Nucleic acid constructs comprising apomixis genes of eriochloa villosa and related methods

Abstract

The present invention relates to nucleic acid constructs comprising the coding sequence of the apomictic trait of Eragrostis curvula ( Eragrostis curvula ) and the use of these constructs for the transformation of non-apomictic plants.

Description

Technical Field

[0001] This invention relates to grass containing curved-leaf thrush ( Eragrostis curvula Nucleic acid constructs encoding the apomixis trait, and the use of these constructs for transforming non-apomixis plants. Background Technology

[0002] Unlike the genetically diverse offspring produced by sexual reproduction in flowering plants, apomixis, an asexual reproductive process, produces seeds containing maternal clones (Nogler, 1984). Apomixis are widespread in angiosperms (Ozias-Akins and van Dijk, 2007), and their emergence is thought to require an imbalance of both the genetic and epigenetic components of female reproduction in sexual ancestors (Grimanelli, 2012).

[0003] Apomixis are common in polyploid grasses, but poorly represented in economically valuable crop species. If apomixis could be introduced into crop plants, its impact on agriculture could be enormous, as it promises to allow heterosis to be maintained across multiple generations.

[0004] Carballo et al., 2021, disclosed a method for identifying apomixis-related genes in *Euphorbia tirucalli* by analyzing differential methylation status in specific regions of the genome and RNA levels identified by RNA-seq. Specifically, the following genes were mentioned: BPM1, BPM2, IDM1, ROS1, ROS4, FARS, and miR-156. Furthermore, Supplementary Table S6 summarizes the different genes contained in the identified regions, indicating methylation status (methylation-demethylation) and RNA-seq status (upregulation-downregulation). Among these, in rice (… Oryza sativa ) and Arabidopsis thaliana ( Arabidopsis thaliana Several homologous genes were identified in the study.

[0005] On the other hand, patent applications WO 2007 / 066214 A2, CN 103849635 A and CN 112779283 A disclose different constructs derived from apomixis genes.

[0006] Patent application WO 2007 / 066214 A2 discloses the use of the DYAD gene and its products to confer apomixis characteristics on plants, and to produce triploid plants that maintain heterosis over multiple generations. Furthermore, the application discloses and illustrates the generation of expression cassettes for producing unreduced female gametophytes and apomixis seeds. The application exemplifies the use of incorporation from *Lepidium holboroughi* (… Boechera holboellii The DYAD gene of ) was used with Agrobacterium tumefaciens ( Arabidopsis thaliana It serves as a conversion agent for Arabidopsis thaliana.

[0007] Patent application CN 103849635 A discloses an expression vector and a method for introducing the Pingy sweettea MhSERK4 gene into apple plants. Specifically, it illustrates the transformation of tobacco plants with the vector (vector pBI121-MhSERK4) containing the MhSERK4 gene in the open reading frame of the expression vector pBI121. Examples include methods for obtaining the gene by reverse transcription of RNA extracted from the plant and amplification of the MhSERK4 transcript. This application also illustrates the introduction of the vector into Agrobacterium (…). Agrobacterium EHA105.

[0008] Patent application CN 112779283 A relates to a nucleic acid construct comprising three expression cassettes (E1, E2, E3). Specifically, expression cassette E2 contains a gene for embryonic autonomous development, and cassette E3 contains a gene necessary for inducing mitosis rather than meiosis (MiMe). Nucleic acid applications (including the preparation of apomixis lines) are disclosed. A method for growing transgenic plants is also included, comprising introducing recombinant nucleic acids or vectors into plants to obtain transgenic plants. This document discloses an apomixis method that allows for the acquisition of seed clones with fixed heterosis. Specifically, the document exemplifies the transformation of rice plants with a p76C expression vector containing the embryonic autonomous gene BBM1 to induce parthenogenesis. The transforming agent used is Agrobacterium EHA105. Summary of the Invention

[0009] Although the use of apomixis genes to transform plants is known in the prior art, and some apomixis genes from *Euphorbia tirucalli* are known, there is still a need for a method to transform non-apomixis plants into apomixis plants by introducing *Euphorbia tirucalli* genes into these plants.

[0010] In this sense, a first aspect of the invention is to provide a nucleic acid construct comprising a coding sequence for an apomixis trait, wherein the coding sequence is extracted from *Euphorbia tirucalli*.

[0011] In one embodiment, the coding sequence comprises a polynucleotide sequence capable of being amplified by two primers having nucleotide sequences selected from any one of SEQ ID NO: 9-53.

[0012] In a particularly preferred embodiment, the coding sequence comprises a polynucleotide sequence of any one of SEQ ID NO: 1-8.

[0013] In an embodiment, the nucleic acid construct of the first aspect of the present invention enables the expression of apomixis in target plants, preferably plants that do not naturally express apomixis, and more preferably corn plants that do not naturally express apomixis.

[0014] In a preferred embodiment, the plant is selected from Arabidopsis thaliana (Arabidopsis thaliana). Arabidopsis ) genus, barley ( Hordeum ) Genus, Rice ( Oryza ) genus, maize ( Zea ) or wheat ( Triticum ) genus. More preferably, selected from Arabidopsis thaliana ( Arabidopsis sp. ), common barley ( Hordeum vulgare ), rice ( Oryza sativa ), corn (corn, Zea mays ) or common wheat ( Triticum aestivum (plants).

[0015] A second aspect of the present invention is to provide a method for converting a non-apomixis plant or plant cell into an apomixis plant or plant cell, the method comprising introducing a nucleic acid construct of the first aspect of the present invention into the non-apomixis plant or plant cell.

[0016] In an embodiment, the method of the second aspect of the present invention includes using Agrobacterium-mediated transformation.

[0017] In an embodiment, the second aspect of the invention involves transforming plants selected from the genera *Arabidopsis*, *Haloxylon*, *Oryza*, *Zea*, or *Triticum*. More preferably, plants selected from *Arabidopsis*, *Haloxylon*, *Oryza*, *Zea*, or *Triticum*.

[0018] In an embodiment, the method of the second aspect of the present invention includes the step of confirming the transformation of a plant or plant cells.

[0019] A third aspect of the present invention is to provide a method for obtaining transgenic apomixis plants, the method comprising the following steps: (i) Provide the target non-apomixis plant or plant cells, (ii) Transforming the plant or plant cells of step (i) with the nucleic acid construct of the first aspect of the present invention, and (iii) Cultivate transformed plants or plant cells.

[0020] In this embodiment, the target plant or plant cells are selected from the genera Arabidopsis, barley, rice, maize, or wheat. More preferably, plants are selected from Arabidopsis, barley, rice, maize, or wheat.

[0021] In an embodiment, the method of the third aspect of the present invention includes a step of confirming the transformation of the plant or plant cells before or after culturing the transformed plant or plant cells.

[0022] A fourth aspect of the invention is to provide a plant or plant cell comprising a nucleic acid construct of the first aspect of the invention.

[0023] In an embodiment, the plant or plant cells can be obtained by the method of the second aspect of the present invention.

[0024] In an embodiment, the plant or plant cells can be obtained by the method of the third aspect of the present invention. Attached Figure Description

[0025] Figure 1 The linear relationship between the scaffold (Y-axis) assembled by the Don Walter variety of *Euphorbia crassirhizoma* and the superimposed group (X-axis) assembled by the Victoria variety.

[0026] Figure 2 Cellular embryological analysis of hybrids (crossbreeds) from the mapping population OTA-S X Don Walter. The percentage of sexual pistils identified in each individual of the mapping population is shown.

[0027] Figure 3 The genomic region of *Thrush crestis* (red) is defined by markers linked to apomixis and contains... EcAPO1 and EcAPO2 Gene.

[0028] Figure 4 Linearity analysis of chromosomes between the Don Walter variety of *Thrush vinifera* containing apomixis and the diploid sexual variety Victoria.

[0029] Figure 5 Reproductive developmental stages of *Euphorbia tirucalli* used for RNA extraction for microarray hybridization. A) A section of pistil tissue showing the archersporial stage.

[0030] Figure 6Agarose gel, showing the amplification products obtained using genomic DNA from 14 *Eriocaulon rubrum* genotypes. The EcAPO-based primer combinations used were: a.1) EcAPO1_F1 / EcAPO1_R1; a.2) EcAPO1_F2 / EcAPO1_R2; a.3) EcAPO1_F3 / EcAPO1_R3; b.1) EcAPO2_F5 / EcAPO2_R5; b.2) EcAPO2_F3 / EcAPO2_R3; b.3) EcAPO2_F4 / EcAPO2_R5.

[0031] Figure 7 Agarose gel, showing the amplification products obtained using genomic DNA from multiple individuals of a curved-leaf thrush mapping population constructed by hybridizing OTA-S and Don Walter, using primers based on a) EcAPO1 and b) EcAPO2.

[0032] Figure 8A The distribution of the first 6 BLAST hits across 3 target sequences.

[0033] Figure 8B Comparison of four EcAPO2 variants.

[0034] Figure 9 Images of in situ hybridization of apomixis (A and B) and sexually induced (C and D) ovaries. Hybridization was performed using an antisense probe of EcAPO1.

[0035] Figure 10 qPCR assays were performed, showing the expression of EcAPO1, 2, 3, and 4 genes in several transgenic lines. Each gene is displayed in a different color. Relative expression on the Y-axis is expressed as logarithmically. 2 The scale is shown.

[0036] Figure 11 . EcAPO Gametophyte development in mutant lines. A, Mature ES in WT ovules. B, Extra nucleus in mutant ovules. C, ES arrested at FG1 stage. D, Mutant ES containing cells (tracheids) with somatic cell identity. E, FM in WT ovules. FG, Mutant ovules showing more than one sustained FM. H, Anthers of mutant plants showing pollen grains (pg). ES, Embryo sac. FM, Functional megaspore. Arrows indicate nucleus location.

[0037] Figure 12 . EcAPOPost-fertilization ovule development in mutant plants. A, pistils of mutant lines showing delayed development (triangle) and early arrest (asterisk). BH, DIC images showing seed development at 24 HAF (BE) and 48 HAF (FH). B and F, WT ovules. CE and GH, EcAPO The ovules of the mutant strain show embryonic (arrow) development arrested in the early globular stage with uncellularized endosperm. C and GH indicate excessive growth in the endosperm sac (ec). DE and H indicate ectopic and nonpolar sacs growing toward the embryonic location. HAF indicates hours post-fertilization.

[0038] Figure 13 WT(A) and EcAPO Flower development in transgenic plants (BK) showing homeotic transformations (BF) and indeterminate development (FK). I to K, pistils observed using DIC microscopy.

[0039] Figure 14 WT(A) and EcAPO Seed size measurements in the mutant line (BD). E, Box plot of seed size, showing WT versus... EcAPO Significant differences between mutant strains. p<0.0001, Welch-corrected t-test was used.

[0040] Figure 15 Twenty-eight (28)-day-old seedlings, which showed EcAPO A. Higher growth rate in mutants; B. WT plants; EcAPO_x5 C. Plants; seedling size. p=0.0008, t-test.

[0041] Figure 16 WT(A) and EcAPO Chromosome count in the background of mutant (B). Arabidopsis thaliana WT diploid cells contain 10 chromosomes (2n=2x=10). Figure B shows the more intensely stained areas, corresponding to nuclei with up to 20 chromosomes. Root cells were treated and observed using Feulgen's stain.

[0042] Figure 17 The qPCR assay demonstrates... EcAPO_1 Gene expression in plants (205). Relative expression on the Y-axis is expressed as log. 2 Scale display.

[0043] Figure 1835-day-old plants at the flowering stage. A, WT plants. BD, EcAPO Genetically modified plants. C and D, plants that have not yet flowered. Detailed Implementation

[0044] The present invention will be described in further detail below with reference to the accompanying drawings and exemplary embodiments.

[0045] Unless otherwise expressly stated or inferred from the context, any technical terms used herein should be understood as having a common definition used in the field and / or a definition understood by those skilled in the art.

[0046] Each embodiment of the object, method, and / or aspect of the invention resulting from a combination of the specific embodiments described herein should be considered to fall within the scope of the invention.

[0047] A first aspect of the present invention is to provide a nucleic acid construct comprising a coding sequence for an apomixis trait, wherein the coding sequence is extracted from *Euphorbia tirucalli*.

[0048] As used herein, the term "nucleic acid construct" refers to a polynucleotide sequence or arrangement of DNA or RNA specifically designed to introduce a particular polynucleotide sequence (e.g., a coding sequence or gene) into a plant. In addition to the coding sequence or target gene, nucleic acid constructs may contain regulatory elements (such as promoters and terminators). Nucleic acid constructs can facilitate the controlled insertion and / or expression of a specific coding sequence. Examples of nucleic acid constructs are expression vectors or expression cassettes.

[0049] As used herein, the term "coding sequence" refers to a polynucleotide sequence that, when translated, produces a target polypeptide, protein, or protein fragment that has a physiological function or is wholly or partially responsible for the development of a specific trait (such as apomixis). Coding sequences can be obtained using any technique known in the art and readily available to those skilled in the art.

[0050] As used herein, the term "apomictic trait" refers to a phenotypic feature or characteristic in a plant that is associated with or responsible for apomicosis. In this sense, apomictic traits are typically controlled by one or more apomictic genes or coding sequences that enable a plant to produce seeds via apomicosis (i.e., without fertilization). This can produce offspring that are genetically identical to the parents. An apomictic trait includes at least one characteristic associated with apomicosis, which includes at least one, some, or all of the steps observed in apomictic reproduction. An apomictic trait includes any microscopic or molecular features associated with apomicosis, including the presence of proteins, factors, or markers associated with these traits.

[0051] Apomixis may be present during early development or flower development. Apomixis include at least one of the following: FG1 arrest, somatic identity (characteristic) in ES cells, multiple FMs, presence of extra nuclei in ES / egg-apparatus, embryo-proper arrest, acellular endosperm / atypical sac, indefinite development, or homeomorphic transformation.

[0052] As used herein, the term "plant" includes whole plants, plant organs (e.g., leaves, stems, flowers, roots, etc.), seeds, and plant cells and their progeny. The scope of plants suitable for the methods of this invention includes higher plants capable of transformation, including angiosperms (monocotyledons and dicotyledons) and gymnosperms. It also includes plants at different ploidy levels, including haploid, diploid, triploid, tetraploid, and other polyploid plants.

[0053] The nucleic acid construct of the first aspect of the present invention enables the expression of apomixis in target plants, preferably plants that do not naturally express apomixis, and more preferably crop plants that do not naturally express apomixis.

[0054] In a preferred embodiment, the nucleic acid construct of the first aspect of the present invention enables the expression of apomixis in plants selected from the genera Arabidopsis, barley, rice, maize, or wheat. More preferably, plants selected from Arabidopsis, barley, rice, maize, or wheat are used.

[0055] In another embodiment, the nucleic acid construct comprises a coding sequence that contains a polynucleotide sequence capable of being amplified by any two primers selected from SEQ ID NO: 9-53.

[0056] More specifically, the coding sequence contains a polynucleotide sequence that can be amplified by any two primers selected from the following: a) SEQ ID NO: 9-14, or b) SEQ ID NO: 15-39, or c) SEQ ID NO: 40-45, or d) SEQ ID NO: 46-51, or e) SEQ ID NO: 52-53.

[0057] As those skilled in the art will understand, if a coding sequence can be amplified using primers selected from SEQ ID NO: 9-53, it means that the coding sequence contains two sequences complementary to those primers. Therefore, in another embodiment, the coding sequence contains at least two polynucleotide sequences complementary to any two primers selected from SEQ ID NO: 9-53. More specifically, the coding sequence contains at least two polynucleotide sequences complementary to any two primers selected from: a) SEQ ID NO: 9-14, or b) SEQ ID NO: 15-39, or c) SEQ ID NO: 40-45, or d) SEQ ID NO: 46-51, or e) SEQ ID NO: 52-53.

[0058] In a preferred embodiment, the coding sequence is selected from any one of SEQ ID NO: 1-8.

[0059] As demonstrated by the examples provided herein, the sequences of SEQ ID NO: 1-8 exhibit the following common features (elements): These can be obtained through differential expression analysis via microarrays. These coding sequences are only found in *Eupatorium fortunei* ( ). Eragrostis In the apomixis genotype of ), The sequences referred to in this article as EcAPO1, EcAPO2_1, EcAPO2_2, EcAPO2_3, EcAPO2_4, and EcAPO5 can be found within the apomixis conditioning region. Meanwhile, the sequences of EcAPO3 and EcAPO4 are found in blocks outside this conditioning region.

[0060] In the above sequences, the sequences SEQ ID NO: 2-5 (corresponding to the genes referred to throughout this specification as EcAPO2_1, EcAPO2_2, EcAPO2_3, and EcAPO2_4, respectively) form subgroups sharing the following nucleotide common regions ( Figure 8B ): - Common Area 1 GGGCCTCGATGGCCGCCTCCCCGCCGCGCAGCCATCACCGGGACGACGACTTYCCTCGCTGCCTCAAGCKTYGMGCGTCCCCSTTCCACTCGTCCGACTCCGAGATTGACCACCGCCGCAGATCGAGGGCCTTCGCGCCGGTCGCCAACAGCCGCCGCAGATCTAGGGCCTCCCCGTCCGTCCCCAACCGCCGCCGTGGCCGCGACCCTGAGGGCTGTTCCATGCTCAGCGGGTATGCCAGCGACCCTTCCCGGCGCTTTAGGGTCCCCGACAGGGAGGAGGATGGGGACCTCAGGCGGAGGCGTGCTAGGGTTGACAAACWGAGGGAGGATGGTCGCCGGCTGATGCGCTCCAG- (SEQ ID NO: 120) - Conserved region 2 - Common Area 3 GCATCGTCTCGATATTTYATAAAAGTTCTATTTCAGGAACTATCAGAGCATCTTGGCATAGGCCAACTTAATGAGAGATTGAAAGWTCTAAATATGCAAGGCTCATTTGAGGTCATCCTTCCGAAGGATCATCCAAAAAAACTTGAGGATCTCC AGTAAATTCTTCACAGCCATCAGTCTTGGGGGTATCRAAGAGAGTATGGGTGGGGACGTGCCACTCCTTGTAATGCGGCAGCACAAGCCTGCATCATCTGKGTTCAAGACTGGTTCGAAAGCTTTTGGCTYAGGATCTCGTGAGTTCTGA-(SEQ ID NO: 122) In the sequences SEQ ID NO: 120-122 provided above, K represents T or G; R represents G or A; Y represents T or C; W represents A or T; M represents C or A; and S represents C or G.

[0061] Accordingly, in another embodiment of the invention, the nucleic acid construct comprises a coding sequence for the apomixis trait, the coding sequence comprising at least one nucleotide sequence selected from SEQ ID NO: 120-122. Preferably, the coding sequence comprises all three nucleotide sequences as described in SEQ ID NO: 120-122. More preferably, the nucleic acid construct comprises a coding sequence for the apomixis trait, the coding sequence having a nucleotide sequence as described in any one of SEQ ID NO: 2-5.

[0062] As illustrated herein, those skilled in the art will understand that the primers described herein can be used to amplify coding sequences responsible for apomixis traits. More specifically, Primers for SEQ ID NO: 9-14 can be used to amplify the coding sequence EcAPO1 of SEQ ID NO: 1. The primers of SEQ ID NO: 15-39 can be used to amplify any of the following variants of the coding sequence EcAPO2: EcAPO2_1 of SEQ ID NO: 2, EcAPO2_2 of SEQ ID NO: 3, EcAPO2_3 of SEQ ID NO: 4, and EcAPO2_4 of SEQ ID NO: 5. Primers for SEQ ID NO: 40-45 can be used to amplify the coding sequence EcAPO3 of SEQ ID NO: 6. The primers of SEQ ID NO: 46-51 can be used to amplify the coding sequence EcAPO4 of SEQ ID NO: 7. The primers of SEQ ID NO: 52-53 can be used to amplify the coding sequence EcAPO5 of SEQ ID NO: 8.

[0063] As used herein, unless otherwise stated or inferred from the context, the coded sequence EcAPO2 without further description should be understood as any one of the EcAPO2 variant sequences EcAPO2_1, EcAPO2_2, EcAPO2_3, or EcAPO2_4.

[0064] Extracting coding sequences from *Thrush cresticulata* can be performed using any technique known in the art, such as amplification with specific primers, cloning, and sequencing, or alternatively, computer identification via RNA-Seq. In a preferred embodiment, the coding sequence for the apomixis trait obtained from *Thrush cresticulata* can be obtained by extracting and reverse transcribing the mRNA product of the apomixis gene from *Thrush cresticulata*.

[0065] As shown in the embodiments provided herein, the construction of the nucleic acid construct of the present invention can be accomplished by cloning a coding sequence for apomixis obtained from *Thrush chinensis* into a suitable vector or expression cassette. In a preferred embodiment, this cloning can be accomplished using at least two primers selected from SEQ ID NO: 64-87.

[0066] In embodiments, the nucleic acid constructs of the present invention comprise a vector or expression cassette selected from GoldenBraid 2.0, pAtWUS, pAtSPL, pAtKNU, pNOS, tAtACTII, tAtUBQ3, t35S, or tNOS.

[0067] In a preferred embodiment, the nucleic acid construct of the present invention comprises: a) the encoded sequence in any of its implementations, and b) The carrier or expression box in any of its embodiments.

[0068] In a particularly preferred embodiment, the nucleic acid construct of the present invention comprises: a) The encoded sequences selected from SEQ ID NO: 1-8, and b) A vector or expression cassette selected from GoldenBraid 2.0, pAtWUS, pAtSPL, pAtKNU, pNOS, tAtACTII, tAtUBQ3, t35S, or tNOS.

[0069] In a particularly preferred embodiment, the nucleic acid construct comprises an expression cassette as shown in Table 9 of this specification.

[0070] As demonstrated by the embodiments and description provided herein, the nucleic acid constructs of the present invention contain coding sequences that have never been described in the prior art, and furthermore, it would not be obvious to those skilled in the art that these specific sequences from *Euphorbia tirucalli* would result in the efficient introduction and development of apomixis in non-apomixis plants, since such technical effects are neither suggested nor disclosed in the prior art literature.

[0071] Furthermore, through the embodiments provided herein, the inventors point out that, with the penetration of EcAPO The increase in the number of genes, along with the increase in the number of observed phenotypes and their penetrance, suggests that there may be a synergistic effect among these genes, further supporting the inventiveness of different aspects of this invention.

[0072] A second aspect of the present invention is to provide a method for converting a non-apomixis plant or plant cell into an apomixis plant or plant cell, the method comprising introducing a nucleic acid construct of the first aspect of the present invention into the non-apomixis plant or plant cell.

[0073] As used herein, the term "transformation" refers to the process of introducing a foreign nucleic acid (preferably a coding sequence with a promoter and a termination signal) or gene into a target organism (e.g., a plant or plant cell). The foreign nucleic acid may be introduced alone or as part of an expression system (e.g., an expression cassette or vector). Transformation may result in transient or permanent expression of the foreign nucleic acid in the target organism, preferably permanent expression, and may involve introducing a foreign gene into the genome (i.e., chromosome) of the target organism.

[0074] When referring to nucleic acids, the term "exogenous" means nucleic acids that cannot exist naturally as part of the genetic material of a particular plant or plant cell, or nucleic acids that cannot be naturally expressed in a particular plant or plant cell.

[0075] Specifically, the term "conversion of a non-apomictic plant to an apomictic plant" refers to the application of the transformation process as defined above to a plant or plant cell, wherein the introduction of exogenous nucleic acid results in the expression of the apomictic trait as defined above in a plant or plant cell that did not originally have or express the apomictic trait.

[0076] Introducing the nucleic acid construct of the first aspect of the present invention into the non-apomixis plant or plant cell can be carried out by any means known and readily available to those skilled in the art. However, in a preferred embodiment, the method of the present invention for transforming plants includes transformation using Agrobacterium-mediated transformation, more preferably Agrobacterium rhizogenes-mediated transformation, for example by floral dip.

[0077] In an embodiment, the second aspect of the invention involves transforming plants selected from the genera *Arabidopsis*, *Haloxylon*, *Oryza*, *Zea*, or *Triticum*. More preferably, plants selected from *Arabidopsis*, *Haloxylon*, *Oryza*, *Zea*, or *Triticum*.

[0078] In another embodiment, the method of the second aspect of the invention includes a nucleic acid construct comprising a coding sequence comprising a polynucleotide sequence capable of being amplified by any two primers selected from SEQ ID NO: 9-53, and more specifically, the coding sequence comprising a polynucleotide sequence capable of being amplified by any two primers selected from: f) SEQ ID NO: 9-14, or g) SEQ ID NO: 15-39, or h) SEQ ID NO: 40-45, or i) SEQ ID NO: 46-51, or j) SEQ ID NO: 52-53.

[0079] In another embodiment, the method of the second aspect of the invention includes a coding sequence comprising at least two polynucleotide sequences complementary to any two primers selected from SEQ ID NO: 9-53. More specifically, the coding sequence comprises at least two polynucleotide sequences complementary to any two primers selected from: f) SEQ ID NO: 9-14, or g) SEQ ID NO: 15-39, or h) SEQ ID NO: 40-45, or i) SEQ ID NO: 46-51, or j) SEQ ID NO: 52-53.

[0080] In a preferred embodiment, the method of the second aspect of the present invention includes a coding sequence selected from any one of SEQ ID NO: 1-8.

[0081] In an embodiment, the method of the second aspect of the present invention includes

[0082] Nucleic acid constructs comprising a vector or expression cassette selected from GoldenBraid 2.0, pAtWUS, pAtSPL, pAtKNU, pNOS, tAtACTII, tAtUBQ3, t35S, or tNOS.

[0083] In a preferred embodiment, the method of the second aspect of the present invention includes the nucleic acid construct of the present invention, the nucleic acid construct comprising...

[0084] c) the encoded sequence in any of its implementations, and

[0085] d) The carrier or expression box in any of its embodiments.

[0086] In a particularly preferred embodiment, the method of the second aspect of the present invention includes the nucleic acid construct of the present invention, the nucleic acid construct comprising...

[0087] c) The encoded sequences selected from SEQ ID NO: 1-8, and

[0088] d) A vector or expression cassette selected from GoldenBraid 2.0, pAtWUS, pAtSPL, pAtKNU, pNOS, tAtACTII, tAtUBQ3, t35S, or tNOS.

[0089] In a particularly preferred embodiment, the method of the second aspect of the invention includes the expression box shown in Table 9 of this specification.

[0090] In an embodiment, the method of the second aspect of the invention further includes constructing the nucleic acid construct of the invention prior to plant transformation by cloning a coding sequence for apomixis extracted from *Euphorbia tirucalli* into a vector or expression cassette. In a preferred embodiment, this cloning can be accomplished using at least two primers selected from SEQ ID NO: 64-87.

[0091] A third aspect of the present invention is to provide a method for obtaining transgenic apomixis plants, the method comprising the following steps: (i) Provide the target non-apomixis plant or plant cells, (ii) Transforming the plant or plant cells of step (i) with the nucleic acid construct of the first aspect of the present invention, and (iii) Cultivate transformed plants or plant cells.

[0092] In this embodiment, the target plant or plant cells in step (i) are selected from the genera *Arabidopsis*, *Haloxylon*, *Oryza*, *Zea*, or *Triticum*. More preferably, plants selected from *Arabidopsis*, *Haloxylon*, *Oryza*, *Zea*, or *Triticum* are used.。

[0093] In one embodiment, step (ii) includes a method for converting a non-apomixis plant or plant cell into an apomixis plant or plant cell using the second aspect of the invention in any of its embodiments.

[0094] Step (iii) can be performed by any means available to those skilled in the art that ensures the proper development of the plant and the apomixis trait. These include, but are not limited to, growth under natural or artificial conditions, in plantation fields, greenhouses, or laboratories. The method may also include the use of artificial growth promoters, such as through the use of fertilizers or hormones.

[0095] In embodiments, the method of the second aspect of the present invention and / or the method of the third aspect of the present invention includes the step of confirming plant or plant cell transformation. Preferably, the confirmation step includes any one of the following: - To detect target coding sequences or genes using hybridization probes, such as those selected from any one of SEQ ID NO: 54-63; or - By PCR, for example, by using primers selected from SEQ ID NO: 9-53 to amplify the coding sequence of apomixis from DNA; or - By RT-PCR, for example by using primers selected from SEQ ID NO: 9-53 to amplify the coding sequence for apomixis from RNA; or - The expression of the target coding sequence was studied by qRT-PCR using primers selected from SEQ ID NO: 112-119; or - Observe the pistils at different stages of flower development; or - Analyze the ploidy level of plants.

[0096] In this implementation, the confirmation can be performed before or after the growth (culture) of the transformed plant or plant cells.

[0097] A fourth aspect of the invention is to provide a transgenic plant or plant cell transformed with a nucleic acid construct of the first aspect of the invention, the nucleic acid construct containing a coding sequence for apomixis traits, wherein the coding sequence is extracted from *Euphorbia tirucalli*.

[0098] In a preferred embodiment, the transgenic plant or plant cell of the fourth aspect of the present invention is a crop plant derived from the genera *Haloxylon*, *Oryza*, *Corn*, or *Triticum*. More preferably, it is a plant selected from common barley, rice, corn, or common wheat. 。

[0099] Preferably, the plant or plant cell is the product of the method of the second aspect of the invention in any of its embodiments.

[0100] Preferably, the plant or plant cell is the product of the method of the third aspect of the invention in any of its embodiments.

[0101] Example

[0102] The following embodiments are intended as exemplary implementations of different objects, methods, and / or aspects of the present invention. These embodiments are not intended to limit the scope of the invention in any way.

[0103] Example 1: Identification of genomic regions and genes involved in apomixis expression in *Euphorbia crescentis*

[0104] Example 1.1: Genomic regions associated with / linked to apomixis

[0105] The genomes of two *Euphorbia tirucalli* cultivars, Don Walter and Victoria, were sequenced and assembled at the chromosome scale. The facultative allotetraploid cultivar Don Walter was sequenced using a combination of Chromium 10X, Oxford nanopore long reads, and Omni-C technology. The assembled genome contains 10 *Euphorbia tirucalli* chromosomes, and the resulting parameters are shown in Table 1. The diploid sexual cultivar Victoria was sequenced using PacBio, Chicago, and Hi-C technology. The genome contains seven complete chromosomes, with the remaining three split into two segments. Isolinearity analysis between the two genomes indicated they were highly conserved; however, some chromosomal rearrangements were detected. Figure 1 ).

[0106]

[0107] Table 1. Indicators of genome assembly in Victoria and Don Walter.

[0108] To identify the genomic regions carrying apomixis loci and their inheritance, a mapping population of 61 individuals was constructed from a hybrid of the sexual female parent OTA-S (2n = 4X = 40, PI 574506, USDA, USA) and the facultative apomixis pollen donor variety Don Walter INTA (2n = 4X = 40). Hybrids were identified by identifying paternal markers using RAPD and AFLP markers. Phenotypic analysis was performed by cytogenetic analysis of panicles collected at flowering time, following the method of Meier et al. (2011). Plants were classified as apomixis if at least one apomixis pistil was observed (Savidan, 2000). Phenotypic identification of the 61 F1 hybrids was performed by cytogenetic analysis. Figure 2 This resulted in a 1:1 ratio of apomixis to sexual plants (34:27, X). 2 = 0.37), consistent with a genetic model of a single dominant trait (Zappacosta et al., 2019). Using both traditional (AFLP and SSR) and high-throughput molecular markers (GBS-SNP), the first saturated linkage map of *Eriocaulon crescentis* at the tetraploid level was constructed using the F1 population. Consequently, four markers linked to apomixis were found in linkage group 3 of the Don Walter map. The inventors also identified putative regulatory regions influencing the expression of this trait and its homolinear relationship with the genomes of other Poaceae species.

[0109] By locating candidate genes and apomixis linkage markers ( Figure 3 During genome assembly, genomic regions linked to apomixis were identified. In-depth analysis of the homolinearity of these marker-defined regions was performed to assess differences between sexually and apomixis genomes. This analysis revealed a significant difference in homolinearity between regions ranging from 17 to 29 Mb in the Don Walter genome and regions ranging from 23 to 29 Mb in the Victoria genome. Figure 4 Of the 1,412 annotated genes located in the Don Walter region, only 259 (19%) had orthologous genes found in diploid germline. Of the 1,153 (81%) genes not orthologously related to the diploid genome, 411 had significant counterparts (corresponding sequences) in the UniProt database based on Blastp alignment. The region was also found to be rich in repetitive elements, as it has 48% repetitive element coverage across the entire genome and 60% coverage of regions linked to apomixis.

[0110] Example 2: Identification of genes involved in apomixis expression in *Euphorbia tirucalli*

[0111] Example 2.1: Microarray Design (id 072215)

[0112] A custom Agilent array was designed using 1,000 k probes from the *Euphorbia milii* reference transcriptome and ESTs. The SurePrint G3 1x1M array format (Agilent) was used. The sequences used to design the 60-mer oligonucleotide probes (hereinafter referred to as CUST) were specifically assembled from 454 raw reads previously stored in the NCBI Sequence Reading Archive (SRA) database (BioProject 358210) and the Expression Sequence Tag Database (dbEST) (numbers EH183417 to EH195711). A custom microarray was created using eArray, a free Agilent network-based application that enables the creation of custom microarray designs and oligonucleotide libraries (https: / / earray.chem.agilent.com / earray / ). For probe design, a base composition methodology option was used, and adapter sequences were not employed. Probes were designed for each sequence. A total of 970,000 probes were obtained from eArray and used to create the 1x1M array format. Slides with printed arrays are ordered directly from Agilent Technologies (Santa Clara, CA, USA).

[0113] Example 2.2: Microscopic Dissection and RNA Extraction

[0114] Nearly 20-30 sporogenous cells were microscopically dissected from spikelets of collected materials of *Euphorbia crescentis* genotypes (including apomixis and sexual individuals of different ploidy levels (2x or 4x)) (Table 2) – CMM pistil plus stamen ( Figure 5 The dissected samples were then ground into a fine powder in liquid nitrogen, and total RNA was extracted using a commercial RNA purification kit (Macherey-Nagel) according to the manufacturer's instructions. The RNA was resuspended in 100 μl of diethyl pyrocarbonate (DEPC)-treated water and quantified using the cyanine dye RiboGreen® (Molecular Probes, Eugene, OR, USA) against an appropriate standard curve. RNA quality was checked using an Agilent 2100 Bioanalyzer instrument (Agilent, USA) with the RNA 6000 PicoLabChip.

[0115] Example 2.3: Microarray Design Hybridization

[0116] Eight independent hybridizations were performed using monochromatic Cy3-marked samples from four apomixis and four sexually propagated *Euphorbia tirucalli* genotypes (Table 2). Data preprocessing and analysis were performed using GeneSpring software v. 14.5. Platform quality was validated using an Agilent spike-in control. Normalization procedures included 75 percentile shift, background correction, median as baseline, and reproductive pattern as a parameter. Differential hybridization of individual probes in the array was considered to exist when log2-transformed Fold Change data > 1 and p-value > 0.01 (using unpaired t-tests and multiple Benjamini-Hochberg correction).

[0117]

[0118] Table 2. Genotypes of *Thrush chinensis* used in microarray hybridization experiments. Ploidy levels are indicated in parentheses. USDA: United States Department of Agriculture; INTA: National Institute of Agricultural Technology; UNS: Southern National University.

[0119] Example 2.4: Microarray hybridization and sequencing analysis.

[0120] Microarray hybridization analysis of RNA extracted from the pistils and stamens of four sexual genotypes and four apomixis genotypes of *Euphorbia tirucalli* using GeneSpring software (Table 2) revealed differential hybridization of 138 60-mer sequences between apomixis and sexual samples.

[0121] Analysis of the hybridization microarray yielded 365 CUST sequences that underwent differential hybridization based on reproductive patterns. BLAST analysis of these sequences using the *Euphorbia tirucalli* transcriptome database revealed that 70 CUST sequences matched transcripts annotated as putative proteins and subsequently named... EcAPO1 7 CUST matches to EcAPO2 The transcript was annotated as a homolog of the pre-mRNA splicing factor CWC22 (related to corn). Compared to PWZ46383; score: 699 bits (1803); expected value: 0.0; consistency: 69%; similarity: 78%; gap rate: 5%); 17 CUST matched transcripts annotated as Cyclin-2A-1 (compared to short-flowered rice ( Oryza brachyanthaCompared to XP_006664043; Score: 601 bits (1550); Expected value: 0.0; Consistency: 67%; Similarity: 78%; Empty space rate: 1%), named EcAPO3 And 2 CUST matches to what is called EcAPO4 The transcript, annotated as F-box protein (as in millet), Setaria italica (Compared to XP_004962938.3; Score: 250 bits; Expected value: 3e-77; Consistency: 58%; Similarity: 69%; Vacancy rate: 6%). Then, one case of a CUST matching a single isot was identified, as well as / or alignments that did not meet the criteria to the point of not being considered valid matches. All of these findings were not considered in further studies. These four transcripts were considered candidate genes involved in the apomixis expression pathway (non-meiotic), and therefore several strategies were followed in hopes of proving this hypothesis. Another candidate gene... EcAPO5 It was identified by performing a BLAST search on the genome sequence of the Tanganyika cultivar.

[0122] Example 2.5: Candidate Gene Cloning and Sequence Analysis

[0123] These five candidate genes were analyzed in detail. Initially, PCR primers were designed based on transcript sequence (isotig) (Table 3), and PCR amplification was performed using genomic DNA from various *Thrush chinensis* genotypes with different reproductive patterns and / or ploidy levels (Table 4). To perform this procedure, genomic DNA was extracted from fresh leaf tissues according to a cetyltrimethylammonium bromide (CTAB)-based protocol, as described by Garbus et al. (2017). MyCycler Biorad was used. TM PCR amplification was performed using a cycler. Each PCR reaction consisted of: 1 μl of a 10 mM dNTPs mixture, 2.5 μl of 10× reaction buffer, 0.5 μl of each forward and reverse primer (100 pmol / μl), and 0.30 μl of DNA polymerase TaqPegasus. © (5 U / µl) and 2 μl of template genomic DNA (30 ng / µl), with a final reaction volume of 25 μl.

[0124] The PCR reaction procedure was as follows: initial DNA denaturation at 94°C for 3 minutes, followed by 40 cycles: 94°C for 30 seconds, annealing at the optimal temperature for each primer pair for 30 seconds, and 72°C for 30 seconds. A final extension was performed at 72°C for 5 minutes. The annealing temperature for each primer pair was set to the lower of the two primers' melting temperatures. The amplification products were analyzed by electrophoresis on a 1% agarose gel and visualized using ethidium bromide.

[0125]

[0126] Table 3. Primers designed based on the sequences of two candidate transcripts from the candidate transcripts of *Euphorbia tirucalli*.

[0127]

[0128] Table 4. Genotyping of *Eriocaulon crescentis* was performed to amplify candidate transcripts indicating seed origin (USDA, INTA, UNS), ploidy level, and reproductive mode.

[0129] Example 2.6: Characterization of candidate transcripts and analysis of their relationship with apomixis

[0130] Several primer pairs were initially designed based on the sequences of transcripts from all studies (Table 3). Primer specificity was carefully examined, and these primers were used to amplify DNA from various germplasms of *Euphorbia tirucalli* (Table 4). Amplified products of the expected size were obtained, and notably, for all transcripts studied, these products were observed only in the apomixis genotype. Figure 6 ).

[0131] Furthermore, when primer combinations of several transcripts 1 and 2 were used in the DNA of hybrid individuals from a mapping population (obtained by hybridization with the sexually reproductive parent OTA-S (4x) as the maternal parent and the apomixis parent DonWalter (4x) as the pollen donor), amplification products were observed in plants classified as apomixis based on cytological embryological analysis, but this amplification was absent in plants classified as sexually reproductive. Figure 7 (and Table 5). Therefore, our results strongly suggest that these transcripts constitute markers of cosegregation with the apomixis trait (and Table 5). Figure 4 ).

[0132] a) b)

[0133] Table 5. In Figure 7The following genotypes of *Echinochloa crus-galli* were analyzed: a) EcAPO1; and b) EcAPO2.

[0134] Both transcripts were amplified from cDNA obtained from apomixis rather than sexually induced inflorescences. For EcAPO2, three different spliced ​​transcripts containing the ORF were sequenced: EcAPO2_1 (SEQ ID NO: 2), EcAPO2_2 (SEQ ID NO: 3), and EcAPO2_3 (SEQ ID NO: 4). Figure 8A , Figure 8B The additional transcript (EcAPO2_4 of SEQ ID NO:5) was predicted from the genome of *Thrush chinensis* using bioinformatics methods. Figure 8B )

[0135] The subsequent study aimed to test the expression profiles of all transcripts and the potential differential expression of alternative splicing between apomixis and sexual reproduction genotypes. Therefore, the availability of natural sexual and tetraploid apomixis genotypes of *Euphorbia tirucalli* (a specific feature of this experimental system) made it possible to obtain a reference transcriptome suitable for transcriptomic comparisons. Hybridization analysis of transcriptome-based microarrays revealed the presence of four genes associated with apomixis expression, which were observed only in the apomixis genotype.

[0136] RNA-seq was also used to investigate the apomixis varieties Bahiense, Tanganyika INTA, and T-355-UNS, and the sexually reproduced variety Victoria. EcAPO1, 2, 3, 4 and 5 The expression of these genes was evaluated (Table 6). RNA was extracted from spikelets and sequenced using Illumina 2x150 reads. Differential expression analysis revealed that all genes were differentially expressed in the apomixis variety and were not expressed in the sexually reproduced variety Victoria.

[0137]

[0138] Table 6: EcAPO Gene expression matrix. The numbers show the mapped reads for each transcript. Values ​​for three replicates are shown for the genotypes Bahiense (BHS), Tanganyika USDA (TUNS), Tanganyika INTA (T.INTA), and Victoria (Vic).

[0139] Example 2.7: In situ hybridization (ISH)

[0140] To investigate the tissue specificity of these gene expressions, in situ hybridization (ISH) was performed on developing floral tissues of both sexually and apomixis genotypes of *Euphorbia tirucalli*.

[0141] Although multiple probes were designed to identify different variants of EcAPO (Table 7), in situ hybridization experiments were performed only on EcAPO1. The tissue targets used for hybridization were inflorescences containing both sexually reproductive and apomixis genotypes of flowers at different developmental stages. Hybridization was performed according to the protocol described by Dusi (2001) with minor modifications. Inflorescences were immobilized in 0.01 M phosphate-buffered saline (pH 7.2) of 4% paraformaldehyde / 0.25% glutaraldehyde, dehydrated in an ethanol series, and embedded in paraffin. Specimens were sliced ​​into 7 µm pieces and placed on positively charged slides. Paraffin was removed using a xylene series. The T7 and SP6 promoter sequences, as 5' tails, were included in different primer pairs used for amplifying both the sense and antisense probes (Table 7). Probes were labeled using the Roche Dig RNA Labeling Kit following the manufacturer's instructions. Hybridization was performed overnight in a humidified chamber at 42°C in a buffer containing 10 mM Tris–HCl pH 7.5, 300 mM NaCl, 50% formamide (deionized), 1 mM EDTA pH 8, Denhart, 10% dextran sulfate, 600 ng / ml total RNA, and 60 ng of the corresponding probe. Detection was performed using anti-DIG AP and NBT / BCIP as substrates according to the RocheDig assay kit instructions.

[0142]

[0143] Table 7. Primer sequences used to generate hybridization probes. Promoter sequences SP6 or T7 are shown in bold.

[0144] Detectable hybridization signals associated with EcAPO1 were detected at all developmental stages of apomixis flowers. Figure 9 AB). Conversely, no significant signal was detected in sexually induced flowers (AB). Figure 9 CD). Before flowering, the signal is confined to the nucellus, megasporocyte mother cell, and functional megaspore; during flowering, it is confined to the nucellus, egg cell, and polar nucleus (CD). Figure 9 No hybridization signal was detected using antisense probes in the same organs and tissues with sexual genotypes.

[0145] Example 3: Design of an expression system for triggering apomixis in Arabidopsis thaliana

[0146] Example 3.1: RNA extraction and first-strand cDNA synthesis from *Thrush chinensis*

[0147] Using the Promega SV Total RNA Isolation System © RNA was obtained from *Thrush chinensis*. Up to 60 mg of inflorescence tissue was isolated and precipitated using a centrifuge basket containing a silica (silica) membrane. The RNA was then treated with RNase-free DNase I and eluted with nuclease-free water. RNA quality and quantity were assessed using a DeNovix DS-11 spectrophotometer. NEB M-MuLV Reverse Transcriptase was used according to the manufacturer's instructions. © Perform first-strand cDNA synthesis.

[0148] Example 3.2: Extraction of DNA and RNA from Arabidopsis thaliana

[0149] Using Invitrogen TM The provided TRIzol TM Reagents and Procedure Guidelines for the Extraction of Total RNA from Arabidopsis Inflorescences. Briefly, samples are collected in liquid nitrogen and immediately ground using a mortar and pestle. The resulting powder, up to 100 mg, is transferred to an RNase-free 1.5 mL tube pre-cooled in liquid nitrogen, and 1 mL of TRIzol is added. TM Once the aqueous phase containing RNA has been separated, the interfacial and organic phases are reserved for subsequent DNA separation. The quality and quantity of nucleic acids are assessed using a DeNovix DS-11 spectrophotometer. NEB M-MuLV Reverse Transcriptase is used according to the manufacturer's instructions. © First-strand cDNA synthesis from RNA.

[0150] Example 3.3: Sequence Capture

[0151] Following the manufacturer's instructions, NEB Q5 high-fidelity DNA polymerase (New England Biolabs) was used to obtain the promoter (regulatory region) and coding sequence (CDS) via PCR. At5g14010 was amplified from wild-type Arabidopsis thaliana genomic DNA using the primers listed in Table 8. KNUCKLES ), At2g17950 ( WUSCHEL At4g09960 SEEDSTICK At4g27330 ( SPOROCYTELESS The 5' regulatory region of the gene. Annotations for all genes are from the Arabidopsis thaliana data resource (TAIR). www.arabidopsis.org (Downloaded from )

[0152] cDNA was obtained from the apomixis of the Tanganyika cultivar *Tanganyika* using the primers described in Table 8. EcAPO Gene EcAPO1 , EcAPO2 , EcAPO3 , EcAPO4 , EcAPO5 The coded sequence (CDS).

[0153]

[0154] Table 8. Primers used during GB2 cloning.

[0155] Example 4.4: Cloning into the expression vector

[0156] All amplified sequences were appended to the 5' end by adding enzymes for type II 12 enzymes. Esp3 I and BsaI The restriction enzyme sites are modified, a step required for cloning in the GoldenBraid 2.0 (GB2.0) vector (Sarrion-Perdigones et al., 2013). If necessary, domestication is performed to remove the internal restriction enzyme sites of these enzymes. The GB2.0 vector was kindly provided by Dr. Diego Orzáez (Laboratory of Plant Genomics and Biotechnology, Polytechnic University of Valencia, Spain) and used according to the authors' protocol (Sarrion-Perdigones et al., 2013) for subsequent assembly and cloning steps. First, each module containing a promoter or coding sequence is cloned into a vector called pUPD2. Next, the basic TU or expression cassette is assembled into the pDGBα vector. These vectors then allow the generation of vectors carrying one to five... EcAPO Transgenic lines of the gene (Table 9). The final expression vector includes transcriptional fusion vectors. pNOS:nptII:tNOS or pNOS:hph:tNOS To confer kanamycin or hygromycin B resistance to transgenic plants.

[0157]

[0158] Table 9. Construction EcAPO Details of the expression boxes. For each box, more than 10 Arabidopsis thaliana samples were obtained. EcAPO Genetically modified strains nptII and hph The genes conferred resistance to kanamycin and hygromycin B in the plant, respectively.

[0159] Escherichia coli and Agrobacterium tumefaciens strains and growth conditions

[0160] Escherichia coli DH5α strain was used for cloning into the GB2.0 vector, and Agrobacterium rhizogenes strain GV3101 was used for stable transformation of Arabidopsis thaliana plants. Both strains were cultured in Luria-Bertani (LB) medium at 37°C and 28°C with shaking (250 rpm), respectively. Chloramphenicol (25 μg / mL) was administered as needed. -1 Ampicillin (50 μg / mL) -1 ), kanamycin (50 μg / mL) -1 ) and spectinomycin (100 μg / mL) -1 Screening for E. coli was performed using rifampin (50 μg / mL). -1 ) and gentamicin (25 μg / mL) -1 It is also used for screening Agrobacterium rhizogenes. 5-Bromo-4-chloro-3-indolyl-β-D-galactosidic acid (X-gal; 40 μg / mL) -1 ) and isopropyl thio-β-galactoside (IPTG; 0.5 mM) were used for white / blue screening of clones on LB agar plates.

[0161] Stable transformation of Arabidopsis thaliana

[0162] Transgenic Arabidopsis lines were generated using the floral dip method (Clough and Bent, 1998). All lines were generated under the Columbia-0 (Col-0) ecotype. For each line containing... EcAPO Gene expression cassettes were used to obtain at least 10 strains. Transgenic plants (plants) were cultured on Murashige y Skoog (MS) medium (Murashige and Skoog, 1962) and kanamycin (50 μg / mL). -1 ) or hygromycin B (25 μg / mL) -1 Growth (culturing) in plates using a selector.

[0163] Plant growth (cultivation) conditions

[0164] Arabidopsis ecotype Columbia-0 and its mutant strain (mutant) were tested at a constant temperature of 22°C under a 16 / 8 hour day / night photoperiod (light flux density of 115 ± 10 μmol / s). -1 m -2Seeds were sterilized in a 50% (v / v) water / 6% sodium hypochlorite solution with 0.1% SDS (sodium dodecyl sulfate), washed four times with sterile water, and then spread on MS medium. Seeds were stratified at 10°C for 48 hours, and then placed at 22°C under 16 hours of light and 8 hours of darkness. After three to four weeks, seedlings were transferred to pots filled with soil.

[0165] Morphological and histological analysis

[0166] Pisces at different developmental stages were dissected on glass slides and cleared overnight in Hoyer's solution (chloral hydrate, water, and glycerol). Ovules and early seeds were observed using DIC optics on a Leica DM2500 LED microscope. Images were captured on a Leica MC 170HD camera using Leica Application Suite (LAS) EZ software. Seedling and seed measurements were performed using ImageJ software (Schneider et al., 2012). Graphs and statistical analysis were performed using GraphPad Prism 8.3.0 for Windows.

[0167] Plexus level measurement

[0168] For chromosome counting, roots were obtained from 15-day-old seedlings cultured on agar plates containing MS medium and appropriate antibiotics as selectants. Roots were immersed in Carnoy's solution (ethanol:acetic acid; 3:1; v:v) and incubated at 4°C for 1 hour in 2 mM hydroxyquinoline before fixation. Chromosome staining was performed using the Feulgen technique. Briefly, the fixed roots were treated with 1N HCl in a water bath at 60°C for 10 minutes. Afterward, the roots were transferred to Schiff's reagent at room temperature for 2 hours (until the tissue stained deep purple) and then crushed onto slides.

[0169] DNA content was determined by flow cytometry services at the Northeast Botanical Institute (IBONE-CONICET, Argentina). Briefly, seedlings were cultured on agar plates and grouped into sets of four for tissue collection. Harvested leaves were immersed in PBS buffer at 4°C and minced using a new razor blade. The mixture was then passed through a 30 μm cell strainer and collected in 5 mL tubes. Samples were incubated in 300 nM DAPI solution in the dark for 5 minutes. After washing three times with PBS buffer, data were collected using a CyFlow Space instrument and analyzed using Partec FloMax software (version 2.4d).

[0170] qPCR detection

[0171] qRT-PCR experiments were performed using cDNA from inflorescences of wild-type (WT) and transgenic lines of Arabidopsis thaliana. qPCR was performed using the SsoAdvanced Universal SYBR Green Supermix real-time PCR reagent on a Bio-rad CFX96™ system. Data were processed using Bio-rad CFX Maestro software. Robustness and reaction efficiency of the obtained values ​​were evaluated using LinRegPCR software (Ruijter et al., 2009). All primers used are described in Table 10. EF1 α and TUA4 Reference gene values ​​were normalized. Relative expression levels were calculated using WT plants as controls. Three to five biological replicates were used for each studied genotype.

[0172]

[0173] Table 10. Primers used for qPCR analysis.

[0174] Example 5: [Regarding...] EcAPO Gene expression analysis

[0175] Analysis was performed on all strains using qPCR. EcAPO Gene expression profiles confirmed EcAPO The presence of transcripts in transgenic plants and the efficiency of the expression systems used ( Figure 10 ).

[0176] Phenotypic analysis of transgenic plants

[0177] Many transgenic lines exhibited abnormalities during the reproductive stage (Table 11). These abnormalities included alterations in gametophyte development, such as loss of embryo sac (ES) viability, changes in cell identity (characteristics) within the ES, and abnormalities in the number or distribution of ES nuclei. Furthermore, in transgenic lines carrying… EcAPO Abnormal phenotypes were detected during flowering in lines containing at least three genes. Among these phenotypes, indefinite development and homeomorphic transformation were observed. Tables 11 and 12 show details of each observed phenotype and its occurrence in transgenic lines.

[0178]

[0179] Table 11. In EcAPO Phenotypes observed in transgenic lines. Only those lines showing the phenotype are listed. Check the box ( This indicates that a given phenotype exists in each transgenic line studied. a Presenting phenotype EcAPO The total number of genetically modified strains. b The total number of strains for each phenotype is shown. See Table 12 for the frequency values ​​of the observed phenotypes.

[0180]

[0181] Table 12. EcAPO Number of ovules with developmental arrest in the T1 strain. Reference: WT ES arrest rate 2.7%; WT embryo arrest rate 0.6%. n=330.

[0182] It is worth noting that, with the infiltration EcAPO The increase in the number of genes was accompanied by an increase in the number of observed phenotypes and their penetrance. This suggests that there may be synergistic or additive effects among these genes.

[0183] EcAPO Gamete and embryo phenotypes in strains

[0184] When in bloom EcAPO The mutants exhibited high levels of ovule arrest in both early and late developmental stages. Higher rates of early abortion were observed in lines with homeomorphic phenotypes that impaired early developmental phenotypic assessment (Table 11). In addition to these abortions associated with homeomorphic transformation, in lines without homeomorphic phenotypes… EcAPO Arrest was also observed in the mutant strains (Table 12). This prompted us to analyze the mutant ovules in the gametophyte using DIC microscopy. Figure 11 ) and embryonic stage ( Figure 12 In the case of Arabidopsis thaliana ( Arabidopsis )middle ，The female reproductive lineage begins with the differentiation of the megasporocyte mother cell (MMC) in the ovule primordium (Drews and Koltunow, 2011). After meiosis, the MMC produces a functional megasporocyte (FM) at the chalazal end, which then develops into an embryo sac (ES) via mitosis. The mature ES consists of eight nuclei and seven cells: two gamete cells; an ovum and a central cell; and five accessory cells; two synergid cells and three antipodal cells (…). Figure 11 A). It is worth noting that, in EcAPO In transgenic plants, ES plants were observed to have a greater number of nuclei and abnormal locations than WT plants, primarily affecting the gamete cell region. Figure 11 B). Furthermore, mutant ES cells that stall at the FG1 stage (Christensen et al., 1997) or contain cells with somatic cell identity can be observed. Figure 11 CD). Furthermore, deregulation (not shown) was noted during ovule or seed development. In mutant ovules, more than one persistent cell was frequently observed during MMC and FM specialization. Figure 11 (FG). Although the mitotic or meiotic origin of these extra cells is currently unknown, their presence could explain the observed extra nuclei.

[0185] Subsequently, after fertilization, the inventors discovered embryos that developed delayed during the pre-globular stage. Figure 12 AB). Furthermore, these early seeds often exhibit excessive growth of uncellularized endosperm and endosperm sacs (AB). Figure 12 C, GH). Occasionally, depolarized (loss of polarity) cyst development and the appearance of ectopic cysts were observed. Figure 12 D, E).

[0186] EcAPO Flower phenotype in the strain

[0187] Arabidopsis thaliana possesses a hermaphroditic floral complex consisting of four concentric whorls. Starting from the outermost whorl, the first whorl is occupied by four sepals, followed by the second whorl with four petals. The third whorl contains six stamens, and the fourth whorl develops two carpels in the center of the floral meristem (FMC), which fuse to form the pistil. Figure 13 A). In genetically modified organisms EcAPO Abnormal flower development patterns observed in plants resemble homeogenesis. apetala2 and Superman Those mutants described (Komaki et al., 1988; Bowman et al., 1989; Kunst et al., 1989). Therefore, in EcAPO The homeomorphic transformation found in the strain simulated the double mutant. ap2 sup (Huang and Ma, 1997), characterized by: missing petals, sepal carpelization (i.e., sepals exhibiting marginal ovules and stigmatic tissue at the apex), reduced stamen number, carpel-stamen fusion (chimeric organs), and loss of determinacy in the reproductive rings. Figure 13 BG). Indeterminate development in the innermost whorl occasionally leads to the formation of a multilocular pistil. Figure 13 G).

[0188] APETALA2 ( AP2 The cadastral gene is essential during normal development of the first whorl (sepia) and the second whorl (petals), and it is a defining gene. SUPERMAN ( SUP (Bowman et al., 1989) set the boundary between the third whorl (stamens) and the fourth whorl (carpels). AP2 and SUP Both genes contribute to the proper allocation and function of AGAMOUS (AG), a key regulator during organogenesis (Bowman et al., 1989). Although AP2 Will AG Expression is limited to the inner rounds 3 and 4, but SUP Will AG Isolation in the fourth round allows for specific control over carpel identity and floral meristem determination (Coen and Meyerowitz, 1991) (Sakai et al., 1995). Another with SUP Closely related genes KNUCKLES ( KNU ) is expressed at the carpal-placental boundary (Sun et al., 2009), and knu The mutant also produces an indefinite (amorphous) phenotype, which features ectopic stamens and carpels appearing within the fourth whorl (Payne et al., 2004). EcAPO This is also frequently observed in strains ( Figure 13 (HK). All mentioned phenotypes indicate EcAPO Gene expression may interfere with AP2, AG, SUP and / or KNU The expression or function of.

[0189] Determinative development in FMC is determined by CLAVATA (CLV) - WUSCHEL (WUS) Pathway control (Bowman et al., 1991; Sun et al., 2009; Sun and Ito, 2015). Proven. AG and SUPThis pathway can be modulated independently (Prunet et al., 2017; Uemura et al., 2018). Although KNU It represents AG right WUS A key link in feedback regulation (Sun et al., 2009), but... CLV Observed in defective mutants sup Phenotype, indicating SUP and CLV There are connections between pathways (Diévart et al., 2003; Trotochaud et al., 1999). Nevertheless, some have proposed... SUP It is possible, at least in part, to CLV Adjustment in a non-dependent manner WUS (Breuil-Broyer et al., 2016). Finally, it was also proposed that... AP2 Can be directly inhibited WUS (Nowak et al., 2022).

[0190] so, EcAPO Among the flowers AP2 , SUP and / or KNU The potential for low gene activity can not only determine homeomorphic transformation but also trigger the accumulation of glutathione (WUS), which in turn will be responsible for an unlimited number of phenotypes. Furthermore, EcAPO Excessive WUS in flowers may contribute to some allotropic phenotypes, as it has been identified in round 3. WUS Ectopic expression leads to higher AG Active and carpel-like stamens (Lenhard et al., 2001; Lohmann et al., 2001), which is in EcAPO Phenotypes observed in flowers ( Figure 13 E). In the sepals AG Similar disorders may occur in EcAPO Observed in mutants ap2 Sample phenotype. Furthermore, WUS accumulation also leads to larger meristems (Fletcher et al., 1999), which is clv The characteristic phenotype of the mutant and also EcAPO_1 Observed in strains (not shown). Finally, it has been reported that accumulation of WUS in the ovule primordium leads to multiple rounds of mitosis of the MMC prior to meiosis, resulting in the development of an extra ES and an extra nuclear phenotype (Zhao et al., 2017), which is similar to that observed in... EcAPO The phenotypes observed in ES ( Figure 11 B).

[0191] ploidy level analysis

[0192] exist EcAPO Found in mutants sup Sample phenotype and classification superwoman mutant ( clark-kent , fon , car , -eA31 , lol Those related to (Jacobsen and Meyerowitz, 1997; Huang and Ma, 1997; Rohde et al., 1999; Breuil-Broyer et al., 2016; Bondada et al., 2020). It is noteworthy that these mutants are derived from… SUP Different DNA methylation patterns along the gene sequence determine this. Furthermore, in EcAPO Almost all gametophyte phenotypes found in mutant plants have been previously described in maize mutants with downregulated DNA methylation pathways (Garcia-Aguilar et al., 2010). Notably, those maize mutants were able to reproduce both diploid sporulation and aposporic development, producing unreduced gametes and extra ES (Garcia-Aguilar et al., 2010). Unreduced gametes are easily identifiable due to their larger size. Regarding this, the inventors were able to... EcAPO Pollen grains of different sizes have been observed in plants. Figure 11 H). This indicates EcAPO Gene expression can directly or indirectly alter the normal epigenetic state in mutant plants.

[0193] Considering EcAPO The link between genes and diploid spore reproduction in *Thalia dealbata* was investigated, and transgenic *Arabidopsis* plants were able to reproduce diploid spore reproduction and development. Without parthenogenesis, this event would result in polyploid plants. Indeed, as in... EcAPO Similar to that observed in mutants, this is also seen in polyploid plants. ap2 Sample and sup Sample phenotypes (Comai, 2000; Madlung et al., 2002; Bondada 2022). Furthermore, in EcAPO The endosperm phenotype found in mutants has been described in triploid seeds with an increased dose of paternal genome (Scott et al., 1998). Since changes in seed size are associated with alterations in the maternal-to-paternal genome ratio (Scott et al., 1998), the inventors documented... EcAPO Individual seed size of the strain. Consistently, the inventors observed mutant seeds with increased or decreased volume, consistent with those described in triploid plants with excessive doses of paternal or maternal parent (…). Figure 14Furthermore, triploid plants with a double dose of paternal genome showed higher growth rates in the seedling stage (Fort et al., 2016), which was in EcAPO Features observed in mutant plants ( Figure 15 ).

[0194] Subsequently, the inventors measured EcAPO Evidence of polyploidy was found in the number of chromosomes in plant root cells. Figure 16 The cells and their corresponding nuclei were larger than normal, and the chromosome count reached 15 to 20, strongly suggesting the presence of triploid and tetraploid plants in the mutant lines. These results further support the conclusion that… EcAPO The potential of genes to establish partial apomixis pathways in unrelated sexual plants.

[0195] Expression Analysis

[0196] Given in EcAPO Both the flower and gametophyte phenotypes found in mutant plants may be associated with alterations in DNA methylation. The inventors first analyzed the transcript levels of genes involved in DNA methylation pathways in our mutants.

[0197] Figure 17 The results obtained by qPCR analysis are shown. EcAPO1 Summary of the expression profiles of transgenic plants. The inventors found that almost all genes involved in epigenetic mechanisms, including DNA methylation, post-translational histone modifications, and the RdDM pathway, were downregulated. Consistent with Garcia-Aguilar et al. (2010), the inventors observed... DRM 1. DRM2 and DDM1 Similar gene disorders, associated with diploid spore reproduction Tripsacum and Boechera Those described by the plant are consistent. Furthermore, although our mutant did not show... CMT3 Changes in transcript levels, but the inventors observed KYP The transcription is reduced, KYP It is a gene that determines the normal function of CMT3 in the CHG methylation process (Johnson et al., 2002; Lindroth et al., 2004). Importantly, the inventors also detected... MET1 and CMT2The expression of these enzymes is low, and they are the main methyltransferases involved in the maintenance of CG and CHH methylation of DNA in Arabidopsis thaliana. Plant DNA methylation occurs in CG, CHG, and CHH backgrounds (where H = A, T, or C), and each background is maintained by the activity of methyltransferases MET1, CMT3, and CMT2, respectively. These enzymes preferentially function in constitutive heterochromatin and are strongly dependent on DDM1 to maintain the silencing of transposon elements (TE) above these regions (Akinmusola et al., 2023). Therefore, DDM1 is a key regulator of DNA methylation in heterochromatin, and Arabidopsis thaliana ddm1 mutants exhibit many pleiotropic phenotypes (including homeotropic phenotypes) (Jacobsen et al., 1997; Jacobsen et al., 2000). Furthermore, moderate or severe reductions in global genome methylation in Arabidopsis thaliana have been reported to lead to ap2 or sup Phenotypes (Finnegan 1996; Ronemus 1996).

[0198] Therefore, the above results can explain not only in EcAPO The aberrant ES observed in mutants can also explain the most common homeotype association phenotypes.

[0199] Furthermore, the inventors of genetically modified organisms EcAPO Found in plants DME The downward adjustment, DME It is a gene that encodes a DNA-glycosylation enzyme, which is specifically expressed in companion cells during gametophyte development (Hsieh et al., 2009; Ibarra et al., 2012). DME In companion cells (trophic cells and central cells), demethylation of small, AT-rich euchromatin TE produces sRNAs, which in turn silence TE in gametes (Slotkin et al., 2009; Ibarra et al., 2012) and immunize them against TE activation. Furthermore, DME Preferential demethylation of adjacent gene sequences and allow imprinting in the endosperm (Bauer et al., 2011).

[0200] It is worth noting that, EcAPO The overall downregulation of epigenetic mechanisms in plants must involve significant activation of TE. Furthermore, in transgenic EcAPO plants... DME The downregulation suggests that imprinting may be lost. Correspondingly, the loss of imprinting in the FWA gene (which originally depended on DME activity) (Kinoshita et al., 2004) determines the late-flowering phenotype (Soppe et al., 2000), as in... EcAPO Seen in mutant plants ( Figure 18).

[0201] Finally, the inventors EcAPO1 Identified in strains SPL and WUS The reduction ( Figure 17 These two genes play a fundamental role in germline specialization in Arabidopsis (Yang et al., 1999; Groß-hardt et al., 2002). Furthermore, the inventors detected… ARF5 The expression was lower, ARF5 It is a gene essential for sexual ovule development (Cucinotta et al., 2021) and participates in cell polarity through the orientation of the auxin efflux carrier PIN1 (Bhatia et al., 2016). These results suggest that normal sexual pathways may be at least partially abolished (repressed) or altered in EcAPO plants.

[0202] References

[0203] Adams S, Vinkenoog R, Spielman M, Dickinson HG, Scott RJ, 2000. Parent-of-origin effects on seed development in Arabidopsis thaliana require DNA methylation. Development 127, 2493-502.

[0204] Akinmusola RY, Wilkins CA, Doughty J. DDM1-Mediated TE Silencing in Plants. Plants (Basel). 2023 Jan 18;12(3):437. doi: 10.3390 / plants12030437.PMID: 36771522; PMCID: PMC9919755.

[0205] Albertini E, Porceddu A, Ferranti F, Reale L, Bacarccia G, Romano B, et al. Apospory and parthenogenesis may be uncoupled in Poa pratensis: acytological investigation. Sex Plant Reprod. 2001;14: 213-17.

[0206] Bauer MJ, Fischer RL. Genome demethylation and imprinting in theendosperm. Curr Opin Plant Biol. 2011 Apr;14(2):162-7. doi: 10.1016 / j.pbi.2011.02.006. Epub 2011 Mar 23. PMID: 21435940; PMCID: PMC3082360.

[0207] Bemer M, Grossniklaus U, 2012. Dynamic regulation of Polycomb groupactivity during plant development. Curr Opin Plant Biol 15, 523-9.

[0208] Bennett MD. Nuclear DNA content and minimum generation time inherbaceous plants. Proc. R. Soc. Lond., B, Biol. Sci. 1972; 181.1063: 109-135.

[0209] Bhatia N, Bozorg B, Larsson A, Ohno C, Jönsson H, Heisler MG. AuxinActs through MONOPTEROS to Regulate Plant Cell Polarity and PatternPhyllotaxis. Curr Biol. 2016 Dec 5;26(23):3202-3208. doi: 10.1016 / j.cub.2016.09.044. Epub 2016 Nov 3. PMID: 27818174; PMCID: PMC5154752.

[0210] Bicknell, R. A. & Koltunow, A. M. Understanding apomixis: recentadvances and remaining conundrums. Plant Cell 16, S228-S245 (2004).

[0211] [ PMC free article ] [ PubMed ] Bondada R, Somasundaram S, Marimuthu MP, Badarudeen MA, PuthiyaveeduVK, Maruthachalam R, Biological Communications 3 , 772 .

[0212] [ PMC free article ] [ PubMed ] Bowman JL, Sakai H, Jack T, Weigel D, Mayer U, Meyerowitz EM. Development114, 599–615.

[0213] [ PubMed ] Bowman JL, Smith DR, Meyerowitz EM, 1989. Genes directing flower development in Arabidopsis. Plant Cell 1, 37–52.

[0214] [ PubMed ] Bowman JL, Smyth DR, Meyerowitz EM, 1991. Genetic interactions amongfloral homeotic genes of Arabidopsis. Development 112, 1–20.

[0215] Breuil-Broyer S, Trehin C, Morel P, et al, 2016. Analysis of theArabidopsis superman allelic series and the interactions with other genesdemonstrate developmental robustness and joint specification of male-femaleboundary, flower meristem termination and carpel compartmentalization. AnnBot 117, 905-23.

[0216] Carman JG. Asynchronous expression of duplicate genes in angiospermsmay cause apomixis, bispory, tetraspory, and polyembryony. Biol J LinneanSoc. 1997; 6: 1:51-94.

[0217] Catanach AS, Erasmuson SK, Podivinsky E, Jordan BR, Bicknell R.Deletion mapping of genetic regions associated with apomixis in Hieracium.Proc Natl Acad Sci USA. 2006;103.49: 18650-5.

[0218] Cervigni GD, Paniego N, Díaz M, Selva JP, Zappacosta D, Zanazzi D, etal Expressed sequence tag analysis and development of gene associated markersin a near-isogenic plant system of Eragrostis curvula. Plant Mol Biol. 2008;67(1-2): 1-10.

[0219] Chaudhury AM, Ming L, Miller C, Craig S, Dennis ES, Peacock J, 1997.Fertilization-independent seed development in Arabidopsis thaliana . PlantBiology 94, 4223-8.

[0220] Chen X, 2004. A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 303, 2022-5.

[0221] Christensen CA, King EJ, Jordan JR, Drews GN, 1997. Megagametogenesisin Arabidopsis wild type and the Gf mutant. Sex Plant Reprod 10, 49-64.

[0222] Clough S., and Bent A. (1998) Floral dip: a simplified method forAgrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal.16, 735-743.

[0223] Coen ES, Meyerowitz EM, 1991. The war of the whorls: geneticinteractions controlling flower development. Nature 353, 31-7.

[0224] Comai L, Tyagi AP, Winter K, et al, 2000. Phenotypic instability andrapid gene silencing in newly formed arabidopsis allotetraploids. Plant Cell12, 1551-68.

[0225] Conner JA, Gunawan G, Ozias-Akins P. Recombination within the apospory specific genomic region leads to the uncoupling of apomixis components in Cenchrus ciliaris. Planta. 2013; 238.1: 51-63.

[0226] Covas G, Cairnie A. Introduction of the golden meal in Argentina.In: Fernandez O, Brevedan RE, Gargajo A, editors. El Pasto llorón: su biología y manejo. Bahía Blanca, Argentina: CERZOS; 1991. p 1–6.

[0227] Crane C. Classification of Apomictic Mechanisms. In: Savidan Y, Carman JG, Dresselhaus T, editors. Flowering of Apomixis: From Mechanisms to Genetic Engineering. Mexico City: CIMMYT; 2001. p. 168-211.

[0228] Cucinotta M, Cavalleri A, Guazzotti A, Astori C, Manrique S, Bombarely A, Oliveto S, Biffo S, Weijers D, Kater MM, Colombo L. Alternative Splicing Generates a MONOPTEROS Isoform Required for Ovule Development. CurrBiol. 2021 Feb 22;31(4):892–899.e3. doi: 10.1016 / j.cub.2020.11.026. Epub 2020Dec 3. PMID: 33275890.

[0229] Diévart A, Dalal M, Tax FE, et al, 2003. CLAVATA1 dominant-negativealleles reveal functional overlap between multiple receptor kinases thatregulate meristem and organ development. Plant Cell 15, 1198-211.

[0230] Drews GN, Koltunow AM, 2011b. The Female Gametophyte. Arabidopsis Book 9, e0155.

[0231] Dusi D (2001) Patterns of RNA distribution during embryo sacdevelopment in sexual and apomictic plants of Brachiaria decumbens. In:Apomixis in Brachiaria decumbens Stapf. Doctoral thesis, WageningenUniversity, Department of Plant Sciences, pp 71–96

[0232] Finnegan EJ, Peacock WJ, Dennis ES. Reduced DNA methylation inArabidopsis thaliana results in abnormal plant development. Proc Natl AcadSci U S A. 1996 Aug 6;93(16):8449-54. doi: 10.1073 / pnas.93.16.8449. PMID:8710891; PMCID: PMC38691.

[0233] Fletcher JC, Brand U, Running MP, Simon R, Meyerowitz EM, 1999.Signaling of cell fate decisions by CLAVATA3 in Arabidopsis shoot meristems.Science 283, 1911-4.

[0234] Fort A, Ryder P, Mckeown PC, et al, 2016. Disaggregating polyploidy,parental genome dosage and hybridity contributions to heterosis inArabidopsis thaliana. New Phytol 209, 590-9.

[0235] Garbus I, Romero J, Selva JP, Pasten MC, Chinestra C, Carballo J,Zappacosta D, Echenique V. De novo transcriptome sequencing and assembly fromapomictic and sexual Eragrostis curvula genotypes. PLOSONE. In press

[0236] García-Aguilar M, Michaud, C., Leblanc, O. & Grimanelli, D. , 2010.Inactivation of a DNA methylation pathway in maize reproductive organsresults in apomixis-like phenotypes. . Plant Cell 22, 3249–67.

[0237] Goodrich J, Puangsomlee P, Martin M, Long D, Meyerowitz EM, CouplandG, 1997. A Polycomb-group gene regulates homeotic gene expression inArabidopsis. Nature 386, 44-51.

[0238] Grimanelli, D. Epigenetic regulation of reproductive development andthe emergence of apomixis in angiosperms. Curr Opin Plant Biol 15, 57-62(2012).

[0239] Gross-Hardt R, Lenhard M, Laux T. WUSCHEL signaling functions ininterregional communication during Arabidopsis ovule development. Genes Dev.2002 May 1;16(9):1129-38. doi: 10.1101 / gad.225202. PMID: 12000795; PMCID:PMC186242.

[0240] Hartley, J. L., Temple, G. F., and Brasch, M. A. (2000) DNA CloningUsing in vitro Site-Specific Recombination. Genome Research. 10, 1788-1795.

[0241] Hsieh TF, Ibarra CA, Silva P, Zemach A, Eshed-Williams L, Fischer RL,Zilberman D. Genome-wide demethylation of Arabidopsis endosperm. Science.2009 Jun 12;324(5933):1451-4. doi: 10.1126 / science.1172417. PMID: 19520962;PMCID: PMC4044190.

[0242] [ PMC free article ] [ PubMed ] Huang H, Ma H, 1997. FON1, an Arabidopsis gene that terminates floralmeristem activity and controls flower organ number. Plant Cell 9, 115–34.

[0243] Ibarra CA, Feng X, Schoft VK, Hsieh TF, Uzawa R, Rodrigues JA, ZemachA, Chumak N, Machlicova A, Nishimura T, Rojas D, Fischer RL, Tamaru H,Zilberman D. Active DNA demethylation in plant companion cells reinforcestransposon methylation in gametes. Science. 2012 Sep 14;337(6100):1360–1364.doi:10.1126 / science.1224839. PMID: 22984074; PMCID: PMC4034762.

[0244] Ikeda Y, Kobayashi Y, Yamaguchi A, Abe M, Araki T, 2007. Molecular basis of late-flowering phenotype caused by dominant epi-alleles of the FWAlocus in Arabidopsis. Plant Cell Physiol 48, 205–20.

[0245] Jacobsen SE, Meyerowitz EM, 1997. Hypermethylated SUPERMAN epigeneticalleles in arabidopsis. Science 277, 1100-3.

[0246] Jacobsen SE, Sakai H, Finnegan EJ, Cao X, Meyerowitz EM. Ectopichypermethylation of flower-specific genes in Arabidopsis. Curr Biol. 2000 Feb24;10(4):179-86. doi: 10.1016 / s0960-9822(00)00324-9. PMID: 10704409.

[0247] Johnson L, Cao X, Jacobsen S. Interplay between two epigenetic marks.DNA methylation and histone H3 lysine 9 methylation. Curr Biol. 2002 Aug 20;12(16):1360-7. doi: 10.1016 / s0960-9822(02)00976-4. PMID: 12194816.

[0248] Katz A, Oliva M, Mosquna A, Hakim O, Ohad N, 2004. FIE and CURLY LEAFpolycomb proteins interact in the regulation of homeobox gene expressionduring sporophyte development. Plant J 37, 707-19.

[0249] Kinoshita T, Miura A, Choi Y, et al, 2004. One-way control of FWAimprinting in Arabidopsis endosperm by DNA methylation. Science 303, 521-3.

[0250] Komaki MK, Okada K, Nishino E, Shimura Y, 1988. Isolation andcharacterization of novel mutants of Arabidopsis thaliana defective in flowerdevelopment. Development 104, 195-203.

[0251] Krogan NT, Hogan K, Long JA, 2012. APETALA2 negatively regulatesmultiple floral organ identity genes in Arabidopsis by recruiting the co-repressor TOPLESS and the histone deacetylase HDA19. Development 139, 4180-90.

[0252] Kunst L, Klenz JE, Martinez-Zapater J, Haughn GW, 1989. AP2 GeneDetermines the Identity of Perianth Organs in Flowers of Arabidopsisthaliana. Plant Cell 1, 1195-208.

[0253] Lenhard M, Bohnert A, Jürgens G, Laux T, 2001. Termination of stemcell maintenance in Arabidopsis floral meristems by interactions betweenWUSCHEL and AGAMOUS. Cell 105, 805-14.

[0254] Lindroth AM, Shultis D, Jasencakova Z, Fuchs J, Johnson L, SchubertD, Patnaik D, Pradhan S, Goodrich J, Schubert I, Jenuwein T, KhorasanizadehS, Jacobsen SE. Dual histone H3 methylation marks at lysines 9 and 27required for interaction with CHROMOMETHYLASE3. EMBO J. 2004 Oct 27;23(21):4286-96. doi: 10.1038 / sj.emboj.7600430. Epub 2004 Sep 30. Erratum in: EMBO J.2011 May 4;30(9):1874. PMID: 15457214; PMCID: PMC524394.

[0255] Lohmann JU, Hong RL, Hobe M, et al, 2001. A molecular link betweenstem cell regulation and floral patterning in Arabidopsis. Cell 105, 793-803.

[0256] Lora J, Yang X, Tucker MR, 2019. Establishing a framework for femalegermline initiation in the plant ovule. J Exp Bot 70, 2937-49.

[0257] Madlung A, Masuelli RW, Watson B, Reynolds SH, Davison J, Comai L,2002. Remodeling of DNA methylation and phenotypic and transcriptionalchanges in synthetic Arabidopsis allotetraploids. Plant Physiol 129, 733-46.

[0258] Mozgova I, Kohler C, Hennig L, 2015. Keeping the gate closed:functions of the polycomb repressive complex PRC2 in development. Plant J 83,121–32.

[0259] Murashige T, Skoog F, 1962. A Revised Medium for Rapid Growth and Bioassays with Tobacco Tissue Cultures. Plantarum Physiology 15, 473-97.

[0260] Nogler, G. Gametophytic apomixis in Embryology of Angiosperms (ed. Johri, BM) 475-518 (Springer, 1984).

[0261] Nowak K, Moro Czyk J, Grzyb M, Szczygie -Sommer A, Gaj MD, 2022.miR172 Regulates WUS during Somatic Embryogenesis in Arabidopsis via AP2.Cells

[0262] Noyes RD, Rieseberg LH. Two independent loci control agamospermy(Apomixis) in the triploid flowering plant Erigeron annuus. Genetics. 2000;155.1:379-390.

[0263] Ohad N, Margossian L, Hsu Y-C, Williams C, Reppetti P, Fisher RL,1996. A mutation that allows endosperm development without fertilization.Plant Biology 93, 5319-24.

[0264] Ozias-Akins, P. & van Dijk, P. Mendelian genetics of apomixis inplants. Annu Rev Genet 41, 509-537 (2007).

[0265] Payne T, Johnson, S. D.,Koltunow, A. M. , 2004. KNUCKLES (KNU)encodes a C2H2 zinc-finger protein that regulates development of basalpattern elements of the Arabidopsis gynoecium. Development 131, 3737-49.

[0266] Pinyopich A, Ditta GS, Savidge B, et al, 2003. Assessing theredundancy of MADS-box genes during carpel and ovule development. Nature 424,85-8.

[0267] Prunet N, Yang W, Das P, Meyerowitz EM, Jack TP, 2017. SUPERMANprevents class B gene expression and promotes stem cell termination in thefourth whorl of Arabidopsis thaliana flowers. Proc Natl Acad Sci U S A 114,7166-71.

[0268] Rohde A, Grunau C, De Beck L, Van Montagu M, Rosenthal A, Boerjan W,1999. Carpel, a new Arabidopsis epi-mutant of the SUPERMAN gene: phenotypicanalysis and DNA methylation status. Plant Cell Physiol 40, 961-72.

[0269] Ronemus MJ, Galbiati M, Ticknor C, Chen J, Dellaporta SL.Demethylation-induced developmental pleiotropy in Arabidopsis. Science. 1996Aug 2;273(5275):654-7. doi: 10.1126 / science.273.5275.654. PMID: 8662558.

[0270] Rounsley SD, Ditta GS, Yanofsky MF, 1995. Diverse roles for MADS boxgenes in Arabidopsis development. Plant Cell 7, 1259-69.

[0271] Ruijter JM, Ramakers C, Hoogaars WM, et al, 2009. Amplificationefficiency: linking baseline and bias in the analysis of quantitative PCRdata. Nucleic acids research 37, e45.

[0272] Sakai H, Medrano LJ, Meyerowitz EM, 1995. Role of SUPERMAN inmaintaining Arabidopsis floral whorl boundaries. Nature 378, 199-203.

[0273] Sarrion-Perdigones A, Marta Vazquez-Vilar, Jorge Palací, BasCastelijns, Javier Forment, Peio Ziarsolo, José Blanca, Antonio Granell,Diego Orzaez, 2013. GoldenBraid 2.0: A Comprehensive DNA Assembly Frameworkfor Plant Synthetic Biology. Plant Physiol. 162, 1618-31.

[0274] Schallau A, Arzenton F, Johnston A, Hähnel U, Koszegi D, Blattner FR,et al Identification and genetic analysis of the APOSPORY locus in Hypericumperforatum L. Plant Journal. 2010; 62.5: 773-784.

[0275] Schneider CA, Rasband WS, Eliceiri KW, 2012. NIH Image to ImageJ: 25years of image analysis. Nat Methods 9, 671-5.

[0276] Scott RJ, Spielman M, Bailey J, Dickinson HG, 1998. Parent-of-origineffects on seed development in Arabidopsis thaliana. Development 125, 3329-41.

[0277] Slotkin RK, Vaughn M, Borges F, Tanurdzi M, Becker JD, Feijó JA,Martienssen RA. Epigenetic reprogramming and small RNA silencing oftransposable elements in pollen. Cell. 2009 Feb 6;136(3):461-72. doi:10.1016 / j.cell.2008.12.038. PMID: 19203581; PMCID: PMC2661848.

[0278] Soppe WJ, Jacobsen SE, Alonso-Blanco C, et al, 2000. The lateflowering phenotype of fwa mutants is caused by gain-of-function epigeneticalleles of a homeodomain gene. Mol Cell 6, 791-802.

[0279] Sørensen MB, Chaudhury AM, Robert H, Bancharel E, Berger F, 2001.Polycomb group genes control pattern formation in plant seed. Curr Biol 11,277-81.

[0280] Sun B, Ito T, 2015. Regulation of floral stem cell termination inArabidopsis. Front Plant Sci 6, 17.

[0281] Sun B, Xu Y, Ng KH, Ito T, 2009. A timing mechanism for stem cellmaintenance and differentiation in the Arabidopsis floral meristem. Genes Dev23, 1791-804.

[0282] Trotochaud AE, Hao T, Wu G, Yang Z, Clark SE, 1999. The CLAVATA1receptor-like kinase requires CLAVATA3 for its assembly into a signalingcomplex that includes KAPP and a Rho-related protein. Plant Cell 11, 393-406.

[0283] Uemura A, Yamaguchi N, Xu Y, et al, 2018. Regulation of floralmeristem activity through the interaction of AGAMOUS, SUPERMAN, and CLAVATA3in Arabidopsis. Plant Reprod 31, 89-105.

[0284] Van Dijk PJ, Tas IC, Falque M, Bakx-Schotman T. Crosses betweensexual and apomictic dandelions (Taraxacum). II. The breakdown of apomixis.Heredity. 1999; 83.6: 715-721.

[0285] Voigt P, Rethman N, Poverene M. Lovegrasses. In: Moser LE, Burson BL,LE, editors. Warm-Season (C4) Grass. Madison: American Society of Agronomy;2004. p. 1027-1056.Voigt PW, Bashaw EC. Facultative apomixis in Eragrostiscurvula. Crop Sci. 1976;16: 803-6.

[0286] Voigt PW. Discovery of sexuality in Eragrostis curvula (Schrad.)Nees. Crop Sci. 1971; 11: 424-425.

[0287] Watson L, Dallwitz MJ. The grass genera of the world. Oxfordshire:CAB international; 1992.

[0288] Yang WC, Ye D, Xu J, Sundaresan V. The SPOROCYTELESS gene ofArabidopsis is required for initiation of sporogenesis and encodes a novelnuclear protein. Genes Dev. 1999 Aug 15;13(16):2108-17. doi: 10.1101 / gad.13.16.2108. PMID: 10465788; PMCID: PMC316961.

[0289] Zappacosta D C, Ochogavía A C, Rodrigo J M, Romero J R, Meier M S,Garbus I, et al Increased apomixis expression concurrent with genetic andepigenetic variation in a necwly synthesized Eragrostis curvula polyploid.Scientific Reports. 2014; 4: 4423.

[0290] Zhao XA, Bramsiepe J, Van Durme M, et al, 2017. RETINOBLASTOMARELATED1 mediates germline entry in Arabidopsis . Science 356, eaaf6532.

[0291] sequence list

Claims

1. A nucleic acid construct comprising a coding sequence for apomixis, wherein the coding sequence is extracted from *Euphorbia tirucalli* (a type of plant). Eragrostis curvula ).

2. The nucleic acid construct according to claim 1, wherein the coding sequence comprises a polynucleotide sequence capable of being amplified by any two primers selected from SEQ ID NO: 9-53.

3. The nucleic acid construct according to claim 1, wherein the coding sequence comprises a polynucleotide sequence of any one of SEQ ID NO: 1-8.

4. The nucleic acid construct according to claim 1, wherein the coding sequence for the apomixis trait comprises at least one nucleotide sequence selected from SEQ ID NO: 120-122.

5. The nucleic acid construct according to claim 4, wherein the coding sequence for the apomixis trait comprises all three nucleotide sequences shown in SEQ ID NO: 120-122.

6. The nucleic acid construct according to any one of claims 1 to 5, wherein the nucleic acid construct enables the expression of apomixis in plants that do not naturally express apomixis.

7. The nucleic acid construct according to claim 6, wherein the plant is selected from Arabidopsis thaliana (… Arabidopsis ) genus, barley ( Hordeum ) Genus, Rice ( Oryza ) genus, maize ( Zea ) or wheat ( Triticum ) belongs to.

8. A method for converting a non-apomixis plant or plant cell into an apomixis plant or plant cell, the method comprising introducing a nucleic acid construct according to any one of claims 1 to 7 into the non-apomixis plant or plant cell.

9. The method of claim 8, wherein the method comprises using Agrobacterium (… Agrobacterium )-mediated transformation.

10. The method according to claim 8 or 9, wherein the method comprises transforming plants selected from the genera Arabidopsis, Hordeum, Oryza, Maize, or Triticum.

11. The method according to any one of claims 8 to 10, wherein the method further comprises the step of confirming the transformation of the plant or plant cells.

12. A method for obtaining transgenic apomixis plants, the method comprising the following steps: a) Provide the target non-apomixis plant or plant cells. b) Transform the plant or plant cells of step (i) using the nucleic acid construct according to any one of claims 1 to 7, and c) Culture the transformed plant or plant cells.

13. The method of claim 12, wherein the conversion in step b) is performed by applying any one of the methods of claims 8 to 11.

14. The method according to any one of claims 12 to 13, wherein the plant or plant cell in step a) is selected from Arabidopsis, barley, rice, maize or wheat.

15. The method according to any one of claims 12 to 14, wherein the method comprises constructing the nucleic acid construct according to any one of claims 1 to 7 by cloning a coding sequence of an apomixis trait extracted from *Euphorbia tirucalli* into a vector or expression cassette prior to performing the transformation on the plant.

16. The method according to any one of claims 12 to 15, wherein the method includes a step of confirming the transformation of the plant or plant cells before or after step (iii).

17. A transgenic plant or plant cell comprising a nucleic acid construct according to any one of claims 1 to 7.

18. The transgenic plant or plant cell according to claim 17, wherein the transgenic plant or plant cell is obtained by the method of any one of claims 8 to 11.

19. The transgenic plant according to claim 17, wherein the transgenic plant is obtained by the method of any one of claims 12 to 16.

Images