Dual-gate multi-channel SiNW-FET biosensor

Abstract

The utility model discloses a double-gate multichannel SiNW-FET biosensor, which comprises a plurality of groups of detection channels, each detection channel comprises a first sub-detection channel and a second sub-detection channel, and the first sub-detection channel and the second sub-detection channel are oppositely arranged; the first sub-detection channel is provided with a first detection part for detecting biomarkers, the second sub-detection channel is provided with a second detection part for detecting biomarkers, and the first detection part and the second detection part are close to each other; the SiNW-FET biosensor disclosed by the utility model has higher flexibility and controllability.

Description

TECHNICAL FIELD

[0001] The utility model relates to the field of biological medicine technology more specifically, it relates to double gate multi -passageway SiNW-FET biological sensor. BACKGROUND

[0002] Colorectal cancer (CRC) is the highest incidence and mortality rate of digestive tract malignant tumor, about 560,000 new patients in China in 2020, leading to about 290,000 deaths. The 5-year survival rate of I patients can reach more than 90%, and the 5-year survival rate of IV patients is only about 10%. The main reasons for the decline in patient survival rate are: 1) about 60% of patients are in the middle and late stages when diagnosed due to the concealment of early symptoms; 2) more than half of the patients will relapse and metastasis during the course of disease. Therefore, early diagnosis and treatment of CRC, accurate assessment of recurrence and metastasis risk and intervention are the key measures to improve patient survival rate and improve prognosis.

[0003] Tumor-associated proteins are closely related to tumor occurrence and development, and have become important detection indicators for early diagnosis and prognosis of tumors. The CRC tumor markers widely used in clinical practice include CEA, CA19-9, CA24-2, CA72-4, etc. However, the sensitivity and specificity of traditional markers are low, which limits their clinical application value. CONTENT OF THE UTILITY MODEL

[0004] On the one hand, the utility model provides double gate multi -passageway SiNW-FET biological sensor, including multiple detection channels, the detection channel includes first sub detection channel and second sub detection channel, the first sub detection channel and the second sub detection channel are oppositely arranged;The first sub detection channel has a first detection part for detecting biomarkers, and the second sub detection channel has a second detection part for detecting biomarkers, and the first detection part and the second detection part are close to each other.

[0005] The biological sensor has multiple detection channels, which can be individually controlled and adjusted, providing higher flexibility. In addition, during actual detection, the added monoclonal antibody solution can flow to the first detection part and the second detection part at the same time, and the first detection part and the second detection part can obtain current data respectively. When there is no obvious difference between the two groups of data, it can be judged that the detection result is reliable. BRIEF DESCRIPTION OF DRAWINGS

[0006] Figure 1 FKBP9 gene expression level diagram in CRC tissue;

[0007] The FKBP9 gene expression level in CRC tissue is significantly higher than that in normal colorectal tissue adjacent to cancer;

[0008] Figure 2 Figure 2 shows the qPCR results indicating the expression level of FKBP9 gene in CRC cell lines;

[0009] The qPCR results indicate that the expression abundance of FKBP9 gene in CRC cell lines (RKO, HT29, HCT116) is high;

[0010] Figure 3 Figure 3 shows the expression level of FKBP9 protein in CRC cell lines;

[0011] The expression of FKBP9 protein in CRC cell lines is up-regulated compared with normal colon epithelial cells NCM460;

[0012] Figure 4 Figure 4 shows the effect of down-regulating FKBP9 expression on the migration and invasion ability of CRC cells;

[0013] Down-regulating FKBP9 expression can inhibit the migration and invasion ability of CRC cells;

[0014] Figure 5 Figure 5 shows the preparation process of the double-gate multi-channel SiNW-FET chip;

[0015] Figure 6 Figure 6 shows the functional modification process of the SiNW surface;

[0016] Figure 7 Figure 7 shows the structural schematic diagram of the double-gate multi-channel SiNW-FET biosensor;

[0017] Figure 8 Figure 8 shows the structural schematic diagram of another perspective of Figure 7 Figure 9 shows the structural schematic diagram of another perspective of

[0018] Figure 9 Figure 10 shows the enlarged schematic diagram of the A part of Figure 8 Figure 11 shows the enlarged schematic diagram of the A part of

[0019] Figure 10 Figure 12 shows that the SiNW-FET chip has excellent electrical performance;

[0020] (A) the transfer characteristic curve of the SiNW-FET chip; (B) the output characteristic curve of the SiNW-FET chip

[0021] Figure 11 Figure 13 shows that the multi-channel SiNW-FET chip can jointly detect tumor markers;

[0022] (A) FKBP9 detection; (B) CEA detection; (C) CA19-9 detection; (D) CA24-2 detection DETAILED DESCRIPTION

[0023] The above solutions are further described below in conjunction with specific examples. It should be understood that these examples are used to illustrate the present application and are not intended to limit the scope of the present application. The implementation conditions used in the examples can be further adjusted according to the conditions of specific manufacturers, and the implementation conditions not mentioned are usually the conditions in conventional experiments.

[0024] The present embodiment discloses a SiNW-FET biosensor capable of detecting tumor markers, which has the advantages of high sensitivity, high specificity, label-free and instant response.

[0025] The present embodiment discloses a novel CRC tumor marker FKBP9. FKBP9 is highly expressed in multiple organs, and is involved in the control of Ca 2+ release into the cytoplasm, and has a peptidyl-prolyl isomerase (PPIase) activity that plays an important role in protein folding and transport. FKBP9 can be used as a novel tumor marker for early diagnosis and evaluation of invasion and metastasis of CRC.

[0026] Marker screening:

[0027] (I) Methodology applied in the screening process of the novel tumor marker FKBP9

[0028] 1. Specimen collection

[0029] Tumor tissues and adjacent normal colorectal tissues of 20 CRC patients were collected during surgery, and the collected tissue specimens were stored in cryogenic tubes in a liquid nitrogen tank. All patients were diagnosed as CRC by pathological examination, and none of them received radiotherapy or chemotherapy before surgery.

[0030] 2. Screening of differentially expressed genes in CRC tissues and adjacent normal colorectal tissues

[0031] Affymetrix gene expression profiling chip technology was used to screen genes with significant differential expression between 20 pairs of CRC tissues and adjacent normal colorectal tissues, with |Fold Change (differential fold)|>1.5 and FDR (false discovery rate)<0.05 as the screening criteria. Agilent RNA6000 nano kit was used to extract total RNA from 20 pairs of CRC tissues and adjacent normal colorectal tissues for screening of differentially expressed genes. Affymetrix gene expression profiling chip was labeled and hybridized using Affymetrix gene chip hybridization, washing and staining kit.

[0032] 3. The expression of FKBP9 gene in CRC cells was detected using real-time quantitative gene amplification fluorescence detection system (qPCR).

[0033] (1) The primers of the internal reference gene and the target gene were designed and synthesized by Ji Kai Gene Co., Ltd. (Shanghai).

[0034] (2) The internal reference gene was GAPDH; the upstream primer sequence was TGACTTCAACAGCGACACCCA; the downstream primer sequence was CACCCTGTTGCTGTAGCCAAA; and the amplified fragment size was 121 (bp).

[0035] (3) The target gene was FKBP9; the upstream primer sequence was TGGGGACTTTCTCAGGTATCA; the downstream primer sequence was ACCACAATCCTTCGCTTTTC; and the amplified fragment size was 174 (bp).

[0036] 4. Western blot was used to detect the protein expression in CRC cells.

[0037] (1) Extraction of cell protein

[0038] 1) The cells were passaged into a six-well plate, and the cells were cultured to 80% density.

[0039] 2) The six-well plate was taken out, and the culture medium was aspirated. 1 mL of 10% PBS was added to each well for flushing twice (adhesion injection of PBS was avoided to avoid cell flushing). 120 uL of lysis solution was added to each well, and the cells in the well were scraped with a cell scraper.

[0040] 3) The cell-containing lysis solution was transferred to a 1.5 mL EP tube using a pipette gun, and placed in an ice box at 4°C for 2 h. Then a low-temperature ultracentrifuge was used for centrifugation at 14000 rpm for 15 min. The supernatant was taken to a new EP tube, and the protein concentration in the supernatant was detected using a protein concentration analyzer.

[0041] 4) 5x SDS-PAGE Loading Buffer was added at 1 / 4 of the volume of the supernatant, mixed well, and boiled for 5 min to denature the protein. It can be stored at -20°C for use.

[0042] (2) Gel preparation

[0043] 1) The glass plate was cleaned and dried, then clamped, and a mark was made at 0.5-1 cm below the tooth comb.

[0044] 2) The appropriate concentration of the lower gel was prepared according to the protein molecular weight, and the lower gel was poured into the clamp to the mark, 1 mL of isopropyl alcohol sealing liquid was added, and it was placed for 30 min until the lower gel solidified.

[0045] 3) Prepare 5% upper layer concentrated gel, discard the isopropanol of the lower layer gel, filter paper to dry, quickly add the upper layer gel to overflow, insert the comb (avoid bubbles), glue, stand for 15 min until the upper layer gel solidifies.

[0046] (3) Electrophoresis

[0047] 1) Prepare 1x electrophoresis solution.

[0048] 2) Carefully remove the comb, rinse the bubbles and broken gel in the electrophoresis solution, and fix the clamp and electrophoresis device.

[0049] 3) Add electrophoresis solution to the inner groove of the electrophoresis to the full, and add half of the outer groove.

[0050] 4) Add 5uL mark and 20ug sample to the hole formed after the comb is pulled out (avoid bubbles).

[0051] 5) Run the gel to the bottom of the mark, the initial electrophoresis voltage is 60V, and the voltage is increased to 160V after the mark passes the concentrated gel.

[0052] (4) Transfer film

[0053] 1) Cut the required gel to the same size PVDF membrane and soak in anhydrous methanol.

[0054] 2) Prepare transfer solution and place it in the tray, and soak the transfer clamp, sponge and four filter papers in it.

[0055] 3) Take out the gel, remove the upper layer gel and cut to the required size, separate the gel plate in the transfer solution, place it on the filter paper, cover the gel surface with PVDF film, chase bubbles, close the transfer clamp, chase bubbles again, and close the transfer clamp tightly.

[0056] 4) Place the transfer clamp in the transfer groove in the 4°C refrigerator, and transfer at 250mA for 2h.

[0057] (5) Blocking

[0058] 1) Prepare blocking milk: milk powder 1.5g + 1x TBST 30mL.

[0059] 2) Take out the film and place it in the prepared skimmed milk, room temperature, slow shaking on the shaker for 2h.

[0060] (6) Incubate the first antibody

[0061] 1) Wash the film with 1x TBST three times, each for 10min.

[0062] 2) Cut the film to the required size.

[0063] 3) Incubate the first antibody: place the film in the milk containing the first antibody in the 4°C shaker and shake slowly overnight.

[0064] Primary antibody milk formula (1:1000): milk powder 0.05g + 1x TBST 6mL + primary antibody 6uL.

[0065] 4) Take out the membrane, wash with 1x TBST for three times, 10min each time.

[0066] 5) Incubate secondary antibody: place the membrane in milk containing secondary antibody, slow shaking in the shaking table at room temperature for 1h. Secondary antibody milk formula (1:2000): milk powder 0.05g + 1x TBST 6mL + secondary antibody 3uL.

[0067] 6) Take out the membrane, wash with 1x TBST for three times, 10min each time.

[0068] (7) Exposure and imaging

[0069] 1) Prepare chemiluminescent developing solution.

[0070] 2) Place the membrane on the inner plate of the luminescence imaging instrument, and evenly drop the developing solution on the membrane.

[0071] 3) Use the luminescence imaging system software to expose, image, and save the picture.

[0072] (8) Analysis of Western blot results

[0073] Use ImageJ software to analyze the gray scale of the Western blot band.

[0074] 5, Lentivirus transfection and screening of stable transfection cell lines

[0075] (1) The shRNA sequence for silencing the FKBP9 gene of CRC cells (shFKBP9) and the negative control sequence shRNA (shCtrl) were synthesized by Jikai Gene Co., Ltd. (Shanghai). The shFKBP9 vector sequence is as follows: 5'-GCTGAGTAAGAAGGGAGATTA-3' (target number: psc53537). The corresponding lentivirus expression plasmid and lentivirus packaging plasmid were purchased from the company, and the lentivirus expression plasmid contains a green fluorescent expression sequence and a puromycin resistance gene sequence.

[0076] (2) Lentivirus transfection and screening of stable transfection cell lines:

[0077] Use lipofectamine 2000 to co-transfect 293T cells with lentivirus expression plasmid and lentivirus packaging plasmid. Collect the cell supernatant containing lentivirus particles after 72h, and obtain concentrated and purified lentivirus particles by ultracentrifugation.

[0078] Add concentrated and purified lentivirus particles to CRC cell lines HCT116 and RKO cells according to MOI value = 10.

[0079] 3) After 12h, observe the cell state and replace the culture medium.

[0080] 4) After 72h, observe the green fluorescence expression under a fluorescence microscope and preliminarily determine the virus transfection efficiency. If the green fluorescence rate is more than 70%, continue to culture the cells until the cell fusion degree reaches 80-90%, and then collect the cells for subsequent experiments.

[0081] Use puromycin at a concentration of 0.2 ug / ml to screen the infected cell strain to obtain a stable expression cell strain.

[0082] 6, Transwell experiment to evaluate tumor invasion / migration ability.

[0083] (1) Use Transwell experiment to evaluate CRC cell migration and invasion ability.

[0084] 1) Place 8um pore size chambers in a 24-well cell culture plate, add 300uL serum-free DMEM high-sugar medium containing 2x10 5 cells to the upper chamber, and add 0.5mL DMEM high-sugar medium containing 10% FBS to the lower chamber of the 24-well plate and place it in the incubator for 48h. The difference between the Transwell invasion experiment and the Transwell migration experiment is that the upper chamber needs to be pre-treated with about 40ul of diluted Matrigel (Matrigel: serum-free DMEM high-sugar medium = 1:5 mixed) uniformly pre-treated in the upper chamber. The rest of the steps are the same as the Transwell migration experiment.

[0085] 2) After 48h, remove the chamber, and use a cotton swab to remove the culture medium and cells in the upper chamber. The cells attached to the membrane are the successfully migrated and invaded cells.

[0086] 3) Fix the cells on the outer membrane surface with 4% paraformaldehyde solution for 30min, and then stain with crystal violet for 30min.

[0087] 4) After air-drying, count the successfully migrated and invaded cells under an optical microscope.

[0088] (II) Research results in the FKBP9 screening process

[0089] 1. The FKBP9 gene expression level in CRC tissue is significantly up-regulated compared with the normal colorectal tissue adjacent to the cancer.

[0090] 1971 genes were screened by Affymetrix expression profiling chip technology, of which 1414 genes were significantly up-regulated and 557 genes were significantly down-regulated. According to the Affymetrix expression profiling chip data analysis, as shown in Figure 1, the expression of FKBP9 in CRC tissues was significantly higher than that in adjacent normal colorectal tissues, and the gene expression difference fold (Fold change) between the two groups of samples was about 3.0.

[0091] 2、qPCR results suggest that the expression abundance of FKBP9 gene in CRC cell lines (RKO, HT29, HCT116) is high.

[0092] qPCR detection data, ΔCt = target gene Ct value - internal reference gene Ct value.

[0093] Ct: Cycle threshold, threshold cycle number. qPCR results suggest that the expression abundance of FKBP9 gene in CRC cell lines (RKO, HT29, HCT116) is high, as shown in Figure 2 .

[0094]

[0095] 3、Compared with normal colon epithelial cells NCM460, FKBP9 protein expression is up-regulated in CRC cell lines.

[0096] As shown in Figure 3, Western blot was used to detect the expression of FKBP9 in three types of human CRC cell strains (RKO, HT29, HCT116) and normal colon epithelial cell strain NCM460. The results showed that compared with NCM460, FKBP9 was up-regulated in the three CRC cell strains, and the expression was relatively high in HCT116 cells.

[0097] 4、Down-regulation of FKBP9 expression can inhibit the migration and invasion ability of CRC cells

[0098] As Figure 4As shown, lentivirus transfection technology was used to knock down FKBP9 gene in HCT116 cells, and reduce the expression level of FKBP9 protein. The results of Transwell migration and invasion experiments showed that compared with the shCtrl group (control group), the number of cells penetrating the membrane of the shFKBP9 group (FKBP9 knockdown group) was significantly reduced, and the difference was statistically significant (P<0.05). That is, down-regulation of FKBP9 expression can inhibit the migration and invasion ability of CRC cells. The experimental results show that FKBP9 expression has a positive promoting effect on the migration and invasion ability of CRC cells, and plays a promoting role in the progression of colorectal cancer.

[0099] SiNW-FET biosensor:

[0100] SiNW-FET biosensor and detection principle: SiNW-FET is a voltage-controlled semiconductor device. The electric field effect formed by the gate voltage VG will cause the change of the carrier density inside the SiNW, thereby adjusting the electrical conductivity of the SiNW. The modification of specific probe molecules on the surface of SiNW can make SiNW-FET a biosensor for detecting target molecules. When the probe molecules specifically capture target molecules, the electric field effect of the charged target molecules will cause changes in the electrical conductivity and current of SiNW. The current change is linearly related to the concentration of target molecules within a certain range, which can realize qualitative and quantitative detection.

[0101] 1. Fabrication of double-gate multi-channel SiNW-FET devices (such as Figure 5 shown)

[0102] Take the fabrication of two channels as an example, which is described as follows:

[0103] (1) SOI wafer top layer silicon thinning. The top silicon layer of a 6-inch p-type SOI wafer is thinned to 30 nm by using thermal oxidation and BOE etching method;

[0104] (2) SiNW preparation. Use a stepper photolithography machine to form SiNW (width 500 nm, height 30 nm), electrodes and circuit patterns, and form protruding SiNW by RIE etching;

[0105] (3) Preparation of insulating layer under top gate. Use photolithography and inductively coupled plasma chemical vapor deposition (ICPCVD) to deposit about 50 nm thick SiO2 insulating layer in a specific area;

[0106] (4) Electrode fabrication (top gate, source, drain and back gate). Ti / Au electrode layer (5nm / 100nm) was deposited on the front side of SiNWs by photolithography and physical vapor deposition (PVD) method; Ti / Au / Ti electrode layer (5nm / 100nm / 5nm) was deposited on the back side;

[0107] (5) Forming good ohmic contact between metal electrode and Si. The wafer was rapidly heated to 300°C in a rapid annealing furnace for 10 seconds and then cooled down at 10°C / s.

[0108] (6) Passivation layer fabrication. SiO2 / SiN passivation layer (100nm / 160nm) was deposited on the front side of the wafer except the detection area by UV photolithography and ICPCVD method. x

[0109] (7) Device electrical performance detection. The transfer / output curve of the device was measured by Agilent B1500A semiconductor analyzer to screen out devices with excellent performance and high consistency.

[0110] 2. Tumor-related protein antibody modification on the surface of silicon nanowires

[0111] As shown in FIG. 1, SiNW surface functional modification: Figure 6

[0112] (1) Connecting hydroxyl group. The SiNW-FET chip was cleaned with acetone, anhydrous ethanol and deionized water for 10 minutes each time, and then placed in an oxygen plasma for 5 minutes to form a layer of hydroxyl group on the surface of the chip after blowing dry with nitrogen gun;

[0113] (2) Connecting amino group. The chip was immersed in 2% APTES ethanol solution for 45 minutes, and the oxygen ethyl group of APTES combined with the hydroxyl group on the surface of the chip to connect the amino group contained in APTES. After taking out the chip, it was placed on a shaker and washed with anhydrous ethanol for three times, five minutes each time. Then the chip was placed on a heating plate and heated at 120°C for 1 hour to volatilize the uncombined APTES;

[0114] (3) Connecting aldehyde group. A 2.5% glutaraldehyde solution was prepared by alkalizing deionized water with solid sodium hydroxide to pH=8-9, and the chip was immersed in the 2.5% glutaraldehyde solution and continuously shaken for 1 hour. During this process, the aldehyde group of glutaraldehyde combined with the amino group of APTES. After taking out the chip, it was placed on a shaker and washed with deionized water for three times, five minutes each time, and then blown dry;

[0115] ​​(4) Connection of monoclonal antibody. Dilute 1xPBS solution with deionized water by 100 times to obtain 0.01xPBS solution, add NaOH to prepare weak alkaline solution (pH=8-9), dilute monoclonal antibody to 100ug / ml with the weak alkaline solution. Place the chip in a clean culture dish, use a pipette to drop 10-20ul of the diluted monoclonal antibody solution to the SiNW detection area, and drop one drop of diluted PBS around the silicon wafer to prevent the SiNW detection area from drying. Store at 4℃ for 4 hours for SiNW antibody modification.

[0116] 3. Fabrication and sealing of multi-channel PDMS microfluidic system

[0117] Fabrication and sealing of multi-channel PDMS microfluidic system:

[0118] (1) Fabrication of multi-channel PDMS microfluidic system.

[0119] ① Use photolithography and deep silicon etching method to fabricate pure silicon microfluidic channel mold;

[0120] ② Place the cleaned mold neatly in a glass dish, configure PDMS prepolymer and polymerization initiator at a mass ratio of 10:1, mix thoroughly with a glass rod, then slowly pour into the microfluidic channel mold, and place in a vacuum tank to remove bubbles;

[0121] ③ After no bubbles are generated, place the glass dish in a 75℃ oven for 40min;

[0122] ④ Separate the solidified PDMS microfluidic channel from the mold, and use a perforator to punch holes to obtain liquid inlet and outlet channels;

[0123] ⑤ After the microfluidic channel is fabricated, place the middle flow channel system in 10% BSA solution for immersion sealing.

[0124] (2) Sealing of PDMS microfluidic system.

[0125] ① Before the surface modification of SiNW, use reversible sealing technology to complete the sealing of microfluidic channel and device surface, and use the method of pressurized sealing of PDMS during high temperature semi-molding to improve the firmness of reversible sealing, so that the firmness and airtightness of the sealing meet the needs of modification;

[0126] ② Use irreversible sealing to complete the final assembly of the microfluidic channel system during detection. Since the sensor is mainly used for clinical detection, the sensor used is a completed sensor, and the requirement for repeated use of the sensor is relatively low, and more attention is paid to the stability and sealing firmness of the detection device. This firm sealing method meets the detection requirements.

[0127] As shown in FIGS. 7-9, the above-prepared double-gate multi-channel SiNW-FET biosensor 1 includes a back gate 20, a silicon-based substrate 21, and multiple groups of detection channels, specifically, a first group of detection channels 2, a second group of detection channels 3, a third group of detection channels 4, and a fourth group of detection channels 5.

[0128] Each of the detection channels includes a first sub-detection channel 6 and a second sub-detection channel 7, which are oppositely arranged. The first sub-detection channel 6 has a first detection part 16 for detecting a biomarker, and the second sub-detection channel 7 has a second detection part 17 for detecting a biomarker. The first detection part 16 and the second detection part 17 are close to each other. The first detection part 16 has a first detection zone 8 and a first silicon nanowire 18. The second detection part 17 has a second detection zone 9 and a second silicon nanowire 19.

[0129] The biosensor has multiple groups of detection channels, which can be individually controlled and adjusted, providing higher flexibility. In addition, in actual detection, the added monoclonal antibody solution can flow to the first detection part and the second detection part at the same time, and the first detection part and the second detection part can obtain current data, respectively. When there is no obvious difference between the two groups of data, it can be judged that the detection result is reliable.

[0130] The first sub-detection channel 6 has a first detection zone 8, a first silicon nanowire 18, a first source electrode 10, a first drain electrode 11, and a first gate electrode 12. The first source electrode 10, the first drain electrode 11, and the first gate electrode 12 are all coated with a film, and the first detection zone 8 is not coated with a film. The coating of the first source electrode 10, the first drain electrode 11, and the first gate electrode 12 can play an insulating role. Only the first detection zone 8 where the nanowire is located is not coated with a film, which avoids the interference of the to-be-detected liquid on the circuit and helps to improve the stability and reliability of the detection current.

[0131] The second sub-detection channel 7 has a second detection zone 9, a second silicon nanowire 19, a second source electrode 13, a second drain electrode 14, and a second gate electrode 15. The second source electrode 13, the second drain electrode 14, and the second gate electrode 15 are all coated with a film, and the second detection zone 9 is not coated with a film. The coating of the second source electrode 13, the second drain electrode 14, and the second gate electrode 15 can play an insulating role. Only the second detection zone 9 where the nanowire is located is not coated with a film, which avoids the interference of the to-be-detected liquid on the circuit and helps to improve the stability and reliability of the detection current.

[0132] In actual detection, the first detection zone 8 of the first detection part 16 is added with the to-be-detected liquid, which will flow to the second detection zone 9 of the second detection part 17 at the same time.

[0133] The first detection part and the second detection part are close to each other, and when the monoclonal antibody solution is added dropwise, the first detection area and the second detection area can be covered at the same time, so that the first nanowire and the second nanowire are simultaneously subjected to antibody modification.

[0134] When the to-be-detected liquid is introduced through the PDMS microchannel, the monoclonal antibodies modified on the surfaces of the first nanowire and the second nanowire can specifically bind to antigens in the to-be-detected liquid. After the first group of electrodes and the second group of electrodes are powered on, the current can be monitored. Because the first detection channel and the second detection channel are simultaneously subjected to antibody modification and the to-be-detected liquid is introduced, two groups of current data can be obtained after power-on. When the two groups of data are analyzed and no obvious difference is found, it can be judged that the detection result is reliable.

[0135] The biosensor is modified with biomarkers FKBP9, CEA, CA19-9 and CA24-2.

[0136] Different biomarkers are detected by the multiple groups of detection channels. For example, the first group of detection channels 2 is modified with the biomarker FKBP9 and is used for detecting the biomarker FKBP9; the second group of detection channels 3 is modified with the biomarker CEA and is used for detecting the biomarker CEA; the third group of detection channels 4 is modified with the biomarker CA19-9 and is used for detecting the biomarker CA19-9; and the fourth group of detection channels 5 is modified with the biomarker CA24-2 and is used for detecting the biomarker CA24-2. Tumor marker detection is commonly used for early diagnosis of CRC, and the sensitivity of single tumor marker detection is relatively low. Joint detection of tumor markers can improve the early detection rate of CRC. The newly discovered tumor marker FKBP9 is combined with the commonly used CRC tumor markers CEA, CA19-9 and CA24-2 for joint detection, which can improve the sensitivity of detection and is helpful for early screening of CRC.

[0137] The voltages applied by the multiple groups of detection channels are different. In actual detection, the voltages can be adjusted as needed.

[0138] The above-mentioned double-gate multi-channel SiNW-FET biosensor is applied to diagnosis and treatment of colorectal cancer.

[0139] In the prior art, the multi-channel silicon nanowire field effect transistor sharing the gate and the drain has relatively single voltage control and can only be synchronously adjusted, and each detection channel cannot be individually controlled. The double-gate multi-channel SiNW-FET biosensor has higher flexibility and controllability: in the multi-channel silicon nanowire field effect transistor with independent electrodes, the electrodes of each channel are independent, each channel can be individually controlled and adjusted, and higher flexibility is provided.

[0140] The utility model discloses a better performance: because each electrode is independent, the multi-channel silicon nanowire field effect tube can more effectively avoid the signal interference between different channels, thereby improving the overall performance of the circuit.

[0141] In addition, the independent electrode design also helps to reduce the noise and power consumption of the circuit, improve the efficiency and stability of the circuit.

[0142] 4, combined detection of colorectal cancer tumor associated proteins

[0143] As shown in Figures 10-11 Combined detection of colorectal cancer tumor associated proteins:

[0144] (1) connect the silicon nanometer biosensor detection system to the Agilent B1500A semiconductor analyzer, the probe of the semiconductor analyzer is connected with the source electrode, the drain electrode, the top gate electrode and the back gate electrode respectively, set the top gate voltage (V TG ), the source-drain voltage (V DS ) and the back gate voltage (V BG ) in the semiconductor analyzer, and adjust the size of the voltage according to the charge characteristics of the tumor marker and the output / transfer curve of SiNW-FET, so that the SiNW-FET biosensor has higher detection sensitivity.

[0145] (2) pump about 300uL 0.01xPBS solution containing 0.5mg / mL bovine serum albumin (BSA) into (80uL / min) the detection system to block the non-specific protein adsorption sites on the surface of the PDMS microchannel, and obtain a stable baseline current (I0) at the same time;

[0146] (3) then slowly pump 0.01xPBS solution containing tumor markers into the detection channel modified with corresponding monoclonal antibodies at 80uL / min, record the source-drain current (I DS ) and the current change (delta I) after the current is stable, and then pump in tumor marker solutions with gradient concentrations for detection;

[0147] (4) switch the probe to the electrodes of other detection channels, set the size of the applied voltage, and pump other tumor marker solutions to be detected into the detection channel modified with corresponding monoclonal antibodies according to steps (2) and (3). Each detection channel detects one tumor marker, so as to realize the combined detection of multiple tumor markers.

[0148] The above description of the embodiments is only for understanding the method of the utility model and its core idea. It should be noted that, for those skilled in the art, without departing from the principles of the utility model, the utility model can be improved and modified in several ways, and these improvements and modifications will also fall within the protection scope of the utility model claims.

Claims

1. A dual-gate multi-channel SiNW-FET biosensor, characterized in that, The biosensor comprises a plurality of groups of detection channels, the detection channels comprising a first sub-detection channel (6) and a second sub-detection channel (7), the first sub-detection channel (6) and the second sub-detection channel (7) being oppositely arranged; the first sub-detection channel (6) has a first detection part (16) for detecting a biomarker, and the second sub-detection channel (7) has a second detection part (17) for detecting a biomarker, the first detection part (16) and the second detection part (17) being close to each other.

2. The dual-gate multi-channel SiNW-FET biosensor of claim 1, wherein, The first sub-detection channel (6) has a first detection area (8), a first silicon nanowire (18), a first source electrode (10), a first drain electrode (11) and a first gate electrode (12); the second sub-detection channel (7) has a second detection area (9), a second silicon nanowire (19), a second source electrode (13), a second drain electrode (14) and a second gate electrode (15).

3. The dual-gate multi-channel SiNW-FET biosensor of claim 2, wherein, The first source electrode (10), the first drain electrode (11) and the first gate electrode (12) are all plated, and the first detection area (8) is not plated.

4. The dual-gate multi-channel SiNW-FET biosensor of claim 3, wherein, The second source electrode (13), the second drain electrode (14) and the second gate electrode (15) are all plated, and the second detection area (9) is not plated.

5. The dual-gate multi-channel SiNW-FET biosensor of claim 4, wherein, The plurality of groups of detection channels comprises a first group of detection channels (2) for detecting a biomarker FKBP9, a second group of detection channels (3) for detecting a biomarker CEA, a third group of detection channels (4) for detecting a biomarker CA19-9, and a fourth group of detection channels (5) for detecting a biomarker CA24-2.

6. The dual-gate multi-channel SiNW-FET biosensor of claim 5, wherein, The biosensor further comprises a back gate electrode (20) and a silicon-based substrate (21).

Images