DNA polynucleotide for targeted insertion of DNA into genes

Abstract

DNA polynucleotide, comprising: a. a first and second splice acceptor sequence, b. a first and second coding sequence, c. a first and second terminator, wherein the first coding sequence is functionally connected to the first splice acceptor and the first terminator, and the second coding sequence is functionally connected to the second splice acceptor and the second terminator, where the first coding sequence, the first splice acceptor and the first terminator are in a tail-to-tail alignment with the second coding sequence, the second splice acceptor and the second terminator, where the first and second coding sequences differ in the nucleic acid sequence, but code for the same amino acids.

Description

SEQUENCE LISTING

[0001] This application contains a sequence listing submitted in ASCII format via EFS-Web, which is hereby incorporated by reference in its entirety. This ASCII copy, created on October 14, 2019, is named SEQUENCE_LISTING_BA2018-4WO_P12987WO00.txt and is 517,036 bytes in size. TECHNICAL FIELD

[0002] This document is in the field of genome editing. More specifically, this document refers to the targeted modification of endogenous genes using infrequently cleaving endonucleases or transposases. BACKGROUND

[0003] Monogenic disorders are caused by one or more mutations in a single gene. Examples include sickle cell disease (hemoglobin beta gene), cystic fibrosis (cystic fibrosis transmembrane conductance regulator gene), and Tay-Sachs disease (beta-hexosaminidase A gene). Monogenic disorders are of interest to gene therapy because replacing the defective gene with a functional copy could provide therapeutic benefit. However, a bottleneck in generating effective therapies is the size of the functional copy of the gene. Many delivery methods, including those using viruses, have size limitations that hinder the delivery of large transgenes. In addition, many genes have alternative splicing patterns, resulting in a single gene encoding multiple proteins. Procedures to correct partial regions of a defective gene may provide an alternative option for treating monogenic disorders.

[0004] WO 2020 / 051396 describes a method for integrating a transgene into the von Willebrand factor gene, the method comprising administering a rare-cutting endonuclease or a transposase directed to a site in the von Willebrand factor gene and administering a transgene, the transgene being integrated into the von Willebrand factor gene. SUMMARY

[0005] Gene editing is a promising method for correcting mutations found in genetic diseases. However, many challenges remain in developing effective therapies for individual diseases, including those caused by gain-of-function mutations or those requiring precise repair. These challenges are seen in diseases such as spinocerebellar ataxia 3 and spinocerebellar ataxia 6, where the disorder is caused by gain-of-function mutations (extended trinucleotide repeats) at the 3' end of genes.

[0006] The DNA polynucleotides described herein offer novel approaches for correcting mutations found at the 3' end of genes. The disclosure herein is based, at least in part, on the design of bimodular DNA polynucleotides compatible with integration by multiple repair pathways. The DNA polynucleotides described herein can be integrated into genes via the homologous recombination pathway, the non-homologous end-joining pathway, or both the homologous recombination and non-homologous end-joining pathways, or by transposition. Furthermore, the outcome of integration in each case (HR, forward NHEJ, reverse NHEJ; forward transposition, or reverse transposition) can lead to precise correction / alteration of the protein product of the target gene. The DNA polynucleotides described herein can be used to fix or introduce mutations in the 3' region of genes of interest.The DNA polynucleotides are particularly useful in cases where precise gene editing is required, or where the mutated endogenous gene being targeted cannot be "replaced" with a synthetic copy because it exceeds the size capacity of standard or viral vectors. The DNA polynucleotides described here can be used for applied research (e.g., gene therapy) or basic research (e.g., creating animal models or understanding gene function).

[0007] The DNA polynucleotides described here are compatible with current in vivo delivery vehicles (e.g., adeno-associated virus vectors and lipid nanoparticles), and they address several challenges in achieving precise modification of gene products.

[0008] The invention relates to a DNA polynucleotide comprising: a. a first and second splice acceptor sequence, b. a first and second coding sequence, c. a first and second terminator, wherein the first coding sequence is operably linked to the first splice acceptor and the first terminator, and the second coding sequence is operably linked to the second splice acceptor and the second terminator, wherein the first coding sequence, the first splice acceptor and the first terminator are in a tail-to-tail alignment with the second coding sequence, the second splice acceptor and the second terminator, wherein the first and second coding sequences differ in nucleic acid sequence but code for the same amino acids.

[0009] In one embodiment, the DNA polynucleotide comprises first and second target sites for one or more infrequently cutting endonucleases, the target sites flanking the first and second splice acceptors. The DNA polynucleotide may be targeted to a site within an intron or at an intron-exon junction. The first and second partial coding sequences are oriented in a tail-to-tail orientation such that integration of the DNA polynucleotide in either direction (i.e., forward or reverse) by NHEJ can result in precise alteration of the protein product of the gene. In other embodiments, the DNA polynucleotide may contain left and right homology arms to enable integration by HR.These DNA polynucleotides can be harbored in an adeno-associated virus (AAV) vector, where the DNA polynucleotide can be integrated via HR (through the homology arms) or by forward NHEJ or reverse NHEJ (by directly integrating the AAV vector into a targeted double-strand break). In one embodiment, vectors having a first and second coding sequence and a left and right homology arm can further contain a first and second site for cleavage by one or more infrequently cutting endonucleases. Cleavage by the one or more infrequently cutting endonucleases can result in the release of a linear DNA polynucleotide with homology arms capable of integration into the genome by HR or NHEJ.In another embodiment, vectors having a first and second coding sequence can be flanked by a first and second site for cleavage by one or more infrequently cutting endonucleases. Cleavage by the one or more infrequently cutting endonucleases can result in the release of a linear DNA polynucleotide capable of integration into the genome by NHEJ. In another embodiment, vectors having a first and second coding sequence can be flanked by a left and right transposon end. Delivery of a CRISPR-associated transposase (e.g., Cas6 / 7 / 8 together with TniQ, TnsA, TnsB, and TnsC) can result in integration of the DNA polynucleotide by transposition.

[0010] The DNA polynucleotide can be used in methods to alter the C-terminus of proteins produced by endogenous genes. In some embodiments, the endogenous gene can comprise the ATXN3 gene or the CACNA1A gene. ATXN3 is a gene encoding the enzyme ataxin-3. Ataxin-3 is a member of the ubiquitin-proteasome system that enables the destruction of excess or damaged proteins. Spinocerebellar ataxia type 3 is a genetic disorder caused by a trinucleotide repeat expansion within the 3' end of the ATXN3 gene. CACNA1A is a gene encoding proteins involved in calcium channel formation. Spinocerebellar ataxia type 6 is a genetic disorder caused by mutations in the CACNA1A gene. The mutations causing SCA6 involve a trinucleotide repeat expansion in the 3' end of the CACNA1A gene.In some embodiments, the DNA polynucleotides provided herein can be used to alter the 3' end of the endogenous ATXN3 gene or CACNA1A gene. In certain embodiments, the target for integration of the transgenes described herein can be intron 9 of the ATXN3 gene or intron 46 of the CACNA1A gene.

[0011] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention relates. Although methods and materials similar or equivalent to those described herein may be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety for all purposes. In case of conflict, the present description, including definitions, shall control. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0012] The details of one or more embodiments of the invention are set forth in the following description. Further features, objects, and advantages of the invention will become apparent from the description and the claims. DESCRIPTION OF THE DRAWINGS Fig. Figure 1 is a representation of the transgenes for targeted insertion into endogenous genes. TS1, target site 1; SA1, splice acceptor site 1; CDS1, coding sequence 1; T1, terminator 1; TS2, target site 2; SA2, splice acceptor site 2; CDS2, coding sequence 2; T2, terminator 2; HA1, homology arm 1; HA2, homology arm 2; BT1, bidirectional terminator 1; AS1, additional sequence 1; AS2, additional sequence 2. Fig.Figure 2 is a diagram illustrating the integration of a transgene into an exemplary gene. The transgene comprises two target sites for one or more infrequently cleaving endonucleases, two splice acceptor sequences, two coding sequences (3.1 and 3.2), and two terminators (T). Integration occurs by non-homologous end joining (NHEJ). Fig. Figure 3 is a diagram illustrating the integration of a transgene into an example gene. The transgene comprises two homology arms, two target sites for one or more rare-cutting endonucleases, two splice acceptor sequences, two coding sequences (3.1 and 3.2), and two terminators. Integration occurs either by homologous recombination (HR) or non-homologous end joining (NHEJ). Fig. Figure 4 is a representation of exon 46, intron 46, and intron 47 of the CACNA1A gene. Also shown is the pB1011-D1 transgene for integration into the CACNA1A gene. Fig. Figure 5 is a representation of the integration results for the pB1011-D1 transgene within the CACNA1A gene. Fig. Figure 6 is a representation of exon 9, intron 9, exon 10, intron 10, and exon 11 of the ATXN3 gene. Also shown is the pB1012-D1 transgene for integration into the ATXN3 gene. Fig. Figure 7 is a representation of the integration results for the pB1012-D1 transgene within the ATXN3 gene. Fig.Figure 8 are images of gels demonstrating the integration of transgenes into the ATXN3 gene. 1, 100-bp ladder with top band running at 1,517 bp; 2, pBA1135 5' junction; 3, pBA1136 5' junction; 4, pBA1137 5' junction; 5, pBA1135 3' junction; 6, pBA1136 3' junction; 7, pBA1137 3' junction; 8, 1-kb ladder with darker bands running at 500 bp, 1,000 bp, and 3,000 bp; 9, 1 kb ladder with darker bands running at 500 bp, 1,000 bp and 3,000 bp; 10, pBA1135 inverted 5' junction; 11, 1 kb ladder with darker bands running at 500 bp, 1,000 bp and 3,000 bp; 12, pBA1136 inverted 5' junction; 13, 1 kb ladder with darker bands running at 500 bp, 1,000 bp and 3,000 bp.000 bp; 14;, primer pair oNJB156+oNJB113; 15, primer pair 114+162; 16, primer pair oNJB116+oNJB113; 17, primer pair oNJB114+oNJB170; 18, primer pair oNJB167+oNJB170; 19, 100 bp ladder with the dark band running at 500 bp; 20, genomic DNA from transfection with pBA1135 and nuclease; 21, genomic DNA from transfection with pBA1136 and nuclease; 22, genomic DNA from transfection with pBA1137 and nuclease; 23, genomic DNA from transfection with water; 24, no DNA control. DETAILED DESCRIPTION

[0013] Disclosed herein are DNA polynucleotides for modifying the coding sequence of endogenous genes and their use as a gene therapy medicament. In some embodiments, the invention relates to inserting a DNA polynucleotide into an endogenous gene, wherein the DNA polynucleotide provides a partial coding sequence that replaces the coding sequence of the endogenous gene. The invention relates to a DNA polynucleotide comprising: a. a first and second splice acceptor sequence, b. a first and second coding sequence, c. a first and second terminator, wherein the first coding sequence is operably linked to the first splice acceptor and the first terminator, and the second coding sequence is operably linked to the second splice acceptor and the second terminator, wherein the first coding sequence, the first splice acceptor and the first terminator are in a tail-to-tail alignment with the second coding sequence, the second splice acceptor and the second terminator, wherein the first and second coding sequences differ in nucleic acid sequence but code for the same amino acids.

[0014] Also described is a method for integrating a DNA polynucleotide or a transgene into an endogenous gene, the method comprising administering a transgene, the transgene comprising a first and a second splice acceptor sequence, a first and a second partial coding sequence, and a bidirectional terminator or a first and a second terminator, and administering one or more infrequently cutting endonucleases targeted to a site within the endogenous gene, whereby the transgene is integrated into the endogenous gene. The method may involve designing the transgene such that the first splice acceptor is operatively linked to the first partial coding sequence and the second splice acceptor is operatively linked to the second partial coding sequence.The arrangement may also include the first partial coding sequence being operatively linked to the first terminator and the second partial coding sequence being operatively linked to the second terminator. The two terminators may be replaced by a single bidirectional terminator. The transgenes may be oriented with the first and second splice acceptors, the first and second partial coding sequences, and the first and second terminators in a tail-to-tail orientation. The transgenes with a tail-to-tail orientation of the sequences may further comprise first and second target sites for one or more infrequently cutting endonucleases, wherein the target sites flank the first and second splice acceptors. The transgenes may comprise left and right homology arms flanking the first and second splice acceptors. The transgene may be harbored within an adeno-associated viral vector.The transgene may further comprise first and second target sites for the one or more infrequently cutting endonucleases, wherein the target sites flank the first and second splice acceptors. The first and second target sites may flank the first and second homology arms. The transgenes described herein may be integrated within an intron of the endogenous gene or at an intron-exon junction. The transgenes may be integrated within an intron or at the intron-exon junction of the ATXN3 gene or the CACNA1A gene. The transgene may comprise first and second partial coding sequences encoding the peptide produced by exon 10 of a non-pathogenic ATXN3 gene and may target intron 9 or the intron 9-exon 10 junction of a pathogenic ATXN3 gene.The transgene may comprise a first and a second partial coding sequence encoding the peptide produced by exon 47 of a non-pathogenic CACNA1A gene and may target intron 46 or the intron 46-exon 47 junction of a pathogenic CACNA1A gene. The infrequently cutting endonuclease may be a CRISPR / Cas12a nuclease or a CRISPR / Cas9 nuclease. The first and second partial coding sequences encode the same amino acids. The first and second coding sequences may differ in nucleic acid sequence but encode the same amino acids. The transgene may be harbored on a vector, with the vector format selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The viral vector may comprise an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector.The methods described herein can be used with a transgene equal to or less than 4.7 kb. The transgene can comprise a first and second partial coding sequence encoding a partial peptide of a functional protein produced by the endogenous target gene. The endogenous target gene can be aberrant.

[0015] The invention relates to DNA polynucleotides comprising: a. a first and second splice acceptor sequence, b. a first and second coding sequence, c. a first and second terminator, wherein the first coding sequence is operably linked to the first splice acceptor and the first terminator, and the second coding sequence is operably linked to the second splice acceptor and the second terminator, wherein the first coding sequence, the first splice acceptor and the first terminator are in a tail-to-tail alignment with the second coding sequence, the second splice acceptor and the second terminator, wherein the first and second coding sequences differ in nucleic acid sequence but code for the same amino acids.

[0016] The DNA polynucleotides having a tail-to-tail orientation of the sequences can further comprise first and second target sites for one or more infrequently cutting endonucleases, wherein the target sites flank the first and second splice acceptors. In another embodiment, the DNA polynucleotides can comprise left and right homology arms flanking the first and second splice acceptors. In this embodiment, the DNA polynucleotide can be harbored within an adeno-associated viral vector. In another embodiment, the DNA polynucleotides can further comprise first and second target sites for one or more infrequently cutting endonucleases, wherein the target sites flank the first and second splice acceptors. The first and second target sites can flank the first and second homology arms.In embodiments, the DNA polynucleotides described herein can be integrated within an intron of the endogenous gene or at an intron-exon junction. The DNA polynucleotides can be integrated within an intron or at the intron-exon junction of the ATXN3 gene or the CACNA1A gene. The DNA polynucleotide can comprise a first and second partial coding sequence encoding the peptide produced by exon 10 of a non-pathogenic ATXN3 gene. The DNA polynucleotide can comprise a first and second partial coding sequence encoding the peptide produced by exon 47 of a non-pathogenic CACNA1A gene. The first and second partial coding sequences encode the same amino acids. In one embodiment, the first and second coding sequences may differ in nucleic acid sequence but encode the same amino acids.The DNA polynucleotides can be harbored on a vector, with the vector format selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The viral vector can be selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The DNA polynucleotides described herein can be equal to or less than 4.7 kb.

[0017] A method for integrating a transgene into an endogenous gene is further described, the method comprising administering a transgene, the transgene comprising left and right transposon ends, first and second splice acceptor sequences, first and second partial coding sequences, and a bidirectional terminator or first and second terminators, and administering a transposase targeting the endogenous gene, whereby the transgene is integrated into the endogenous gene. The method may comprise designing the transgene such that the first splice acceptor is operatively linked to the first partial coding sequence and the second splice acceptor is operatively linked to the second coding sequence. The arrangement may also comprise the first partial coding sequence being operatively linked to the first terminator and the second partial coding sequence being operatively linked to the second terminator.The two terminators can be replaced by a single bidirectional terminator. The transgenes can be oriented with the first and second splice acceptors, the first and second coding sequences, and the first and second terminators in a tail-to-tail orientation. Transgenes with a tail-to-tail orientation of the sequences can further comprise a left and right transposon end flanking the first and second splice acceptors. The transgenes described here can be integrated within an intron of the endogenous gene or at an intron-exon junction. The transgenes can be integrated within an intron or at the intron-exon junction of the ATXN3 gene or the CACNA1A gene.The transgene may comprise a first and second partial coding sequence encoding the peptide produced by exon 10 of a non-pathogenic ATXN3 gene and may target intron 9 or the intron 9-exon 10 junction of a pathogenic ATXN3 gene. The transgene may comprise a first and second partial coding sequence encoding the peptide produced by exon 47 of a non-pathogenic CACNA1A gene and may target intron 46 or the intron 46-exon 47 junction of a pathogenic CACNA1A gene. The transposase may be a CRISPR transposase, wherein the CRISPR transposase comprises the Cas12k or Cas6 protein. The first and second partial coding sequences encode the same amino acids. In one embodiment, the first and second coding sequences may differ in nucleic acid sequence but encode the same amino acids.The transgene can be harbored on a vector, with the vector format selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The viral vector can comprise an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The methods described herein can be used with a transgene equal to or less than 4.7 kb. The left end can comprise the sequence shown in SEQ ID NO:41, and the right end can comprise the sequence shown in SEQ ID NO:13.

[0018] The invention relates to DNA polynucleotides comprising: a. a first and second splice acceptor sequence, b. a first and second coding sequence, c. a first and second terminator, wherein the first coding sequence is operably linked to the first splice acceptor and the first terminator, and the second coding sequence is operably linked to the second splice acceptor and the second terminator, wherein the first coding sequence, the first splice acceptor and the first terminator are in a tail-to-tail alignment with the second coding sequence, the second splice acceptor and the second terminator, wherein the first and second coding sequences differ in nucleic acid sequence but code for the same amino acids.

[0019] The DNA polynucleotides with a tail-to-tail orientation of the sequences may further comprise a left and right transposon end flanking the first and second splice acceptors. In embodiments, the DNA polynucleotides described herein may be integrated within an intron of the endogenous gene or at an intron-exon junction. The DNA polynucleotides may be integrated within an intron or at the intron-exon junction of the ATXN3 gene or the CACNA1A gene. The DNA polynucleotide may comprise a first and second partial coding sequence encoding the peptide produced by exon 10 of a non-pathogenic ATXN3 gene. The DNA polynucleotide may comprise a first and second partial coding sequence encoding the peptide produced by exon 47 of a non-pathogenic CACNA1A gene. The first and second partial coding sequences encode the same amino acids.In one embodiment, the first and second coding sequences may differ in nucleic acid sequence but encode the same amino acids. The DNA polynucleotides may be harbored on a vector, wherein the vector format is selected from double-stranded linear DNA, double-stranded circular DNA, or a viral vector. The viral vector may be selected from an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector. The DNA polynucleotides described herein may be equal to or less than 4.7 kb. The left end may comprise the sequence shown in SEQ ID NO:41, and the right end may comprise the sequence shown in SEQ ID NO:13.

[0020] Also described is a method for integrating a transgene into an endogenous gene, the method comprising administering a transgene, the transgene comprising first and second splice acceptor sequences, first and second coding sequences, a bidirectional terminator, or first and second terminators and first and second homology arms, wherein the transgene is integrated into the endogenous gene. The method may comprise designing the transgene such that the first splice acceptor is operatively linked to the first partial coding sequence and the second splice acceptor is operatively linked to the second coding sequence. The arrangement may also comprise the first partial coding sequence being operatively linked to the first terminator and the second partial coding sequence being operatively linked to the second terminator. The two terminators may be replaced by a single bidirectional terminator.The homology arms can flank the first and second splice acceptor sequences, the first and second coding sequences, the one bidirectional terminator, or the first and second terminators. The coding sequence can encode a complete coding sequence or a partial coding sequence. The transgenes can be oriented with the first and second splice acceptor, the first and second coding sequences, and the first and second terminators in a tail-to-tail orientation. Transgenes with a tail-to-tail orientation of the sequences can further comprise first and second target sites for one or more infrequently cutting endonucleases, the target sites flanking the first and second splice acceptors. The transgenes can comprise left and right homology arms flanking the first and second splice acceptors. The transgene can be harbored within an adeno-associated viral vector.The transgene may further comprise a first and second target site for the one or more infrequently cleaving endonucleases, wherein the target sites flank the first and second splice acceptors. The first and second target sites may flank the first and second homology arms. The transgenes described herein may be integrated within an intron of the endogenous gene or at an intron-exon junction.

[0021] In performing the methods and in preparing and using the compositions disclosed herein, unless otherwise indicated, conventional techniques of molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA, and related fields are employed, as are common in the art. These techniques are described extensively in the literature. See, for example, Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd ed., Cold Spring Harbor Laboratory Press, 1989 and 3rd ed., 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the METHODS IN ENZYMOLOGY series, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, 3rd ed., Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Volume 304, “Chromatin” (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Volume 119, “Chromatin Protocols” (PB Becker, ed.) Humana Press, Totowa, 1999.

[0022] As used herein, the terms "nucleic acid" and "polynucleotide" may be used interchangeably. Nucleic acid and polynucleotide may refer to a deoxyribonucleotide or ribonucleotide polymer in a linear or circular conformation and in single- or double-stranded form. These terms are not intended to be limiting with respect to the length of a polymer. The terms may include both known analogues of natural nucleotides and nucleotides modified in the base, sugar, and / or phosphate moieties.

[0023] The terms "polypeptide," "peptide," and "protein" can be used interchangeably and refer to covalently linked amino acid residues. The term also applies to proteins in which one or more amino acids are chemical analogues or modified derivatives of corresponding naturally occurring amino acids.

[0024] The terms "operatively linked" or "operably linked" are used interchangeably and refer to a juxtaposition of two or more components (e.g., sequence elements) in which the components are arranged such that both components function normally and allow for the possibility that at least one of the components can mediate a function exerted on at least one of the other components. To illustrate, a transcriptional regulatory sequence, such as a promoter, is operatively linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. A transcriptional regulatory sequence is generally operatively linked in cis to a coding sequence, but need not be directly adjacent to it.For example, an enhancer is a transcriptional regulatory sequence that is operatively linked to a coding sequence, even if they are not contiguous. Furthermore, a splice acceptor, for example, may be operatively linked to a partial coding sequence if the splice acceptor allows for the delineation of the 3' boundary of an intron and if translation of the resulting mature mRNA leads to the incorporation of the peptide sequence encoded by the partial coding sequence into the final protein product.

[0025] As used herein, the term "cleavage" refers to the breaking of the covalent backbone of a nucleic acid molecule. Cleavage can be initiated by a variety of methods, including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Cleavage can refer to either a single-stranded nick or a double-stranded break. A double-stranded break can occur as a result of two different single-stranded nicks. Nucleic acid cleavage can result in either blunt ends or staggered ends. In certain embodiments, rare-cutting endonucleases are used for targeted double-stranded or single-stranded DNA cleavage.

[0026] An "exogenous" molecule can refer to a small molecule (e.g., sugars, lipids, amino acids, fatty acids, phenolic compounds, alkaloids) or a macromolecule (e.g., protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide), or a modified derivative of the above molecules, or a complex comprising one or more of the above molecules, that is produced or present outside a cell, or is not normally present in a cell. Exogenous molecules can be introduced into cells. Methods for introducing or "administering" exogenous molecules into cells can include lipid-mediated transfer, electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate coprecipitation, DEAE-dextran-mediated transfer, and viral vector-mediated transfer.As defined herein, "administration" can refer to the delivery, provision, or introduction of exogenous molecules into a cell. When a transgene or infrequent-cutting endonuclease is administered to a cell, the transgene or infrequent-cutting endonuclease is delivered, provided, or introduced into the cell. The infrequent-cutting endonuclease can be administered as a purified protein, as a nucleic acid, or as a mixture of purified protein and nucleic acid. The nucleic acid (i.e., RNA or DNA) can encode the infrequent-cutting endonuclease or a portion of an infrequent-cutting endonuclease (e.g., a gRNA).Administration may be achieved by methods such as lipid-mediated transfer, electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate coprecipitation, DEAE-dextran-mediated transfer, viral vector-mediated transfer, or any other suitable means for delivering purified protein or nucleic acids or a mixture of purified protein and nucleic acids to a cell.

[0027] An "endogenous" molecule is a molecule present in a specific cell at a specific developmental stage under specific environmental conditions. An endogenous molecule can be a nucleic acid, a chromosome, the genome of a mitochondrion, chloroplast, or other organelle, or a naturally occurring episomal nucleic acid. Other endogenous molecules can be proteins, such as transcription factors and enzymes.

[0028] As used herein, a "gene" refers to a coding region of DNA that encodes a gene product, including any DNA regions that regulate the production of the gene product. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and locus control regions. As used herein, a "wild-type gene" refers to a form of the gene that is present at the highest frequency in a given population.

[0029] An “endogenous gene” refers to a region of DNA that is normally present in a particular cell and encodes a gene product, as well as any regions of DNA that regulate the production of the gene product.

[0030] "Gene expression" refers to the conversion of the information contained in a gene into a gene product. A gene product can be the direct transcription product of a gene. The gene product can be, for example, mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA, or a protein produced by translation of an mRNA, but is not limited to these. Gene products also include RNAs modified by processes such as capping, polyadenylation, methylation, and editing, as well as proteins modified by processes such as methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation.

[0031] "Coding" refers to the conversion of the information contained in a nucleic acid into a product, which can arise from the direct transcription product of a nucleic acid sequence. The product can be, for example, but is not limited to, mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA, or a protein produced by translation of an mRNA. Gene products also include RNAs modified by processes such as capping, polyadenylation, methylation, and editing, as well as proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation.

[0032] A “target site” or “target sequence” defines a section of nucleic acid to which a rare-cutting endonuclease or a CRISPR-associated transposase will bind, provided sufficient conditions for binding exist.

[0033] The term "recombination" as used here refers to a process of exchanging genetic information between two polynucleotides. The term "homologous recombination (HR)" refers to a specific form of recombination that can occur, for example, in the repair of double-strand breaks. Homologous recombination requires nucleotide sequence homology present on a "donor" molecule. The donor molecule can be used by the cell as a template for repairing a double-strand break. Information within the donor molecule that differs from the genomic sequence at or near the double-strand break can be stably incorporated into the cell's genomic DNA.

[0034] The term "integrating" as used herein refers to the process of adding DNA to a target region of DNA. As described herein, integration can be facilitated by various means, including non-homologous end joining, homologous recombination, or targeted transposition. For example, the integration of a user-supplied DNA molecule into a target gene can be facilitated by non-homologous end joining. This involves making a targeted double-strand break within the target gene and administering a user-supplied DNA molecule. The user-supplied DNA molecule can include exposed DNA ends to facilitate capture during repair of the target gene by non-homologous end joining. The exposed ends can be present on the DNA molecule upon administration (i.e., administration of a linear DNA molecule) or generated upon administration to the cell (i.e.A rare-cutting endonuclease cleaves the user-supplied DNA molecule inside the cell to expose the ends. Additionally, the user-supplied DNA molecule can be harbored on a viral vector, including an adeno-associated viral vector. In another example, integration occurs by homologous recombination. Here, the user-supplied DNA can harbor a left and right homology arm. In another example, integration occurs by transposition. Here, the user-supplied DNA harbors a left and right transposon end.

[0035] The term "transgene" as used herein refers to a sequence of nucleic acids that can be transferred to an organism or cell. The transgene may comprise a gene or sequence of nucleic acids that is not normally present in the target organism or cell. Additionally, the transgene may comprise a copy of a gene or sequence of nucleic acids that is normally present in the target organism or cell. A transgene may be an exogenous DNA sequence that is introduced into the cytoplasm or nucleus of a target cell. In one embodiment, the transgenes described herein contain partial coding sequences, wherein the partial coding sequences encode a portion of a protein produced by a gene in the host cell.

[0036] As used here, the term "pathogenic" refers to anything that can cause disease. A pathogenic mutation can refer to a change in a gene that causes disease. A pathogenic gene refers to a gene that contains a modification that causes disease. As an example, a pathogenic ATXN3 gene in patients with spinocerebellar ataxia 3 refers to an ATXN3 gene with an expanded CAG trinucleotide repeat, where the expanded CAG trinucleotide repeat causes the disease.

[0037] As used herein, the term "tail-to-tail" refers to an orientation of two units in opposite and reverse directions. The two units can be two sequences on a single nucleic acid molecule, with the 3' end of each sequence placed side by side. For example, a first nucleic acid having the elements, in a 5' to 3' direction, [splice acceptor 1] - [partial coding sequence 1] - [terminator 1] and a second nucleic acid having the elements [splice acceptor 2] - [partial coding sequence 2] - [terminator 2] can be placed in a tail-to-tail orientation, resulting in [splice acceptor 1] - [partial coding sequence 1] - [terminator 1] - [terminator 2 RC] - [partial coding sequence 2 RC] - [splice acceptor 2 RC], where RC refers to the reverse complement.

[0038] The term "intron-exon junction" refers to a specific location within a gene. The specific location lies between the last nucleotide in an intron and the first nucleotide of the following exon. When a transgene described here is integrated, the transgene can be integrated within the "intron-exon junction." If the transgene contains cargo, the cargo is integrated immediately after the last nucleotide in the intron. In some cases, integration of a transgene within the intron-exon junction can result in removal of the sequence within the exon (e.g., integration via HR and replacement of the sequence within the exon with the cargo within the transgene).

[0039] As used herein, the term "homologous" refers to a sequence of nucleic acids or amino acids with similarity to a second sequence of nucleic acids or amino acids. In some embodiments, the homologous sequences may have at least 80% sequence identity (e.g., 81%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity) to each other.

[0040] As used herein, the term "partial coding sequence" refers to a nucleic acid sequence that encodes a partial protein. The partial coding sequence may encode a protein that has one or fewer amino acids compared to the wild-type or functional protein. The partial coding sequence may encode a partial protein with homology to the wild-type or functional protein. The term "partial coding sequence," with respect to ATXN3, refers to a sequence of nucleic acids that encodes a partial ATXN3 protein. The partial ATXN3 protein has one or fewer amino acids compared to a wild-type ATXN3 protein. If the 3' end of the gene is modified, the one or fewer amino acids may come from the N-terminal end of the protein.If the ATXN3 gene has 11 exons, then the partial coding sequence may include a sequence encoding the peptide produced by exons 2-11 or 3-11 or 4-11 or 5-11 or 6-11 or 7-11 or 8-11 or 9-11 or 10-11 or 11.

[0041] The methods and compositions described in this document may utilize transgenes with a cargo sequence. The term "cargo" may refer to elements such as the complete or partial coding sequence of a gene, a partial sequence of a gene with single nucleotide polymorphisms relative to the WT or altered target, a splice acceptor, a terminator, a transcriptional regulatory element, purification tags (e.g., glutathione S-transferase, poly(His), maltose-binding protein, Strep-tag, Myc-tag, AviTag, HA-tag, or chitin-binding protein), or reporter genes (e.g., GFP, RFP, lacZ, cat, luciferase, puro, neomycin). As defined herein, "cargo" may refer to the sequence within a transgene that is integrated at a target site.For example, “cargo” can refer to the sequence on a transgene between two homology arms, two target sites for a rare-cutting endonuclease, or a left and right transposon end.

[0042] The term "homology sequence" refers to a sequence of nucleic acids that has homology to a second nucleic acid. The homology sequence may, for example, be present on a donor molecule as an "arm with homology" or a "homology arm." A homology arm may be a sequence of nucleic acids within a donor molecule that facilitates homologous recombination with the second nucleic acid. As defined herein, a homology arm may also be referred to as an "arm." In a donor molecule with two homology arms, the homology arms may be referred to as "arm 1" and "arm 2." In one aspect, a cargo sequence may be flanked by first and second homology arms.

[0043] The term "bidirectional terminator" refers to a terminator that can terminate RNA polymerase transcription in either the sense or antisense direction. Unlike two unidirectional terminators in tail-to-tail orientation, a bidirectional terminator can encompass a non-chimeric DNA sequence. Examples of bidirectional terminators include the ARO4, TRP1, TRP4, ADH1, CYC1, GAL1, GAL7, and GAL10 terminators.

[0044] A 5' or 3' end of a nucleic acid molecule refers to the orientation and chemical orientation of the nucleic acid. As defined here, the "5' end of a gene" may include the exon containing the start codon, but not the exon containing the stop codon. As defined here, the "3' end of a gene" may include the exon containing the stop codon, but not the exon containing the start codon.

[0045] The term "ATXN3" gene refers to a gene encoding the enzyme ataxin-3. A representative sequence of the ATXN3 gene can be found at NCBI Reference Sequence: NG_008198.2 and the corresponding SEQ ID NO: 42. The exon and intron boundaries can be defined using the sequence given in SEQ ID NO: 42. Specifically, exon 1 comprises the sequence from 1 to 54. Exon 2 comprises the sequence from 9745 to 9909. Exon 3 comprises the sequence from 10446 to 10490. Exon 4 comprises the sequence from 12752 to 12837. Exon 5 comprises the sequence from 13265 to 13331. Exon 6 comprises the sequence from 17766 to 17853. Exon 7 comprises the sequence from 23325 to 23457. Exon 8 comprises the sequence from 24117 to 24283. Exon 9 comprises the sequence from 25522 to 25618. Exon 10 comprises the sequence from 35530 to 35648. Exon 11 comprises the sequence from 42169 to 48031. Intron 1 covers the sequence from 55 to 9744. Intron 2 covers the sequence from 9910 to 10445. Intron 3 covers the sequence from 10491 to 12751.Intron 4 covers the sequence from 12838 to 13264. Intron 5 covers the sequence from 13332 to 17765. Intron 6 covers the sequence from 17854 to 23324. Intron 7 covers the sequence from 23458 to 24116. Intron 8 covers the sequence from 24284 to 25521. Intron 9 covers the sequence from 25619 to 35529. Intron 10 covers the sequence from 35649 to 42168.

[0046] The term "CACNA1A" gene refers to a gene encoding the protein calcium voltage-gated channel subunit alpha1A. A representative sequence of the CACNA1A gene can be found at NCBI Reference Sequence: NG_011569.1 and the corresponding SEQ ID NO: 43. The exon and intron boundaries can be defined using the sequence given in SEQ ID NO: 43. Specifically, exon 1 comprises the sequence from 1 to 529. Exon 2 comprises the sequence from 51249 to 51354. Exon 3 comprises the sequence from 53446 to 53585. Exon 4 comprises the sequence from 134682 to 134773. Exon 5 comprises the sequence from 140992 to 141144. Exon 6 comprises the sequence from 146662 to 146855. Exon 7 comprises the sequence from 170552 to 170655. Exon 8 comprises the sequence from 171968 to 172083. Exon 9 comprises the sequence from 173536 to 173592. Exon 10 comprises the sequence from 176125 to 176217. Exon Exon 11 covers the sequence from 189140 to 189349. Exon 12 covers the sequence from 193680 to 193792.Exon 13 comprises the sequence from 197933 to 198045. Exon 14 comprises the sequence from 198210 to 198341. Exon 15 comprises the sequence from 198607 to 198679. Exon 16 comprises the sequence from 202577 to 202694. Exon 17 comprises the sequence from 202848 to 202915. Exon 18 comprises the sequence from 205805 to 205911. Exon 19 comprises the sequence from 207108 to 207917. Exon 20 comprises the sequence from 219495 to 219958. Exon 21 comprises the sequence from 221255 to 221393. Exon 22 comprises the sequence from 223065 to 223194. Exon 23 comprises the sequence from 229333 to 229392. Exon 24 comprises the sequence from 230505 to 230611. Exon 25 comprises the sequence from 243628 to 243727. Exon 26 comprises the sequence from 244851 to 245011. Exon 27 comprises the sequence from 246760 to 246897. Exon 28 comprises the sequence from 248910 to 249111. Exon 29 comprises the sequence from 251202 to 251366. Exon 30 comprises the sequence from 253360 to 253470. Exon 31 comprises the sequence from 261196 to 261279.Exon 32 comprises the sequence from 270731 to 270847. Exon 33 comprises the sequence from 271187 to 271252. Exon 34 comprises the sequence from 271425 to 271540. Exon 35 comprises the sequence from 274601 to 274751. Exon 36 comprises the sequence from 276252 to 276379. Exon 37 comprises the sequence from 277666 to 277762. Exon 38 comprises the sequence from 281689 to 281794. Exon 39 comprises the sequence from 291853 to 291960. Exon 40 comprises the sequence from 292128 to 292228. Exon 41 comprises the sequence from 293721 to 293830. Exon 42 covers the sequence from 293939 to 294077. Exon 43 covers the sequence from 294245 to 294358. Exon 44 covers the sequence from 295809 to 295844. Exon 45 covers the sequence from 296963 to 297149. Exon 46 covers the sequence from 297452 to 297705. Exon 47 covers the sequence from 298413 to 300019. Intron 1 covers the sequence from 530 to 51248. Intron 2 covers the sequence from 51355 to 53445. Intron 3 covers the sequence from 53586 to 134681.Intron 4 comprises the sequence from 134774 to 140991. Intron 5 comprises the sequence from 141145 to 146661. Intron 6 comprises the sequence from 146856 to 170551. Intron 7 comprises the sequence from 170656 to 171967. Intron 8 comprises the sequence from 172084 to 173535. Intron 9 comprises the sequence from 173593 to 176124. Intron 10 comprises the sequence from 176218 to 189139. Intron 11 comprises the sequence from 189350 to 193679. Intron 12 comprises the sequence from 193793 to 197932. Intron 13 comprises the sequence from 198046 to 198209. Intron 14 comprises the sequence from 198342 to 198606. Intron 15 comprises the sequence from 198680 to 202576. Intron 16 comprises the sequence from 202695 to 202847. Intron 17 comprises the sequence from 202916 to 205804. Intron 18 comprises the sequence from 205912 to 207107. Intron 19 comprises the sequence from 207918 to 219494. Intron 20 comprises the sequence from 219959 to 221254. Intron 21 comprises the sequence from 221394 to 223064. Intron 22 comprises the sequence from 223195 to 229332.Intron 23 comprises the sequence from 229393 to 230504. Intron 24 comprises the sequence from 230612 to 243627. Intron 25 comprises the sequence from 243728 to 244850. Intron 26 comprises the sequence from 245012 to 246759. Intron 27 comprises the sequence from 246898 to 248909. Intron 28 comprises the sequence from 249112 to 251201. Intron 29 comprises the sequence from 251367 to 253359. Intron 30 comprises the sequence from 253471 to 261195. Intron 31 comprises the sequence from 261280 to 270730. Intron 32 comprises the sequence from 270848 to 271186. Intron 33 comprises the sequence from 271253 to 271424. Intron 34 comprises the sequence from 271541 to 274600. Intron 35 comprises the sequence from 274752 to 276251. Intron 36 comprises the sequence from 276380 to 277665. Intron 37 comprises the sequence from 277763 to 281688. Intron 38 comprises the sequence from 281795 to 291852. Intron 39 comprises the sequence from 291961 to 292127. Intron 40 comprises the sequence from 292229 to 293720.Intron 41 comprises the sequence from 293831 to 293938. Intron 42 comprises the sequence from 294078 to 294244. Intron 43 comprises the sequence from 294359 to 295808. Intron 44 comprises the sequence from 295845 to 296962. Intron 45 comprises the sequence from 297150 to 297451. Intron 46 comprises the sequence from 297706 to 298412.

[0047] The percentage sequence identity between a given nucleic acid or amino acid sequence and a sequence referenced by a particular sequence identification number is determined as follows. First, a nucleic acid or amino acid sequence is compared to the sequence referenced by a particular sequence identification number using the BLAST 2 Sequences (Bl2seq) program from the standalone version of BLASTZ, which includes BLASTN version 2.0.14 and BLASTP version 2.0.14. This standalone version of BLASTZ can be obtained online at fr.com / blast or at ncbi.nlm.nih.gov. Instructions for using the Bl2seq program can be found in the BLASTZ readme file. Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used for comparing nucleic acid sequences, while BLASTP is used for comparing amino acid sequences.To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to an arbitrary filename (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default settings. For example, the following command can be used: B. can be used to generate an output file containing a comparison between two sequences: C:\Bl2seq -ic:\seq1.txt -jc:\seq2.txt - p blastn -oc:\output.txt -q -1 -r 2. To compare two amino acid sequences, the Bl2seq options are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g. C:\seq1.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any filename (e.g., C:\output.txt); and all other options are left at their default settings. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\Bl2seq -ic:\seq1.txt -jc:\seq2.txt -p blastp -oc:\output.txt. If the two compared sequences share homology, the specified output file will display these regions of homology as sequence alignments. If the two compared sequences do not share homology, the specified output file will not display any sequence alignments.

[0048] After alignment, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is present in both sequences. Percent sequence identity is determined by dividing the number of matches by either the length of the sequence in the identified sequence or by an articulated length (e.g., 100 consecutive nucleotides or amino acid residues from one sequence in an identified sequence), followed by multiplying the resulting value by 100. The percent sequence identity value is rounded to the nearest tenth.

[0049] Methods are described for modifying the 3' end of endogenous genes, wherein endogenous genes have at least one intron between two coding exons. The intron can be any intron that is removed from the precursor messenger RNA by the normal messenger RNA processing machinery. The intron can be between 20 bp and >500 kb in size and can include elements such as a splice donor site, a branch sequence, and an acceptor site. The transgenes disclosed herein for modifying the 3' end of endogenous genes can include multiple functional elements, including target sites for infrequently cutting endonucleases, homology arms, splice acceptor sequences, coding sequences, and transcription terminators ( Fig. 1).

[0050] In one embodiment, the transgene comprises two target sites for one or more infrequently cutting endonucleases. The target sites may have a suitable sequence and length for cleavage by an infrequently cutting endonuclease. The target sites may be suitable for cleavage by CRISPR systems, TAL effector nucleases, zinc-finger nucleases, or meganucleases, or a combination of CRISPR systems, TALE nucleases, zinc-finger nucleases, or meganucleases, or any other site-specific nuclease. The target sites may be positioned such that cleavage by the infrequently cutting endonuclease results in the release of a transgene from a vector. The vector may comprise viral vectors (e.g., adeno-associated vectors) or non-viral vectors (e.g., plasmids, minicircle vectors). If the transgene comprises two target sites, the target sites may be the same sequence (i.e.,, they are attacked by the same infrequently cutting endonuclease) or they can be different sequences (i.e., they are attacked by two or more different infrequently cutting endonucleases).

[0051] In one embodiment, the transgene comprises a first and second target site for one or more infrequently cutting endonucleases, along with first and second homology arms. The first and second homology arms may contain a sequence homologous to a genomic sequence at or near the desired integration site. The homology arms may be of a suitable length to participate in homologous recombination with the sequence at or near the desired integration site. The length of each homology arm can range from 20 nt to 10,000 nt (e.g., 20 nt, 30 nt, 40 nt, 50 nt, 100 nt, 200 nt, 300 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1,000 nt, 2,000 nt, 3,000 nt, 4,000 nt, 5,000 nt, 6,000 nt, 7,000 nt, 8,000 nt, 9,000 nt, 10,000 nt).In one embodiment, a homology arm may comprise functional elements, including a target site for a rare-cutting endonuclease and / or a splice acceptor sequence. In one embodiment, a first homology arm (e.g., a left homology arm) may comprise a sequence homologous to the targeted intron, including the splice acceptor site of the targeted intron. In another embodiment, a second homology arm may comprise a sequence homologous to a genomic sequence downstream of the targeted intron (e.g., an exon sequence, a 3' UTR sequence). However, the second homology arm must not possess splice acceptor functions in the reverse complement direction. To determine whether a sequence possesses splice acceptor functions, several steps can be taken, including in silico analyses and experimental testing.To determine whether potential for splice acceptor function exists, the sequence desired for the second homology arm can be screened for consensus branch sequences (e.g., YTRAC) and splice acceptor sites (e.g., Y-rich NCAGG). If branch or splice acceptor sequences are present, single-nucleotide polymorphisms can be introduced to disrupt function, or a different, but adjacent, sequence can be selected that does not contain such sequences. Preferably, the window of sequence that can be used for a second homology arm extends from 1 bp to 10 kb downstream of the intron targeted for integration. To experimentally determine whether the second homology possesses splice acceptor function, a synthetic construct can be constructed that includes the second homology arm within an intron in a reporter gene.The construct can then be administered to a suitable cell type and monitored for splicing function.

[0052] In one embodiment, the transgene comprises two splice acceptor sequences, referred to herein as first and second splice acceptor sequences. The first and second splice acceptor sequences are positioned in opposite directions (i.e., tail-to-tail orientation) within the transgene and flank internal sequences (i.e., coding sequences and terminators). When the transgene is integrated into an intron in the forward or reverse direction, the splice acceptor sequences facilitate the removal of the adjacent / upstream intron sequence during mRNA processing. The first and second splice acceptor sequences may be the same sequences or different sequences. One or both splice acceptor sequences may be the splice acceptor sequence of the intron into which the transgene is to be integrated.One or both splice acceptor sequences may be a synthetic splice acceptor sequence or a splice acceptor sequence from an intron of another gene.

[0053] In one embodiment, the transgene comprises a first and a second coding sequence operatively linked to the first and second splice acceptor sequences. The first and second coding sequences are positioned in opposite directions within the transgene (i.e., in tail-to-tail orientation). When the transgene is integrated into an endogenous gene in the forward or reverse direction, the first or second coding sequence is transcribed into mRNA by the promoter of the endogenous gene. The coding sequences can be designed to correct defective coding sequences, introduce mutations, or introduce new peptide sequences. The first and second coding sequences can be the same nucleic acid sequence and encode the same protein. Alternatively, the first and second coding sequences can be different nucleic acid sequences and encode the same protein (i.e.,by exploiting codon degeneracy). The coding sequence may encode purification tags (e.g., glutathione S-transferase, poly(His), maltose-binding protein, Strep-tag, Myc-tag, AviTag, HA-tag, or chitin-binding protein) or reporter proteins (e.g., GFP, RFP, lacZ, cat, luciferase, puro, neomycin). In one embodiment, the transgene comprises first and second partial coding sequences operably linked to first and second splice acceptor sequences, and the transgene does not comprise a promoter.

[0054] In one embodiment, the transgene may comprise a bidirectional terminator or first and second terminators operatively linked to first and second coding sequences. The bidirectional terminator or first and second terminators are positioned in opposite directions within the transgene (i.e., in a tail-to-tail orientation). When the transgene is integrated into an endogenous gene in a forward or reverse direction, the bidirectional terminator or first and second terminators terminate transcription from the promoter of the endogenous gene. The first and second terminators may be the same terminators or different terminators.

[0055] In one embodiment, this document provides a transgene comprising first and second target sites for a rare-cutting endonuclease, first and second splice acceptor sequences, first and second coding sequences, and a bidirectional terminator or first and second terminators. The transgene can be integrated into endogenous genes via non-homology-dependent methods, including non-homologous end joining and alternative non-homologous end joining, or by microhomology-mediated end joining. In one aspect, the transgene is integrated into an intron within the endogenous gene ( Fig. 2).

[0056] In another embodiment, this document provides a transgene comprising first and second homology arms, first and second target sites for a rare-cutting endonuclease, first and second splice acceptor sequences, first and second coding sequences, and a bidirectional terminator or first and second terminators. The transgene can be integrated into endogenous genes via both homology-dependent methods (e.g., synthesis-dependent strand annealing and microhomology-mediated end joining) and non-homology-dependent methods (e.g., non-homologous end joining and alternative non-homologous end joining). In one aspect, the transgene is integrated into an intron within the endogenous gene ( Fig. 3). In another aspect, the transgene is integrated at the end of the intron or at the beginning of the downstream exon ( Fig. 3).

[0057] In another embodiment, this document provides a transgene comprising first and second homology arms, first and second coding sequences, first and second splice acceptor sequences, and a bidirectional terminator or first and second terminators ( Fig. 1). In another embodiment, this document provides a transgene comprising a first and second coding sequence, a first and second splice acceptor sequence, and a bidirectional terminator or a first and second terminator.

[0058] In a further embodiment, this document provides a transgene comprising first and second homology arms, first and second coding sequences, first and second splice acceptor sequences, a bidirectional terminator or first and second terminators, and first and second additional sequences ( Fig.1). In certain embodiments, the additional sequence can be any additional sequence present on the transgene at the 5' and 3' ends, however, the additional sequence should not include an element that functions as a splice acceptor. The additional sequence can be, for example, inverted terminal repeats of a viral genome. The additional sequence can be present on a transgene that has a linear format. The linear format allows for integration by NHEJ. For example, a transgene harbored in an adeno-associated viral vector, where the additional sequence is the inverted terminal repeats, can be integrated directly by NHEJ at a target site after cleavage by a rare-cutting endonuclease (i.e., no processing of the transgene is required). In another example, the additional sequence is a left and right transposon end.

[0059] In another embodiment, this document provides transgenes within viral vectors, including adeno-associated viruses and adenoviruses, wherein the transgene comprises a first and second splice acceptor sequence, a first and second coding sequence, and a bidirectional terminator or a first and second terminator. Due to the inverted terminal repeats of the viral vectors, the transgenes also comprise a first and second additional sequence.

[0060] In another embodiment, this document provides transgenes within viral vectors, including adeno-associated viruses and adenoviruses, wherein the transgene comprises first and second homology arms, first and second splice acceptor sequences, first and second coding sequences, and a bidirectional terminator or first and second terminators. Due to the inverted terminal repeats of the viral vectors, the transgenes also comprise first and second additional sequences.

[0061] In some embodiments, the transgenes provided herein can be integrated with transposases. The transposases can include CRISPR transposases (Strecker et al., Science 10.1126 / science.aax9181, 2019; Klompe et al., Nature, 10.1038 / s41586-019-1323-z, 2019). The transposases can be used in combination with a transgene comprising a first and a second splice acceptor sequence, a first and a second coding sequence, a bidirectional terminator, or a first and a second terminator ( Fig.1) and a left and right transposon end. The CRISPR transposases may comprise the Type V-U5, C2C5 CRISPR protein, Cas12k, along with the proteins tnsB, tnsC, and tniQ. In some embodiments, the Cas12k may be from Scytonema hofmanni (SEQ ID NO: 30) or Anabaena cylindrica (SEQ ID NO: 31). In one embodiment, the transgenes described herein, comprising a left (SEQ ID NO: 32) and a right transposon end (SEQ ID NO: 33), may be delivered to cells along with ShCas12k, tnsB, tnsC, TniQ, and a gRNA (SEQ ID NO: 14). Alternatively, the CRISPR transposase may contain the Cas6 protein along with auxiliary proteins such as Cas7, Cas8, and TniQ.In one embodiment, the transgenes described herein, comprising a left (SEQ ID NO:41) and right transposon end (SEQ ID NO:13), can be delivered to eukaryotic cells along with Cas6 (SEQ ID NO:37), Cas7 (SEQ ID NO:37), Cas8 (SEQ ID NO:37), TniQ (SEQ ID NO:37), TnsA (SEQ ID NO:37), TnsB (SEQ ID NO:37), TnsC (SEQ ID NO:37), and a gRNA (SEQ ID NO:12). The proteins can be administered directly to the cells as purified protein or can be encoded on RNA or DNA. If encoded on RNA or DNA, the sequence can be codon-optimized for expression in eukaryotic cells. The gRNA (SEQ ID NO:12) can be placed downstream of an RNA polIII promoter and terminated with a poly(T) terminator.

[0062] In some embodiments, the transgenes described herein may comprise a combination of elements including splice acceptors, partial coding sequences, terminators, homology arms, left and right transposase ends, and sites for cleavage by rare-cutting endonucleases. In one embodiment, the combination from 5' to 3' may be: [Splice Acceptor 1] - [Partial Coding Sequence 1] - [Terminator 1] - [Terminator 2 RC] - [Partial Coding Sequence 2 RC] - [Splice Acceptor 2 RC], where RC represents the reverse complement. This combination may be harbored on a linear DNA molecule or an AAV molecule and may be integrated into the target gene by NHEJ through a targeted break.In another embodiment, the combination from 5' to 3' can be: [Cleavage site of infrequently cutting endonuclease 1] - [Splice acceptor 1] - [Partial coding sequence 1] - [Terminator 1] - [Terminator 2 RC] - [Partial coding sequence 2 RC] - [Splice acceptor 2 RC] - [Cleavage site of infrequently cutting endonuclease 1]. In another embodiment, the combination from 5' to 3' can be: [Cleavage site of infrequently cutting endonuclease 1] - [Homology arm 1] - [Splice acceptor 1] - [Partial coding sequence 1] - [Terminator 1] - [Terminator 2 RC] - [Partial coding sequence 2 RC] - [Splice acceptor 2 RC] - [Homology arm 2] - [Cleavage site of infrequently cutting endonuclease 2]. In this combination, one or more infrequently cutting endonucleases can be used to enable HR and NHEJ. For example, a single infrequently cutting nuclease can target the target gene (ie,a desired intron), and the cleavage sites flanking the homology arms can be designed to represent the same target sequence within the intron. In another embodiment, the combination from 5' to 3' can be as follows: [homology arm 1 + cleavage site of infrequently cutting endonuclease 1] - [splice acceptor 1] - [partial coding sequence 1] - [terminator 1] - [terminator 2 RC] - [partial coding sequence 2 RC] - [splice acceptor 2 RC] - [homology arm 2] - [cleavage site of infrequently cutting endonuclease 1]. In this combination, one or more infrequently cutting endonucleases can enable HR and NHEJ. For example, a single infrequently cutting nuclease can cleave within homology arm 1, downstream of homology arm 2, and at the genomic target site (i.e., at the site of homology to the sequence in homology arm 1).In another embodiment, the combination of 5' to 3' may be as follows: [left end for a transposase] - [splice acceptor 1] - [partial coding sequence 1] - [terminator 1] - [terminator 2 RC] - [partial coding sequence 2 RC] - [splice acceptor 2 RC] - [right end for a transposase]. In all embodiments, splice acceptor 1 and splice acceptor 2 may be the same or different sequences; partial coding sequence 1 and partial coding sequence 2 may be the same or different sequences; terminator 1 and terminator 2 may be the same or different sequences.

[0063] In embodiments, a transgene comprising the structure [infrequent cutting endonuclease 1 cleavage site] - [homology arm 1] - [splice acceptor 1] - [partial coding sequence 1] - [terminator 1] - [terminator 2 RC] - [partial coding sequence 2 RC] - [splice acceptor 2 RC] - [homology arm 2] - [infrequent cutting endonuclease 2 cleavage site] can be integrated into DNA by delivering one or more infrequent cutting endonucleases. When an infrequent cutting endonuclease is delivered, the infrequent cutting endonuclease can release the transgene by cleaving at the infrequent cutting endonuclease 1 and 2 cleavage site. Furthermore, the same infrequent cutting endonuclease can create a break within the target gene, simulating insertion by HR or NHEJ.

[0064] In other embodiments, a transgene comprising the structure [homology arm 1 + cleavage site of infrequently cutting endonuclease 1] - [splice acceptor 1] - [partial coding sequence 1] - [terminator 1] - [terminator 2 RC] - [partial coding sequence 2 RC] - [splice acceptor 2 RC] - [homology arm 2] - [cleavage site of infrequently cutting endonuclease 1] can be integrated into DNA by delivering one or more infrequently cutting endonucleases. When an infrequently cutting endonuclease is delivered, the infrequently cutting endonuclease can release the transgene by cleaving at the cleavage site of infrequently cutting endonuclease 1 and 2. Furthermore, the same infrequently cutting endonuclease can create a break within the target gene, simulating insertion by HR or NHEJ. Integration by HR can occur when the cleavage occurs upstream of the integration site (i.e., within a homology arm).

[0065] In embodiments, the site for transgene integration may be an intron or an intron-exon junction. When targeting an intron, the partial coding sequence may comprise a sequence encoding the peptide produced by the following exons within the endogenous gene. For example, if the transgene is designed to integrate into intron 9 of an endogenous gene with 11 exons, the partial coding sequence may comprise a sequence encoding the peptide produced by exons 10 and 11 of the endogenous gene. When targeting an intron-exon junction, the transgene may be designed to include homology arms with a sequence homologous to the 3' of said intron.

[0066] In some embodiments, the partial coding sequences may be complete coding sequences. The complete coding sequence may encode an endogenous gene (e.g., Factor VIII, Factor IX, or INS) or reporter genes (e.g., RFP, GFP, cat, lacZ, luciferase). The complete coding sequences may be operatively linked to splice acceptors and terminators and placed in a transgene in a tail-to-tail orientation.

[0067] The methods and compositions provided herein can be used to modify endogenous genes within cells. Endogenous genes may include: fibrinogen, prothrombin, tissue factor, factor V, factor VII, factor VIII, factor IX, factor X, factor XI, factor XII (Hageman factor), factor XIII (fibrin-stabilizing factor), von Willebrand factor, prekallikrein, high molecular weight kininogen (Fitzgerald factor), fibronectin, antithrombin III, heparin cofactor II, protein C, protein S, protein Z, protein Z-related protease inhibitor, plasminogen, alpha-2 antiplasmin, tissue plasminogen activator, urokinase, plasminogen activator inhibitor-1, plasminogen activator inhibitor-2, glucocerebrosidase (GBA), α-galactosidase A (GLA), iduronate sulfatase (IDS), iduronidase (IDUA), acid sphingomyelinase (SMPD1), MMAA, MMAB, MMACHC, MMADHC (C2orf25), MTRR, LMBRD1, MTR, Propionyl-CoA carboxylase (PCC) (subunits PCCA and / or PCCB),a glucose-6-phosphate transporter (G6PT) protein or glucose-6-phosphatase (G6Pase), an LDL receptor (LDLR), ApoB, LDLRAP-1, a PCSK9, a mitochondrial protein such as NAGS (N-acetylglutamate synthetase), CPS1 (carbamoylphosphate synthetase I) and OTC (ornithine transcarbamylase), ASS (arginine succinic acid synthetase), ASL (arginine succinic acid lyase) and / or ARG1 (arginase), and / or a solute carrier family 25 (SLC25A13, an aspartate / glutamate carrier) protein, a UGT1A1 or UDP-glucuronsyltransferase polypeptide A1, a fumarylacetoacetate hydrolyase (FAH), an alanine glyoxylate aminotransferase (AGXT) protein, a glyoxylate reductase / hydroxypyruvate reductase (GRHPR) protein, a transthyretin gene (TTR) protein, an ATP7B protein, a phenylalanine hydroxylase (PAH) protein, a USH2A protein, an ATXN protein, and a lipoprotein lyase (LPL) protein.

[0068] The transgene may contain a sequence for modifying the sequence encoding a polypeptide that is missing or nonfunctional or has a gain-of-function mutation in the subject with a genetic disease, including, but not limited to, the following genetic diseases: achondroplasia, achromatopsia, acid maltase deficiency, adenosine deaminase deficiency, adrenoleukodystrophy, Aicardi syndrome, alpha-1 antitrypsin deficiency, alpha thalassemia, androgen insensitivity syndrome, Pert syndrome, arrhythmogenic right ventricular dysplasia, ataxia-telangictasia, Barth syndrome, beta thalassemia, blue rubber bleb nevus syndrome, Canavan disease, chronic granulomatous diseases (CGD), Cri du Chat syndrome, cystic fibrosis, Dercum's disease, ectodermal dysplasia, Fanconi anemia, progressive fibrodysplasia ossificans, fragile X syndrome, galactosemia, Gaucher disease, generalized gangliosidoses (e.g. GM1), hemochromatosis,the hemoglobin C mutation in the 6th codon of beta-globin (HbC), hemophilia, Huntington's disease, Hurler syndrome, hypophosphatasia, Klinefleter syndrome, Krabbe's disease, Langer-Giedion syndrome, leukocyte adhesion deficiency, leukodystrophy, long QT syndrome, Marfan syndrome, Moebius syndrome, mucopolysaccharidosis (MPS), Nagel-patella syndrome, nephrogenic diabetes insipdius, neurofibromatosis, Neimann-Pick disease, osteogenesis imperfecta, porphyria, Prader-Willi syndrome, progeria, Proteus syndrome, retinoblastoma, Rett syndrome, Rubinstein-Taybi syndrome, Sanfilippo syndrome, severe combined immunodeficiency (SCID), Shwachman syndrome, sickle cell disease (sickle cell anemia), Smith-Magenis syndrome, Stickler syndrome, Tay-Sachs disease, Thrombocytopenia Absent Radius (TAR) syndrome, Treacher Collins syndrome, Trisomy, Tuberous sclerosis, Turner syndrome, Urea cycle disorder, von Hippel-Landau disease, Waardenburg syndrome, Williams syndrome, Wilson's disease, Wiskott-Aldrich syndrome,X-linked lymphoproliferative syndrome, lysosomal storage diseases (e.g., Gaucher disease, GM1, Fabry disease, and Tay-Sachs disease), mucopolysaccahidosis (e.g., Hunter disease, Hurler disease), hemoglobinopathies (e.g., sickle cell disease, HbC, α-thalassemia, β-thalassemia), and hemophilias.

[0069] Other diseases that can be treated through targeted integration include von Willebrand disease, Usher syndrome, polycystic kidney disease, spinocerebellar ataxia type 3 and spinocerebellar ataxia type 6.

[0070] In one embodiment, the genomic modification is the insertion of a transgene into the endogenous CACNA1A genome sequence. The transgene may contain a synthetic and partial coding sequence for the CACNA1A protein. The partial coding sequence may be homologous to the coding sequence within a wild-type CACNA1A gene, or a functional variant of the wild-type CACNA1A gene, or a mutant of the wild-type CACNA1A gene. In one embodiment, the transgene encoding the partial CACNA1A protein is inserted into intron 46 or the beginning of exon 47.

[0071] In another embodiment, the genomic modification is the insertion of a transgene into the endogenous ATXN3 genome sequence. The transgene may contain a synthetic and partial coding sequence for the ATXN3 protein. The partial coding sequence may be homologous to the coding sequence within a wild-type ATXN3 gene, a functional variant of the wild-type ATXN3 gene, or a mutant of the wild-type ATXN3 gene. In one embodiment, the transgene encoding the partial ATXN3 protein is inserted into intron 9 or the beginning of exon 10.

[0072] In one embodiment, the methods and compositions described herein can be used to modify the 3' end of an endogenous gene, resulting in modification of the C-terminus of the protein encoded by the endogenous gene. Modification of the 3' end of the coding sequence of the endogenous gene can comprise replacement of the last coding exon (i.e., the exon comprising the stop codon) up to an exon located between the exon containing the start coding codon and the last exon. As defined herein, "replacement" refers to the insertion of DNA into a gene, wherein the inserted DNA provides the information for the production of the mRNA and protein of one or more exons. Replacement can be accomplished by integrating a transgene into the endogenous gene, wherein the transgene comprises one or more coding sequences operably linked to a splice acceptor.The insertion may or may not result in the deletion of sequences within the endogenous gene (e.g., deletion of introns and exons).For example, if a gene has 72 exons and the start codon is within exon 1, the modification may involve the replacement of exons 2-72, 3-72, 4-72, 5-72, 6-72, 7-72, 8-72, 9-72, 10-72, 11-72, 12-72, 13-72, 14-72, 15-72, 16-72, 17-72, 18-72, 19-72, 20-72, 21-72, 22-72, or 23-72 or 24-72 or 25-72 or 26-72 or 27-72 or 28-72 or 29-72 or 30-72 or 31-72 or 32-72 or 33-72, or 34-72, or 35-72, or 36-72, or 37-72, or 38-72, or 39-72, or 40-72, or 41-72, or 42-72, or 43-72, or 44-72, or 45-72, or 46-72, or 47-72, or 48-72, or 49-72, or 50-72, or 51-72, or 52-72, or 53-72, or 54-72, or 55-72, or 56-72, or 57-72, or 58-72, or 59-72, or 60-72, or 61-72, or 62-72, or 63-72, or 64-72, or 65-72, or 66-72, or 67-72, or 68-72, or 69-72, or 70-72, or 71-72 or 72.In one embodiment, the exons of the endogenous gene can be replaced by integrating a transgene into the endogenous gene, wherein the transgene comprises a first and second partial coding sequence, wherein the first and second partial coding sequence encodes a peptide produced by the exons of the endogenous gene.For example, the first and second coding sequence of the transgene may encode a peptide derived from exons of the endogenous gene 2-72, 3-72, 4-72, 5-72, 6-72, 7-72, 8-72, 9-72, 10-72, 11-72, 12-72, 13-72, 14-72, 15-72, 16-72, 17-72, 18-72, 19-72, 20-72, 21-72, 22-72 or 23-72 or 24-72 or 25-72 or 26-72 or 27-72 or 28-72 or 29-72 or 30-72 or 31-72 or 32-72 or 33-72, or 34-72, or 35-72, or 36-72, or 37-72, or 38-72, or 39-72, or 40-72, or 41-72, or 42-72, or 43-72, or 44-72, or 45-72, or 46-72, or 47-72, or 48-72, or 49-72, or 50-72, or 51-72, or 52-72, or 53-72, or 54-72, or 55-72, or 56-72, or 57-72, or 58-72, or 59-72, or 60-72, or 61-72, or 62-72, or 63-72, or 64-72, or 65-72, or 66-72, or 67-72, or 68-72, or 69-72, or 70-72, or 71-72 or 72 is produced.The transgene can be integrated within the endogenous gene in the upstream intron or at the beginning of the exon corresponding to the first exon within the partial coding sequence of the transgene (. Fig. 2). The transgene can be designed to be 4.7 kb or less in size and incorporated into an AAV vector and particles and delivered to target cells in vivo.

[0073] In one embodiment, the transgene is a DNA sequence harboring a first and a second partial coding sequence, wherein the partial coding sequences encode a partial protein, wherein the partial protein is homologous to a corresponding region in a functional protein produced by a wild-type gene. The host gene, or endogenous gene, is one in which expression of the protein is aberrant, in other words, is not expressed, is expressed at low levels, or is expressed but the mRNA or protein product, or a portion thereof, is nonfunctional, has reduced function, or exhibits a gain-of-function, resulting in a disorder in the host.

[0074] As described herein, the donor molecule can be present in a viral or non-viral vector. The vectors can be in the form of circular or linear double-stranded or single-stranded DNA. The donor molecule can be conjugated or associated with a reagent that facilitates stability or cellular update. The reagent can be lipids, calcium phosphate, cationic polymers, DEAE-dextran, dendrimers, polyethylene glycol (PEG), cell-penetrating peptides, gas-encapsulated microbubbles, or magnetic beads. The donor molecule can be incorporated into a viral particle. The virus can be retroviral, adenoviral, adeno-associated vectors (AAV), herpes simplex, poxvirus, hybrid adenoviral vector, Epstein-Barr virus, lentivirus, or herpes simplex virus.

[0075] In certain embodiments, the AAV vectors described herein can be derived from any AAV. In certain embodiments, the AAV vector is derived from the defective and non-pathogenic parvovirus adeno-associated type 2 virus. All such vectors are derived from a plasmid that retains only the 145 bp inverted terminal AAV repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery through integration into the genome of the transduced cell are key features for this vector system. (Wagner et al., Lancet 351:9117 1702-3, 1998; Kearns et al., Gene Ther. 9:748-55, 1996). Other AAV serotypes, including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAVrh.10, as well as any novel AAV serotype, may also be used in accordance with the present invention.In some embodiments, chimeric AAV is used, in which the viral origins of the long terminal repeat (LTR) sequences of the viral nucleic acid are heterologous to the viral origin of the capsid sequences. Non-limiting examples include chimeric viruses with LTRs derived from AAV2 and capsids derived from AAV5, AAV6, AAV8, or AAV9 (i.e., AAV2 / 5, AAV2 / 6, AAV2 / 8, or AAV2 / 9, respectively).

[0076] The constructs described here can also be incorporated into an adenoviral vector system. Adenovirus-based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. High titers and high expression levels can be achieved with such vectors.

[0077] The methods and compositions described herein are applicable to any eukaryotic organism in which alteration of the organism through genomic modification is desired. Eukaryotic organisms include plants, algae, animals, fungi, and protists. Eukaryotic organisms may also include plant cells, algal cells, animal cells, fungal cells, and protist cells.

[0078] Examples of mammalian cells include, but are not limited to, oocytes, K562 cells, CHO cells (Chinese hamster ovary cells), HEP-G2 cells, BaF-3 cells, Schneider cells, COS cells (monkey kidney cells expressing SV40 T antigen), CV-1 cells, HuTu80 cells, NTERA2 cells, NB4 cells, HL-60 cells, and HeLa cells, 293 cells (see, e.g., Graham et al. (1977) J. Gen. Virol. 36:59), and myeloma cells such as SP2 or NS0 (see, e.g., Galfre and Milstein (1981) Meth. Enzymol. 73(B):346). Peripheral blood mononucleocytes (PBMCs) or T cells can also be used, as can embryonic and adult stem cells. Examples of stem cells that can be used include embryonic stem cells (ES cells), induced pluripotent stem cells (iPSCs), mesenchymal stem cells, hematopoietic stem cells, liver stem cells, skin stem cells, and neural stem cells.

[0079] The DNA polynucleotides or transgenes of the invention, or the described methods, can be used in the production of modified organisms. The modified organisms can be small mammals, companion animals, farm animals, and primates. Non-limiting examples of rodents can include mice, rats, hamsters, gerbils, and guinea pigs. Non-limiting examples of companion animals can include cats, dogs, rabbits, hedgehogs, and ferrets. Non-limiting examples of farm animals can include horses, goats, sheep, pigs, llamas, alpacas, and cattle. Non-limiting examples of primates can include capuchin monkeys, chimpanzees, lemurs, macaques, marmosets, tamarins, spider monkeys, squirrel monkeys, and vervet monkeys. The methods and compositions of the invention can be used in humans.

[0080] Exemplary plants and plant cells that can be modified using the methods described herein include, but are not limited to, monocotyledonous plants (e.g., wheat, corn, rice, millet, barley, sugarcane), dicotyledonous plants (e.g., soybean, potato, tomato, alfalfa), fruit plants (e.g., tomato, apple, pear, strawberry, orange), forage crops (e.g., alfalfa), root vegetable plants (e.g., carrot, potato, sugar beet, yam), leafy vegetable plants (e.g., lettuce, spinach); vegetative crops for consumption (e.g., soybeans and other legumes, squash, peppers, eggplant, celery, etc.), flowering plants (e.g., petunia, rose, chrysanthemum), conifers and pines (e.g., pine, spruce); poplar trees (e.g., P. tremula×P. alba); Fiber plants (cotton, jute, flax, bamboo); plants used in phytoremediation (e.g. heavy metal enriching plants); oil plants (e.g.Sunflower, rapeseed) and plants used for experimental purposes (e.g., Arabidopsis). The methods disclosed herein can be used within the genera Asparagus, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucurbita, Daucus, Erigeron, Glycine, Gossypium, Hordeum, Lactuca, Lolium, Lycopersicon, Malus, Manihot, Nicotiana, Orychophragmus, Oryza, Persea, Phaseolus, Pisum, Pyrus, Prunus, Raphanus, Secale, Solanum, Sorghum, Triticum, Vitis, Vigna, and Zea. The term plant cells encompasses both isolated plant cells and whole plants or parts of whole plants such as seeds, callus, leaves, and roots. The present disclosure also encompasses seeds of the plants described above, wherein the seed has been modified using the compositions and / or methods described herein.The present disclosure further encompasses the progeny, clones, cell lines, or cells of the transgenic plants described above, wherein the progeny, clones, cell lines, or cells comprise the transgene or gene construct. Exemplary algal species include microalgae, diatoms, Botryococcus braunii, Chlorella, Dunaliella tertiolecta, Gracileria, Pleurochrysis carterae, Sorgassum, and Ulva.

[0081] The methods described in this document may involve the use of infrequently cutting endonucleases to stimulate homologous recombination or nonhomologous integration of a transgene molecule into an endogenous gene. The infrequently cutting endonuclease may include CRISPR, TALENs, or zinc-finger nucleases (ZFNs). The CRISPR system may include CRISPR / Cas9 or CRISPR / Cas12a (Cpf1). The CRISPR system may include variants that exhibit broad PAM capability (Hu et al., Nature 556, 57–63, 2018; Nishimasu et al., Science DOI: 10.1126, 2018) or higher on-target binding or cleavage activity (Kleinstiver et al., Nature 529:490–495, 2016). The gene editing reagent can be in the form of a nuclease (Mali et al., Science 339:823-826, 2013; Christian et al., Genetics 186:757-761, 2010), nickase (Cong et al., Science 339:819-823, 2013; Wu et al., Biochemical and Biophysical Research Communications 1:261-266, 2014), CRISPR-FokI dimers (Tsai et al., Nature Biotechnology 32:569-576, 2014), or paired CRISPR nickases (Ran et al., Cell 154:1380-1389, 2013).

[0082] The methods and compositions described in this document may be used in a circumstance where it is desired to modify the 3' end of the coding sequence of an endogenous gene. For example, patients with SCA3 or SCA6 have expanded CAG repeats in exon 10 (second-to-last exon) and exon 47 (last exon), respectively. Patients with SCA3 or SCA6 may benefit from replacement of exons 10-11 and 47, respectively. In other examples, patients with genetic disorders due to loss-of-function mutations within the 3' end of an endogenous gene could benefit from replacement of the last exons of the gene.

[0083] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. EXAMPLESExample 1: Targeted integration of DNA into the ATXN3 gene

[0084] Three plasmids were constructed containing transgenes designed for integration into the ATXN3 gene in human cells. All transgenes were designed to insert within intron 9 or the junction of intron 9 and exon 10 of the ATXN3 gene, and all transgenes were designed to insert at least one splice acceptor and at least one functional coding sequence for exons 10 and 11 of the ATXN3 gene. The first plasmid, designated pBA1135, comprised a left and right homology arm with sequence homologous to the 3' end of intron 9 and the 5' end of intron 10 (i.e., successful gene targeting would result in the removal of exon 10 and replacement with the cargo sequence within pBA1135).Between the homology arms, from 5' to 3', were a splice acceptor (splice acceptor from ATXN3 intron 9), the coding sequence for exons 10 and 11 of ATXN3, the SV40 terminator, the reverse BGH terminator, the reverse coding sequence for exons 10 and 11 (codon-adjusted), and the reverse splice acceptor. The sequence for the pBA1135 transgene is shown in SEQ ID NO:17. A corresponding Cas9 nuclease was designed to cleave i) within intron 9 of the ATXN3 gene, ii) within the left homology arm of pBA1135, and iii) at the 3' end of the right homology arm of pBA1135. Successful cleavage of the plasmid was expected to release the transgene, allowing the sequence to be used as a template for HR or for integration via NHEJ. The Cas9 gRNA target site is shown in SEQ ID NO:18. The individual elements within pBA1135 are shown in SEQ ID NO:44-51.SEQ ID NO:44 comprises the left homology arm, the nuclease target site, and the splice acceptor. SEQ ID NO:45 comprises the partial coding sequence (exons 10 and 11) of a non-pathogenic ATXN3 gene. SEQ ID NO:46 comprises the SV40 p(A) terminator sequence. SEQ ID NO:47 comprises the BGH terminator in reverse complement. SEQ ID NO:48 comprises the reverse complement, codon-matched partial coding sequence (exons 10 and 11) of a non-pathogenic ATXN3 gene. SEQ ID NO:49 comprises the splice acceptor sequence. SEQ ID NO:50 comprises the right homology arm sequence. SEQ ID NO:51 comprises the nuclease target site sequence. The second plasmid, designated pBA1136, contained the same cargo as pBA1135, but the homology arms were removed. The nuclease target sites were retained to facilitate release of the transgene from the plasmid.Successful cleavage of the plasmid was expected to release the transgene, allowing the sequence to be used for integration by NHEJ into the ATXN3 gene. The sequence of pBA1136 is shown in SEQ ID NO:19. The third plasmid, designated pBA1137, contained the same sequence as pBA1135, except for the reverse sequences and the nuclease target site (i.e., reverse terminator, reverse coding sequence, and reverse splice acceptor). Plasmid pBA1137 was used as a control for conventional HR-based procedures. The sequence of pBA1137 is shown in SEQ ID NO:20.

[0085] Transfection was performed with HEK293T cells. HEK293T cells were maintained at 37°C and 5% CO 2maintained in DMEM highly supplemented with 10% fetal bovine serum (FBS). HEK293T cells were transfected with 2 μg of donor, 2 μg of guide RNA (RNA format), and 2 μg of Cas9 (RNA format). Transfections were performed by electroporation. Genomic DNA was isolated 72 hours post-transfection and analyzed for integration events. A list of primers used to detect integration or genomic DNA is provided in Table 1. Table 1: Primers for detecting the integration of transgenes into ATXN3. Primer name Sequence (5' to 3') SEQ ID NO: oNJB043 CAAAGGTGCCCCTTGAGGTT 21 oNJB044 AGGAGAAGTCTGCCGTTACT 22 oNJB113 GGACAAACCACAACTAGAATGC 23 oNJB114 TAGGAAAGGACAGTGGAGT 24 oNJB116 CCATTATGTCTCAGTTTGTTCAGTG 25 oNJB156 CCAGACCATCTCAGACACC 26 oNJB162 GGCTGGGCTTCCACTTAC 27 oNJB167 GTGGTTTGTCCAAACTCATCAA 28 oNJB170 AGTAACTCTGCACTTCCCATTG 29

[0086] To demonstrate the integration of pBA1135, pBA1136, and pBA1137, PCRs were performed on the genomic DNA. For pBA1137, the transgene was designed to integrate precisely by HR. Accordingly, bands indicating a precise insertion into exon 10 were detected in the 5' and 3' junction PCRs ( Fig.8, lanes 4 and 7). The expected band sizes were 1,520 bp for the 5' junction and 786 bp for the 3' junction. Primers oNJB113 and oNJB116 were used for the 5' junction PCR. Primers oNJB167 and oNJB170 were used for the 3' junction PCR. Since no homology arms were present in pBA1136, it was assumed that the transgene was inserted via NHEJ insertion. Bands of corresponding sizes were observed for the transgene integrating in the forward and reverse directions. Integration in the forward direction is in Fig. 8 can be seen in lanes 3 (expected size approx. 1,520 bp) and 6 (expected size approx. 1,519 bp). The integration in the backward direction is shown in Fig.8, lane 12 (expected size approximately 1,520 bp). Primers oNJB113 and oNJB116 were used for the 5' junction PCR. Primers oNJB114 and oNJB170 were used for the 3' junction PCR. Primers oNJB116 and oNJB114 were used for the inverse 5' junction PCR. Regarding ppBA1135, both homology arms and nuclease cleavage sites were present on the transgene. Integration by HR was observed by detecting bands in the 5' and 3' junction PCRs ( Fig. 8, lanes 2 and 5). In addition, integration by NHEJ was observed by detecting bands in an inverse 5' junction PCR ( Fig.8, lane 10). The expected size for the 5' junction PCR was 1,520 bp. The expected size for the 3' junction PCR was 1,157 bp. The expected size for the inverse 5' junction PCR was approximately 1,520 bp. Primers oNJB113 and oNJB116 were used for the 5' junction PCR. Primers oNJB114 and oNJB170 were used for the 3' junction PCR. Primers oNJB116 and oNJB114 were used for the inverse 5' junction PCR.

[0087] The results show that the described transgenes, which comprise bidirectional partial coding sequences, can be integrated into genomic DNA via several different repair pathways. Example 2: Targeted integration of DNA into the CACNA1A gene

[0088] A CACNA1A-targeting transgene is designed to replace the 3' end of the CACNA1A coding sequence. A plasmid is constructed with a transgene designed to integrate the WT coding sequence into intron 46 or the beginning of exon 47 ( Fig.4). The transgene comprises a first homology arm that is homologous to the sequence immediately following the splice donor site in intron 46. The first homology arm also includes the nuclease target site (SEQ ID NO:9) and a splice acceptor sequence. The first homology arm is followed by a first coding sequence that includes CACNA1A exon 47 and an unexpanded CAG repeat sequence (SEQ ID NO:3). Following the first coding sequence is an SV40 poly(A) termination sequence (SEQ ID NO:4). A second set of functional elements is present in a tail-to-tail orientation. The beginning of the second set of elements includes a nuclease target site (SEQ ID NO:9), followed by a second homology arm. The second homology arm harbors 446 bp homologous to the sequence immediately following the stop coding sequence (SEQ ID NO:8). This sequence was determined by in silico analysis to be free of consensus branching or splice acceptor sequences.The second homology arm is followed by a second splice acceptor from the carp beta-actin intron 1 (SEQ ID NO:7). The splice acceptor is followed by a codon-optimized version of CACNA1A exon 47 (SEQ ID NO:6) and a bGH poly(A) terminator (SEQ ID NO:5).

[0089] A corresponding Cas12a nuclease is designed to create three double-strand breaks after transfection of the plasmid: i) within intron 46 of the endogenous CACNA1A gene, 2) within the first homology arm in the pBA1011-D1 transgene, and 3) after the second homology arm in the pBA1011-D1 transgene. The target sequence for the Cas12a nuclease is shown in SEQ ID NO: 9.

[0090] Confirmation of the function of the transgene and the CRISPR vectors is achieved by transfection of HEK293 cells. HEK293 cells are maintained at 37°C and 5% CO 2maintained in high-glucose DMEM medium without L-glutamine and without sodium pyruvate, supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) solution 100X. HEK293 cells are transfected with each of the plasmid constructs and combinations thereof using Lipofectamine 3000. Two days after transfection, DNA is extracted and analyzed for mutations and targeted insertions within the CACNA1A gene. Nuclease activity is analyzed using the Cel-I assay or by deep sequencing of amplicons containing the CRISPR / Cas12a target sequence. Successful integration of the transgene is analyzed by PCR ( Fig. 5). Example 3: Targeted integration of DNA into the ATXN3 gene

[0091] An ATXN3-targeting transgene is designed to replace the 3' end of the ATXN coding sequence (exons 10 and 11). A plasmid is constructed with a transgene designed to integrate the WT coding sequence into intron 9 or the beginning of exon 10 ( Fig.5). The transgene comprises a first homology arm homologous to the intron 9 sequence (SEQ ID NO: 10). The first homology arm also includes the target site for a Cas12a nuclease and a splice acceptor sequence. The first homology arm is followed by a first coding sequence comprising ATXN3 exons 10 and 11 and an unexpanded CAG repeat sequence. Following the first coding sequence is an SV40 poly(A) termination sequence. A second set of functional elements is present in a tail-to-tail orientation. The beginning of the second set of elements includes a target site for the Cas12a nuclease, followed by a second homology arm. The second homology arm harbors 379 bp homologous to the sequence immediately following the end of exon 10 (i.e., the beginning of intron 10). This sequence was determined by in silico analysis to have a limited number of potential branching or splice acceptor sequences.The second homology arm is followed by a second splice acceptor from the carp beta-actin intron 1. The splice acceptor is followed by a codon-optimized version of ATXN3 exons 10 and 11 and a bGH poly(A) terminator.

[0092] A corresponding Cas12a nuclease is designed to create three double-strand breaks after plasmid transfection: i) within intron 9 of the endogenous ATXN3 gene, 2) within the first homology arm in the pBA1012-D1 transgene, and 3) adjacent to the second homology arm in the pBA1012-D1 transgene. The target sequence for the Cas12a nuclease is shown in SEQ ID NO:11.

[0093] Confirmation of the function of the transgene and the CRISPR vectors is achieved by transfection of HEK293 cells. HEK293 cells are maintained at 37°C and 5% CO 2maintained in high-glucose DMEM medium without L-glutamine and without sodium pyruvate, supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) solution 100X. HEK293 cells are transfected with each of the plasmid constructs and combinations thereof using Lipofectamine 3000. Two days after transfection, DNA is extracted and analyzed for mutations and targeted insertions within the ATXN3 gene. Nuclease activity is analyzed using the Cel-I assay or by deep sequencing of amplicons containing the CRISPR / Cas12a target sequence. Successful integration of the transgene is analyzed by PCR ( Fig. 7). Example 4: Targeted integration of DNA into the ATXN3 gene using Cas12k transposases

[0094] An ATXN3-targeting transgene is designed to replace the 3' end of the ATXN coding sequence (exons 10 and 11). A plasmid is constructed containing a transgene designed to integrate the WT coding sequence into intron 9 or the beginning of exon 10. The transgene comprises a right and a left end of the transposon, a first and a second splice acceptor, a first and a second coding sequence (encoding amino acids from exons 10 and 11), and a first and a second terminator. The sequence between the right and left ends of the transposon is shown in SEQ ID NO: 17.

[0095] The plasmids are constructed to express the Scytonema hofmanni tnsB, tnsC, tniQ, and Cas12k (SEQ ID NO: 30) using eukaryotic promoters. A second plasmid is constructed to express the corresponding Cas12k guide RNA (SEQ ID NO: 14). The target sequence of the guide RNA is CCGCCCGACCTTTCACTTTC (SEQ ID NO: 15). The Cas12k transposon plasmid is cotransformed into HEK293 cells with a plasmid containing the ATXN3 targeting transgene. HEK293 cells are maintained at 37°C and 5% CO 2 maintained in high-glucose DMEM medium without L-glutamine and sodium pyruvate, supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) 100X solution. HEK293 cells are transfected with each of the plasmid constructs and combinations thereof using Lipofectamine 3000. Two days after transfection, DNA is extracted and analyzed for targeted insertions into the ATXN3 gene. Transgene integration is analyzed by PCR. Example 5: Targeted integration of DNA into the CACNA1A gene

[0096] A CACNA1A-targeting transgene is designed to replace the 3' end of the CACNA1A coding sequence. A plasmid is constructed with a transgene designed to integrate the WT coding sequence into intron 46 or the beginning of exon 47. The transgene includes a right and left transposon end, a first and second splice acceptor, a first and second coding sequence (encoding amino acids of exon 47), and a first and second terminator.

[0097] The plasmids are constructed to express the Scytonema hofmanni tnsB, tnsC, tniQ, and Cas12k (SEQ ID NO: 30) using eukaryotic promoters. A second plasmid is constructed to express the corresponding Cas12k guide RNA (SEQ ID NO: 14). The guide RNA is designed for the target sequence CCCGGATCCCGGCTGTGACC (SEQ ID NO: 16). The Cas12k transposon plasmids are co-transformed into HEK293 cells with a plasmid containing the ATXN3 targeting transgene. HEK293 cells are maintained at 37°C and 5% CO 2maintained in high-glucose DMEM medium without L-glutamine and sodium pyruvate, supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) 100X solution. HEK293 cells are transfected with each of the plasmid constructs and combinations thereof using Lipofectamine 3000. Two days after transfection, DNA is extracted and analyzed for targeted insertions into the ATXN3 gene. Transgene integration is analyzed by PCR. This is followed by a sequence listing as an electronic document. This can be accessed both in DEPATISnet and in the DPMA register.

Claims

[1] DNA polynucleotide comprising: a first and second splice acceptor sequence, b. a first and second coding sequence, c. a first and a second terminator, wherein the first coding sequence is operatively linked to the first splice acceptor and the first terminator, and the second coding sequence is operatively linked to the second splice acceptor and the second terminator, wherein the first coding sequence, the first splice acceptor and the first terminator are in a tail-to-tail alignment with the second coding sequence, the second splice acceptor and the second terminator, wherein the first and second coding sequences differ in nucleic acid sequence but code for the same amino acids. [2] The DNA polynucleotide of claim 1, further comprising first and second target sites for one or more infrequently cutting endonucleases, wherein the target sites flank the first and second splice acceptors. [3] The DNA polynucleotide of claim 1, further comprising left and right homology arms flanking the first and second splice acceptors. [4] An adeno-associated viral vector harboring the DNA polynucleotide of claim 1. [5] DNA polynucleotide according to any one of claims 1 to 4 for use as a gene therapy medicament.

Images