).

[0036] Based on the target sequence, Primer 7 and Primer 8 were synthesized; Primer 7 and Primer 8 were annealed at 95°C for 3 min in a PCR instrument, and then slowly cooled to 20°C at 0.2°C / s to obtain double-stranded DNA molecules.

[0037] Primer 7: 5'-TGTGGTGGTCCGCAGCGGCAAGTACCC-3' (SEQ ID NO.15) Primer 8: 5'-AAACGGGTACTTGCCGCTGCGGACCA-3' (SEQ ID NO. 16); Using the "CRISPR / Cas Vector Construction Kit (Catalog No.: BGK032)" from Baige Gene Technology (Jiangsu) Co., Ltd., double-stranded DNA molecules were constructed into the BGK032 vector according to the instructions.

[0038] The ligation product was transformed into E. coli DH5α, positive clones were identified by colony PCR, plasmids were extracted, and sequencing was performed.

[0039] Sequencing results showed that a recombinant vector containing the sequence shown in SEQ ID NO.14 was obtained and named BGK032-OsPLDα2.

[0040] III. Obtaining Recombinant Agrobacterium Take 5 μl of BGK032-OsMATL and BGK032-OsPLDα2 plasmids obtained in the previous two steps, mix them with 100 μl of Agrobacterium GV3101 competent cells, and incubate on ice for 10 min; transform Agrobacterium by electroporation to obtain recombinant strains. The recombinant strains that are correctly identified by colony PCR are named EH-BGK032-OsMATL and EH-BGK032-OsPLDα2.

[0041] IV. Obtaining Transgenic Rice Plants The two recombinant Agrobacterium strains EH-BGK032-OsMATL and EH-BGK032-OsPLDα2 obtained in the previous step were subjected to genetic transformation of rice callus tissue, and the specific methods were as follows: (1) Select plump and mature seeds of the rice variety Zhonghua 11, remove the husks and put them into a 50 mL centrifuge tube. Pour 40 mL of 70% ethanol into the tube, invert it several times, and pour out the waste liquid. Then add 2.5% NaClO into the tube, shake it several times, and pour out the waste liquid. Finally, add sterile water to the tube and wash it several times, and pour out the waste liquid. Use a sterile spoon to scoop out the washed seeds, spread them evenly on a large petri dish with sterile filter paper, drain them, and dispense them into N6D medium. Incubate them in a light incubator for about 15 days.

[0042] (2) The newly grown primary callus was peeled onto a new N6D medium and cultured in a light incubator for about 15 days.

[0043] (3) Use an inoculation loop to gently pick up the single colonies of EH-BGK032-OsMATL and EH-BGK032-OsPLDα2 identified in the previous step, add them to 20 mL of culture medium containing the corresponding antibiotics, and incubate at 30℃ for 12 h.

[0044] (4) Take 400 μL of the cultured bacterial solution and add it to a new 20 mL culture medium. Incubate the bacterial solution until the OD reaches 0.6-0.8. Collect the bacterial solution, centrifuge at 6000 g, 4℃ for 8 min, pour out the waste liquid, add 40 mL of AAM (containing 40 μL of 1000×AS), shake left and right to resuspend the bacterial solution, and measure the OD to 0.05-0.1.

[0045] (5) Place the second-generation callus into a sterile centrifuge tube, add 30 mL of AAM infection solution, gently shake for 120 s, pour out the infection solution, scoop out the callus, place it on a culture dish lined with sterile filter paper to drain, about 60 min; use sterile forceps to pick up the filter paper and gently place it on 2N6-AS medium, then take 1 mL of AAM (containing 30 μL 1000×AS) and add it evenly; aliquot the drained callus into 2N6-AS medium, cover with sealing film, protect from light, and incubate at 30℃ for 48 h.

[0046] (6) Place the callus tissue into a 50 mL sterile centrifuge tube, add sterile water, and wash several times until the waste liquid is no longer turbid; then wash several times with sterile water containing carbenicillin, pour out the waste liquid, scoop out the callus tissue with a sterile spoon, and blow dry; use sterile forceps to pick up the drained callus and place it in N6D-S medium and culture under light for about 15 days.

[0047] (7) Transfer the callus tissue to NK medium and continue culturing for about 30 days (replace the medium every half month during this period) until small green dots grow on the callus. (8) The callus tissue is then transferred to MS-HF medium and cultured under light for 30 days. After that, the cap of the tissue culture bottle can be removed to harden the seedlings. (9) Cultivate sufficiently large transgenic plants in tap water first, and then transplant them into soil for further cultivation.

[0048] V. Rice OsMATL Molecular identification of transgenic plants with gene mutants The result obtained in the previous step OsMATL Leaves of T0 generation transgenic plants were sampled, and genomic DNA was extracted as a template. PCR amplification was performed on the editing target site shown in SEQ ID NO.11 and the DNA fragments flanking it using a primer pair consisting of Primer 9 and Primer 10.

[0049] Primer 9: 5'-TCCCTCCATCCACAAACCCT-3' (SEQ ID NO. 17); Primer 10: 5'-CCTCGTCTCGCCCAGCATCTT-3' (SEQ ID NO. 18).

[0050] Take 5 μl of PCR product for agarose gel electrophoresis detection, and send the PCR product with the correct DNA band size to Genscript Biotech Co., Ltd. for sequencing.

[0051] Sequencing results showed that two [unclear] were identified. OsMATLThe transgenic rice plants with specific gene mutations were named as follows: osmatl-cr1 and osmatl-cr2 Of these two individual plants OsMATL DNA sequences of gene editing targets, such as Figure 1 As shown.

[0052] exist osmatl-cr1 In a single plant, OsMATL One nucleotide (A) was inserted at the first exon of the gene; exist osmatl-cr2 In a single plant, OsMATL A nucleotide (A) is missing at the first exon of the gene; In these two mutant monocultures, OsMATL Mutations in the CDS sequence of a gene all lead to frameshift mutations in the protein it encodes.

[0053] VI. Rice OsPLDα2 Molecular identification of transgenic plants with gene mutants The result obtained in the previous step OsPLDα2 Leaves of T0 generation transgenic plants were sampled, and genomic DNA was extracted as a template. The DNA fragments flanking the editing target site shown in SEQ ID NO.14 were amplified by PCR using a primer pair consisting of Primer 11 and Primer 12.

[0054] Primer 11: 5'- CGGTGGGCGTGGGCAAGGGG -3' (SEQ ID NO. 19); Primer 12: 5'-CGTCGAGCGGGATCCGGGGG-3' (SEQ ID NO. 20).

[0055] Take 5 μl of PCR product for agarose gel electrophoresis detection, and send the PCR product with the correct DNA band size to Genscript Biotech Co., Ltd. for sequencing.

[0056] Sequencing results showed that two [unclear] were identified. OsPLDα2 The transgenic rice plants with specific gene mutations were named as follows: ospldα2-cr1 and ospldα2-cr2 Of these two individual plants OsPLDα2 DNA sequences of gene editing targets, such as Figure 2 As shown.

[0057] exist ospldα2-cr1 In a single plant, OsPLDα2 A nucleotide (A) is missing at the second exon of the gene; exist ospldα2-cr2 In a single plant, OsPLDα2A nucleotide (A) was inserted at the second exon of the gene; In these two mutant monocultures, OsPLDα2 Mutations in the CDS sequence of a gene all lead to frameshift mutations in the protein it encodes.

[0058] Example 3, Rice OsMATL and OsPLDα2 Construction and molecular identification of transgenic plants with double gene mutants one, OsMATL and OsPLDα2 Construction of transgenic plants with double gene mutants Will OsPLDα2 The genome sequence (SEQ ID NO. 1) and CDS sequence (SEQ ID NO. 3) were provided to Wuhan Boyuan Biotechnology Co., Ltd., which designed the target. The specific method is as follows: [The text abruptly ends here, likely due to an incomplete sentence or missing information.] OsPLDα2 The genome sequence (SEQ ID NO. 11) was input into the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), which designed CRISPR-Cas9 sgRNA targets. One or more of target 1 and target 2 were selected for gene editing vector construction.

[0059] The sequence of target 1 is: GGAGCTTGGCCTGCTAGGGTTGG (SEQ ID NO.21). The sequence of target 2 is: GACACGGTGGGCGTGGGCAAGGG (SEQ ID NO.22). The two sgRNA units were synthesized into the intermediate vector PUC57 via whole-genome synthesis. Then, Primer 13 and Primer 14 were synthesized, and PCR amplification was performed using the PUC57 plasmid containing the two sgRNAs as a template to obtain double-stranded DNA molecules with sticky ends.

[0060] Primer 13: 5'-accggtaaggcgcgccgtagt-3' (SEQ ID NO. 23); Primer 14: 5'-gcgattaagttgggtaacgccaggg-3' (SEQ ID NO.24) Double-stranded DNA molecules were ligated into a BsaI-cleaved pHK1-Cas9-U3 linearized vector (containing in the "Monocot Gene Editing Vector Kit (Hyg)" product from Wuhan Boyuan Biotechnology Co., Ltd.) using T4 DNA ligase. The ligation product was transformed into *E. coli* DH5α, and positive clones were identified by colony PCR. Plasmids were extracted and sequenced. Sequencing results showed that recombinant vectors containing SEQ ID NO. 21 and SEQ ID NO. 22 were obtained. Then, the vector constructed in step five of Example 2 was transformed using Agrobacterium-mediated genetic transformation. osmatl-cr1 The callus tissue of homozygous mutant material was transformed to obtain T0 generation transgenic plants.

[0061] two, OsMATL and OsPLDα2 Molecular identification of double-gene mutant plants Take the result obtained in step one OsMATL and OsPLDα2 Genomic DNA was extracted from leaves of the T0 generation mutant plants. Using the genomic DNA as a template, PCR amplification was performed on the editing target site shown in SEQ ID NO.21 and the DNA fragments flanking it using primer pair consisting of Primer 15 and Primer 16. PCR amplification was performed on the editing target site shown in SEQ ID NO.22 and the DNA fragments flanking it using primer pair consisting of Primer 17 and Primer 18.

[0062] Primer 15: 5'-TCAATCGGTGGCGTTCGC-3' (SEQ ID NO. 25); Primer 16: 5'-CTGCATGGGAGATCTAAGTAAG-3' (SEQ ID NO. 26).

[0063] Primer 17: 5'-CTGTAGGAGTACTGATGAAGCT-3' (SEQ ID NO. 27; Primer 18: 5'-GTAGACGTGGAAGGACTCG-3' (SEQ ID NO. 28).

[0064] PCR products were detected by 1% agarose gel electrophoresis and then sent to Genscript Biotech Co., Ltd. for sequencing. Based on the sequencing results, one [product name missing] was identified. OsPLDα2 The mutated individual plant is named: osmatl ospldα2. exist osmatl ospldα In mutants, OsPLDα2The gene underwent mutations at both target sites: a nucleotide mutation from A to G at target site 1 in exon 1, resulting in the amino acid at position 22 of the encoded protein changing from asparagine to serine; and a 35-nucleotide deletion at target site 2 in exon 2, leading to a frameshift and premature termination of protein translation. Figure 3 ).

[0065] Example 4 OsMATL and OsPLDα2 Ploid detection and induction rate determination of offspring from double-gene mutants T3 generation respectively osmatl-cr1, osmatl-cr2, ospldα2-cr1 and ospldα2-cr2 Single mutant seeds and T2 generation osmatl ospldα2 Double mutant seeds were sown in the field, and plant phenotypes were observed. Plants exhibiting characteristics such as short stature, compact plant type, small ears, and low seed setting rate were likely haploid plants. Figure 4 , Figure 6 Plants initially identified as potentially haploid based on phenotypic observation were selected for flow cytometry analysis. The method was as follows: Nuclei were extracted from young leaves of the plants to be tested; the signal was detected using a flow cytometer. The peak value of the nuclear signal of wild-type Zhonghua 11 was set to 100. If the nuclear signal peak of the tested plant appeared near 50, the plant was considered haploid; if the signal peak appeared near 100, the plant was considered diploid. The haploid induction rate was calculated using the formula: Haploid induction rate (%) = (Number of haploid plants in the maternal parent / Total number of plants) × 100.

[0066] The results showed that, based on phenotypic identification and flow cytometry analysis, no haploid plants were detected in 200 plants of Zhonghua 11 (Table 1); and in 1592 plants... osmatl-cr1 One haploid plant was detected in the plant population, with a haploid induction rate of 0.06% (Table 1). Figure 4 , Figure 5 ); in 72 plants osmatl ospldα2 One haploid plant was detected among the double mutant plants, with a haploid induction rate of 1.39% (Table 1). Figure 6 , Figure 7 ); while in 1080 plants osmatl-cr2 1408 plants ospldα2-cr1 Plants and 1448 plants ospldα2-cr2 No haploid plants were detected in any of the plants (Table 1). These results indicate that only mutations... OsMATL and OsPLDα2 Among these, a single gene cannot induce or is almost unable to induce haploid formation (the induction rate is mostly 0%, with only one haploid plant appearing, a proportion of only 0.06%). However, simultaneous mutations in rice... OsMATL and OsPLDα2 Two genes can significantly increase the induction rate of rice haploids.

[0067] Table 1 osmatl ospldα2 Haploid induction efficiency of mutants Zhonghua No. 11 Zhonghua No. 11 200 0 0 1592 1 0.06 1080 0 0 1408 0 0 1448 0 0 72 1 1.39 The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

[0068] SEQ ID NO: 1 rice OsMATL Full genome nucleotide sequence SEQ ID NO:2 rice OsPLDα2 Whole genome nucleotide sequence SEQ ID NO:3 rice OsMATL Gene CDS sequence SEQ ID NO: 4 rice OsPLDα2 Gene CDS sequence SEQ ID NO: 5 Oryza sativa OsMATL Gene amino acid sequence MAASYSCRRTCEACSTRAMAGCVVGEPASAPGQRVTLLAIDGGGIRGLIPGTILAFLEARLQELDGPDARLADYFDCIAGTSTGGLITAMLAAPGDHGRPLFAASDINRFYLDNGPLIFPQKRCGMAAAMAALTRPRYNGKYLQGKIRKMLGETRVRDTLTNVVIPTFDVRLLQPTIFSTYDAKSMPLKNALLSDICISTSAAPTYLPAHCFQTTDDATGKVREFDLIDGGVAANNPTMVAMTQITKKIMVKDKEELYPVKPSDCGKFLVLSVGTGSTSDQGMYTARQCSRWGIVRWLRNKGMAPIIDIFMAASSDLVDIHAAVMFQSLHSDGDYLRIQDNTLHGDAATVDAATRDNMRALVGIGERMLAQRVSRVNVETGRYVEVPGAGSNADALRGFARQLSEERRARLGRRNACGGGGEGEPSGVACKR* SEQ ID NO: 6 Oryza sativa OsPLDα2 Gene amino acid sequence MAKILLHGTMHVTIFEAESLSNPSRPSSQAPQFLRKLVEGIEDTVGVGKGTSKVYATIGLDKARVGRTRTLADDTAAPRWYESFHVYCAHLATHVAFTLKAKNPIGASLLGVGYLPVRDVLAGDEVDRWLPLCDDTDARTPIGDGGGKVHVKLQYFDISKDRSWGRGVRSGKYPGVPYTFFSQRQGCKVTLYQDAHVPDGFIPRIPLDGGRSYEPHRCWEDIFDAINGARHFIYITGWSVYTEIALIRDADRPKPGGGVTLGELLKKKAGEGVRVLMLVWDDRTSVGMLKKDGLMATHDEETMNYFQGTEVNCVLCPRNPDDSGSIVQDLQISTMFTHHQKIVVVDHDMPSSRHGGGNGGGRRRVVSFVGGLDLCDGRYDTPFHSLFRTLGTAHHDDFHQPNFATATVAKGGPREPWHDIHCRLEGPVAWDVLYNFEQRWRKQGGKDLLVQLRDLAETVIPPSPAMFPEDAESWNVQLFRSIDGGAAFGFPDTPEDAARAGLVSGKDQIIDRSIQDAYIAAIRRARSFIYIENQYFLGSSYCWKPNDGVKPEDVGALHLIPKELSMKVVSKIEAGERFTVYVVVPMWPEGIPESGSVQAILDWQRRTMEMMYTDIAHAIQAKGIDADPKDYLTFFCLGNREAKSAGEYEPPEQAEPDTGYFHAQQNRRFMIYVHTKMMIVDDEYIIVGSANINQRSMDGARDSEIAMGAYQPHHLAAAGRPARGQVHGFRMALWYEHLGTVDEAFQRPESLDCVRKVNAMADRCWDLYAGDGPERDLPGHLLTYPVGVAGDGTITQLPGVEFFPDTQARILGAKSDYLPPILTT*

Claims

1. Rice haploid-induced genes OsMATL and OsPLDα2 or genes OsMATL and OsPLDα2 Encoded proteins, or genes OsMATL and OsPLDα2 Knockout vectors or amplified genes OsMATL and OsPLDα2 The application of primers in genetic engineering for regulating the induction rate of haploids in rice.

2. The application according to claim 1, characterized in that, At the same time, knock out genes in rice. OsMATL and OsPLDα2 or simultaneously reduce the gene content in rice OsMATL and OsPLDα2 The expression level of the encoded protein, or the introduction of a knockout gene into rice. OsMATL and OsPLDα2 The knockout vector can improve the efficiency of haploid induction in rice.

3. The application according to claim 1, characterized in that, The gene OsMATL and OsPLDα2 The DNA molecule described in either 1) or 2) below: 1) OsMATL The genome sequence of the DNA molecule is shown in SEQ ID NO.1; OsPLDα2 The genome sequence of the DNA molecule is shown in SEQ ID NO.2; 2) OsMATL The CDS sequence of the DNA molecule is shown in SEQ ID NO.3; OsPLDα2 The CDS sequence of the DNA molecule is shown in SEQ ID NO.

4.

4. The application according to claim 1, characterized in that, The gene OsMATL The amino acid sequence of the encoded protein is shown in SEQ ID NO. 5; the gene OsPLDα2 The amino acid sequence of the encoded protein is shown in SEQ ID NO.

6.

5. The application according to claim 1, characterized in that, The gene OsMATL The knockout vector is a CRISPR-Cas9 vector targeting the target shown in SEQ ID NO. 11; the gene OsPLDα2 The knockout vector is a CRISPR-Cas9 vector targeting the targets shown in SEQ ID NO.14 and / or SEQ ID NO.21 and / or SEQ ID NO.22.

Images