Rapid detection kit for clinical common bacteria

Abstract

The utility model relates to a clinical common bacteria rapid detection kit, which comprises an integrally formed box body, the box body is a cuboid formed by cutting and bending a paperboard, the top surface and the front side surface of the left part of the box body are respectively provided with a first tearing cover through a first breakpoint easy-to-tear line, and a second tearing cover is arranged on the front side surface of the left part of the box body. A second tearing cover is separated from the top face and the front side face of the middle portion of the box body through a second breakpoint easy-to-tear line, and a third tearing cover is separated from the top face and the front side face of the right portion of the box body through a third breakpoint easy-to-tear line. The kit disclosed by the utility model has the following advantages: 1, the original three kits are integrated through one kit, so that the kit is convenient to carry and operate; 2, due to the design of the easy-to-tear line, quick taking for detection is facilitated; and 3, the primer or mixed liquid is prevented from being mixed through the separation design. And 4, one kit simultaneously contains specific primers of three common drug-resistant bacteria, and a result can be obtained by adding a treated clinical to-be-detected sample to react, so that the experimental period is greatly shortened.

Description

Technical Field

[0001] This invention relates to the field of detection kit technology, and in particular to a rapid detection kit for common clinical bacteria. Background Technology

[0002] According to the latest national bacterial resistance surveillance report, Escherichia coli, Klebsiella pneumoniae, and Staphylococcus aureus are common pathogenic microorganisms in clinical practice. Rapid and accurate detection of these bacteria is crucial for patient diagnosis and treatment. Current technologies often utilize different detection kits to detect Escherichia coli, Klebsiella pneumoniae, and Staphylococcus aureus separately. Furthermore, the detection time for individual primers is long, resulting in low efficiency, and requiring the preparation of three additional kits each time, which is inconvenient in terms of operation and portability. Therefore, a rapid detection kit for common clinical bacteria has been designed to address these problems. Summary of the Invention

[0003] To overcome the above shortcomings, this utility model provides a rapid detection kit for common clinical bacteria, including an integrally molded box body. The box body is a cuboid shape formed by cutting and bending cardboard. The top and front sides of the left part of the box body are separated into a first tear-off cap by a first tear line. The top and front sides of the middle part of the box body are separated into a second tear-off cap by a second tear line. The top and front sides of the right part of the box body are separated into a third tear-off cap by a third tear line.

[0004] The first tear line is located on the front side. The horizontal line of the first tear line is bent downward to form the first press-tear arc. The second tear line is located on the front side. The horizontal line of the second tear line is bent downward to form the second press-tear arc. The third tear line is located on the front side. The horizontal line of the third tear line is bent downward to form the third press-tear arc.

[0005] The inner bottom surface of the No. 1 tear cap is provided with a No. 1 mixing tube fixing paper tape and a No. 1 primer tube fixing paper tape. Both the No. 1 mixing tube fixing paper tape and the No. 1 primer tube fixing paper tape are arc-shaped strips, which are used to hold the No. 1 mixing tube and the No. 1 primer tube respectively.

[0006] The inner bottom surface of the No. 2 tear cap is provided with a No. 2 mixing tube fixing paper tape and a No. 2 primer tube fixing paper tape. Both the No. 2 mixing tube fixing paper tape and the No. 2 primer tube fixing paper tape are arc-shaped strips, which are used to hold the No. 2 mixing tube and the No. 2 primer tube respectively.

[0007] The inner bottom surface of the No. 3 tear cap is provided with a No. 3 mixing tube fixing paper strip and a No. 3 primer tube fixing paper strip. Both the No. 3 mixing tube fixing paper strip and the No. 3 primer tube fixing paper strip are arc-shaped strips, which are used to hold the No. 3 mixing tube and the No. 3 primer tube respectively.

[0008] The first mixing tube contains a mixture for Escherichia coli detection, and the first primer tube contains primers for Escherichia coli detection; the second mixing tube contains a mixture for Klebsiella pneumoniae detection, and the second primer tube contains primers for Klebsiella pneumoniae detection; the third mixing tube contains a mixture for Staphylococcus aureus detection, and the third primer tube contains primers for Staphylococcus aureus detection.

[0009] Furthermore, the box body is provided with two partitions, namely partition number one and partition number two, which divide the box body into three spaces; one partition is located below between the first tear-off cover and the second tear-off cover, and partition number two is located below between the second tear-off cover and the third tear-off cover.

[0010] Preferably, the materials of the mixing tube fixing paper tape and the primer tube fixing paper tape are elastic materials.

[0011] Preferably, the partition is made of rigid plastic, which serves to separate the compartments while also supporting the internal space of the box, preventing it from being crushed when squeezed.

[0012] The beneficial effects of this utility model are:

[0013] The rapid detection kit for common clinical bacteria described in this invention has the following advantages:

[0014] 1. The original three reagent kits have been integrated into one kit, making it convenient to carry and operate;

[0015] 2. The easy-tear line design allows for quick and easy handling and testing;

[0016] 3. Avoid mixing primers or mixtures through a partitioned design.

[0017] 4. One kit contains specific primers for three common drug-resistant bacteria. The results can be obtained by adding the treated clinical sample to the kit and reacting with the primer. This greatly shortens the experimental cycle. Based on the real-time fluorescence signal, the results can generally be obtained within 30 minutes. Attached Figure Description

[0018] Figure 1 A 3D view of a rapid detection kit for common clinical bacteria;

[0019] Figure 2 This is a front view of a rapid detection kit for common clinical bacteria.

[0020] Figure 3 A top view of a rapid detection kit for common clinical bacteria;

[0021] Figure 4 for Figure 3 AA-direction cross-section diagram;

[0022] Figure 5 A diagram illustrating the usage status of a rapid detection kit for common clinical bacteria.

[0023] in:

[0024] 1-Box body; 2-Tear cap No. 1; 3-Tear cap No. 2; 4-Tear cap No. 3; 5-Easy tear line No. 1; 6-Easy tear line No. 2; 7-Easy tear line No. 3; 8-Easy tear arc line No. 1; 9-Easy tear arc line No. 2; 10-Easy tear arc line No. 3; 11-Mixing tube No. 1; 12-Primer tube No. 1; 13-Fixing paper tape for mixing tube No. 1; 14-Fixing paper tape for primer tube No. 1; 15-Separator No. 1; 16-Separator No. 2. Detailed Implementation

[0025] A rapid clinical test kit for common bacteria includes an integrally molded box 1, which is a cuboid shape formed by cutting and bending cardboard. The top and front sides of the left part of the box 1 are separated into a first tear-off cap 2 by a first tear line 5. The top and front sides of the middle part of the box 1 are separated into a second tear-off cap 3 by a second tear line 6. The top and front sides of the right part of the box 1 are separated into a third tear-off cap 4 by a third tear line 7.

[0026] The first tear line 5, located on the front side, bends downwards to form the first press-tear arc 8. To use, press the first press-tear arc 8 with your thumb and then flip it upwards to easily tear the first tear line 5. The second tear line 6, located on the front side, bends downwards to form the second press-tear arc 9. To use, press the second press-tear arc 9 with your thumb and then flip it upwards to easily tear the second tear line 6. The third tear line 7, located on the front side, bends downwards to form the third press-tear arc 10. To use, press the third press-tear arc 10 with your thumb and then flip it upwards to easily tear the third tear line 7.

[0027] The inner bottom surface of the No. 1 tear cap 2 is provided with a No. 1 mixing tube fixing paper strip 13 and a No. 1 primer tube fixing paper strip 14. Both the No. 1 mixing tube fixing paper strip 13 and the No. 1 primer tube fixing paper strip 14 are arc-shaped strips, which are used to hold the No. 1 mixing tube 11 and the No. 1 primer tube 12 respectively.

[0028] The inner bottom surface of the No. 2 tear cap 3 is provided with a No. 2 mixing tube fixing paper tape and a No. 2 primer tube fixing paper tape. Both the No. 2 mixing tube fixing paper tape and the No. 2 primer tube fixing paper tape are arc-shaped strips, which are used to hold the No. 2 mixing tube and the No. 2 primer tube respectively.

[0029] The inner bottom surface of the No. 3 tear cap 4 is provided with a No. 3 mixing tube fixing paper strip and a No. 3 primer tube fixing paper strip. Both the No. 3 mixing tube fixing paper strip and the No. 3 primer tube fixing paper strip are arc-shaped strips, which are used to hold the No. 3 mixing tube and the No. 3 primer tube respectively.

[0030] Mixing tube 11 contains a mixture for Escherichia coli detection, and primer tube 12 contains primers for Escherichia coli detection; mixing tube 2 contains a mixture for Klebsiella pneumoniae detection, and primer tube 2 contains primers for Klebsiella pneumoniae detection; mixing tube 3 contains a mixture for Staphylococcus aureus detection, and primer tube 3 contains primers for Staphylococcus aureus detection.

[0031] Escherichia coli-specific primer sequences:

[0032] uidA-F: ​​CGGAAGCAACGCGTAAACTC;

[0033] uidA-R: TGAGCGTCGCAGAACATTACA;

[0034] Staphylococcus aureus-specific primer sequences:

[0035] nuc-F:GGTTCTGAATATCCAACAG;

[0036] nuc-R: GTCTGAATGTCATTGGTTG;

[0037] Klebsiella pneumoniae-specific primer sequences:

[0038] SHV-F: ATCCACTATCGCCAGCAG;

[0039] SHV-R: TGTTATCGCTCATGGTAATGG.

[0040] Furthermore, the box body 1 is provided with two partitions, namely partition 15 and partition 16, which divide the box body 1 into three spaces; partition 15 is located below the space between the first tear-off cover 2 and the second tear-off cover 3, and partition 16 is located below the space between the second tear-off cover 2 and the third tear-off cover 4.

[0041] Preferably, the materials of the mixing tube fixing paper tape and the primer tube fixing paper tape are elastic materials.

[0042] Preferably, the partition is made of rigid plastic, which serves to separate the parts while also supporting the internal space of the box 1, preventing it from being crushed when squeezed.

[0043] How to use:

[0044] In use, press the first easy-tear arc line 8 with your thumb and then flip it up to easily tear the first easy-tear line 5; take out the inner bottom surface of the first tear cap 2, which is secured by the first mixing tube fixing paper tape 13 and the first primer tube fixing paper tape 14; the first mixing tube 11 contains the mixture for Escherichia coli detection, and the first primer tube 12 contains the primer for Escherichia coli detection; it can be used for rapid detection of Escherichia coli in the test sample.

[0045] In use, press the second easy-tear arc line 9 with your thumb and then flip it upwards to easily tear the second easy-tear line 6; remove the inner bottom of the second tear cap 3 and fix the second mixing tube and the second primer tube, which are held in place by the second mixing tube and the second primer tube; the second mixing tube contains the mixed solution for Klebsiella pneumoniae detection, and the second primer tube contains the primers for Klebsiella pneumoniae detection; this allows for rapid detection of Klebsiella pneumoniae in the test sample.

[0046] When using, press the No. 3 easy-tear arc line 10 with your thumb and then flip it up to easily tear open the No. 3 easy-tear line 7; take out the inner bottom of the No. 3 tear cap 4 and fix the No. 3 mixing tube and the No. 3 primer tube, which are held in place by the paper tape; the No. 3 mixing tube contains a mixture for Staphylococcus aureus detection, and the No. 3 primer tube contains primers for Staphylococcus aureus detection, which can be used for rapid detection of Staphylococcus aureus in the sample.

[0047] In the description of this utility model, it should be understood that the terms "upper", "lower", "front", "rear", "left", "right", "top", "bottom", "inner", "outer", etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are only for the convenience of describing this utility model and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limitations on this utility model.

[0048] In the description of this utility model, it should be noted that, unless otherwise explicitly specified and limited, the terms "installation," "connection," and "joining" should be interpreted broadly. For example, they can refer to a fixed connection, a detachable connection, or an integral connection; they can refer to a mechanical connection or an electrical connection; they can refer to a direct connection or an indirect connection through an intermediate medium; and they can refer to the internal connection of two components. Those skilled in the art can understand the specific meaning of the above terms in this utility model based on the specific circumstances.

[0049] The above description is only a preferred embodiment of the present utility model. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present utility model, and these improvements and modifications should also be considered within the protection scope of the present utility model.

Claims

1. A rapid detection kit for common clinical bacteria, comprising an integrally molded box (1), characterized in that, The box body (1) is a cuboid shape formed by cutting and bending cardboard. The top and front sides of the left part of the box body (1) are separated into a first tear-off cover (2) by a first tear-off line (5). The top and front sides of the middle part of the box body (1) are separated into a second tear-off cover (3) by a second tear-off line (6). The top and front sides of the right part of the box body (1) are separated into a third tear-off cover (4) by a third tear-off line (7). The first tear line (5) is located on the front side and the horizontal line is bent downward to form the first press tear arc (8). The second tear line (6) is located on the front side and the horizontal line is bent downward to form the second press tear arc (9). The third tear line (7) is located on the front side and the horizontal line is bent downward to form the third press tear arc (10). The inner bottom surface of the No. 1 tear cap (2) is provided with a No. 1 mixing tube fixing paper strip (13) and a No. 1 primer tube fixing paper strip (14). Both the No. 1 mixing tube fixing paper strip (13) and the No. 1 primer tube fixing paper strip (14) are arc-shaped strips, which are used to hold the No. 1 mixing tube (11) and the No. 1 primer tube (12) respectively. The inner bottom surface of the No. 2 tear cap (3) is provided with the No. 2 mixing tube fixing paper tape and the No. 2 primer tube fixing paper tape. The No. 2 mixing tube fixing paper tape and the No. 2 primer tube fixing paper tape are both arc-shaped strips, which are used to hold the No. 2 mixing tube and the No. 2 primer tube respectively. The inner bottom surface of the No. 3 tear cap (4) is provided with the No. 3 mixing tube fixing paper tape and the No. 3 primer tube fixing paper tape. The No. 3 mixing tube fixing paper tape and the No. 3 primer tube fixing paper tape are both arc-shaped strips, which are used to hold the No. 3 mixing tube and the No. 3 primer tube respectively. Mixing tube 1 (11) contains a mixture for Escherichia coli detection, and primer tube 1 (12) contains primers for Escherichia coli detection; mixing tube 2 contains a mixture for Klebsiella pneumoniae detection, and primer tube 2 contains primers for Klebsiella pneumoniae detection; mixing tube 3 contains a mixture for Staphylococcus aureus detection, and primer tube 3 contains primers for Staphylococcus aureus detection.

2. The rapid detection kit for common clinical bacteria according to claim 1, characterized in that, The box body (1) is provided with two partitions, namely partition 1 (15) and partition 2 (16), which divide the box body (1) into three spaces; partition 1 (15) is located below between the first tear-off cover (2) and the second tear-off cover (3), and partition 2 (16) is located below between the second tear-off cover (3) and the third tear-off cover (4).

3. The rapid detection kit for common clinical bacteria according to claim 1, characterized in that, The paper tape for fixing the mixing tube and the paper tape for fixing the primer tube are made of elastic material.

4. The rapid detection kit for common clinical bacteria according to claim 1, characterized in that, The partition is made of hard plastic, which serves to separate the space and support the internal space of the box (1) to prevent it from being crushed when squeezed.

Images