A system for evaluating the properties of plant growth-promoting rhizobacteria (PGPR) endophytic bacteria isolated from Acanthus ilicifolius L.

Abstract

A system for evaluating the plant growth-promoting rhizobacterial properties (PGPR) of endophytic bacteria isolated from Acanthus ilicifolius L., and for assessing plant growth parameters, consisting of: a) an isolation unit for isolating and purifying endophytic bacteria from leaves of Acanthus ilicifolius L., the isolation unit comprising: • Surface sterilization device configured to treat leaf explants successively with Tween20 solution, 70% ethanol and 1% mercuric chloride, • Grinding device for homogenizing leaf tissue with phosphate buffer solution, • Incubation chamber configured for the cultivation of bacterial colonies on nutrient agar at 37°C; b) a characterization unit for the morphological, biochemical and molecular characterization of isolated bacteria, wherein the characterization unit comprises the following: • Equipment for Gram staining, • Equipment for biochemical tests for performing the indole test, the methyl red test, the citrate utilization test, the H2S production test, the gelatin hydrolysis test, the starch hydrolysis test and the catalase test, and • Molecular analysis equipment configured for 16S rRNA sequencing, including DNA isolation apparatus, PCR thermocycler and DNA sequencer; c) an optimization unit configured to analyze the culture conditions for maximum bacterial growth at different temperatures and pH values, the optimization unit comprising a colorimeter configured to measure absorbance at 610 nm to generate bacterial growth curves; d) a PGPR property evaluation unit for assessing the plant growth-promoting potential of isolated bacteria, wherein the PGPR property evaluation unit comprises the following: • Testing equipment for indole-3-acetic acid (IAA) production using the Salkowski color test, • Test apparatus for phosphate solubilization using the Pikovskaya medium • Devices for testing siderophore production using chromazurol S-agar (CAS agar) and • Test apparatus for the activity of 1-amino-1-cyclopropane-1-carboxylate (ACC) deaminase using Dworkin and Foster minimal salt medium; and e) a plant growth evaluation unit configured for in vitro analysis of the effects of bacterial inoculum on plant growth parameters such as stem length, root length, leaf length and chlorophyll content.

Description

AREA OF INVENTION

[0001] The present disclosure relates to a system for evaluating the plant growth-promoting rhizobacterial properties (PGPR) of endophytic bacteria isolated from Acanthus ilicifolius L. BACKGROUND OF THE INVENTION

[0002] Endophytic bacteria are microorganisms that live inside healthy plants without harming them. Due to their ability to promote plant growth through mechanisms such as biological nitrogen fixation, phosphate release, the production of phytohormones like indole-3-acetic acid (IAA), siderophore synthesis, and the production of 1-amino-1-cyclopropane-1-carboxylate (ACC) deaminase, these bacteria have attracted considerable scientific interest. The beneficial interactions between endophytic bacteria and plants have revealed promising applications as biofertilizers, biopesticides, and remediation agents in sustainable agriculture.

[0003] Mangrove ecosystems, particularly species such as Acanthus ilicifolius L., represent unique habitats that support stress-resistant endophytic bacterial strains. These bacteria are adapted to extreme conditions such as high salinity, intense UV radiation, and fluctuating nutrient availability. These extreme conditions promote the evolution of endophytic bacteria with enhanced abilities to boost plant growth under stress. As a result, mangroves are valuable sources for isolating novel bacterial strains with significant biotechnological potential for agricultural applications.

[0004] Common methods for investigating endophytic bacteria involve several individual processes, including surface sterilization, bacterial isolation and purification, morphological and biochemical characterization, molecular identification via 16S rRNA sequencing, optimization of growth conditions, and evaluation of plant growth-promoting properties through various assays. However, existing approaches lack an integrated system that efficiently combines these processes into a unified platform for the comprehensive evaluation of PGPR properties. The fragmented nature of conventional methods leads to labor-intensive procedures, high time expenditure, and potential inconsistencies in data interpretation, particularly regarding the correlation of in vitro expression of PGPR properties with actual plant growth enhancement.

[0005] Therefore, there is a significant need for an integrated system that combines isolation, characterization, optimization, evaluation of PGPR properties, and plant growth analysis in a single platform. The present invention addresses these shortcomings with a comprehensive system featuring functionally integrated units for the processing, characterization, optimization, and evaluation of endophytic bacteria isolated from Acanthus ilicifolius L. This enables a systematic assessment of their plant growth-promoting potential and their suitability for agricultural and biotechnological applications. SUMMARY OF THE INVENTION

[0006] The present invention relates to an integrated system for evaluating the plant growth-promoting properties of rhizobacteria (PGPR) endophytic bacteria isolated from Acanthus ilicifolius L., a mangrove species. The aim is to enable the isolation, characterization, optimization, evaluation of PGPR properties, and assessment of plant growth in a unified system in order to systematically evaluate the plant growth-promoting potential of endophytic bacteria and their suitability for agricultural and biotechnological applications, including their use as biofertilizers, bioremediation agents, and agents for controlling plant diseases.

[0007] The present disclosure aims to provide a system for evaluating the plant growth-promoting properties of rhizobacteria (PGPR) endophytic bacteria from Acanthus ilicifolius L. and for assessing plant growth parameters. The system comprises: a) an isolation unit for isolating and purifying endophytic bacteria from leaves of Acanthus ilicifolius L., wherein the isolation unit comprises: a surface sterilization device for sequentially treating leaf explants with Tween-20 solution, 70% ethanol, and 1% mercuric chloride; a milling device for homogenizing leaf tissue with phosphate buffer solution; and an incubation chamber for cultivating bacterial colonies on nutrient agar at 37 °C;b) a characterization unit for the morphological, biochemical and molecular characterization of isolated bacteria, the characterization unit comprising: a Gram staining apparatus, a biochemical testing apparatus for performing the indole test, the methyl red test, the citrate utilization test, the H2S production test, the gelatin hydrolysis test, the starch hydrolysis test and the catalase test, and a molecular analysis apparatus for performing 16S rRNA sequencing including a DNA isolation apparatus, a PCR thermocycler and a DNA sequencer; c) an optimization unit for analyzing culture conditions to maximize bacterial growth at different temperatures and pH values, the optimization unit comprising a colorimeter for measuring absorbance at 610 nm for generating bacterial growth curves;d) a PGPR property evaluation unit for assessing the plant growth-promoting potential of isolated bacteria, the PGPR property evaluation unit comprising: a test facility for indole-3-acetic acid (IAA) production using the Salkowski color test, a test facility for phosphate solubilization using Pikovskaya medium, a test facility for siderophore production using chromazurol-S (CAS) agar, and a test facility for 1-amino-1-cyclopropane-1-carboxylate (ACC) deaminase activity using Dworkin and Foster minimal salt medium; and e) a plant growth evaluation unit for performing in vitro analyses of the effects of bacterial inoculum on plant growth parameters such as stem height, root length, leaf length, and chlorophyll content.

[0008] The subject of the present disclosure is the provision of a system for evaluating the plant growth-promoting rhizobacterial properties (PGPR) of endophytic bacteria isolated from Acanthus ilicifolius L.

[0009] Another objective of the present disclosure is the isolation and purification of endophytic bacteria from the mangrove Acanthus ilicifolius L.

[0010] Another objective of the present disclosure is the morphological, biochemical and molecular characterization of the isolated bacteria.

[0011] Another objective of the present disclosure is the use of various techniques such as Gram staining, biochemical tests and 16S rRNA sequencing.

[0012] Another objective of the present disclosure is the analysis of the optimization of culture conditions to maximize bacterial growth.

[0013] Another objective of this disclosure is to evaluate the plant growth-promoting potential of the isolated bacteria.

[0014] However, another objective of the present disclosure is to explore the potential applications of the isolated bacteria in agriculture and biotechnology.

[0015] To further clarify the advantages and features of the present disclosure, the invention is described in more detail with reference to specific embodiments illustrated in the accompanying drawing. It is understood that this drawing merely shows typical embodiments of the invention and is therefore not to be understood as limiting its scope of protection. The invention is described and explained in more detail and with reference to the accompanying drawing. BRIEF DESCRIPTION OF THE IMAGE

[0016] These and other features, aspects and advantages of the present disclosure will be better understood when the following detailed description is read with reference to the accompanying drawing, in which the same symbols represent the same parts, wherein: Fig. Figure 1 shows a block diagram of a system for evaluating the plant growth-promoting rhizobacterial properties (PGPR) of endophytic bacteria isolated from Acanthus ilicifolius L., according to an embodiment of the present disclosure.

[0017] Furthermore, those skilled in the art will recognize that the elements in the drawing are simplified and not necessarily drawn to scale. For example, the flowcharts illustrate the process by highlighting the main steps to facilitate understanding of the present disclosure. With regard to the construction of the device, one or more components may be represented in the drawing by conventional symbols. The drawing may show only those specific details relevant to understanding the embodiments of the present disclosure, so as not to clutter the drawing with details that are already apparent to those skilled in the art from the description contained herein. DETAILED DESCRIPTION:

[0018] To facilitate understanding of the principles of the invention, reference is made below to the embodiment shown in the drawing, which is described using specific terms. It is understood, however, that this does not limit the scope of protection of the invention. Rather, modifications and further developments of the depicted system, as well as further applications of the inventive principles shown therein, are conceivable, insofar as they would normally occur to a person skilled in the art in the field of the invention.

[0019] It will be clear to those skilled in the art that the foregoing general description and the following detailed description are exemplary and explanatory of the invention and are not to be understood as a limitation of it.

[0020] References to “an aspect”, “another aspect”, or similar phrases in this description mean that a particular feature, structure, or property described in connection with the embodiment is included in at least one embodiment of the present disclosure. Therefore, phrases such as “in one embodiment”, “in another embodiment”, and similar expressions in this description may, but do not necessarily, all refer to the same embodiment.

[0021] The terms "includes," "comprehensive," or similar expressions denote non-exclusive inclusion. Thus, a procedure or method containing a list of steps does not only include those steps but may also include further steps not explicitly listed or inherent in the procedure or method. Likewise, the statement "includes..." for one or more devices, subsystems, elements, structures, or components, without further limitations, does not preclude the existence of other devices, subsystems, elements, structures, or components.

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meanings generally known to those skilled in the art in the field to which this invention belongs. The systems, methods, and examples described herein serve only for illustration and are not to be understood as limiting.

[0023] Embodiments of the present disclosure are described in detail below with reference to the attached drawing.

[0024] The system (100) according to Fig.1 comprises: a) an isolation unit (102) for isolating and purifying endophytic bacteria from leaves of Acanthus ilicifolius L., the isolation unit (102) comprising: a surface sterilization device for sequentially treating leaf explants with Tween20 solution, 70% ethanol and 1% mercuric chloride, a milling device for homogenizing leaf tissue with phosphate buffer solution and an incubation chamber for cultivating bacterial colonies on nutrient agar at 37°C;b) a characterization unit (104) for the morphological, biochemical and molecular characterization of isolated bacteria, wherein the characterization unit (104) comprises: a Gram staining apparatus, a biochemical testing apparatus for performing the indole test, the methyl red test, the citrate utilization test, the H2S production test, the gelatin hydrolysis test, the starch hydrolysis test and the catalase test, and a molecular analysis apparatus for performing 16S rRNA sequencing including a DNA isolation apparatus, a PCR thermocycler and a DNA sequencer; c) an optimization unit (106) for analyzing culture conditions to maximize bacterial growth at different temperatures and pH values, wherein the optimization unit (106) comprises a colorimeter for measuring absorbance at 610 nm for generating bacterial growth curves;d) a PGPR property evaluation unit (108) for assessing the plant growth-promoting potential of isolated bacteria, the PGPR property evaluation unit (108) comprising: a test apparatus for indole-3-acetic acid (IAA) production using the Salkowski color test, a test apparatus for phosphate solubilization using Pikovskaya medium, a test apparatus for siderophore production using chromazurol-S (CAS) agar, and a test apparatus for 1-amino-1-cyclopropane-1-carboxylate (ACC) deaminase activity using Dworkin and Foster minimal salt medium; and e) a plant growth evaluation unit (110) for performing in vitro analyses of the effects of bacterial inoculum on plant growth parameters such as stem length, root length, leaf length, and chlorophyll content.

[0025] In one embodiment, the isolation unit (102) is configured to perform subculturing of selected isolates by repeated streaking onto agar plates to obtain pure bacterial strains.

[0026] In one embodiment, the optimization unit (106) is configured to test bacterial growth at temperatures of 4°C, 37°C and 50°C.

[0027] In one embodiment, the optimization unit (106) is configured to maintain the pH value at 4, 7 or 10 using acetate buffer, phosphate buffer or bicarbonate buffer respectively.

[0028] In one embodiment, the molecular analysis device of the characterization unit (104) comprises a PCR apparatus configured to perform a thermocycler with denaturation at 95 °C, annealing at 55 °C and extension at 72 °C using the primers 27F and 1492R for 16S rRNA amplification.

[0029] In one embodiment, the characterization unit (104) further comprises a MacConkey agar assay device configured to differentiate bacteria based on their ability to ferment lactose.

[0030] In one embodiment, the PGPR property evaluation unit (108) is configured to measure IAA production by adding Salkowski's reagent to the culture filtrate and measuring the optical density at 540 nm.

[0031] In one embodiment, the plant growth evaluation unit (110) comprises a device for using paper towels, configured to germinate and grow Vigna unguiculata (L.) Walp. seeds for comparative analysis between bacteria-inoculated and control groups.

[0032] In one embodiment, the plant growth evaluation unit (110) further comprises a chlorophyll content measuring device configured to extract chlorophyll with 80% acetone and measure the absorption at wavelengths of 663 nm and 645 nm.

[0033] In one embodiment, the system is configured to isolate Sphingomonas paucimobilis as an endophytic bacterium from Acanthus ilicifolius L. for use as a biofertilizer, bioremediation agent, or agent for controlling plant diseases.

[0034] The present invention provides a system for evaluating the plant growth-promoting properties of rhizobacteria (PGPR) from endophytic bacteria of Acanthus ilicifolius L. and for assessing plant growth parameters.The system includes an isolation unit for isolating and purifying endophytic bacteria from leaf tissue by surface sterilization and cultivation on nutrient agar, a characterization unit for morphological, biochemical, and molecular identification (including Gram staining, biochemical tests, and 16S rRNA sequencing with PCR amplification and DNA sequencing), an optimization unit for determining optimal growth conditions by analyzing bacterial growth at different temperatures and pH values ​​using colorimetric measurements, a PGPR property evaluation unit for determining indole-3-acetic acid production, phosphate release, siderophore production, and ACC deaminase activity using special assays, and a plant growth evaluation unit for in vitro analysis of the effects of the bacterial inoculum on plant growth parameters such as stem length, root length, leaf length, and chlorophyll content.This enables a comprehensive evaluation of endophytic bacteria such as Sphingomonas paucimobilis for applications as biofertilizers, bioremediation agents, and plant disease control agents in agriculture and biotechnology.

[0035] For screening for endophytic bacterial association, bacterial examination is carried out in the laminar airflow (LAF) system of the microbiology laboratory, with explants being taken from the healthy leaves of Acanthus ilicifolius L.

[0036] The system features a dedicated device for screening and isolating endophytic bacterial associations from plant tissue. Bacterial examination is performed in a laminar flow environment within a microbiology laboratory, into which healthy leaf explants of Acanthus ilicifolius L. are introduced. The isolation process involves the sequential surface treatment of the leaves, beginning with repeated washing under running water, followed by washing with Tween-20 solution and subsequent rinsing. The system then assists sterilization by immersion in 70% ethanol for two minutes, treatment with 1% mercury(II) chloride solution for two minutes, and finally, seven washes with distilled water to remove any surface contamination.The isolation module also includes a grinding function that homogenizes the sterilized leaves with 10 ml of phosphate buffer using sterile grinding tools such as a mortar and pestle. The resulting tissue extract is plated onto nutrient agar plates for microbial cultivation. An incubation function maintains the plates at 37 °C for 24 hours to allow colony growth. A control plate containing agar nutrient medium after the final wash, but without a leaf explant, serves to verify sample purity; the absence of growth in this control confirms the absence of epiphytic contamination.

[0037] To obtain pure bacterial strains, the system enables the production and sterilization of nutrient agar via autoclaving. A laminar flow chamber ensures sterile conditions. The isolated bacterial colonies are streaked onto solidified agar, and the plates are incubated for 24 hours in an incubator. For further purification, the isolated bacterial colonies are labeled and further purified by subculturing on agar plates. The bacteria are then streaked onto agar again.

[0038] The system includes an optimization component for maximizing culture conditions for bacterial growth. This involves analyzing the culture conditions that influence maximum bacterial growth. Controlled incubations at various temperatures—4 °C, 37 °C, and 50 °C—are conducted to determine the optimal temperature parameters. pH-dependent growth analysis is supported by defined buffer systems: acetate buffer for pH 3.6–5.6, phosphate buffer for pH 5.8–7.4, and bicarbonate buffer for pH 9.2–10.6. This allows for evaluation at target pH values ​​of 4, 7, and 10. A loopful of organisms was inoculated onto 10 ml of nutrient broth and incubated for 12 hours, with pH and temperature varied. Absorbance was measured hourly at 610 nm in a colorimeter. The bacterial growth curve was determined by analyzing bacterial growth in the colorimeter.

[0039] The system includes an identification module for characterizing bacterial isolates using morphological, molecular, and biochemical analyses. Morphological characterization is supported by a device that enables Gram staining of the bacterial isolates according to standard procedures in veterinary laboratories. A bacterial smear from a pure culture is prepared and fixed on a clean slide. The slide is covered with crystal violet for one minute and then rinsed with running tap water. It is then covered with Gram iodine solution for one minute and rinsed again with tap water. Decolorization is performed with 95% ethanol, followed immediately by rinsing with tap water. The slide is counterstained with safranin for one minute, rinsed with running tap water, and air-dried.The system makes it possible to cover the dried slide with immersion oil and view it under a microscope.

[0040] The system also includes a molecular characterization unit that enables the identification of the bacterial isolate via 16S rRNA sequencing. Genomic DNA isolation is performed using the EX pure Microbial DNA Isolation Kit. The protocol begins with lysis and homogenization: Monolayer cells are lysed by aseptically suspending 1–3 colonies in 450 µL of lysis buffer in a 2 mL microcentrifuge tube and then repeatedly pipetting. Next, 4 µL of RNase and 250 µL of neutralization buffer are added. The mixture is vortexed and incubated in a water bath at 65 °C for 30 minutes. To minimize DNA fragmentation, the DNA solutions are mixed by inverting. The tubes are centrifuged for 20 minutes at 14,000 rpm and 10 °C. After centrifugation, the viscous supernatant is transferred to a fresh 2-mL microcentrifuge tube without disturbing the pellet.600 µL of binding buffer are added, pipetted thoroughly, and incubated for 5 minutes at room temperature. 600 µL of the lysate are transferred to a spin column in a collection tube and centrifuged for 2 minutes at 14,000 rpm. The flow is discarded. The spin column is reconnected to the collection tube, the remaining 600 µL of lysate are added, and the column is centrifuged again for 2 minutes at 14,000 rpm, with the flow being discarded. Next, 500 µL of wash buffer I are added to the spin column, and the column is centrifuged for 2 minutes at 14,000 rpm, with the flow being discarded. The column is reassembled, 500 µL of wash buffer II are added, and the column is centrifuged for 2 minutes at 14,000 rpm. The spin column is then transferred to a sterile 1.5 ml microcentrifuge tube, and 100 µl of elution buffer is added to the center of the column without touching the filter. After 5 minutes of incubation at room temperature, the tubes are centrifuged at 6000 rpm.DNA concentrations are measured using Qubit 3.0.

[0041] PCR amplification also takes place within the system. In PCR, primers are used to amplify genomic DNA sequences using DNA polymerase. This synthesizes DNA from deoxynucleotide substrates on a single-stranded DNA template by adding nucleotides to the 3' end of a custom-designed oligonucleotide that hybridizes to a longer DNA template. Thus, when a synthetic oligonucleotide hybridizes to a single-stranded template containing a region complementary to the oligonucleotide, the DNA polymerase can use the oligonucleotide as a primer and extend its 3' end to create an elongated region of double-stranded DNA.

[0042] The Taq master mix consists of Taq DNA polymerase in 2x Taq buffer, 0.4 mM dNTPs, 3.2 mM MgCl₂, and 0.02% bromophenol blue. For primer application, 5 µL of isolated DNA is added to a 25 µL PCR reaction solution containing 1.5 µL each of forward and reverse primers, 5 µL deionized water, and 12 µL of Taq master mix. PCR is performed under the following thermocycler conditions: denaturation at 95 °C, whereby the DNA template is heated to 95 °C, breaking the weak hydrogen bonds that hold the DNA strands together in a helix and causing the strands to separate, resulting in single-stranded DNA. Annealing, where the mixture is cooled to 55 °C or higher so that the primers bind (anneal) to the complementary sequence in the template DNA; and elongation, where the reaction is subsequently heated to 72 °C, the optimal temperature for DNA polymerase.DNA polymerase extends the primers by sequentially adding nucleotides to them, using the target DNA as a template. The details of the primer encoding are described in the following table. Primer name Sequence details Number of bases 27F 5'AGAGTTTGATCCTGGCTCAG3' 20 1492R 5'AAGGAGGTGATCCAGCCGCA3' 20

[0043] PCR products are cleaned using the Montage PCR Clean-Up Kit to remove unincorporated primers and dNTPs. Sequencing of the PCR products is performed using the ABI PRISM® BigDye™ Terminator Cycle Sequencing Kit and AmpliTaq® DNA polymerase (FS enzyme). The sequencing protocol involves sequencing each template in a single run using universal 16S rRNA primers. Fluorescently labeled fragments are purified of unincorporated terminators by ethanol precipitation. Samples are suspended in distilled water and separated electrophoretically in an ABI 3730x1 sequencer (Applied Biosystems). DNA from bacterial samples is also isolated using AllPrep Bacterial / Fungal DNA / RNA / Protein Kits, and DNA concentrations are analyzed using a qubit.The fluorometer detects fluorescence signals only when dyes bind to specific target molecules such as DNA or RNA, even in the presence of free nucleotides, degraded nucleic acids, or protein impurities. The sample obtained had a DNA concentration of 23.6 mg / µL.

[0044] The system also supports bioinformatic analyses. The 16S rRNA sequence is analyzed using BLAST search with the NCBI similarity tool. Phylogenetic analysis is performed using closely related sequences from the BLAST results, followed by multiple sequence alignment. MUSCLE 3.7 is used for multiple sequence alignment, and the aligned sequences are refined with Gblocks 0.91b, removing poorly aligned positions and divergent regions. PhyML 3.0 aLRT is used for phylogenetic analysis with the HKY85 substitution model. PhyML is characterized by high accuracy compared to other phylogeny programs, while also offering significantly higher speed. TreeDyn 198.3 is used to visualize the phylogenetic tree.The system also supports biochemical characterization to differentiate bacterial species based on biochemical activities such as protein, fat, and carbohydrate metabolism, enzyme production, and compound utilization. Growth on MacConkey agar is assessed using selective and differential MacConkey medium for the isolation and differentiation of Gram-negative bacteria based on their lactose fermentation. Isolates are inoculated onto MacConkey agar and incubated overnight at 37 °C to observe growth and lactose fermentation properties. For the indole test, sterilized test tubes containing 4 ml of tryptophan broth are aseptically inoculated with an 18–24 hour old culture and incubated for 24–28 hours at 37 °C. After incubation, 0.5 ml of Kovacs reagent is added. A cherry-red coloration of the upper layer indicates a positive result.In the Methyl Red test, MRVP broth is prepared in test tubes and aseptically inoculated with two loops of the bacterial culture. The test tubes are incubated for 48–72 hours at 37 °C, and after incubation, a few drops of Methyl Red indicator solution are added. The appearance of a red color indicates a positive result. This test detects microorganisms that produce stable acids through the fermentation of glucose with mixed acids. The Citrate Utilization Test assesses an organism's ability to utilize citrate as an energy source. The test tubes contain Simmons citrate agar, which is inoculated with each organism. Use a light inoculum from the center of the isolated colony and spread it evenly across the slant agar. After 4–7 days of aerobic incubation at 35–37 °C, observe a green-blue color change along the slant agar.For the H₂S production test, filter paper strips soaked in 5% lead acetate solution are dried and autoclaved for 15 minutes at 10 1b pressure. The strips are placed on nutrient broth inoculated with the selected bacterial culture. Darkening of the paper indicates H₂S production. Gelatin hydrolysis is investigated using gelatin agar medium prepared by adding 12% gelatin to nutrient broth and then autoclaving at 121 °C for 12 minutes. Tubes are inoculated by piercing the substrate and incubated at 37 °C. The tubes are removed daily and stored at 4 °C to detect liquefaction, which indicates gelatinase activity. Starch hydrolysis is determined by streaking the organism onto starch agar plates and incubating for 48 hours at 37 °C. After incubation, iodine solution is applied for 30 seconds and then poured off.A clear zone around the growth line indicates a positive result. The catalase test differentiates organisms based on their ability to produce the enzyme catalase. One to two milliliters of hydrogen peroxide solution are placed in a test tube, and colonies from an 18-24 hour old culture are immersed using a sterile instrument. Immediate bubbling indicates catalase activity.

[0045] The system includes a module for evaluating plant growth-promoting properties, enabling the assessment of various PGPR characteristics of bacterial isolates. Within this system, indole-3-acetic acid (IAA) production is investigated using the Salkowski colorimetric assay. The isolates are cultured in tryptophan broth at 32 °C for 5 days. Subsequently, the culture filtrate is separated by centrifugation at 10,000 × g for 10 minutes. 3 ml of Salkowski reagent and 2 ml of distilled water are added to 1 ml of the culture filtrate. After 30 minutes of incubation in the dark, the tubes are examined for a pink coloration, and the optical density at 540 nm is measured using a photochemimetric colorimeter. The system also supports the analysis of phosphate solubilization. The ability of bacterial endophytes to solubilize insoluble phosphate is tested on Pikovskaya medium with added calcium triphosphate.The isolates are inoculated onto Pikovskaya agar and incubated for 5–7 days at 32 °C. The formation of a halo around the bacterial colony is considered a positive indicator of mineral phosphate solubilization. Chromazurol-S agar (CAS agar) is used for siderophore production. CAS agar consists of a mixture of four solutions: Solution 1 (Fe-CaS indicator solution), Solution 2 (Pipes buffer), Solution 3 (glucose, mannitol, and trace elements), and Solution 4 (casamino acid). Each solution is prepared and sterilized separately before being mixed. The resulting Fe-CaS dye complex colors the medium blue to dark green. The isolates are cultured on this medium for 96 hours at 32 °C. The appearance of orange halos around the colonies indicates siderophore production. The system also supports the assessment of 1-Amino-1-cyclopropane-1-carboxylate (ACC) deaminase production activity.In the first screening stage, each isolated endophyte strain is placed on Petri dishes with Dworkin and Foster minimal medium (g L. -1 : KH2PO4 (4), Na2HPO4 (6), MgSO4 · 7H2O (0.2), Glucose (2), Gluconic acid (2), Citric acid (2), Agar (15) and trace elements mg L -1 [FeSO4 · 7H2O (1), H3BO3 (10), MnSO4 · H2O (11.19), ZnSO4 · 7H2O (124.6), CuSO4 · 5H2O (78.22), MoO3 (10), FeSO4 · 7H2O (1000)]) is inoculated at pH 7.2. The medium is supplemented with 3 mM ACC as the sole nitrogen source. The inoculated plates are incubated for 48–98 hours at 28 ± 2 °C. Colonies on this medium indicate a positive capacity for ACC utilization; such isolates are selected for further quantitative analysis.

[0046] The system also includes a module for assessing plant growth for the in vitro evaluation of the effects of bacterial inocula on plant development. In this setup, the growth parameters of Vigna unguiculata (L.) Walp. are compared using the paper towel method in Petri dishes. The inoculum is prepared from a bacterial culture in the logarithmic growth phase. Two study groups—test and control—are established. Soil is filled into pots with 1.5 kg of soil each, and each treatment is repeated three times in a fully randomized experimental design. The seedlings are carefully planted, and the test group is inoculated with bacterial culture on days 3, 7, and 10. The study is conducted for two weeks under controlled conditions, after which the plants are analyzed. The system also supports chlorophyll content analysis. Approximately 0.Fifteen grams of fresh leaves from the control and inoculated pots are collected and ground in a mortar. Ten milliliters of 80% acetone are added, the mixture is filtered, and transferred to centrifuge tubes. Centrifugation is carried out for 15 minutes at 10,000 rpm and 4 °C. The chlorophyll content is calculated based on the absorbance at 663 nm and 645 nm using the following formulas: Chlorophyll a=12.7(A663)−2.69(A645) Chlorophyll b=22.9(A645)−4.68(A663) Total chlorophyll(a+b)=Z=8.02(A663)−20.20(A645)

[0047] System-based analysis of the isolated bacteria revealed that the strain is Gram-negative, coccoid, and cluster-forming. Optimization of growth conditions using response surface analysis showed that the bacteria exhibited maximum growth at 50 °C and a pH of 4. The plant growth-promoting effect of the isolate was investigated using the system's plant growth assessment module and paper towel experiments. These showed that the bacteria promoted the growth of Vigna unguiculata L. by increasing stem, root, and leaf length. The identified Sphingomonas paucimobilis also produced indole-3-acetic acid and exhibited ACC deaminase activity, both factors that promote plant growth, and furthermore showed phosphate-soluble properties. The results confirmed the successful isolation of Sphingomonas paucimobilis from Acanthus ilicifolius L.Sphingomonas paucimobilis, a mangrove species, was isolated and its potential as a plant growth-promoting bacterium was investigated. The results showed that the isolated bacteria could find valuable applications in agriculture and biotechnology. The present invention underscores the importance of mangrove species as a source of unique bacterial strains with potential benefits in these fields. Furthermore, the study highlighted the promising potential of Sphingomonas paucimobilis as a biofertilizer, bioremediation agent, and effective contributor to the control of plant diseases.

[0048] The drawing and the preceding description illustrate embodiments. Those skilled in the art will recognize that one or more of the described elements can be combined to form a single functional element. Alternatively, certain elements can be divided into several functional elements. Elements of one embodiment can be added to another. For example, the process flows described here can be modified and are not limited to the manner described herein. Furthermore, the actions of a flowchart need not be performed in the sequence shown; nor do all actions necessarily need to be carried out. Actions that do not depend on other actions can be performed in parallel with the other actions. The scope of protection of the embodiments is in no way limited by these specific examples. Numerous variations, whether explicitly stated in the description or not, such as...Differences in structure, dimensions, and materials are possible. The scope of protection of the embodiments is at least as comprehensive as described by the following claims.

[0049] The advantages, other benefits, and problem solutions have been described above with reference to specific embodiments. However, the advantages, benefits, problem solutions, and any components that can effect or enhance an advantage, benefit, or solution are not to be construed as critical, necessary, or essential features or components of the claims. REFERENCES 100 Block diagram of a system for evaluating the properties of plant growth-promoting rhizobacteria (PGPR) endophytic bacteria isolated from Acanthus ilicifolius L. 102 Isolation Ward 104 Characterization Unit 106 Optimization Unit 108 PGPR Feature Assessment Unit 110 Plant Growth Assessment Unit

Claims

[1] A system for evaluating the plant growth-promoting rhizobacterial properties (PGPR) of endophytic bacteria isolated from Acanthus ilicifolius L. and for assessing plant growth parameters, consisting of: a) an isolation unit for isolating and purifying endophytic bacteria from leaves of Acanthus ilicifolius L., the isolation unit comprising: • Surface sterilization device configured to treat leaf explants successively with Tween20 solution, 70% ethanol and 1% mercuric chloride, • Grinding device for homogenizing leaf tissue with phosphate buffer solution, • Incubation chamber configured for the cultivation of bacterial colonies on nutrient agar at 37°C; b) a characterization unit for the morphological, biochemical and molecular characterization of isolated bacteria, wherein the characterization unit comprises the following: • Equipment for Gram staining, • Equipment for biochemical tests for performing the indole test, the methyl red test, the citrate utilization test, the H2S production test, the gelatin hydrolysis test, the starch hydrolysis test and the catalase test, and • Molecular analysis equipment configured for 16S rRNA sequencing, including DNA isolation apparatus, PCR thermocycler and DNA sequencer; c) an optimization unit configured to analyze the culture conditions for maximum bacterial growth at different temperatures and pH values, the optimization unit comprising a colorimeter configured to measure absorbance at 610 nm to generate bacterial growth curves; d) a PGPR property evaluation unit for assessing the plant growth-promoting potential of isolated bacteria, wherein the PGPR property evaluation unit comprises the following: • Testing equipment for indole-3-acetic acid (IAA) production using the Salkowski color test, • Test apparatus for phosphate solubilization using the Pikovskaya medium • Devices for testing siderophore production using chromazurol S-agar (CAS agar) and • Test apparatus for the activity of 1-amino-1-cyclopropane-1-carboxylate (ACC) deaminase using Dworkin and Foster minimal salt medium; and e) a plant growth evaluation unit configured for in vitro analysis of the effects of bacterial inoculum on plant growth parameters such as stem length, root length, leaf length and chlorophyll content. [2] System according to claim 1, wherein the isolation unit is configured to perform the subculturing of selected isolates by repeated streaking onto agar plates to obtain pure bacterial strains. [3] System according to claim 1, wherein the optimization unit is configured to test bacterial growth at temperatures of 4°C, 37°C and 50°C. [4] System according to claim 1, wherein the optimization unit is configured to maintain the pH value at 4, 7 and 10 using acetate buffer, phosphate buffer or bicarbonate buffer respectively. [5] System according to claim 1, wherein the molecular analysis device of the characterization unit comprises a PCR apparatus configured to perform a thermocycler with denaturation at 95 °C, annealing at 55 °C and extension at 72 °C using the primers 27F and 1492R for 16S rRNA amplification. [6] System according to claim 1, wherein the characterization unit further comprises a MacConkey agar assay configured to differentiate bacteria based on their ability to ferment lactose. [7] System according to claim 1, wherein the PGPR property evaluation unit is configured to measure IAA production by adding Salkowski's reagent to the culture filtrate and measuring the optical density at 540 nm. [8] System according to claim 1, wherein the plant growth evaluation unit comprises a paper towel method configured for the germination and growth of Vigna unguiculata (L.) Walp. seeds for a comparative analysis between bacteria-inoculated and control groups. [9] System according to claim 1, wherein the plant growth evaluation unit further comprises a chlorophyll content measuring device configured to extract chlorophyll with 80% acetone and measure the absorption at wavelengths of 663 nm and 645 nm. [10] System according to claim 1, wherein the system is configured to isolate Sphingomonas paucimobilis as endophytic bacteria from Acanthus ilicifolius L. for use as a biofertilizer, bioremediation agent or agent for controlling plant diseases.

Images