Reaction tube for multiple nucleic acid amplification

Abstract

A reaction tube for multiple nucleic acid amplification is relevant to the field of application technology in life science research and medical examination, and the like. This reaction tube for multiple nucleic acid amplification comprises a base (1) and several reaction tube cavities (3); the base (1) is provided with a reference plane (2), the openings of the several reaction tube cavities (3) are all located on the reference plane (2), and their interiors extend perpendicularly to the reference plane (2) towards the interior of the base (1).In the reaction tube for multiple nucleic acid amplification, several reaction tube cavities (3) are provided on the reference plane (2) of the base (1). Multiple PCR amplification can be carried out by adding a nucleic acid sample and different PCR systems, or alternatively, a PCR freeze-drying system is included in the tube cavity (3). Depending on requirements, a nucleic acid sample for amplification is distributed in different reaction tube cavities (3), and several different types of nucleic acids can be amplified simultaneously and stored under the same reaction environment or made available for other reaction tests, thereby significantly increasing the efficiency of nucleic acid amplification and ensuring uniformity of conditions for nucleic acid amplification.

Description

Cross-reference to related applications

[0001] The present disclosure claims priority to Chinese Patent Application No. 201811647409.7, filed on December 29, 2018, in the Chinese Patent Office, entitled “Reaction Tube for Multiple Nucleic Acid Amplification,” the entire disclosure of which is incorporated herein by reference. Technical area

[0002] The present disclosure relates to the field of application technology of life science research and medical examination and the like, and more particularly relates to a reaction tube that enables performing multiple nucleic acid amplification. Technical background

[0003] Polymerase chain reaction (PCR) technology is a technology for the rapid amplification of DNA in vitro, with each cycle comprising three processes such as denaturation, annealing, and elongation.First, a double-stranded DNA sample is heated at a high temperature of about 95°C, which breaks the hydrogen bond in the double strand, so that the DNA is cleaved into two complementary single-stranded DNA molecules by thermolysis, a process called a high-temperature melting reaction; then, the temperature is rapidly reduced to a range of about 50 to 65°C, below which temperature the single-stranded DNA is bound to a primer according to the principle of complementary base pairing, a process called a low-temperature annealing reaction; after the annealing reaction is completed, the temperature is rapidly raised to about 72°C to conduct an extension reaction, and under the conditions of DNA polymerase and appropriate concentration of magnesium ions, a mononucleotide is bound from the 3' end of the primer to form a new DNA.Through such a process, two DNA molecules are formed from one original DNA double-stranded molecule, and their number is doubled. After each cycle, the number of target nucleic acid molecules is doubled, and these newly formed double strands can in turn be used as templates for the next cycle. After 30-40 cycles, the number of target nucleic acid molecules is amplified to approximately 109 times the original number.

[0004] Therefore, PCR, also referred to as cell-free molecular cloning or targeted enzymatic amplification technology of a specific DNA sequence by an in vitro primer, enables rapid amplification of target DNA and has features such as strong specificity, high sensitivity, ease of operation, time-saving, and high efficiency; and it can be applied not only to basic research such as gene isolation, cloning, and nucleic acid sequence analysis, but also to DNA- and RNA-related scenarios such as disease diagnosis.

[0005] In addition, isothermal amplification is also a new method for nucleic acid amplification and has received more and more attention in recent years.

[0006] However, regardless of PCR amplification technology or isothermal amplification technology, there are still many deficiencies in simultaneous amplification reactions of multiple nucleic acids.

[0007] CN 204625613 U discloses a laboratory plate with checkerboard-arranged wells for conducting PCR fluorescence reactions. CN 207828256 U, on the other hand, discloses a PCR fluorescence reaction strip with seven tubes arranged one behind the other in a row. CN 206244808 U discloses a cube-shaped laboratory plate with checkerboard-arranged wells, wherein several cube-shaped laboratory plates are designed to nest together. Subject of the revelation

[0008] The present disclosure is based on an object to provide a reaction tube which enables multiple nucleic acid amplification to be carried out, so that one of the technical problems existing in the prior art with regard to the reaction tube for nucleic acid amplification can be solved.

[0009] To achieve at least one of the above objects, the following technical solution is adopted in the present disclosure: The present disclosure provides a reaction tube for multiple nucleic acid amplification comprising a base and a plurality of reaction tube cavities; the base is provided with a reference plane, the openings of the plurality of reaction tube cavities are all provided on the reference plane, and the interiors thereof each extend perpendicular to the reference plane toward the interior of the base.

[0010] Based on the above technical solution, the multiple reaction tube cavities are distributed annularly around the same axis. -- The technical implications of this solution are that the multiple, annularly distributed reaction tube cavities enable a comparatively compact design, while also achieving a more regular layout, which facilitates operations for injecting and extracting a test sample during a test. For example, eight, twelve, or sixteen reaction tube cavities are distributed annularly around the same central axis.

[0011] Based on one of the above technical solutions, the multiple reaction tube cavities are further distributed among the rings with several different radii. -- The technical implications of this solution are that this design allows the multiple reaction tube cavities to be distributed into several coaxial rings with different radii, thus allowing as many reaction tube cavities as possible to be arranged in a relatively small space. For example, twelve reaction tube cavities can be arranged on the outer ring, and six reaction tube cavities can be arranged on the inner ring, all evenly distributed around the same central axis.

[0012] Based on one of the above technical solutions, the multiple reaction tube cavities located on the same ring are further fixed separately on the base. -- The technical impact of this technical solution is that the independently arranged reaction tube cavities save material for the entire reaction tube and reduce the weight of the reaction tube. Furthermore, testing operations are facilitated and investigation efficiency is increased because the multiple reaction tube cavities are arranged independently and are therefore easily distinguishable and designed by appearance.

[0013] Alternatively, the multiple reaction tube cavities located on the same ring are integrally formed and fixed to the base. -- The technical effects of this technical solution are that uniform heating of all reaction tube cavities and the realization of the isothermal effect are promoted by the integral molding or arrangement of all reaction tube cavities on the base, and the construction of the entire reaction tube is more compact and the shape thereof is more complete.

[0014] Based on one of the above technical solutions, a central tube cavity is further comprised, which is arranged on the reference plane and is located in the center of the ring(s) of the plurality of reaction tube cavities. -- The technical effects of this technical solution are that the central tube cavity is able to not only reduce the weight of the reaction tube body, but also to perform amplification reaction operations using the central tube cavity as a working space by means of an operating handle that cooperates with the central tube cavity.

[0015] Based on one of the above technical solutions, the central pipe cavity further passes through the base. -- The technical impact of this technical solution is that the central tube cavity passing through the base further reduces the mass of the reaction tube, thereby still providing sufficient space for the testing process.

[0016] Based on one of the above technical solutions, the base is further cylindrical, the axis of which coincides with the axis of the central tube cavity. -- The technical effects of this technical solution are that the provision of a screw cap is facilitated by the cylindrical base, and by utilizing a construction in cooperation with the thread on the side wall thereof, uniform blockage of all reaction tube cavities by the screw cap is realized.

[0017] Based on any of the above technical solutions, a plugging member or a screw cap is further comprised; the plugging member is arranged at the opening of any one of the reaction tube cavities; and the screw cap is threadably arranged at one end of the base to plug the openings of the plurality of reaction tube cavities. -- The technical effects of this technical solution are that the plugging element is arranged at an opening plugging the reaction tube cavity, wherein the sealing is preferably realized using a heat-sealing film or a heat-sealing adhesive; and the screw cap enables integral plugging of all reaction tube cavities, thereby preliminarily sealing the nucleic acid sample solutions in the reaction tube cavities and thereby protecting them from the influence of factors such as dust and environmental exposure, and also preventing tipping and leakage of the nucleic acid sample solutions. Furthermore, a filling hole can be provided on the screw cap to facilitate the injection of a nucleic acid sample solution.

[0018] Based on one of the above technical solutions, the plurality of reaction tube cavities are further distributed in the array on the reference plane. -- The technical impact of this solution is that the reaction tube cavities distributed throughout the array are more regular in design and positioned more precisely. In this case, a heat-sealing film or heat-sealing adhesive can be used to seal the reaction tube cavity.

[0019] The present disclosure has beneficial effects, including: In the reaction tube for multiple nucleic acid amplification provided in the present disclosure, multiple reaction tube cavities are arranged on the reference plane of a base. Multiple PCR amplification can be performed by adding a nucleic acid sample and various PCR systems, or alternatively, a PCR freeze-drying system is included in the tube cavity. As needed, a nucleic acid sample for amplification is distributed in different reaction tube cavities, and multiple different types of nucleic acids can be amplified simultaneously and stored under the same reaction environment or prepared for other reaction tests, thereby significantly increasing the efficiency of nucleic acid amplification and ensuring the uniformity of nucleic acid amplification conditions.

[0020] Additional technical features of the present disclosure and the advantages thereof will be explained more clearly in the following description, or may be understood by specific practice of the present disclosure. Description of the drawings

[0021] In order to more clearly describe technical solutions of specific embodiments of the present disclosure, the drawings required for describing the specific embodiments are briefly presented below. Of course, the drawings in the following explanation show some embodiments of the present disclosure, and additional drawings could be obtained by those skilled in the art by referring to these drawings without inventive step. Fig.1 shows a perspective structural diagram of the shape of a first reaction tube for multiple nucleic acid amplification according to an embodiment of the present disclosure; Fig. 2 shows a front view according to Fig. 1 ; Fig. 3 shows a plan view according to Fig. 2; Fig. 4 is a perspective structural diagram showing the shape of a second reaction tube for multiple nucleic acid amplification according to an embodiment of the present disclosure; Fig. 5 shows a front view according to Fig. 4; Fig. 6 shows a plan view according to Fig. 5; Fig. 7 is a perspective structural diagram showing the shape of a third reaction tube for multiple nucleic acid amplification according to an embodiment of the present disclosure; Fig. 8 shows a plan view according to Fig. 7; Fig.9 is a perspective structural diagram showing the shape of a fourth reaction tube for multiple nucleic acid amplification according to an embodiment of the present disclosure; Fig. 10 shows a front view according to Fig. 9; Fig. 11 shows a plan view according to Fig. 10; Fig. Figure 12 shows a diagram of the agarose gel electrophoresis result of an integrated and multiple tube-based PCR amplification; and Fig. Figure 13 shows a diagram of the agarose gel electrophoresis result of an integrated PCR amplification.

[0022] Reference symbols: 1-base; 2-reference plane; 3-reaction tube cavity; and 4-central tube cavity. Detailed description of the embodiments

[0023] Below, technical solutions of the present disclosure will be described clearly and comprehensively with reference to the drawings. Obviously, the described embodiments are only partial embodiments, rather than all of the embodiments of this disclosure. All further embodiments that could be obtained by a person skilled in the art based on the embodiments in this disclosure without inventive activity are within the scope of the disclosure.

[0024] In explaining this disclosure, it should be explained that orientation or positional relationships indicated by terms such as "central," "top," "bottom," "left," "right," "vertical," "horizontal," "inside," and "outside" are orientation or positional relationships shown based on the drawings. These terms are intended only to facilitate explanation of the disclosure and simplify explanation. They do not imply or imply that the mentioned device or element should have a specific orientation and be constructed and operated in a specific orientation. Therefore, they should not be construed as limitations on the disclosure. Furthermore, terms such as "first," "second," and "third" are for illustrative purposes only and should not be interpreted as implying or implying any importance in relativity.

[0025] In explaining this disclosure, it should be clarified that terms such as "assemble," "connection," and "connect" should be understood in a broad sense unless otherwise expressly stated and defined. For example, it could be either a fixed connection, a detachable connection, or an integral connection; it could be either a mechanical connection or an electrical connection; and it could be either a direct connection, an indirect connection through an intermediate link, or an internal communication between two elements. Those skilled in the art could understand the specific meanings of the above terms in this disclosure according to specific circumstances. I. Description of the state of the art:

[0026] Regardless of whether PCR amplification technology or isothermal amplification technology is used, simultaneous amplification reactions of multiple nucleic acids inevitably result in inconsistencies in reaction environment conditions and operating times due to design flaws in reaction devices. Therefore, significant differences in the amplification effects of consecutive reactions occur. Furthermore, the amplification system is susceptible to mutual interference when performing multiple PCRs using a conventional PCR tube, which affects the amplification effect. II. Overview of the technical solution of the present disclosure:

[0027] The present disclosure provides a reaction tube for multiple nucleic acid amplification comprising a base 1 and a plurality of reaction tube cavities 3; the base 1 is provided with a reference plane 2, the openings of the plurality of reaction tube cavities 3 are all provided on the reference plane 2, and the interiors thereof each extend perpendicular to the reference plane 2 toward the interior of the base 1.

[0028] By the above technical solution of the reaction tube enabling multiple nucleic acid amplification to be performed, existing problems in the prior art regarding the reaction tube for nucleic acid amplification, such as non-concentrated and non-uniform operations, inconsistent reaction conditions, mutual interference, and low amplification efficiency in multiple nucleic acid amplification, can be better solved: A plurality of reaction tube cavities 3 are arranged on the reference plane 2 of a base 1, multiple PCR amplification can be performed by adding a nucleic acid sample and various PCR systems, or alternatively, a PCR freeze-drying system is included in the tube cavity.According to needs, a nucleic acid sample for amplification is distributed in different reaction tube cavities 3, and several different types of nucleic acids can be amplified simultaneously and stored under the same reaction environment or provided for other reaction tests, thereby greatly increasing the efficiency of nucleic acid amplification and ensuring the uniformity of nucleic acid amplification conditions. III. Specific embodiments of the technical solution of the present disclosure

[0029] With regard to the above technical problems encountered in existing technical solutions, the technical solution of the present disclosure will be further explained and described below using specific embodiments: The present embodiment provides a reaction tube that enables multiple nucleic acid amplification to be carried out, wherein Fig. 1 shows a perspective structural diagram of the shape of a first reaction tube for multiple nucleic acid amplification according to an embodiment of the present disclosure; Fig. 2 a front view according to Fig. 1 shows; Fig. 3 a plan view according to Fig. 2 shows; Fig. 4 shows a perspective structural diagram of the shape of a second reaction tube for multiple nucleic acid amplification according to an embodiment of the present disclosure; Fig. 5 a front view according to Fig. 4 shows; and Fig. 6 a plan view according to Fig. 5 shows. As it is in Fig.1 to 6, the reaction tube for multiple nucleic acid amplification comprises a base 1 and a plurality of reaction tube cavities 3 arranged on the base 1; the base 1 is provided with a reference plane 2, the openings of the plurality of reaction tube cavities 3 are all provided on the reference plane 2, and the interiors thereof each extend perpendicular to the reference plane 2 toward the interior of the base 1.

[0030] Based on the above embodiment, the plurality of reaction tube cavities 3 are further distributed annularly with the same radius around the same axis as shown in Fig. 1, Fig. 3, Fig. 4, and Fig.6. In this case, the multiple annularly distributed reaction tube cavities 3 enable a comparatively compact construction, while also implementing a more regular layout, which facilitates operations for injecting and extracting a test sample during a test. For example, eight, twelve, or sixteen reaction tube cavities 3 are distributed annularly with the same radius around the same central axis. The optional number of reaction tube cavities 3 could be 8, 10, 12, 16, or 24. An optional material for the reaction tube cavity 3 could be polypropylene plastic.

[0031] Fig. 7 shows a perspective structural diagram of the shape of a third reaction tube for multiple nucleic acid amplification according to an embodiment of the present disclosure; and Fig. 8 shows a plan view according to Fig.7. Based on the above embodiments, the plurality of reaction tube cavities 3 are further distributed among the rings with a plurality of different radii, as shown in Fig. 7 and Fig.8, where the optional number of different radii could be 2, 3, or 4. The reaction tube of such a design allows the distribution of the multiple reaction tube cavities 3 by subdividing them into several coaxial rings with different radii, and thus as many reaction tube cavities 3 as possible can be arranged in a comparatively small space, thus enabling simultaneous testing of multiple samples. For example, twelve reaction tube cavities 3 are arranged on the outer ring of the same radius R, and six reaction tube cavities 3 are arranged on the inner ring of the same radius r, all evenly distributed around the same central axis, where R > r. An optional material for the reaction tube cavity 3 could be polypropylene plastic.

[0032] Further, based on the above embodiments, the plurality of reaction tube cavities 3 located on the same ring are each separately fixed on the base 1 as shown in Fig. 1 and Fig. 2. In this design, the independently arranged reaction tube cavities 3 save the material of the entire reaction tube and reduce the weight of the reaction tube. Furthermore, testing operations are facilitated and investigation efficiency is increased because the multiple reaction tube cavities 3 are independently arranged and can then be easily distinguished and designed by appearance.

[0033] Alternatively, the plurality of reaction tube cavities 3 located on the same ring are integrally formed and fixed on the base 1 as shown in Fig. 4, Fig. 5, and Fig.7. In this case, all the reaction tube cavities 3 are integrally formed and arranged on the base 1, thereby promoting uniform heating of all the reaction tube cavities 3 and realizing the isothermal effect, and the construction of the entire reaction tube is more compact and the shape thereof is more complete.

[0034] On the basis of the above embodiments, a central tube cavity 4 is further comprised, which is arranged on the reference plane 2 and is located in the middle of the ring(s) of the plurality of reaction tube cavities 3, as shown in Fig. 1, Fig. 3, Fig. 4, Fig. 6, Fig. 7, and Fig.8. In this design, the central tube cavity 4 is capable of not only reducing the weight of the reaction tube body, but also performing amplification reaction operations using the central tube cavity 4 as a working space by means of an operating handle that cooperates with the central tube cavity 4. The shape of the central tube cavity 4 is not limited, and optionally, the central tube cavity 4 could be a cylinder, a cuboid, a polyhedron, or a cone.

[0035] Based on the above embodiments, the central tube cavity 4 further passes through the base 1, as shown in Fig. 1, Fig. 3, Fig. 7, and Fig. 8, thereby further reducing the mass of the reaction tube and still providing sufficient space for the testing process.

[0036] Based on the above embodiments, the reaction tube for multiple nucleic acid amplification provided in the present disclosure further comprises a plugging cap arranged on the base 1, and the plugging cap can realize uniform plugging of all the reaction tube cavities 3. As shown in Fig.1-8, in one embodiment, a connecting element is arranged on a side wall of the base 1, and the connecting element can be detachably connected to the plugging cap (not shown in the figures). The connecting element can be embodied in various forms; for example, an elastic projection provided on the base 1 can be configured as the connecting element, while a recess is provided in the plugging cap, so that a detachable connection between the connecting element and the plugging cap is realized; alternatively, a threaded structure provided on the base 1 is configured as the connecting element, while a structure in cooperation with the above threaded structure is provided in the plugging cap, so that a detachable connection between the connecting element and the plugging cap is realized.In another embodiment, the base 1 is provided with a connecting element which is pivotally connected to the plugging cap (not shown in the figures).

[0037] Furthermore, the base 1 is cylindrical, the axis of which coincides with the axis of the central tube cavity 4. In this construction, the cylindrical base 1 facilitates the provision of a screw cap configured as a plugging cap; and by utilizing a construction in cooperation with the thread on the side wall thereof, uniform plugging of all reaction tube cavities 3 by the screw cap is realized.

[0038] Based on the above embodiments, a plugging member (not shown) or a screw cap (not shown) is further included. The plugging member is disposed at the opening of any one of the reaction tube cavities 3, and the screw cap is threadably provided on one end of the base 1 to plug the openings of a plurality of reaction tube cavities 3. In this case, any single reaction tube cavity 3 can be sealed by the plugging member using a heat-sealing film or a heat-sealing adhesive, and the screw cap enables integral plugging of all the reaction tube cavities 3, thereby preliminarily sealing the nucleic acid sample solutions in the reaction tube cavities 3 and protecting them from influences such as dust and environmental exposure, and also preventing tipping and leakage of the nucleic acid sample solutions.Furthermore, a filling hole may be provided on the screw cap to facilitate the injection of a nucleic acid sample solution.

[0039] Fig. 9 is a perspective structural diagram showing the shape of a fourth reaction tube for multiple nucleic acid amplification according to an embodiment of the present disclosure; Fig. 10 shows a front view according to Fig. 9; and Fig. 11 shows a plan view according to Fig. 10. Based on the above embodiments, the plurality of reaction tube cavities 3 are further distributed in the array on the reference plane 2 as shown in Fig. 9-11. The reaction tube cavities 3 distributed throughout the array are more regular in design and positioned more precisely.

[0040] Optionally, the multiple reaction tube cavities 3 can each be separately fixed to the base 1. Independently arranged reaction tube cavities 3 save the material of the entire reaction tube and reduce the weight of the reaction tube. Furthermore, testing operations are facilitated and investigation efficiency is increased because the multiple reaction tube cavities 3 are arranged independently and can then be easily distinguished and designed from each other by appearance.

[0041] Optionally, all the reaction tube cavities 3 may be integrally formed and arranged on the base 1. Integrally formed respective reaction tube cavities 3 promote uniform heating of all the reaction tube cavities 3 and the realization of the isothermal effect, and the construction of the entire reaction tube is more compact and the shape thereof is more complete.

[0042] Optionally, a plugging cap is also included, which is arranged on the base 1, and the plugging cap can realize uniform plugging of all reaction tube cavities 3. In one embodiment, a connecting element is arranged on a side wall of the base 1, and the connecting element can be detachably connected to the plugging cap (not shown in the figures). The connecting element can be embodied in various forms; for example, an elastic projection provided on the base 1 can be configured as the connecting element, while a recess is provided in the plugging cap, so that a detachable connection is realized between the connecting element and the plugging cap; alternatively, a connecting element is provided on the base 1, which is pivotally connected to the plugging cap (not shown in the figures).

[0043] Optionally, a plugging element (not shown) is also included. The plugging element is arranged at the opening of any one of the reaction tube cavities 3, and the plugging cap is hingedly provided at one end of the base 1 to plug the openings of multiple reaction tube cavities 3. In this case, any single reaction tube cavity 3 can be sealed by the plugging element using a heat-sealing film or a heat-sealing adhesive, and the plugging cap enables integral plugging of all the reaction tube cavities 3, thereby preliminarily sealing the nucleic acid sample solutions in the reaction tube cavities 3 and protecting them from influences such as dust and environmental exposure, and also preventing tipping and leakage of the nucleic acid sample solutions.Furthermore, a filling hole may be provided on the screw cap to facilitate the injection of a nucleic acid sample solution.

[0044] As it is in Fig. 1 and Fig.2, the reaction tube for multiple nucleic acid amplification comprises a base 1 and a plurality of reaction tube cavities 3 arranged on the base 1; the base 1 is provided with a reference plane 2, the openings of the plurality of reaction tube cavities 3 are all provided on the reference plane 2, and the interiors thereof each extend perpendicular to the reference plane 2 toward the interior of the base 1. The plurality of reaction tube cavities 3 are annularly distributed with the same radius around the same axis and are each separately fixed on the base 1. Here, the reaction tube cavity 3 includes a tube cavity main body and a conical bottom that communicates with the tube cavity main body and tapers from top to bottom.The reaction tube for multiple nucleic acid amplification further comprises a central tube cavity 4 extending through the base 1, arranged on the reference plane 2 and located in the center of the ring(s) of the multiple reaction tube cavities 3. The reaction tube for multiple nucleic acid amplification further comprises a plugging cap (not shown in the figures) arranged on the base 1. The base 1 is cylindrical, the axis of which coincides with the axis of the central tube cavity 4, and the base 1 is provided with a threaded structure configured as a connecting element. A structure in cooperation with the above threaded structure is provided in the plugging cap, so that uniform plugging of all the reaction tube cavities 3 is realized.

[0045] The following description is based on a multiple tube-based PCR amplification test: Fig.Figure 12 shows a diagram of the agarose gel electrophoresis result of an integrated and multiple tube-based PCR amplification. As shown in Fig. 12 is shown in the drawing: M ①DNA2000, 50 ng; ②DNA1000, 50ng; ③DNA750, 150ng; ④DNA500, 50ng; ⑤DNA250, 50ng; ⑥DNA100, 50ng; 1 negative control of four holes; 2 Diagram of the electrophoresis result of PCR tube bundle-based amplification of West Nile virus; 3 Diagram of the electrophoresis result of PCR-bundle-based amplification of Eastern equine encephalomyelitis virus; 4 Diagram of the electrophoresis result of PCR-bundle-based amplification of Venezuelan equine encephalomyelitis virus; 5 Diagram of the electrophoresis result of PCR tube bundle-based amplification of tick-borne encephalitis virus; 6 Diagram of the electrophoresis result of the 8-tube row-based double amplification of West Nile virus and Eastern equine encephalomyelitis virus (strips from top to bottom); 7 Diagram of the electrophoresis result of the 8-tube row-based double amplification of West Nile virus and Venezuelan equine encephalomyelitis virus (strips from top to bottom); 8 Diagram of the electrophoresis result of the 8-tube row-based double amplification of West Nile virus and tick-borne encephalitis virus (strips from top to bottom); 9 Diagram of the electrophoresis result of the 8-tube row-based double amplification of Eastern equine encephalomyelitis virus and Venezuelan equine encephalomyelitis virus (strips from top to bottom); 10 Diagram of the electrophoresis result of the 8-tube row-based double amplification of eastern equine encephalomyelitis virus and tick-borne encephalitis virus (strips from top to bottom); 11 Diagram of the electrophoresis result of the 8-tube row-based double amplification of Venezuelan equine encephalomyelitis virus and tick-borne encephalitis virus (strips from top to bottom); 12 Diagram of the electrophoresis result of the 8-tube row-based triple amplification of West Nile virus, Eastern equine encephalomyelitis virus, and Venezuelan equine encephalomyelitis virus (stripes from top to bottom); 13 Diagram of the electrophoresis result of the 8-tube row-based triple amplification of West Nile virus, Eastern equine encephalomyelitis virus, and tick-borne encephalitis virus (stripes from top to bottom); 14 Diagram of the electrophoresis result of the 8-tube row-based triple amplification of West Nile virus, Venezuelan equine encephalomyelitis virus, and tick-borne encephalitis virus (stripes from top to bottom); 15 Diagram of the electrophoresis result of the 8-tube row-based triple amplification of Eastern equine encephalomyelitis virus, Venezuelan equine encephalomyelitis virus, and tick-borne encephalitis virus (stripes from top to bottom); and 16 Diagram of the electrophoresis result of the 8-tube row-based quadruple amplification of West Nile virus, Eastern equine encephalomyelitis virus, Venezuelan equine encephalomyelitis virus, and tick-borne encephalitis virus (stripes from top to bottom). Fig. Figure 13 shows a diagram of the agarose gel electrophoresis result of an integrated PCR amplification. As shown in Fig. 13 is shown in the drawing: M ①DNA2000, 50 ng; ②DNA1000, 50ng; ③DNA750, 150ng; ④DNA500, 50ng; ⑤DNA250, 50ng; ⑥DNA100, 50ng; 2-8 Diagrams of electrophoresis results of tube bundle-based PCR amplification with automated loaded samples of tick-borne encephalitis virus; 9-16 Diagrams of the electrophoresis results of tube bundle-based PCR amplification with manually loaded samples of tick-borne encephalitis virus; and 1, 9 negative controls Example 1: Qualitative and semi-quantitative investigation of tube bundle-based PCR amplification of four mosquito-borne viruses. 1. Design of specific primers for the four mosquito-borne viruses.

[0046] Selecting from the mosquito-borne viruses: West Nile virus, eastern equine encephalomyelitis virus, Venezuelan equine encephalomyelitis virus, and tick-borne encephalitis virus; and designing specific primers with their gene coding regions as the target region of amplification, the sequences of which are listed in Table 1 (Sequences of specific primers of four mosquito-borne viruses). Table 1 Sequences of specific primers of four mosquito-borne viruses Names Sequences (5'-3') WNV-F TGCTGATATGATTGATCC WNV-R TAGCGTAACACATCAGTG EEE-F ACACTAAATTCACCCTAGTTCGAT EEE-R GTGTATAAAATTACTTAGGAGCAGCATTATG TBEV-F GATCAAGTTCAGAGCGGGAATG TBEV-R CGATGTCACACATGATGGTATCAG VEE-F CTACCCAAAATGGAGAAAGTTC VEE-R GCTTGGCTTCTACCTCAAAC 2. PCR system formulation

[0047] (1) Formulating a quadruple PCR reaction system comprising: 50 µL total reaction volume of the PCR reaction, 5 × 10 µL PCR buffer solution, 25 × 2 µL enzyme, 0.3 µmol / L each of upstream and downstream primers of West Nile virus, Eastern equine encephalomyelitis virus, Venezuelan equine encephalomyelitis virus, and tick-borne encephalitis virus, 6 µL template, and water to make up to a final volume of 50 µL;

[0048] (2) Formulating a triple PCR reaction system, a total of 4 groups, respectively as follows: 1 West Nile virus, Eastern equine encephalomyelitis virus, and Venezuelan equine encephalomyelitis virus; 2 West Nile virus, Eastern equine encephalomyelitis virus, and tick-borne encephalitis virus; 3 West Nile virus, Venezuelan equine encephalomyelitis virus, and tick-borne encephalitis virus; and 4 Eastern equine encephalomyelitis virus, Venezuelan equine encephalomyelitis virus, and tick-borne encephalitis virus. comprising: 25 µL total reaction volume of the PCR reaction, 5 × 5 µL PCR buffer solution, 25 × 1 µL enzyme, 0.3 µmol / L each of upstream and downstream primers, 6 µL template, and water to make up to a final volume of 25 µL.

[0049] (3) Formulating a two-way PCR reaction system, a total of 6 groups, respectively as follows: 1 West Nile virus and Eastern equine encephalomyelitis virus; 2 West Nile virus and Venezuelan equine encephalomyelitis virus; 3 West Nile virus and tick-borne encephalitis virus; 3 Eastern equine encephalomyelitis virus and Venezuelan equine encephalomyelitis virus; 3 Eastern equine encephalomyelitis virus and tick-borne encephalitis virus; and 6 Venezuelan equine encephalomyelitis virus and tick-borne encephalitis virus. comprising: 25 µL total reaction volume of the PCR reaction, 5 × 5 µL PCR buffer solution, 25 × 1 µL enzyme, 0.3 µmol / L each of upstream and downstream primers, 6 µL template, and water to make up to a final volume of 25 µL.

[0050] (4) Formulate a simple PCR reaction system, a total of 4 groups, respectively as follows: 1 West Nile virus; 3 Eastern equine encephalomyelitis virus; 3 Venezuelan equine encephalomyelitis virus; and @ Tick-borne encephalitis virus; comprising: 15 µL total reaction volume of the PCR reaction, 5 × 3 µL PCR buffer solution, 25 × 0.6 µL enzyme, 0.3 µmol / L each of upstream and downstream primers, 6 µL template, and water to make up to a final volume of 15 µL. 3. PCR amplification

[0051] (1) Amplification using a Veriti® 96-well thermal cycler PCR instrument

[0052] The above duplicate, triple, and quadruple systems were each added to an Axgen 8-tube PCR tube under reaction conditions: 50°C for 2 min; 94°C for 2 min; 94°C for 15 s; 58°C for 45 s, and 35 cycles in total;

[0053] (2) Amplification using a tube bundle-based PCR instrument

[0054] The above simple systems were each added from the top of the tube to an 8-well tube bundle, with ① West Nile virus; ② Eastern equine encephalomyelitis virus; ③ Venezuelan equine encephalomyelitis virus; and ④ Tick-borne encephalitis virus being added to wells 1, 3, 5, and 7, respectively, while negative control systems were added to wells 2, 4, 6, and 8, respectively, under reaction conditions: 50°C for 2 min; 94°C for 2 min; 94°C for 15 s; 58°C for 45 s, and 35 cycles in total. 4. Results of the qualitative and semi-quantitative study

[0055] Referring to the Cowin Bio DM2000 DNA Marker Test Guide for the agarose gel electrophoresis experiment, Tanon® Gel Image System ID analysis software was used. The effects of the tube-bundle-based amplifications of the four viruses were better than those of the triplicate and quadruplicate Axgen 8-tube PCR tube-based reactions. The semi-quantitative results were shown in Table 2 (Table of total PCR amplification products of different amplification systems), and the qualitative results were shown in Fig. 12 shown. Table 2 Table of totals of PCR Amplification products of different amplification systems Serial number Yield (ng) 180bp 158bp 101bp 73bp 1 - a - - - 2 137 3 - 125,07 - - 4 - - 89,68 - 5 - - - 122,8 6 123 115 - - 7 106,7 - 83,28 - 8 85,39 - - 114,69 9 - 96,11 80,28 - 10 - 89,28 - 115,17 11 - - 81,54 115,17 12 79,36 81,44 41,43 - 13 75,22 74,13 - 114,69 14 69,3 - 42, 72 114,69 15 - 71,58 39 96 110,22 16 52,52 47,69 28,86 84,93 a: No target product strip was detected. Example 2: Qualitative and semi-quantitative investigation of the stability of tube-bundle-based PCR amplification. 1. PCR system formulation

[0056] Formulation of the PCR reaction system: 15 µL total reaction volume of the PCR reaction per well, 5 × 3 µL PCR buffer solution, 25 × 0.6 µL enzyme, 0.3 µmol / L each of upstream and downstream primers, 6 µL template, and water to make up to a final volume of 15 µL. 2. PCR amplification

[0057] The system formulated above was added from the top of the tube to each 8-well tube bundle, with a negative control system added to well 1 and the tick-borne encephalitis virus reaction system added to wells 2-8.

[0058] The reaction conditions were as follows: 50°C for 2 min; 94°C for 2 min; 94°C for 15 s; 58°C for 45 s, and 35 cycles in total. 3. Results of the qualitative and semi-quantitative study

[0059] Referring to the Cowin Bio DM2000 DNA Marker Test Guide for the agarose gel electrophoresis experiment, Tanon® Gel Image System ID analysis software was used, and the results showed that the PCR amplification effects were relatively stable and uniform for automated and manual sample loading, respectively. The semi-quantitative results were shown in Table 3 (Graph of agarose gel electrophoresis results of integrated PCR amplification), and the qualitative results were shown in Fig. 13 shown. Table 3 Diagram of agarose gel electrophoresis results of integrated PCR amplification Serial number Yield (ng) 1 - a 2 240,74 3 215,43 4 240,12 5 242,47 6 245,06 7 216,67 8 204,12 9 207,41 10 216,67 11 219,75 12 211,73 13 222,84 14 223,7 15 224,69 16 - a a: No target product strip was detected.

[0060] Finally, it should be explained that the above respective embodiments serve only to describe the technical solutions of this disclosure, rather than limiting them. Although this disclosure is described in detail with reference to the preceding respective embodiments, those skilled in the art should understand that the technical solutions recorded in the preceding respective embodiments may still be modified, or partial or all technical features may be substituted therein, while these modifications or substitutions do not cause the essence of the respective technical solutions to deviate from the scope of the technical solutions of the respective embodiments of this disclosure.

[0061] Furthermore, although some embodiments described above include certain features included in other embodiments, rather than including further features, it should be understood by those skilled in the art that a combination of features of different embodiments falls within the scope of the present disclosure and forms different embodiments. For example, in the following claims, any of the claimed embodiments may be used in any combination. Furthermore, the information disclosed in the "Technical Background" section only serves to enhance the understanding of the overall technical background of the present disclosure and should not be considered as an acknowledgment or any form of suggestion that this information forms the prior art already known to those skilled in the art. Industrial applicability

[0062] In the reaction tube for multiple nucleic acid amplification provided in the present disclosure, multiple PCR amplification can be performed by adding a nucleic acid sample and various PCR systems, or alternatively, a PCR freeze-drying system is included in the tube cavity. As needed, a nucleic acid sample for amplification is distributed in different reaction tube cavities, and multiple different types of nucleic acids can be amplified simultaneously and stored under the same reaction environment or prepared for other reaction tests, thereby significantly increasing the efficiency of nucleic acid amplification and ensuring the uniformity of nucleic acid amplification conditions.

Claims

[1] A reaction tube for multiple nucleic acid amplification, the reaction tube for multiple nucleic acid amplification comprising a base (1) and a plurality of reaction tube cavities (3); the base (1) is provided with a reference plane (2), the openings of the plurality of reaction tube cavities (3) are all provided on the reference plane (2), and the interiors thereof each extend perpendicular to the reference plane (2) toward the interior of the base (1), characterized by that the plurality of reaction tube cavities (3) are distributed in a ring shape around the same axis. [2] Reaction tube for multiple nucleic acid amplification according to claim 2, characterized by that the plurality of reaction tube cavities (3) are distributed in a ring shape with the same radius around the same axis. [3] Reaction tube for multiple nucleic acid amplification according to claim 2, characterized bythat the plurality of reaction tube cavities (3) are distributed over the rings with several different radii around the same axis. [4] Reaction tube for multiple nucleic acid amplification according to claim 2 or 3, characterized by that the plurality of reaction tube cavities (3) located on the same ring are each fixed separately on the base (1). [5] Reaction tube for multiple nucleic acid amplification according to claim 2 or 3, characterized by that the plurality of reaction tube cavities (3) located on the same ring are integrally formed and fixed on the base (1). [6] Reaction tube for multiple nucleic acid amplification according to one of claims 1 to 5, characterized by that the reaction tube cavity (3) comprises a tube cavity main body and a conical bottom which communicates with the tube cavity main body and tapers from top to bottom. [7] Reaction tube for multiple nucleic acid amplification according to one of claims 1 to 6, characterized by that the material of the reaction tube cavity (3) contains polypropylene plastic. [8] Reaction tube for multiple nucleic acid amplification according to one of claims 1 to 7, characterized by that a central tube cavity (4) is also included, which is arranged on the reference plane (2) and is located in the middle of the ring(s) of the plurality of reaction tube cavities (3). [9] Reaction tube for multiple nucleic acid amplification according to claim 8, characterized by that the central tube cavity (4) passes through the base (1). [10] Reaction tube for multiple nucleic acid amplification according to claim 9, characterized by that the base (1) is cylindrical, the axis of which coincides with the axis of the central tube cavity (4). [11] Reaction tube for multiple nucleic acid amplification according to one of claims 1 to 9, characterized bythat a plugging cap is also included, which is arranged on the base (1) and is configured to plug the opening of the reaction tube cavity (3). [12] Reaction tube for multiple nucleic acid amplification according to claim 11, characterized by that the plugging cap further comprises a filling hole configured to inject a reaction liquid into the reaction tube cavity (3). [13] Reaction tube for multiple nucleic acid amplification according to claim 11 or 12, characterized by that the blockage cap is detachably connected to the base (1). [14] Reaction tube for multiple nucleic acid amplification according to claim 11 or 12, characterized by that the blockage cap is hinged to the base (1). [15] Reaction tube for multiple nucleic acid amplification according to one of claims 1 to 14, characterized bythat a blocking element is also included, which is arranged at the opening of the reaction tube cavity (3). [16] Reaction tube for multiple nucleic acid amplification according to claim 15, characterized by that the blocking element is a heat-seal film or a heat-seal adhesive. [17] Reaction tube for multiple nucleic acid amplification according to one of claims 11 to 16, characterized by that the plugging element is arranged at the opening of any one of the reaction tube cavities (3); a screw cap is screwably arranged at one end of the base (1) to plug the openings of the plurality of reaction tube cavities (3). [18] Reaction tube for multiple nucleic acid amplification according to claim 1, characterized by that the plurality of reaction tube cavities (3) in the array are distributed on the reference plane (2).

Images