METHOD FOR DETECTING A PREDETERMINED NUCLEOTIDE SEQUENCE
Patent Information
- Application Number
- DE602019079028
- Authority / Receiving Office
- DE · DE
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-04-19
- Filing Date
- 2019-05-14
- Publication Date
- 2025-12-10
- Estimated Expiration
- 2039-05-14
AI Technical Summary
Current nucleic acid sequencing methods require enzymatic amplification and polymerization steps, which are costly and time-consuming, and there is a need for a rapid, amplification- and enzyme-free sequencing method with long-read-lengths and low error rates.
The use of sequencing probes with barcode domains where each position corresponds to at least two nucleotides in the target binding domain, combined with a synthetic backbone and cleavable linkers, allows for enzyme-free, amplification-free nucleic acid sequencing with rapid sample-to-answer capability.
This approach enables rapid, cost-effective nucleic acid sequencing with long read lengths and low error rates, particularly suitable for clinical applications.
Description
BACKGROUND OF THE INVENTION
[0001] There are currently a variety of methods for nucleic acid sequencing, i.e., the process of determining the precise order of nucleotides within a nucleic acid molecule. Current methods require amplifying a nucleic acid enzymatically, e.g., PCR, and / or by cloning. Further enzymatic polymerizations are required to produce a detectable signal by a light detection means. Such amplification and polymerization steps are costly and / or time-consuming. WO2017 / 201073 describes probes comprising a target binding domain and a barcode domain with attachment regions which are suitable to bind complementary probes. WO2011 / 106583 provides probes and probe systems for detection of nucleic acids. WO2018 / 094385 (prior art pursuant to Art. 54(3) EPC) describes sequencing probes comprising barcode domains in which each position in the barcode domain corresponds to at least two nucleotides in the target binding domain. There is a need in the art for a method of nucleic acid sequencing that is rapid and amplification- and enzyme-free. The present disclosure addresses these needs.SUMMARY OF THE INVENTION
[0002] The invention is defined by the claims. Any other aspects, configurations or instances of the disclosure as set for herein not falling within the scope of the claims are for information only.
[0003] The invention provides a method for identifying the presence of a predetermined nucleotide sequence in a target nucleic acid, as defined by the claims. In related instances disclosed for illustrative purposes, there is provided sequencing probes, further methods, kits, and apparatuses that provide rapid enzyme-free, amplification-free, and library-free nucleic acid sequencing that has long-read-lengths and with low error rate. The sequencing probes described herein include barcode domains in which each position in the barcode domain corresponds to at least two nucleotides in the target binding domain. Moreover, the methods, kits, and apparatuses have rapid sample-to-answer capability. These features are particularly useful for sequencing in a clinical setting. The present disclosure is an improvement of the disclosure disclosed in Patent Publication No. U.S. 2016 / 0194701 (which corresponds to WO2016 / 081740).
[0004] In a related instance provided for illustrative purposes, there is provided a probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify a corresponding nucleotide in the target nucleic acid molecule and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment position comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, and wherein the synthetic backbone comprises L-DNA, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain and each of the at least three attachment positions have a different nucleic acid sequence, and wherein the nucleic acid sequence of each position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that is bound by the target binding domain; and a first complementary primary nucleic acid molecule hybridized to a first attachment position of the at least three attachment positions, wherein the first primary complementary nucleic acid molecule comprises at least two domains and a cleavable linker, wherein the first domain is hybridized to the first attachment position of the barcode domain and the second domain capable of hybridizing to at least one complementary secondary nucleic acid molecule, and wherein the linker modification is and wherein the linker modification is located between the first and second domains.
[0005] A probe can comprise about 60 nucleotides. A probe can comprise a single-stranded DNA synthetic backbone and a double-stranded DNA spacer between the target binding domain and the barcode domain. A single-stranded DNA synthetic backbone can comprise L-DNA. A single-stranded DNA synthetic backbone can comprise about 27 nucleotides. A double-stranded DNA spacer can comprise L-DNA. A double-stranded DNA spacer can comprise about 25 nucleotides in length.
[0006] The number of nucleotides in a target binding domain of a probe can be greater than the number of attachment positions in the barcode domain of the probe. A target binding domain can comprise eight nucleotides and a barcode domain can comprise three attachment positions. At least one of the nucleotides in the target binding domain that does not identify a corresponding nucleotide in the target nucleic acid molecule can precede the at least six nucleotides in the target binding domain and wherein at least one of the nucleotides in the target binding domain that does not identify a corresponding nucleotide in the target nucleic acid molecule can follow the at least six nucleotides in the target binding domain.
[0007] An attachment position in the barcode domain can comprise one attachment region. At least one nucleic acid sequence of each attachment position in the barcode domain can comprise about 9 nucleotides. At least one nucleic acid sequence of an attachment position can comprise a 3' terminal guanosine nucleotide. At least one nucleic acid sequence of each attachment position can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 3' terminal guanosine nucleotide. Each nucleotide of an at least one nucleic acid sequence of an attachment position can be L-DNA. Each nucleotide of the at least eight nucleotides of the target binding domain can be D-DNA.
[0008] A complementary nucleic acid molecule can be a primary nucleic acid molecule, wherein the primary nucleic acid molecule directly can bind to at least one attachment region within at least one attachment position of a barcode domain. A primary nucleic acid molecule can comprise at least two domains, a first domain capable of binding to at least one attachment region within at least one attachment position of the barcode domain and a second domain capable of binding to at least one complementary secondary nucleic acid molecule. The first domain of a primary nucleic acid molecule can comprise L-DNA. The second domain of the primary nucleic acid molecule can comprise D-DNA. The first domain of the primary nucleic acid molecule can comprise a 5' terminal cytosine nucleotide. The first domain of the primary nucleic acid molecule can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 5' terminal cytosine nucleotide. A cleavable linker can be located between the first domain of a primary nucleic acid molecule and the second domain of a primary nucleic acid molecule. The cleavable linker can comprises at least one cleavable moiety. The cleavable moiety can be a photocleavable moiety.
[0009] A primary nucleic molecule cam ne hybridized to at least one attachment region within at least one attachment position of a barcode domain and can be hybridized to at least one secondary nucleic acid molecule. A primary nucleic molecule can be hybridized to four secondary nucleic acid molecules.
[0010] A secondary nucleic acid molecule can comprise at least two domains, a first domain capable of binding to a complementary sequence in at least one primary nucleic acid molecule; and a second domain capable of binding to (a) a first detectable label and an at least second detectable label, (b) to at least one complementary tertiary nucleic acid molecule, or (c) a combination thereof. A secondary nucleic acid molecule can comprise a cleavable linker. The cleavable linker can be located between the first domain and the second domain. The cleavable linker can be photo-cleavable. A secondary nucleic molecule can be hybridized to at least one primary nucleic acid molecule and hybridized to at least one tertiary nucleic acid molecule. A secondary nucleic molecule can be hybridized to (a) at least one primary nucleic acid molecule, (b) at least one tertiary nucleic acid molecule, and (c) a first detectable label and an at least second detectable label. Each secondary nucleic molecule can be hybridized to one tertiary nucleic acid molecule. A first and at least second detectable labels can have the same emission spectrum or can have different emission spectra.
[0011] A tertiary nucleic acid molecule can comprise at least two domains, a first domain capable of binding to a complementary sequence in a secondary nucleic acid molecule; and a second domain capable of binding to a first detectable label and an at least second detectable label. A tertiary nucleic acid molecule comprises a cleavable linker. A cleavable linker can be located between the first domain and the second domain. The cleavable linker can be photo-cleavable. A tertiary nucleic molecule can be hybridized to at least one secondary nucleic acid molecule and can comprise a first detectable label and an at least second detectable label. The first and at least second detectable labels can have the same emission spectrum or can have different emission spectra.
[0012] The at least first and second detectable labels located on the secondary nucleic acid molecule can have the same emission spectra and the at least first and second detectable labels located on the tertiary nucleic acid molecule can have the same emission spectra, and wherein the emission spectra of the detectable labels on the secondary nucleic acid molecule can be different than the emission spectra of the detectable labels on the tertiary nucleic acid molecule.
[0013] A primary nucleic acid molecule can be hybridized to four secondary nucleic acid molecules, wherein each of the four secondary nucleic acid molecules comprises four first detectable labels, and wherein each of the four secondary nucleic acid molecules is hybridized to one tertiary nucleic acid molecule, wherein the tertiary nucleic acid molecule comprises five detectable labels. The emission spectra of the first detectable labels of the secondary nucleic acid molecules can be different than the emission spectra of the second detectable labels on the tertiary nucleic acid molecules.
[0014] In a related instance provided for illustrative purposes, there is provided a method for determining a nucleotide sequence of a nucleic acid comprising: (1) hybridizing the target binding domain of at least one first probe of claim 1 to a first region of a target nucleic acid that is optionally immobilized to a substrate at one or more positions; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (3) identifying the at least one first and the at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment position; (4) removing the at least one first and the at least one second detectable label hybridized to the first attachment position; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment position of the at least three attachment positions of the barcode domain; (6) identifying the at least one third and the at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (7) removing the at least one third and the at least one fourth detectable label hybridized to the second attachment position; (8) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of the at least three attachment positions of the barcode domain; (9) identifying the at least one fifth and the at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position; and (10) determining the nucleotide sequence of at least six nucleotides of the optionally immobilized target nucleic acid hybridized to the at least six nucleotides of the target binding domain of the at least one first probe based on the identity of the at least one first detectable label, the at least one second detectable label, the at least one third detectable label, the at least one fourth detectable label, the at least one fifth detectable label and the at least one sixth detectable label.
[0015] The preceding method can further comprise (11) removing the at least one first probe from the first region of the optionally immobilized target nucleic acid; (12) hybridizing the target binding domain of a least one second probe of claim 1 to a second region of the optionally immobilized target nucleic acid and wherein the target binding domain of the first probe and the at least second probe are different; (13) hybridizing a fourth complementary nucleic acid molecule comprising at least one seventh detectable label and at least one eighth detectable label to a first attachment position of the at least three attachment positions of the barcode domain of the at least one second probe; (14) identifying the at least one seventh and the at least one eighth detectable label of the fourth complementary nucleic acid molecule hybridized to the first attachment position; (15) removing the at least one seventh and the at least one eighth detectable label hybridized to the first attachment position; (16) hybridizing a fifth complementary nucleic acid molecule comprising at least one ninth detectable label and at least one tenth detectable label to a second attachment position of the at least three attachment positions of the barcode domain of the at least second probe; (17) identifying the at least one ninth and the at least one tenth detectable label of the fifth complementary nucleic acid molecule hybridized to the second attachment position; (18) removing the at least one ninth and the at least one tenth detectable label hybridized to the second attachment position; (19) hybridizing a sixth complementary nucleic acid molecule comprising at least one eleventh detectable label and at least one twelfth detectable label to a third attachment position of the at least three attachment positions of the barcode domain of the at least second probe; (20) identifying the at least one eleventh and the at least one twelfth detectable label of the sixth complementary nucleic acid molecule hybridized to the third attachment position; and (21) determining the nucleotide sequence of at least six nucleotides of the optionally immobilized target nucleic acid hybridized to the at least six nucleotides of the target binding domain of the at least one second probe based on the identity of the at least one seventh detectable label, the at least one eighth detectable label, the at least one ninth detectable label, the at least one tenth detectable label, the at least one eleventh detectable label and the at least one twelfth detectable label.
[0016] The preceding method can further comprise assembling each identified linear order of nucleotides in the at least first region and at least second region of the optionally immobilized target nucleic acid, thereby identifying a sequence for the optionally immobilized target nucleic acid.
[0017] Steps (4) and (5) can occur sequentially or concurrently. Steps (7) and (8) can occur sequentially or concurrently.
[0018] The first and second detectable labels can have the same emission spectrum or have different emission spectra. The third and fourth detectable labels can have the same emission spectrum or have different emission spectra. The fifth and sixth detectable labels can have the same emission spectrum or have different emission spectra.
[0019] A first complementary nucleic acid molecule, a second complementary nucleic acid molecule and a third complementary nucleic acid molecule can comprise a cleavable linker. A cleavable linker can be photo-cleavable.
[0020] A first complementary nucleic acid molecule can comprise a primary nucleic acid, four secondary nucleic acid molecules and four tertiary nucleic acid molecules, wherein the primary nucleic acid is hybridized to four secondary nucleic acid molecules, wherein each of the four secondary nucleic acid molecules comprises four first detectable labels, and wherein each of the four secondary nucleic acid molecules is hybridized to one tertiary nucleic molecule, wherein each of the four tertiary nucleic acid molecules comprises five second detectable labels.
[0021] A primary nucleic acid molecule can comprise at least two domains, a first domain that hybridizes to a first attachment position of the barcode domain and a second domain that hybridizes to four secondary nucleic acid molecules. A primary nucleic acid molecule can comprise a cleavable linker located between the first domain and the second domain.
[0022] A secondary nucleic acid molecule can comprise at least two domains, a first domain that hybridizes to the second domain of the primary nucleic acid molecule; and a second domain that comprises four first detectable labels and that hybridizes to one tertiary nucleic acid molecule. A secondary nucleic acid molecule can comprise a cleavable linker located between the first domain and the second domain.
[0023] Removing at least one first and the at least one second detectable label hybridized to a first attachment position can comprise cleaving the cleavable linker between the first domain and the second domain of the primary nucleic acid, cleaving the cleavable linker between the first domain and the second domain of each secondary nucleic acid or any combination thereof.
[0024] In a related instance provided for illustrative purposes, there is provided a composition comprising at least one molecular complex, wherein the at least one molecular complex comprises: (A) a target nucleic acid molecule obtained from a biological sample, and (B) at least two nucleic acid molecule complexes, wherein a first complex comprises a first partially double-stranded nucleic acid molecule, wherein one strand of the first partially double-stranded nucleic acid molecule comprises: a target specific domain hybridized to a first portion of the target nucleic acid molecule, a duplex domain annealed to the other strand of the first partially double-stranded nucleic acid molecule, and at least one first affinity moiety, wherein the other strand of the first partially double-stranded nucleic acid molecule comprises: a duplex domain that is annealed to the other strand of the first partially double-stranded nucleic acid molecule, a substrate specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety wherein the second complex comprises a second partially double-stranded nucleic acid molecule, wherein one strand of the second partially double-stranded nucleic acid molecule comprises: a target specific domain hybridized to a second portion of the target nucleic acid, wherein the first and the second portion do not overlap, and a duplex domain annealed to the other strand of the second partially double-stranded nucleic acid molecule, wherein the other strand of the second partially double-stranded nucleic acid molecule comprises: a duplex domain annealed to the other strand of the second partially double-stranded nucleic acid molecule, a sample specific domain that identifies the biological sample from which the target nucleic acid was obtained, a first single-stranded purification sequence, a first cleavable moiety located between the duplex domain and the sample specific domain, and a second cleavable moiety located between the sample specific domain and the first single-stranded purification sequence.
[0025] In a related instance provided for illustrative purposes, there is provided a composition comprising at least one molecular complex, wherein the at least one molecular complex comprises: (A) a target nucleic acid molecule obtained from a biological sample, and (B) at least two nucleic acid molecule complexes, wherein a first complex comprises a first partially double-stranded nucleic acid molecule, wherein one strand of the first partially double-stranded nucleic acid molecule comprises: a target specific domain hybridized to a first portion of the target nucleic acid molecule, a duplex domain annealed to the other strand of the first partially double-stranded nucleic acid molecule, and at least one first affinity moiety, wherein the other strand of the first partially double-stranded nucleic acid molecule comprises: a duplex domain that is annealed to the other strand of the first partially double-stranded nucleic acid molecule and that is operably linked to the 3' end of the target nucleic acid molecule, a substrate specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety, wherein the second complex comprises a second partially double-stranded nucleic acid molecule, wherein one strand of the second partially double-stranded nucleic acid molecule comprises: a target specific domain hybridized to a second portion of the target nucleic acid, wherein the first and the second portion do not overlap, and a duplex domain annealed to the other strand of the second partially double-stranded nucleic acid molecule, wherein the other strand of the second partially double-stranded nucleic acid molecule comprises: a duplex domain annealed to the other strand of the second partially double-stranded nucleic acid molecule and that is operably linked to the 5' end of the target nucleic acid molecule, a sample specific domain that identifies the biological sample from which the target nucleic acid was obtained, and a first cleavable moiety located between the duplex domain and the sample specific domain.
[0026] In a related instance provided for illustrative purposes, there is provided a composition comprising at least one molecular complex, wherein the at least one molecular complex comprises: (A) a target nucleic acid molecule obtained from a biological sample, and (B) at least two nucleic acid molecule complexes, wherein a first complex comprises a first partially double-stranded nucleic acid molecule, wherein one strand of the first partially double-stranded nucleic acid molecule comprises: a target specific domain hybridized to a first portion of the target nucleic acid molecule, a duplex domain annealed to the other strand of the first partially double-stranded nucleic acid molecule, and at least one first affinity moiety wherein the other strand of the first partially double-stranded nucleic acid molecule comprises: a duplex domain that is annealed to the other strand of the first partially double-stranded nucleic acid molecule and that is operably linked to the 3' end of the target nucleic acid molecule, a substrate specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety, wherein the second complex comprises a second partially double-stranded nucleic acid molecule, wherein one strand of the second partially double-stranded nucleic acid molecule comprises: a target specific domain hybridized to a second portion of the target nucleic acid, wherein the first and the second portion do not overlap, and a duplex domain annealed to the other strand of the second partially double-stranded nucleic acid molecule, wherein the other strand of the second partially double-stranded nucleic acid molecule comprises: a duplex domain annealed to the other strand of the second partially double-stranded nucleic acid molecule and that is operably linked to the 5' end of the target nucleic acid molecule.
[0027] In a related instance provided for illustrative purposes, there is provided a composition comprising: a planar solid support substrate; a first layer on the planar solid support substrate; a second layer on the first layer; wherein the second layer comprises a plurality of nanowells, wherein each nanowell provides access to an exposed portion of the first layer, wherein each nanowell comprises a plurality of first oligonucleotides covalently attached to the exposed portion of the first layer.
[0028] In a related instance provided for illustrative purposes, there is provided a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify a corresponding nucleotide in the target nucleic acid molecule and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, wherein the nucleic acid sequences of the at least three attachment positions determine the position and identity of the at least six nucleotides in the target nucleic acid that are bound by the target binding domain, and wherein each of the at least three attachment positions have a different nucleic acid sequence
[0029] In a related instance provided for illustrative purposes, there is also provided a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify a corresponding nucleotide in the target nucleic acid molecule and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment position comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain and each of the at least three attachment positions have a different nucleic acid sequence, and wherein the nucleic acid sequence of each position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that is bound by the target binding domain.
[0030] In a related instance provided for illustrative purposes, there is provided a complex comprising: a) a composition comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify a corresponding nucleotide in the target nucleic acid molecule and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, wherein the nucleic acid sequences of the at least three attachment positions determine the position and identity of the at least six nucleotides in the target nucleic acid that are bound by the target binding domain, and wherein each of the at least three attachment positions have a different nucleic acid sequence; and a first complementary primary nucleic acid molecule hybridized to a first attachment position of the at least three attachment positions, wherein the first primary complementary nucleic acid molecule comprises at least two domains and a cleavable linker, wherein the first domain is hybridized to the first attachment position of the barcode domain and the second domain is capable of hybridizing to at least one complementary secondary nucleic acid molecule, and wherein the cleavable linker is and wherein the cleavable linker is located between the first and second domains.
[0031] In a related instance provided for illustrative purposes, there is provided a method for determining a nucleotide sequence of a nucleic acid comprising: (1) hybridizing the target binding domain of a first sequencing probe of the present disclosure to a first region of a target nucleic acid that is optionally immobilized to a substrate at one or more positions; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (3) identifying the at least one first and the at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment position; (4) removing the at least one first and the at least one second detectable label hybridized to the first attachment position; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment position of the at least three attachment positions of the barcode domain; (6) identifying the at least one third and the at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (7) removing the at least one third and the at least one fourth detectable label hybridized to the second attachment position; (8) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of the at least three attachment positions of the barcode domain; (9) identifying the at least one fifth and the at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position; and (10) determining the nucleotide sequence of at least six nucleotides of the optionally immobilized target nucleic acid hybridized to the at least six nucleotides of the target binding domain of the first sequencing probe based on the identity of the at least one first detectable label, the at least one second detectable label, the at least one third detectable label, the at least one fourth detectable label, the at least one fifth detectable label and the at least one sixth detectable label.
[0032] In a related instance provided for illustrative purposes, there is provided a method for determining a nucleotide sequence of a nucleic acid comprising: (1) hybridizing the target binding domain of a first sequencing probe of claim 113 or 114 to a target nucleic acid that is optionally immobilized to a substrate at one or more positions; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (3) identifying the at least one first and the at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment position; (4) identifying the position and identity of a first nucleotide and a second nucleotide in the optionally immobilized target nucleic acid hybridized to two of the at least six nucleotides of the target binding domain based on the identity of the at least one first detectable label and the at least one second detectable label; (5) removing the at least one first and the at least one second detectable label hybridized to the first attachment position; (6) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment position of the at least three attachment positions of the barcode domain; (7) identifying the at least one third and the at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (8) identifying the position and identity of a third nucleotide and a fourth nucleotide in the optionally immobilized target nucleic acid hybridized to two of the at least six nucleotides of the target binding domain based on the identity of the at least one third detectable label and the at least one fourth detectable label; (9) removing the at least one third and the at least one fourth detectable label hybridized to the second attachment position; (10) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of the at least three attachment positions of the barcode domain; (11) identifying the at least one fifth and the at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position; and (12) identifying the position and identity of a fifth nucleotide and a sixth nucleotide in the optionally immobilized target nucleic acid hybridized to two of the at least six nucleotides of the target binding domain based on the identity of the at least one fifth detectable label and the at least one sixth detectable label; thereby determining the nucleotide sequence of at least six nucleotides of the optionally immobilized target nucleic acid hybridized to the at least six nucleotides of the target binding domain of the first sequencing probe.
[0033] The invention provides a method for identifying the presence of a predetermined nucleotide sequence in a target nucleic acid comprising: (1) hybridizing a target binding domain of a first probe to a first region of a target nucleic acid that is optionally immobilized to a substrate at one or more positions, wherein the probe comprises a target binding domain and a barcode domain; wherein the target binding domain is at least 12 nucleotides in length; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, wherein the barcode domain consists of L-DNA, wherein each of the at least three attachment positions have a different nucleic acid sequence; and wherein each attachment position in the barcode domain is about 6 to about 20 nucleotides in length; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (3) identifying the at least one first and the at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment position; (4) removing the at least one first and the at least one second detectable label hybridized to the first attachment position; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment position of the at least three attachment positions of the barcode domain; (6) identifying the at least one third and the at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (7) removing the at least one third and the at least one fourth detectable label hybridized to the second attachment position; (8) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of the at least three attachment positions of the barcode domain; (9) identifying the at least one fifth and the at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position, thereby determining the presence of the predetermined nucleotide sequence based on the identity of the at least one first detectable label, the at least one second detectable label, the at least one third detectable label, the at least one fourth detectable label, the at least one fifth detectable label and the at least one sixth detectable label.
[0034] In a related instance provided for illustrative purposes, there is provided a kit comprising: (A) a first nucleic acid molecule complex comprising a first partially double-stranded nucleic acid molecule, wherein one strand of the first partially double-stranded nucleic acid molecule comprises: a target specific domain that hybridizes to a first portion of a target nucleic acid molecule, a duplex domain annealed to the other strand of the first partially double-stranded nucleic acid molecule, at least one first affinity moiety, wherein the other strand of the first partially double-stranded nucleic acid molecule comprises: a duplex domain that is annealed to the other strand of the first partially double-stranded nucleic acid molecule, substrate specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety; (B) a second nucleic acid molecule complex comprising a second partially double-stranded nucleic acid molecule, wherein one strand of the second partially double-stranded nucleic acid molecule comprises: a target specific domain that hybridizes to a second portion of the target nucleic acid, wherein the first and the second portion do not overlap, and a duplex domain annealed to the other strand of the second partially double-stranded nucleic acid molecule, and wherein the other strand of the second partially double-stranded nucleic acid molecule comprises: a duplex domain annealed to the other strand of the second partially double-stranded nucleic acid molecule, a sample specific domain that identifies the biological sample from which a target nucleic acid was obtained, a substrate specific domain that hybridizes to a complementary nucleic acid attached to a substrate, a first single-stranded purification sequence, a first cleavable moiety located between the duplex domain and the sample specific domain, and a second cleavable moiety located between the sample specific domain and the first single-stranded purification sequence.
[0035] In a related instance provided for illustrative purposes, there is also provided a kit comprising: a first single-stranded nucleic acid molecule comprising: a target specific domain that hybridizes to a first portion of a target nucleic acid molecule, a duplex domain that anneals to the duplex domain of a second single-stranded nucleic acid molecule, and at least one first affinity moiety, (B) a second single-stranded nucleic acid molecule comprising: a duplex domain that anneals to the duplex domain of the first single-stranded nucleic acid molecule, a substrate specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety, (C) a third single-stranded nucleic acid molecule comprising: a target specific domain that hybridizes to a second portion of a target nucleic acid, wherein the first and the second portion do not overlap, and a duplex domain that anneals to the duplex domain of a fourth single-stranded nucleic acid molecule, (D) a fourth single-stranded nucleic acid molecule comprising: a duplex domain that anneals to the duplex domain of the third single-stranded nucleic acid molecule, a sample specific domain that identifies the biological sample from which a target nucleic acid was obtained, a first single-stranded purification sequence, a first cleavable moiety located between the duplex domain and the sample specific domain, and a second cleavable moiety located between the sample specific domain and the first single-stranded purification sequence.
[0036] Any of the above aspects can be combined with any other aspect.
[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In the Specification, the singular forms also include the plural unless the context clearly dictates otherwise; as examples, the terms "a," "an," and "the" are understood to be singular or plural and the term "or" is understood to be inclusive. By way of example, "an element" means one or more element. Throughout the specification the word "comprising," or variations such as "comprises" or "comprising," will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term "about."BRIEF DESCRIPTION OF THE DRAWINGS
[0038] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0039] The above and further features will be more clearly appreciated from the following detailed description when taken in conjunction with the accompanying drawings. FIG. 1 is an illustration of one exemplary sequencing probe of the present disclosure. FIG. 2 shows the design of standard, three-part sequencing and one-part linker probes of the present disclosure. FIG. 3 is an illustration of an exemplary reporter complex of the present disclosure hybridized to an exemplary sequencing probe of the present disclosure. FIG. 4 shows a schematic illustration of an exemplary reporter probe of the present disclosure. FIG. 5 is a schematic illustration of several exemplary reporter probes of the present disclosure comprising different arrangements of tertiary nucleic acids. FIG. 6 is a schematic illustration of several exemplary reporter probes of the present disclosure comprising branching tertiary nucleic acids. FIG. 7 shows possible positions for cleavable linker modifications within an exemplary reporter probe of the present disclosure. FIG. 8 is a schematic illustration of the capture of a target nucleic acid using the two capture probe system of the present disclosure. FIG. 9 shows the results from an experiment using the present methods to capture and detect a multiplex cancer panel, composed of 100 targets, using a FFPE sample. FIG. 10 is a schematic illustration of a single cycle of the sequencing method of the present disclosure. FIG. 11 is a schematic illustration of one cycle of the sequencing method of the present disclosure and the corresponding imaging data collected during this cycle. FIG. 12 illustrates an exemplary sequencing probe pool configuration of the present disclosure in which the eight color combinations are used to design eight different pools of sequencing probes. FIG. 13 compares the barcode domain design disclosed in U.S. 2016 / 019470 with the barcode domain design of the present disclosure. FIG. 14 is a schematic illustration of a sequencing cycle of the present disclosure in which a cleavable linker modification is used to darken a barcode position. FIG. 15 is an illustrative example of an exemplary sequencing cycle of the present disclosure in which a position within a barcode domain is darkened by displacement of the primary nucleic acids. FIG. 16 is schematic illustration of how the sequencing method of the present disclosure allows for the sequencing of the same base of a target nucleic acid with different sequencing probes. FIG. 17 shows how multiple base calls for a specific nucleotide position on the target nucleic acid, recorded from one or more sequencing probes, can be combined to create a consensus sequence, thereby increasing the accuracy of the final base call. FIG. 18 shows the results from a sequencing experiment obtained using the sequencing method of the present disclosure and analyzed using the Assembly Algorithm. For plots on the left panel, starting at the top left plot proceeding clockwise, sequences shown correspond to SEQ ID NOs: 3, 4, 6, 8, 7 and 5. For the table on the right, starting at the top moving down, sequences correspond to SEQ ID NOs: 3, 4, 7, 8, 6 and 5. FIG. 19 shows a schematic illustration of the experimental design for the multiplexed capture and sequencing of oncogene targets from a FFPE sample. FIG. 20 shows an illustrative schematic of direct RNA sequencing and the results from experiments to test the compatibility of RNA molecules with the sequencing method of the present disclosure. FIG. 21 shows the sequencing of a RNA molecule and a DNA molecule that have the same nucleotide sequence using the sequencing method of the present disclosure. FIG. 22 shows a comparison of the performance of standard and three-part sequencing probes of the present disclosure. FIG. 23 shows the effect of LNA substitutions within exemplary target binding domains of the present disclosure using individual probes. FIG. 24 shows the effect of LNA substitutions within exemplary target binding domains of the present disclosure using a pool of nine probes. FIG. 25 shows the effect of modified nucleotides and nucleic acid analogue substitutions in exemplary target binding domains of the present disclosure. FIG. 26 shows the results from an experiment to quantify the raw accuracy of the sequencing method of the present disclosure. FIG. 27 shows the results from an experiment to determine the accuracy of the sequencing method of the present disclosure when nucleotides in the target nucleic acid are sequenced by more than one sequencing probe. FIG. 28 is a schematic illustration of a sequencing probe of the present disclosure comprising pocket oligos. FIG. 29 is a schematic illustration of a sequencing probe of the present disclosure comprising PEG linker regions between each attachment position. FIG. 30 is a schematic illustration of a sequencing probe of the present disclosure comprising abasic regions between each attachment position. FIG. 31 is an illustration of an exemplary reporter complex of the present disclosure indirectly hybridized to an exemplary sequencing probe of the present disclosure via a connector oligo. FIG. 32 is an illustration of a parity scheme used in the methods of the present disclosure. FIG. 33 is a schematic illustration of a capture probe, adaptor oligonucleotide and lawn oligonucleotide complex of the present disclosure. FIG. 34 is a schematic illustration of a c5 probe complex and c3 probe complex of the present disclosure hybridized to a target nucleic acid. FIG. 35 is a schematic illustration of a target nucleic acid-c3 probe-c5 probe complex of the present disclosure after digestion with FEN1. FIG. 36 is a schematic illustration of a target nucleic acid-c3 probe-c5 probe complex of the present disclosure after ligation. FIG. 37 is a schematic illustration of USER-mediated cleavage of a target nucleic acid-c3 probe-c5 probe complex of the present disclosure. FIG. 38 is a schematic illustration a target nucleic acid-c3 probe-c5 probe complex of the present disclosure after USER-mediated cleavage. FIG. 39 is a schematic illustration of UV-mediated cleavage of a target nucleic acid-c3 probe-c5 probe complex of the present disclosure. FIG. 40 is a schematic illustration a target nucleic acid-c3 probe-c5 probe complex of the present disclosure after UV-mediated cleavage attached via a complementary nucleic acid to a substrate. FIG. 41 is a schematic illustration of a c3.2 probe complex and a c5.2 probe complex of the present disclosure hybridized to a target nucleic acid. FIG. 42 is a schematic illustration of a target nucleic acid complex of the present disclosure after ligation of the c3.2 and c5.2 probe complexes. FIG. 43 is a schematic illustration of the cleavage and release of the single-stranded purification sequence in a target nucleic acid complex of the present disclosure. FIG. 44 is a schematic illustration of a target nucleic acid complex of the present disclosure immobilized on a substrate of the present disclosure. FIG. 45 is a schematic illustration of the cleavage and release of the substrate specific domain after immobilization of a target nucleic acid complex of the present disclosure to a substrate of the present disclosure. FIG. 46 is a schematic illustration of a target nucleic acid complex of the present disclosure after release of the substrate specific domain immobilized on a substrate of the present disclosure. FIG. 47 is a schematic cross section of an exemplary array of the present disclosure. FIG. 48 is a schematic cross section of an exemplary array of the present disclosure comprising nanowells that have the shape of a pyramid. FIG. 49 is a schematic diagram of an exemplary array of the present disclosure comprising a plurality of cylindrical nanowells arranged in a random pattern. FIG. 50 is a schematic diagram of an exemplary array of the present disclosure comprising cylindrical nanowells arranged in an ordered grid with a constant pitch. FIG. 51 is a schematic cross section of an exemplary array of the present disclosure wherein a single target nucleic acid complex is immobilized in each nanowell. FIG. 52 is a schematic cross section of an exemplary array of the present disclosure wherein a single target nucleic acid complex is immobilized in each nanowell thereby preventing the immobilization of other target nucleic acid complexes. FIG. 53 is a schematic illustration of a sequencing probe of the present disclosure that consists entirely of L-DNA and that comprises attachment regions with 3' terminal L-dG nucleotides. FIG. 54 is a schematic illustration of a sequencing probe of the present disclosure that consists entirely of D-DNA and that comprises pocket oligos located between attachment region 1 (Spot 1) and attachment region 2 (Spot 2) and between attachment region 2 (Spot 2) and attachment region 3 (Spot 3). FIG. 55 is a schematic illustration of a synthetic target nucleic acid immobilized onto a solid substrate using a capture probe and a lawn oligonucleotide in combination with a protein lock. FIG. 56 is a series of charts showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The x-axis denotes specific nucleotides of the target nucleic acid being sequenced. The top chart shows the theoretical sequencing diversity, observed sequencing diversity and observed sequencing coverage for the LG-spaced and D-pocket sequencing probes. The red boxes denote predicted problematic areas for sequencing. FIG. 57 is a series of charts showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The x-axis denotes specific nucleotides of the target nucleic acid being sequenced. The top chart shows the theoretical sequencing diversity, observed sequencing diversity and observed sequencing coverage for the LG-spaced and D-pocket sequencing probes. The red boxes denote predicted problematic areas for sequencing. FIG. 58 is a series of charts showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The x-axis denotes specific nucleotides of the target nucleic acid being sequenced. The top chart shows the theoretical sequencing diversity, observed sequencing diversity and observed sequencing coverage for the LG-spaced and D-pocket sequencing probes. The red boxes denote predicted problematic areas for sequencing. FIG. 59 is a series of charts showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The x-axis denotes specific nucleotides of the target nucleic acid being sequenced. The top chart shows the observed sequencing diversity and observed sequencing coverage for the LG-spaced and D-pocket sequencing probes. FIG. 60 is a series of charts showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The x-axis denotes specific nucleotides of the target nucleic acid being sequenced. The top chart shows the observed sequencing diversity and observed sequencing coverage for the LG-spaced and D-pocket sequencing probes. FIG. 61 is a series of charts showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The x-axis denotes specific nucleotides of the target nucleic acid being sequenced. The top chart shows the observed sequencing diversity and observed sequencing coverage for the LG-spaced and D-pocket sequencing probes. FIG. 62 is a series of histograms showing the total number of barcode events and the number of valid, 3-spot readouts in sequencing experiments using the LG-spaced sequencing probes and the D-pocket sequencing probes of the present disclosure. FIG. 63 is a series of graphs showing the total number of on target events, invalid events, off target events, 1 error at b 1 -b 6 events, 2 errors at b 1 -b 6 events, 3 errors at b 1 -b 6 events, 4 errors at b 1 -b 6 events, 5 error at b 1 -b 6 events and 6 errors at b 1 -b 6 events in sequencing experiments using the LG-spaced sequencing probes and the D-pocket sequencing probes of the present disclosure. FIG. 64 is a series of graphs showing the total number of on target events, invalid events, off target events, 1 error at b 1 -b 6 events, 2 errors at b 1 -b 6 events, 3 errors at b 1 -b 6 events, 4 errors at b 1 -b 6 events, 5 error at b 1 -b 6 events and 6 errors at b 1 -b 6 events in sequencing experiments using the LG-spaced sequencing probes and the D-pocket sequencing probes of the present disclosure. FIG. 65 is a chart showing the number of 1 spotter (only one out of a possible three reporter probes are successfully recorded), 2 spotter (only two out of a possible three reporter probes are successfully recorded) and 3 spotter (all three possible reporter probes are successfully recorded) events in each cycle of a sequencing experiments using the D-pocket sequencing probes (cycles 1-50) and LG-spaced sequencing probes (cycles 51-100) of the present disclosure. FIG. 66 is a series of charts showing the results of sequencing experiments using LG-spaced sequencing probes and D-pocket sequencing probes of the present disclosure. The leftmost panels show the number of on-target, new hexamer, redundant hexamer, off-target and invalid events recorded in each cycle of the sequencing experiments. Cycles 1-50 were performed using D-pocket sequencing probes and cycles 51-100 were performed using LG-spaced sequencing probes of the present disclosure. FIG. 67 is a schematic illustration of a target nucleic acid immobilized to a solid substrate using the methods and compositions of the present disclosure. The target nucleic acid is immobilized using a protein lock between biotin moieties located on the capture probes and lawn oligonucleotides and a neutravidin moiety. DETAILED DESCRIPTION OF THE INVENTION
[0040] The invention provides a method for identifying the presence of a predetermined nucleotide sequence in a target nucleic acid, as defined by the claims. In related instances provided for illustrative purposes, the present disclosure provides sequencing probes, reporter probes, further methods, kits, and apparatuses that provide rapid, enzyme-free, amplification-free, and library-free nucleic acid sequencing that has long-read-lengths and with low error rate.Compositions of the Present Disclosure (not claimed)
[0041] In a related instance provided for illustrative purposes, there is provided a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs recited in Table 1. An exemplary target binding domain comprises at least eight nucleotides and is capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in the target nucleic acid molecule and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule; wherein any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogues and wherein the at least two nucleotides in the target binding domain that do not identify a corresponding nucleotide in the target nucleic acid molecule can be any of the four canonical bases that is not specific to the target dictated by the at least six nucleotides in the target binding domain or universal or degenerate bases. An exemplary barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence capable of being bound by a complementary nucleic acid molecule, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain and each of the at least three attachment positions have a different nucleic acid sequence, and wherein the nucleic acid sequence of each position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that is bound by the target binding domain.
[0042] In other aspects, an exemplary target binding domain can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein the at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in the target nucleic acid molecule; wherein any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogues.
[0043] In a related instance provided for illustrative purposes, there is provided a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least ten nucleotides and is capable of binding a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in the target nucleic acid molecule and wherein at least four nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence capable of being bound by a complementary nucleic acid molecule, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain and each of the at least three attachment positions have a different nucleic acid sequence, and wherein the nucleic acid sequence of each position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that is bound by the target binding domain.
[0044] In a related instance provided for illustrative purposes, there is also provided a population of sequencing probes comprising a plurality of any of the sequencing probes disclosed herein.
[0045] The target binding domain, barcode domain, and backbone of the disclosed sequencing probes, as well as, the complementary nucleic acid molecule (e.g., reporter molecules or reporter complexes) are described in more detail below.
[0046] A sequencing probe of the present disclosure comprises a target binding domain and a barcode domain. Figure 1 is a schematic illustration of an exemplary sequencing probe of the present disclosure. Figure 1 shows that the target binding domain is capable of binding a target nucleic acid. A target nucleic acid can be any nucleic acid to which the sequencing probe of the present disclosure can hybridize. The target nucleic acid can be DNA or RNA. The target nucleic acid can be obtained from a biological sample from a subject. The terms "target binding domain" and "sequencing domain" are used interchangeably herein.
[0047] The target binding domain can comprise a series of nucleotides (e.g. is a polynucleotide). The target binding domain can comprise DNA, RNA, or a combination thereof. In the case when the target binding domain is a polynucleotide, the target binding domain binds to a target nucleic acid by hybridizing to a portion of the target nucleic acid that is complementary to the target binding domain of the sequencing probe, as shown in Figure 1.
[0048] The target binding domain of the sequencing probe can be designed to control the likelihood of sequencing probe hybridization and / or de-hybridization and the rates at which these occur. Generally, the lower a probe's Tm, the faster and more likely that the probe will de-hybridize to / from a target nucleic acid. Thus, use of lower Tm probes will decrease the number of probes bound to a target nucleic acid.
[0049] The length of a target binding domain, in part, affects the likelihood of a probe hybridizing and remaining hybridized to a target nucleic acid. Generally, the longer (greater number of nucleotides) a target binding domain is, the less likely that a complementary sequence will be present in the target nucleotide. Conversely, the shorter a target binding domain is, the more likely that a complementary sequence will be present in the target nucleotide. For example, there is a 1 / 256 chance that a four-mer sequence will be located in a target nucleic acid versus a 1 / 4096 chance that a six-mer sequence will be located in the target nucleic acid. Consequently, a collection of shorter probes will likely bind in more locations for a given stretch of a nucleic acid when compared to a collection of longer probes.
[0050] In circumstances, it is preferable to have probes having shorter target binding domains to increase the number of reads in the given stretch of the nucleic acid, thereby enriching coverage of a target nucleic acid or a portion of the target nucleic acid, especially a portion of particular interest, e.g., when detecting a mutation or SNP allele.
[0051] The target binding domain can be any amount or number of nucleotides in length. The target binding domain can be at least 12 nucleotides in length, at least 10 nucleotides in length, at least 8 nucleotides in length, at least 6 nucleotides in length or at least three nucleotides in length.
[0052] Each nucleotide in the target binding domain can identify (or code for) a complementary nucleotide of the target molecule. Alternatively, some nucleotides in the target binding domain identify (or code for) a complementary nucleotide of the target molecule and some nucleotides in the target binding domain do not identify (or code for) a complementary nucleotide of the target molecule.
[0053] The target binding domain can comprise at least one natural base. The target binding domain can comprise no natural bases. The target binding domain can comprise at least one modified nucleotide or nucleic acid analog. The target binding domain can comprise no modified nucleotides or nucleic acid analogs. The target binding domain can comprise at least one universal base. The target binding domain can comprise no universal bases. The target binding domain can comprise at least one degenerate base. The target binding domain can comprise no degenerate bases.
[0054] The target domain can comprise any combination natural bases (e.g. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more natural bases), modified nucleotides or nucleic acid analogs (e.g. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more modified nucleotides or nucleic acid analogs), universal bases (e.g. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more universal bases), or degenerate bases (e.g. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more degenerative bases). When present in a combination, the natural bases, modified nucleotides or nucleic acid analogs, universal bases and degenerate bases of a particular target binding domain can be arranged in any order.
[0055] The terms "modified nucleotides" or "nucleic acid analogues" include, but are not limited to, locked nucleic acids (LNA), bridged nucleic acids (BNA), propyne-modified nucleic acids, zip nucleic acids (ZNA ®< ), isoguanine, isocytosine 6-amino-1-(4-hydroxy-5-hydroxy methyl-tetrahydro-furan-2-yl)-1,5-dihydro-pyrazolo[3,4-d]pyrimidin-4-one (PPG) and 2'-modified nucleic acids such as 2'-O-methyl nucleic acids. The target binding domain can include zero to six (e.g. 0, 1, 2, 3, 4, 5 or 6) modified nucleotides or nucleic acid analogues. Preferably, the modified nucleotides or nucleic acid analogues are locked nucleic acids (LNAs).
[0056] The term "locked nucleic acids (LNA)" as used herein includes, but is not limited to, a modified RNA nucleotide in which the ribose moiety comprises a methylene bridge connecting the 2' oxygen and the 4' carbon. This methylene bridge locks the ribose in the 3'-endo confirmation, also known as the north confirmation, that is found in A-form RNA duplexes. The term inaccessible RNA can be used interchangeably with LNA. The term "bridged nucleic acids (BNA)" as used herein includes, but is not limited to, modified RNA molecules that comprise a five-membered or six-membered bridged structure with a fixed 3'-endo confirmation, also known as the north confirmation. The bridged structure connects the 2' oxygen of the ribose to the 4' carbon of the ribose. Various different bridge structures are possible containing carbon, nitrogen, and hydrogen atoms. The term "propyne-modified nucleic acids" as used herein includes, but is not limited to, pyrimidines, namely cytosine and thymine / uracil, that comprise a propyne modification at the C5 position of the nucleic acid base. The term "zip nucleic acids (ZNA ®< )" as used herein includes, but is not limited to, oligonucleotides that are conjugated with cationic spermine moieties.
[0057] The term "universal base" as used herein includes, but is not limited to, a nucleotide base does not follow Watson-Crick base pair rules but rather can bind to any of the four canonical bases (A, T / U, C, G) located on the target nucleic acid. The term "degenerate base" as used herein includes, but is not limited to, a nucleotide base that does not follow Watson-Crick base pair rules but rather can bind to at least two of the four canonical bases A, T / U, C, G), but not all four. A degenerate base can also be termed a Wobble base; these terms are used interchangeably herein.
[0058] The exemplary sequencing probe depicted in Figure 1 illustrates a target binding domain that comprises a six nucleotide long (6-mer) sequence (b 1 - b 2 - b 3 - b 4 - b 5 - b 6 ) that hybridizes specifically to complementary nucleotides 1-6 of the target nucleic acid that is to be sequenced. This 6-mer portion of the target binding domain (b 1 - b 2 - b 3 - b 4 - b 5 - b 6 ) identifies (or codes for) the complementary nucleotides in the target sequence (1- 2- 3- 4- 5- 6). This 6-mer sequence is flanked on either side by a base (N). The bases indicated by (N) may independently be a universal or degenerate base. Typically, the bases indicated by (N) are independently one of the canonical bases. The bases indicated by (N) do not identify (or code for) the complementary nucleotide it binds in the target sequence and are independent of the nucleic acid sequence of the (6-mer) sequence (b 1 - b 2 - b 3 - b 4 - b 5 - b 6 ).
[0059] The sequencing probe depicted in Figure 1 can be used in conjugation with the sequencing methods of the present disclosure to sequence target nucleic acids using only hybridization reactions, no covalent chemistry, enzymes or amplification is needed. To sequence all possible 6-mer sequences in a target nucleic acid molecule, a total of 4096 sequencing probes are needed (4^6=4096).
[0060] Figure 1 is exemplary for one configuration of a target binding domain of the sequence probe of the present disclosure. Table 1 provides several other configurations of target binding domains of the present disclosure. One preferred target binding domain, called the "6 LNA" target binding domain, comprises 6 LNAs at positions b1 to b6 of the target binding domain. These 6 LNAs are flanked on either side by a base (N). As used herein, an (N) base can be a universal / degenerate base or a canonical base that is independent of the nucleic acid sequence of the (6-mer) sequence (b 1 - b 2 - b 3 - b 4 - b 5 - b 6 ). In other words, while the bases b 1 - b 2 - b 3 - b 4 - b 5 - b 6 may be specific to any given target sequence, the (N) bases can be a universal / degenerate base or composed of any of the four canonical bases that is not specific to the target dictated by bases b 1 -b 2 - b 3 - b 4 - b 5 - b 6 . For example, if the target sequence to be interrogated is CAGGCATA bases b 1 -b 2 - b 3 - b 4 - b 5 - b 6 of the target binding domain would be TCCGTA while each of the (N) bases of the target binding domain could independently be A, C, T or G such that a resulting target binding domain could have the sequence ATCCGTAG, TTCCGTAC, GTCCGTAG or any of the other 16 possible iterations. Alternatively, the two (N) bases could proceed the 6 LNAs. Alternatively still, the two (N) bases could follow the 6 LNAs. Table 1 Target Binding Domain Bases B1 B2 B3 B4 B5 B6 "6mer"bbbbbb"8mer"bbbbbbbb"10mer"bbbbbbbbbb"Natural I"NNbbbbbbNN"Natural II"NbbbbbbN"2 LNA"Nbb++bbNNb+bb+bNN+bbbb+N"4 LNA"N++bb++NN+b++b+NNb++++bN"6 LNA"++++++N++++++N"8mer with LNA"Nb / +b / +b / +b / +b / +b / +N"MGB"QbbbbbbQbbbbbbbbb = natural base; + = modified nucleotide or nucleotide analog (e.g. LNA, 2-O'-methyl-modified bases, 6-amino-1-(4-hydroxy-5-hydroxy methyl-tetrahydro-furan-2-yl)-1,5-dihydro-pyrazolo[3,4-d]pyrimidin-4-one (PPG)); N = natural, universal or degenerate base; Q is a minor groove binder (e.g. Twisted Intercalating Nucleic Acid, MGB-BP3, Brostallicin)
[0061] Table 1 also describes a "10 mer" target binding domain that comprises 10 natural, target-specific bases. Table 1 also describes an "8 mer" target binding domain that comprises 8 natural, target-specific bases.
[0062] Table 1 further describes the "Natural I" target binding domain that comprises 6 natural bases at positions b1 to b6. These 6 natural bases are flanked on either side by 2 (N) bases. Alternatively, all four (N) bases could proceed the 6 natural bases. Alternatively still, all four (N) bases could follow the 6 natural bases. Any number of the four (N) bases (i.e. 1, 2, 3 or 4) could proceed the 6 natural bases while the remaining (N) bases would follow the 6 natural bases.
[0063] Table 1 further describes the "Natural II" target binding domain that comprises 6 natural bases at positions b1 to b6. These 6 natural bases are flanked on either side by an (N) base. Alternatively, both (N) bases could proceed the 6 natural bases. Alternatively still, both (N) bases could follow the 6 natural bases. Typically the (N) bases of the Natural II binding domain are degenerate bases.
[0064] Table 1 also describes a "2 LNA" target binding domain that comprises a combination of 2 LNAs and 4 natural bases at positions b1 to b6 of the target binding domain. The 2 LNAs and 4 natural bases can occur in any order. For example, the positions b3 and b4 can be LNAs while positions b1, b2, b5 and b6 are natural bases. Bases b1 to b6 are flanked on either side by a (N) base. Alternatively, bases b1 to b6 can be proceeded by two (N) bases. Alternatively still, bases b1 to b6 can be followed by two (N) bases.
[0065] Table 1 further describes a "4 LNA" target binding domain that comprises a combination of 4 LNAs and 2 natural bases at positions b1 to b6 of the target binding domain. The 4 LNAs and 2 natural bases can occur in any order. For example, the positions b2 to b5 can be LNAs while positions b1 and b6 are natural bases. Bases b1 to b6 are flanked on either side by a (N) base. Alternatively, bases b1 to b6 can be proceeded by two (N) bases. Alternatively still, bases b1 to b6 can be followed by two (N) bases.
[0066] Table 1 further describes a "6 LNA" target binding domain that comprises 6 LNAs at positions b1 to b6 of the target binding domain. Bases b1 to b6 can be flanked on either side by a (N) base.
[0067] Table 1 further describes a "8mer with LNA" target binding domain that individually comprises either a natural base or an LNA at any of the positions b1 to b6 of the target binding domain. Bases b1 to b6 can be flanked on either side by a (N) base.
[0068] The target binding domain can also comprise a minor-groove binder moiety. A minor-groove binder moiety is a chemical modification of an oligonucleotide that adds a chemical moiety that can bind to the minor groove of the target nucleotide to which the oligonucleotide is hybridized. Without being bound by theory, the inclusion of a minor-groove binder moiety increases the affinity of a target binding domain for a target nucleic acid, increasing the melting temperature of the target binding domain-target nucleic acid duplex. The higher binding affinity can allow for use of a smaller target binding domain.
[0069] The target binding domain can also comprise one or more twisted intercalating nucleic acids (TINAs). A TINA is a nucleic acid molecule that stabilizes the formation of Hoogsteen triplex DNA from double-stranded oligonucleotides and triplex-forming oligonucleotides. TINAs can be used to stabilize a double-stranded oligonucleotides, thereby improving the specificity and sensitivity of an oligonucleotide probe to a target nucleic acid.
[0070] The target binding domain can also comprise nucleic acid molecules comprising a 2'-O-methyl-modified base. A 2'-O-methyl-modified base is a nucleoside modification of RNA in which a methyl group is added to the 2' hydroxyl group of the ribose to produce a 2' methoxy group. A 2'-O-methyl-modified base offers superior protection against base hydrolysis and digestion by nucleases. Without being bound by theory, the addition of a 2'-O-methyl-modified base also increases the melting temperature of a nucleic acid duplex.
[0071] The target binding domain can also comprise a covalently linked stilbene modification. A stilbene modification can increase the stability of a nucleic acid duplex.
[0072] The sequencing probe of the present disclosure comprises a synthetic backbone. The target binding domain, also described herein as the sequencing domain, and the barcode domain are operably linked. The target binding domain and barcode domain can be covalently attached, as part of one synthetic backbone. The target binding domain and barcode domain can be attached via a linker (e.g., nucleic acid linker, chemical linker). The synthetic backbone can comprise any material, e.g., polysaccharide, polynucleotide, polymer, plastic, fiber, peptide, peptide nucleic acid, or polypeptide. Preferably, the synthetic backbone is rigid. The synthetic backbone can comprise a single-stranded DNA molecule. The backbone can comprise "DNA origami" of six DNA double helices (See, e.g., Lin et al, "Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA." Nature Chemistry; 2012 Oct; 4(10): 832-9). A barcode can be made of DNA origami tiles (Jungmann et al, "Multiplexed 3D cellular super-resolution imaging with DNA-PAINT and Exchange-PAINT", Nature Methods, Vol. 11, No. 3, 2014).
[0073] The sequencing probe of the present disclosure can comprise a partially double-stranded synthetic backbone. The sequencing probe can comprise a single-stranded DNA synthetic backbone and a double-stranded DNA spacer between the target binding domain and the barcode domain. The double-stranded DNA spacer can comprise at least one modified nucleotide or nucleic acid analogue. Typical modified nucleotides or nucleic acid analogues useful in the double-stranded DNA spacer are isoguanine and isocytosine. Alternatively still, each of the nucleic acids comprising the double-stranded DNA spacer can independently be L-DNA. In some aspects, a double-stranded DNA spacer can comprise L-DNA. A double-stranded DNA spacer can consist of L-DNA. A double-stranded DNA spacer can consist essentially of L-DNA.
[0074] A double-stranded DNA spacer can comprise about 1 nucleotide to about 100 nucleotides in length. A double-stranded DNA spacer can comprise about 25 nucleotides in length.
[0075] A synthetic backbone can comprise L-DNA. A synthetic backbone can consist of L-DNA. A synthetic backbone can consist essentially of L-DNA. A single-stranded DNA synthetic backbone can comprise about 10 nucleotides to about 100 nucleotides in length. A single-stranded DNA synthetic backbone can comprise about 52 nucleotides in length. A single-stranded DNA synthetic backbone can comprise about 27 nucleotides in length.
[0076] A barcode domain can comprise L-DNA. A barcode domain can consist of L-DNA. A barcode domain can consist essentially of L-DNA. A barcode domain can comprise about 27 nucleotides, or about 52 nucleotides, or about 99 nucleotides, or about 74 nucleotides. A barcode domain can be about 27 nucleotides, or about 52 nucleotides, or about 99 nucleotide or about 74 nucleotides in length.
[0077] The sequencing probe can comprise a single-stranded DNA synthetic backbone and a polymer-based spacer, with similar mechanical properties as double-stranded DNA, between the target binding domain and the barcode domain. Typical polymer-based spacers include polyethylene glycol (PEG) type polymers.
[0078] The double-stranded DNA spacer can be from about 1 nucleotide to about 100 nucleotides in length; from about 2 nucleotides to about 50 nucleotides in length; from about 20 nucleotides to about 40 nucleotides in length. Preferably, the double-stranded DNA spacer is about 36 nucleotides in length.
[0079] One sequencing probe of the present disclosure, termed a "standard probe" is illustrated in the left panel of Figure 2. The standard probe of Figure 2 comprises a barcode domain covalently attached to the target binding domain, such that the target binding and barcode domains are present within the same single stranded oligonucleotide. In Figure 2, left panel, the single stranded oligonucleotide binds to a stem oligonucleotide to create a 36 nucleotide long double-stranded spacer region called the stem. Using this architecture, each sequencing probe in a pool of probes can hybridize to the same stem sequence.
[0080] In alternative aspects, each of the nucleic acids comprising the barcode domain and the region that binds to the stem oligo nucleotide of a standard probe can be a canonical base or a modified nucleotide or nucleic acid analogue. Typical modified nucleotides or nucleic acid analogues useful in the barcode domain and the region that binds to the stem oligo nucleotide of a standard probe are isoguanine and isocytosine. Alternatively still, each of the nucleic acids comprising the barcode domain and the region that binds to the stem oligo nucleotide of a standard probe can independently be L-DNA. For example, the barcode domain and the region that binds to the stem oligo nucleotide of a standard probe can be comprised entirely of L-DNA. In other examples, the barcode domain and the region that binds to the stem oligo nucleotide of a standard probe can be comprised of segments of L-DNA separated by segments of single-stranded nucleic acid that is abasic or segments of a polymer with similar mechanical properties as double-stranded DNA such as PEG further described below.
[0081] Another sequencing probe of the present disclosure, termed a "3 Part Probe" is illustrated in the middle panel of Figure 2. The 3 Part Probe of Figure 2 comprises a barcode domain that is attached to the target binding domain via a linker. In this example, the linker is a single stranded stem oligonucleotide that hybridizes to the single stranded oligonucleotide that contains the target binding domain and the single stranded oligonucleotide that contains the barcode domain, creating a 36 nucleotide long double stranded spacer region that bridges the barcode domain (18 nucleotides) and target binding domain (18 nucleotides). Using this exemplary probe configuration, in order to prevent the exchange of barcode domains, each barcode can be designed such that it hybridizes to a unique stem sequence. Furthermore, each barcode domain can also be hybridized to its corresponding stem oligonucleotide prior to pooling together different sequencing probes.
[0082] In alternative aspects, each of the nucleic acids comprising the single stranded stem oligonucleotide can be a canonical base or a modified nucleotide or nucleic acid analogue. Typical modified nucleotides or nucleic acid analogues useful in the single stranded stem oligonucleotide are isoguanine and isocytosine. Alternatively still, each of the nucleic acids comprising the single stranded stem oligonucleotide can independently be L-DNA.
[0083] In alternative aspects, each of the nucleic acids comprising the region on the barcode domain to which the single stranded stem oligonucleotide hybridizes can be a canonical base or a modified nucleotide or nucleic acid analogue. Typical modified nucleotides or nucleic acid analogues useful in the single stranded stem oligonucleotide are isoguanine and isocytosine. Alternatively still, each of the nucleic acids comprising the region on the barcode domain to which the single stranded stem oligonucleotide hybridizes can independently be L-DNA.
[0084] In alternative aspects, each of the nucleic acids comprising the region on the single stranded oligonucleotide that contains the target binding domain to which the single stranded stem oligonucleotide hybridizes can be a canonical base or a modified nucleotide or nucleic acid analogue. Typical modified nucleotides or nucleic acid analogues useful in the single stranded stem oligonucleotide are isoguanine and isocytosine. Alternatively still, each of the nucleic acids comprising the region on the single stranded oligonucleotide that contains the target binding domain to which the single stranded stem oligonucleotide hybridizes can independently be L-DNA.
[0085] Another sequencing probe of the present disclosure, termed a "1-Part Linker Probe" is illustrated in the right panel of Figure 2. The 1-Part Linker Probe of Figure 2 comprises a barcode domain that is attached to the target binding domain via a linker. In this example, the linker is a PEG molecule. Alternatively, the linker could be trans-stilbene. Alternatively still, the linker can be any polymer with similar mechanical properties as double-stranded DNA. Typical polymer-based spacers include polyethylene glycol (PEG) type polymers.
[0086] A sequencing probe of the present disclosure can comprise about 60 nucleotides. A sequencing probe of the present disclosure can comprise about 107 nucleotides. A sequencing probe of the present disclosure can be about 60 nucleotides in length, or about 107 nucleotides in length. The nucleotides comprising a sequencing probe can each individually be a canonical base a modified nucleotide or nucleic acid analogue including L-DNA and D-DNA.
[0087] A barcode domain comprises a plurality of attachment positions, e.g., one, two, three, four, five, six, seven, eight, nine, ten, or more attachment positions. The number of attachment positions can be less than, equal to, or more than the number of nucleotides in the target binding domain. The target binding domain can comprise more nucleotides than number of attachment positions in the backbone domain, e.g., one, two, three, four, five, six, seven, eight, nine, ten, or more nucleotides. The target binding domain can comprise eight nucleotides and the barcode domain comprises three attachment positions. The target binding domain can comprise ten nucleotides and the barcode domain comprises three attachment positions
[0088] The length of the barcode domain is not limited as long as there is sufficient space for at least three attachment positions, as described below. The terms "attachment positions," "positions" and "spots," are used interchangeably herein. The terms "barcode domain" and "reporting domain," are used interchangeably herein.
[0089] Each attachment position in the barcode domain corresponds to two nucleotides (a dinucleotide) in the target binding domain and, thus, to the complementary dinucleotide in the target nucleic acid that is hybridized to the dinucleotide in the target binding domain. As a non-limiting example, the first attachment position in the barcode domain corresponds to the first and second nucleotides in the target binding domain (e.g., Figure 1 where R1 is the first attachment position in the barcode domain and R1 corresponds to dinucleotide b1 and b2 in the target binding domain - which in turn identifies dinucleotides 1 and 2 of the target nucleic acid); the second attachment position in the barcode domain corresponds to the third and fourth nucleotides in the target binding domain (e.g., Figure 1 where R2 is the second attachment position in the barcode domain and R2 corresponds to dinucleotide b3 and b4 in the target binding domain - which in turn identifies dinucleotides 3 and 4 of the target nucleic acid); and the third attachment position in the barcode domain corresponds to the fifth and sixth nucleotides in the target binding domain (e.g., Figure 1 where R3 is the third attachment position in the barcode domain and R3 corresponds to dinucleotide b5 and b6 in the target binding domain - which in turn identifies dinucleotide 5 and 6 of the target nucleic acid). In a further non-limiting example, the first attachment position in the barcode domain, the second attachment position in the barcode domain and the third attachment position in the barcode domain collectively correspond to the first through sixth nucleotides in the target binding domain (e.g., Figure 1 where nucleotides b1 to b6 in the target binding domain - which in turn identifies six nucleotides of the target nucleic acid).
[0090] Each attachment position in the barcode domain comprises at least one attachment region, e.g., one to 50, or more, attachment regions. Certain positions in a barcode domain can have more attachment regions than other positions (e.g., a first attachment position can have three attachment regions whereas a second attachment position can have two attachment positions); alternately, each position in a barcode domain has the same number of attachment regions. Each attachment position in the barcode domain can comprise one attachment region. Each attachment position in the barcode domain can comprise more than one attachment region. At least one of the at least three attachment positions in the barcode domain can comprise a different number of attachment regions than the other two attachments positions in the barcode domain. In some aspects, each attachment position in a barcode domain can comprise one attachment region.
[0091] Each attachment region comprises at least one (i.e., one to fifty, e.g., ten to thirty) copies of a nucleic acid sequence(s) capable of being reversibly bound by a complementary nucleic acid molecule (e.g., DNA or RNA). The nucleic acid sequences of attachment regions at a single attachment position can be identical; thus, the complementary nucleic acid molecules that bind those attachment regions are identical. Alternatively, the nucleic acid sequences of attachment regions at a position are not identical; thus, the complementary nucleic acid molecules that bind those attachment regions are not identical.
[0092] The nucleic acid sequence comprising each attachment region in a barcode domain can be about 6 nucleotides to about 20 nucleotides in length. The nucleic acid sequence comprising each attachment region in a barcode domain can be about 12 nucleotides in length. The nucleic acid sequence comprising each attachment region in a barcode domain can be about 16 nucleotides in length. The nucleic acid sequence comprising each attachment region in a barcode domain can be about 14 nucleotides in length. The nucleic acid sequence comprising each attachment region in a barcode domain can be about 8 nucleotides in length. The nucleic acid sequence comprising each attachment region in a barcode domain can be about 9 nucleotides in length.
[0093] An attachment position, an attachment region or at least one nucleic acid sequence of an attachment region can comprise at least one super T base (5-hydroxybutynl-2'-deoxyuridine). An attachment position, an attachment region or at least one nucleic acid sequence of an attachment region can comprise at least one 3' terminal super T base (5-hydroxybutynl-2'-deoxyuridine). An attachment position, an attachment region or at least one nucleic acid sequence of an attachment region can comprise at least one 5' terminal super T base (5-hydroxybutynl-2'-deoxyuridine).
[0094] Each of the nucleic acids comprising each attachment region in a barcode domain can independently be a canonical base or a modified nucleotide or nucleic acid analogue. At least one, at least two, at least three, at least four, at least five, or at least six nucleotides in the attachment region in a barcode domain can be modified nucleotides or nucleotide analogues. Typical ratios of modified nucleotides or nucleotide analogues to canonical bases in a barcode domain are 1:2 to 1:8. Typical modified nucleotides or nucleic acid analogues useful in the attachment region in a barcode domain are isoguanine and isocytosine. The use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine, for example, can improve binding efficiency and accuracy of the reporter to the appropriate attachment region in a barcode domain while minimizing binding elsewhere, including to the target.
[0095] One or more attachment regions within a barcode domain can comprise L-DNA. L-DNA is the left-turning and mirror image version of naturally occurring, right-turning D-DNA. L-DNA is more stable and resistant to enzymatic digestion. Since L-DNA cannot hybridize to D-DNA, L-DNA can improve binding efficiency and binding accuracy of the reporter to the appropriate attachment region in the barcode domain and prevent binding of the reporter elsewhere on the sequencing probe. In some aspects, each nucleotide of the at least one nucleic acid sequence of an attachment position can be L-DNA.
[0096] Each of the nucleic acids comprising each attachment region in a barcode domain can independently comprise an Adenine, a Cytosine, a Guanine, or a Thymine base. Alternatively, each of the nucleic acids comprising each attachment region in a barcode domain can independently comprise an Adenine, a Guanine or a Thymine base.
[0097] Each of the nucleic acid sequences comprising each attachment region in a barcode domain can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 3' terminal guanosine nucleotide. Each of the nucleic acid sequences comprising each attachment region in a barcode domain can consist of at least one adenine nucleotide, at least on thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 3' terminal guanosine nucleotide. Each of the nucleic acid sequences comprising each attachment region in a barcode domain can consist essentially of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 3' terminal guanosine nucleotide.
[0098] Each of the nucleic acid sequences comprising each attachment region in a barcode domain can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 5' terminal guanosine nucleotide. Each of the nucleic acid sequences comprising each attachment region in a barcode domain can consist of at least one adenine nucleotide, at least on thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 5' terminal guanosine nucleotide. Each of the nucleic acid sequences comprising each attachment region in a barcode domain can consist essentially of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 5' terminal guanosine nucleotide.
[0099] In some aspects, at least one attachment region in at least one attachment position of a barcode domain can comprise a 3' terminal guanosine nucleotide. In some aspects, at least one attachment region in at least two attachment positions of a barcode domain can comprise a 3' terminal guanosine nucleotide. In some aspects, at least one attachment region in at least three attachment positions of a barcode domain can comprise a 3' terminal guanosine nucleotide. A 3' terminal guanosine nucleotide can be L-DNA.
[0100] In some aspects, at least one attachment region in at least one attachment position of a barcode domain can comprise a 3' terminal guanosine nucleotide. In some aspects, at least one attachment region in at least two attachment positions of a barcode domain can comprise a 3' terminal guanosine nucleotide. In some aspects, at least one attachment region in at least three attachment positions of a barcode domain can comprise a 5' terminal guanosine nucleotide. A 3' terminal guanosine nucleotide can be L-DNA, for example L-deoxyguanosine (L-dG). The terminal L-dG nucleotide mitigates cross-junctional hybridization between attachment regions and / or attachment positions as well as maintain stability by providing base stacking interactions.
[0101] One or more attachment regions can be integral to a polynucleotide backbone; that is, the backbone is a single polynucleotide and the attachment regions are parts of the single polynucleotide's sequence. One or more attachment regions can be linked to a modified monomer (e.g., modified nucleotide) in the synthetic backbone such that the attachment region branches from the synthetic backbone. An attachment position can comprise more than one attachment region, in which some attachment regions branch from the synthetic backbone and some attachment regions are integral to the synthetic backbone. At least one attachment region in at least one attachment position can be integral to the synthetic backbone. Each attachment region in each of the at least three attachment positions can be integral to the synthetic backbone. At least one attachment region in at least one attachment position can branch from the synthetic backbone. Each attachment region in each of the at least three attachment positions can branch from the synthetic backbone.
[0102] Each attachment position within a barcode domain corresponds to one of sixteen dinucleotides i.e., either adenine-adenine, adenine-thymine / uracil, adenine-cytosine, adenine-guanine, thymine / uracil-adenine, thymine / uracil-thymine / uracil, thymine / uracil-cytosine, thymine / uracil-guanine, cytosine-adenine, cytosine-thymine / uracil, cytosine-cytosine, cytosine-guanine, guanine-adenine, guanine-thymine / uracil, guanine-cytosine or guanine-guanine. Thus, the one or more attachment regions located in a single attachment position of a barcode domain correspond to one of sixteen dinucleotides and comprise a nucleic acid sequence that is specific to the dinucleotide to which the attachment region corresponds. Attachment regions located in different attachment positions of a barcode domain contain unique nucleic acid sequences even if these positions within the barcode domain correspond to the same dinucleotide. For example, given a sequencing probe of the present disclosure that contains a target binding domain with a hexamer that encodes the sequence A-G-A-G-A-C, the barcode domain of this sequencing probe would contain three positions, with the first attachment position corresponding to an adenine-guanine dinucleotide, the second attachment position corresponding to an adenine-guanine dinucleotide and the third attachment position corresponding to an adenine-cytosine dinucleotide. The attachment regions located in position one of this example probe would comprise a nucleic acid sequence that is unique from the nucleic acid sequence of the attachment regions located in position two, even though both attachment position one and attachment position two correspond to the dinucleotide adenine-guanine. The sequences of specific attachment positions are designed and tested such that the complementary nucleic acid of a particular attachment position will not interact with a different attachment position. Additionally, the nucleotide sequence of a complementary nucleic acid is not limited; preferably it lacks substantial homology (e.g., 50% to 99.9%) with a known nucleotide sequence; this limits undesirable hybridization of a complementary nucleic acid and a target nucleic acid.
[0103] Figure 1 shows an illustration of one exemplary sequencing probe of the present disclosure comprising an exemplary barcode domain. The exemplary barcode domain depicted in Figure 1 comprises three attachment positions, R 1 , R 2 , and R 3 . Each attachment position corresponds to a specific dinucleotide present within the 6-mer sequence (bi thru b 6 ) of the target binding domain. In this example, R 1 corresponds to positions b 1 and b 2 , R 2 corresponds to positions b 3 and b 4 , and R 3 corresponds to positions b 5 and b 6 . Thus, each position decodes a particular dinucleotide present in the 6-mer sequence of the target binding domain, allowing for the identification of the particular two bases (A, C, G or T) present in each particular dinucleotide.
[0104] In the exemplary barcode domain depicted in Figure 1, each attachment position comprises a single attachment region that is integral to the synthetic backbone. Each attachment region of the three attachment positions contains a specific nucleotide sequence that corresponds to the particular dinucleotide that is encoded by each attachment position. For example, attachment position R 1 comprises an attachment region that has a specific sequence that corresponds to the identity of the dinucleotide b 1 -b 2 .
[0105] The barcode domain can further comprise one or more binding regions. The barcode domain can comprise at least one single-stranded nucleic acid sequence adjacent or flanking at least one attachment position. The barcode domain can comprise at least two single-stranded nucleic acid sequences adjacent or flanking at least two attachment positions. The barcode domain can comprise at least three single-stranded nucleic acid sequences adjacent or flanking at least three attachment positions. These flanking portions are known as "Toe-Holds," which can be used to accelerate the rate of exchange of oligonucleotides hybridized adjacent to the Toe-Holds by providing additional binding sites for single-stranded oligonucleotides (e.g., "Toe-Hold" Probes; see, e.g., Seeling et al., "Catalyzed Relaxation of a Metastable DNA Fuel"; J. Am. Chem. Soc. 2006, 128(37), pp12211-12220).
[0106] At least one attachment region within a barcode domain can be flanked on at least one side by a double-stranded nucleic acid sequence. At least two attachment regions within a barcode domain can be flanked on at least one side by a double-stranded nucleic acid sequence. At least three attachment regions within a barcode domain can be flanked on at least one side by a double-stranded nucleic acid sequence.
[0107] Any attachment region within a barcode domain can be separated from any adjacent attachment position by a double-stranded nucleic acid sequence called a "pocket oligo". Figure 28 shows an example of a sequencing probe with a barcode domain comprising three attachment positions. Attachment position one is separated from the adjacent attachment position two by a pocket oligo. Attachment position two is further separated from the adjacent attachment position three by another pocket oligo.
[0108] Each of the nucleic acids comprising a pocket oligo can be a canonical base or a modified nucleotide or nucleic acid analogue. Typical modified nucleotides or nucleic acid analogues useful in a pocket oligo are isoguanine and isocytosine. Alternatively still, each of the nucleic acids comprising a pocket oligo can independently be L-DNA. A pocket oligo can comprise at least one super T base (5-hydroxybutynl-2'-deoxyuridine). A pocket oligo can be about 25 nucleotides in length.
[0109] In some aspects, at least one, at least two or at least three attachment positions in a barcode domain can be adjacent to at least one flanking double-stranded polynucleotide. An at least one flanking double-stranded polynucleotide can comprise at least one modified nucleotide or nucleic acid analogue. An at least one flanking double-stranded polynucleotide can comprise L-DNA. An at least one flanking double-stranded polynucleotide can comprise at least one super T base (5-hydroxybutynl-2'-deoxyuridine). An at least one flanking double-stranded polynucleotide can be about 25 nucleotides in length.
[0110] At least one attachment region within a barcode domain can be flanked on at least one side by any polymer with similar mechanical properties as double-stranded DNA. Typical polymer-based spacers include polyethylene glycol (PEG) type polymers. At least two attachment regions within a barcode domain can be flanked on at least one side by any polymer with similar mechanical properties as double-stranded DNA. At least three attachment regions within a barcode domain can be flanked on at least one side by any polymer with similar mechanical properties as double-stranded DNA.
[0111] Any attachment region within a barcode domain can be separated from any adjacent attachment position by any polymer with similar mechanical properties as double-stranded DNA. Typical polymer-based spacers include polyethylene glycol (PEG) type polymers. Figure 29 shows an example of a sequencing probe with a barcode domain comprising three attachment positions. Attachment position one is separated from the adjacent attachment position two by a PEG-linker. Attachment position two is further separated from the adjacent attachment position three by another PEG-linker.
[0112] At least one attachment region within a barcode domain can be flanked on at least one side by a single-stranded nucleic acid molecule that is abasic. An abasic nucleic acid molecule is a nucleic acid molecule that has neither a purine nor a pyrimidine base. At least two attachment regions within a barcode domain can be flanked on at least one side by a single-stranded nucleic acid molecule that is abasic. At least three attachment regions within a barcode domain can be flanked on at least one side by a single-stranded nucleic acid molecule that is abasic.
[0113] Any attachment region within a barcode domain can be separated from any adjacent attachment position a single-stranded nucleic acid molecule that is abasic. Figure 30 shows an example of a sequencing probe with a barcode domain comprising three attachment positions. Attachment position one is separated from the adjacent attachment position two by a single-stranded nucleic acid molecule that is abasic. Attachment position two is further separated from the adjacent attachment position three by another single-stranded nucleic acid molecule that is abasic.
[0114] Any attachment region within a barcode domain can be separated from any adjacent attachment position by a 3' terminal guanosine nucleotide. In some aspects, at least one attachment region in at least two attachment positions of a barcode domain can comprise a 3' terminal guanosine nucleotide. Figure 53 shows an example of a sequencing probe with a barcode domain comprising three attachment positions each one separated by a terminal L-G nucleotide. Attachment position one is separated from the adjacent attachment position two by a L-G nucleotide. Attachment position two is further separated from the adjacent attachment position three by another L-G nucleotide. Attachment position three is terminated on the 3' end with a L-G nucleotide.
[0115] Sequencing probes of the present disclosure can have overall lengths (including target binding domain, barcode domain, and any optional domains) of about 20 nanometers to about 50 nanometers. The sequencing probe's backbone can be a polynucleotide molecule comprising about 120 nucleotides, about 60 nucleotides, about 52 nucleotides or about 27 nucleotides.
[0116] A sequencing probe can comprise a cleavable linker modification. A cleavable linker modification can comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten or any number of cleavable moieties. Any cleavable linker modification or cleavable moiety known to one of skill in the art can be utilized. Non-limiting examples of cleavable linker modifications and cleavable moieties include, but are not limited to, UV-light cleavable linkers, reducing agent cleavable linkers and enzymatically cleavable linkers. An example of an enzymatically cleavable linker is the insertion of deoxyuracil for cleavage by the USER ™< enzyme. The cleavable linker modification can be located anywhere along the length of the sequencing probe, including, but not limited to, a region between the target binding domain and the barcode domain. The right panel of Figure 7 depicts exemplary cleavable linker modifications that can be incorporated into the probes of the present disclosure.Reporter Probes (not claimed)
[0117] A nucleic acid molecule that binds (e.g., hybridizes) to a complementary nucleic acid sequence within at least one attachment region within at least one attachment position of a barcode domain of a sequencing probe of the present disclosure and comprises (directly or indirectly) a detectable label is referred to herein as a "reporter probe" or "reporter probe complex," these terms are used interchangeably herein. The reporter probe can be DNA, RNA or PNA. Preferably, the reporter probe is DNA.
[0118] A reporter probe can comprise at least two domains, a first domain capable of binding at least one first complementary nucleic acid molecule and a second domain capable of binding a first detectable label and at least a second detectable label. Figure 3 shows a schematic of an exemplary reporter probe of the present disclosure bound to the first attachment position of a barcode domain of an exemplary sequencing probe. In Figure 3, the first domain of the reporter probe (shown in hatched maroon) binds a complementary nucleic acid sequence within attachment position R 1 of the barcode domain and the second domain of the reporter probe (shown in gray) is bound to two detectable labels (one green label, one red label).
[0119] Alternatively, the reporter probe can comprise at least two domains, a first domain capable of binding at least one first complementary nucleic acid molecule and a second domain capable of binding at least one second complementary nucleic acid molecule. The at least one first and at least one second complementary nucleic acid molecules can be different (have different nucleic acid sequences).
[0120] A "primary nucleic acid molecule" is a reporter probe comprising at least two domains, a first domain capable of binding (e.g. hybridizing) to a complementary nucleic acid sequence within at least one attachment region within at least one attachment position of a barcode domain of a sequencing probe and a second domain capable of binding (e.g. hybridizing) to at least one additional complementary nucleic acid. A primary nucleic acid molecule can directly bind the complementary nucleic acid sequence within the at least one attachment region within the at least one attachment position of a barcode domain of a sequencing probe. A primary nucleic acid molecule can indirectly bind the complementary nucleic acid sequence within the at least one attachment region within the at least one attachment position of a barcode domain of a sequencing probe via a nucleic acid linker. This nucleic acid linker is called a "connector oligo".
[0121] A connector oligo can comprise at least two domains, a first domain capable of binding (e.g. hybridizing) at least one first complementary nucleic acid sequence within at least one attachment region within at least one attachment position of a barcode domain and a second domain capable of binding (e.g. hybridizing) to the first domain of a primary nucleic acid molecule. Figure 31 shows a sequencing probe bound to a reporter probe via a connector oligo.
[0122] Each of the nucleic acids comprising the first domain or the second domain of a connector oligo can be a canonical base or a modified nucleotide or nucleic acid analogue. Typical modified nucleotides or nucleic acid analogues useful in the first or second domain of a connector oligo are isoguanine and isocytosine. The use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine, for example, can improve binding efficiency and accuracy of the first domain of a connector oligo to the appropriate complementary nucleic acid sequence within at least one attachment region within at least one attachment position of a barcode domain of a sequencing probe while minimizing binding elsewhere, including to the target. The use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine, for example, can improve binding efficiency and accuracy of the second domain of a connector oligo to the appropriate first domain of a reporter probe while minimizing binding elsewhere, including to the target. Alternatively, each of the nucleic acids comprising the first or the second domain of a connector oligo can independently be L-DNA. In one example of a connector oligo, the first domain comprises D-DNA and the second domain comprises L-DNA. In another example of a connector oligo, the first domain comprises D-DNA and the second domain comprises isoguanine and / or isocytosine.
[0123] The first domain of a connector oligo can be about 8 to about 16 nucleotides in length. Preferably, the first domain of a connector oligo is 14 nucleotides in length. The second domain of a connector oligo can be about 4-12 nucleotides in length. Preferably, the second domain of a connector oligo can be about 8 nucleotides in length.
[0124] In aspects comprising a connector oligo, an attachment region can be referred to as being partially double-stranded. A partially double-stranded attachment region can comprise a double-stranded region and a single-stranded. The single-stranded region of a partially double-stranded attachment region can comprise at least one nucleic acid sequence that binds (e.g. hybridizes) to at least one complementary nucleic acid sequence. The at least one complementary nucleic acid sequence that binds (e.g. hybridizes) to the single-stranded region of a partially double-stranded attachment region can be a primary nucleic acid molecule.
[0125] Each of the nucleic acids comprising the double-stranded region of a partially double-stranded attachment region can independently be a canonical base or a modified nucleotide or nucleic acid analogue. At least one, two, at least three, at least four, at least five, least six, at least seven or at least eight nucleotides in the double-stranded region of a partially double-stranded attachment region can be modified nucleotides or nucleotide analogues. Typical ratios of modified nucleotides or nucleotide analogues to canonical bases in a barcode domain are 1:2 to 1:8. Typical modified nucleotides or nucleic acid analogues useful in the first domain of a primary nucleic acid molecule are isoguanine and isocytosine. Alternatively, each of the nucleic acids comprising the double-stranded region of a partially double-stranded attachment region can independently be L-DNA.
[0126] Each of the nucleic acids comprising the single-stranded region of a partially double-stranded attachment region can independently be a canonical base or a modified nucleotide or nucleic acid analogue. At least one, two, at least three, at least four, at least five, least six, at least seven or at least eight nucleotides in the single-stranded region of a partially double-stranded attachment region can be modified nucleotides or nucleic acid analogues. Typical ratios of modified nucleotides or nucleic acid analogues to canonical bases in a barcode domain are 1:2 to 1:8. Typical modified nucleotides or nucleic acid analogues useful in a single-stranded region of a partially double-stranded attachment region are isoguanine and isocytosine. The use of modified nucleotides or nucleic acid analogues such as isoguanine and isocytosine, for example, can improve binding efficiency and accuracy of a single-stranded region of a partially double-stranded attachment region to the appropriate complementary nucleic acid sequence of a primary nucleic acid molecule while minimizing binding elsewhere, including to the target. Alternatively, each of the nucleic acids comprising the first domain of a primary nucleic acid molecule can independently be L-DNA.
[0127] The primary nucleic acid molecule can comprise a cleavable linker. The cleavable linker can be located between the first domain and the second domain. Preferably, the cleavable linker is photo-cleavable. The cleavable linker can comprise at least one or at least two cleavable moieties. The at least one or at least two cleavable moieties can be photo-cleavable.
[0128] The first domain of a primary nucleic acid molecule can be about 6 to 16 nucleotides in length. Preferably, the first domain of a primary nucleic acid molecule is about 8 nucleotides in length.
[0129] Each of the nucleic acids comprising the first domain of a primary nucleic acid molecule can independently be a canonical base or a modified nucleotide or nucleic acid analogue. At least one, two, at least three, at least four, at least five, least six, at least seven or at least eight nucleotides in the first domain of a primary nucleic acid molecule can be modified nucleotides or nucleotide analogues. Typical ratios of modified nucleotides or nucleotide analogues to canonical bases in a barcode domain are 1:2 to 1:8. Typical modified nucleotides or nucleic acid analogues useful in the first domain of a primary nucleic acid molecule are isoguanine and isocytosine. The use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine, for example, can improve binding efficiency and accuracy of the first domain of a primary nucleic acid molecule to the appropriate complementary nucleic acid sequence within at least one attachment region within at least one attachment position of a barcode domain of a sequencing probe while minimizing binding elsewhere, including to the target. Alternatively, each of the nucleic acids comprising the first domain of a primary nucleic acid molecule can independently be L-DNA.
[0130] In some aspects, a first domain of a primary nucleic acid molecule can be composed entirely of L-DNA and the second domain of the primary nucleic acid molecule can be composed entirely of D-DNA.
[0131] In some aspects, a first domain of a primary nucleic acid molecule can comprise a 3' terminal cytosine nucleotide. In some aspects, a first domain of a primary nucleic acid molecule can comprise a 3' terminal cytosine nucleotide, wherein the 3' terminal cytosine nucleotide is L-DNA.
[0132] In some aspects, a first domain of a primary nucleic acid molecule can comprise a 5' terminal cytosine nucleotide. In some aspects, a first domain of a primary nucleic acid molecule can comprise a 5' terminal cytosine nucleotide, wherein the 5' terminal cytosine nucleotide is L-DNA.
[0133] In some aspects, a first domain of a primary nucleic acid molecule can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 3' terminal cytosine nucleotide. In some aspects, a first domain of a primary nucleic acid molecule can consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 3' terminal cytosine nucleotide. In some aspects, a first domain of a primary nucleic acid molecule can consist essentially of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 3' terminal cytosine nucleotide.
[0134] In some aspects, a first domain of a primary nucleic acid molecule can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 5' terminal cytosine nucleotide. In some aspects, a first domain of a primary nucleic acid molecule can consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 5' terminal cytosine nucleotide. In some aspects, a first domain of a primary nucleic acid molecule can consist essentially of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide or any combination thereof and a 5' terminal cytosine nucleotide.
[0135] The at least one additional complementary nucleic acid that binds the primary nucleic acid molecule is referred to herein as a "secondary nucleic molecule." The primary nucleic acid molecule can bind (e.g., hybridize) to at least one, at least two, at least three, at least four, at least five, or more secondary nucleic acid molecules. Preferably, the primary nucleic acid molecule binds (e.g., hybridizes) to four secondary nucleic acid molecules.
[0136] A secondary nucleic acid molecule can comprise at least two domains, a first domain capable of binding (e.g. hybridizing) to at least one complementary sequence in at least one primary nucleic acid molecule and a second domain capable of binding (e.g. hybridizing) to (a) a first detectable label and an at least second detectable label; (b) to at least one additional complementary nucleic acid; or (c) a combination thereof. In some aspects, a first domain of a secondary nucleic acid molecule can be composed entirely of L-DNA and the second domain of the secondary nucleic acid molecule can be composed entirely of D-DNA. In some aspects, both the first domain and second domain of a secondary nucleic acid molecule can be composed entirely of D-DNA.
[0137] The secondary nucleic acid molecule can comprise a cleavable linker. The cleavable linker can be located between the first domain and the second domain. Preferably, the cleavable linker is photo-cleavable.
[0138] Each of the nucleic acids comprising the first domain of a secondary nucleic acid molecule can independently be a canonical base or a modified nucleotide or nucleic acid analogue. At least one, two, at least three, at least four, at least five, or at least six nucleotides in the first domain of a secondary nucleic acid molecule can be modified nucleotides or nucleotide analogues. Typical ratios of modified nucleotides or nucleotide analogues to canonical bases in a barcode domain are 1:2 to 1:8. Typical modified nucleotides or nucleic acid analogues useful in the first domain of a secondary nucleic acid molecule are isoguanine and isocytosine. The use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine, for example, can improve binding efficiency and accuracy of the first domain of a secondary nucleic acid molecule to the appropriate complementary nucleic acid sequence within the second domain of a primary nucleic acid molecule while minimizing binding elsewhere.
[0139] The at least one additional complementary nucleic acid that binds the secondary nucleic acid molecule is referred to herein as a "tertiary nucleic molecule." The secondary nucleic acid molecule can bind (e.g., hybridize) to at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or more tertiary nucleic acid molecules. Preferably, the at least one secondary nucleic acid molecule binds (e.g., hybridizes) to one tertiary nucleic acid molecule.
[0140] A tertiary nucleic acid molecule comprises at least two domains, a first domain capable of binding (e.g. hybridizing) to at least one complementary sequence in at least one secondary nucleic acid molecule and a second domain capable of binding (e.g. hybridizing) to a first detectable label and an at least second detectable label. Alternatively, the second domain can include the first detectable label and an at least second detectable label via direct or indirect attachment of the labels during oligonucleotide synthesis using, for example, phosphoroamidite or NHS chemistry. In some aspects, a first domain of a tertiary nucleic acid molecule can be composed entirely of L-DNA and the second domain of the tertiary nucleic acid molecule can be composed entirely of D-DNA. In some aspects, both the first domain and second domain of a tertiary nucleic acid molecule can be composed entirely of D-DNA. The tertiary nucleic acid molecule can comprise a cleavable linker. The cleavable linker can be located between the first domain and the second domain. Preferably, the cleavable linker is photo-cleavable.
[0141] Each of the nucleic acids comprising the first domain of a tertiary nucleic acid molecule can independently be a canonical base or a modified nucleotide or nucleic acid analogue. At least one, two, at least three, at least four, at least five, or at least six nucleotides in the first domain of a tertiary nucleic acid can be modified nucleotides or nucleotide analogues. Typical ratios of modified nucleotides or nucleotide analogues to canonical bases in a first domain of a tertiary nucleic acid molecule are 1:2 to 1:8. Typical modified nucleotides or nucleic acid analogues useful in the first domain of a tertiary nucleic acid molecule are isoguanine and isocytosine. The use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine, for example, can improve binding efficiency and accuracy of the first domain of a tertiary nucleic acid molecule to the appropriate complementary nucleic acid sequence within the second domain of a second nucleic acid molecule while minimizing binding elsewhere.
[0142] Reporter probes are bound to a first detectable label and an at least second detectable label to create a dual color combination. This dual combination of fluorescent dyes can include a duplicity of a single color, e.g. blue-blue. As used herein, the term "label" includes a single moiety capable to producing a detectable signal or multiple moieties capable of producing the same or substantially the same detectable signal. For example, a label includes a single yellow fluorescent dye such as ALEXA FLUOR ™< 532 or multiple yellow fluorescent dyes such as ALEXA FLUOR ™< 532.
[0143] The reporter probes can bind to a first detectable label and an at least second detectable label, in which each detectable label is one of four fluorescent dyes: blue (B); green (G); yellow (Y); and red (R). The use of these four dyes creates 10 possible dual color combinations BB; BG; BR; BY; GG; GR; GY; RR; RY; or YY. In some aspects, reporter probes of the present disclosure are labeled with one of 8 possible color combinations: BB; BG; BR; BY; GG; GR; GY; or YY as depicted in Figure 3. The detectable label and an at least second detectable label can have the same emission spectrum or can have a different emission spectra.
[0144] In aspects comprising a sequencing probe and a primary nucleic acid molecule, the present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs recited in Table 1. An exemplary target binding domain comprises at least eight nucleotides and is capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in the target nucleic acid molecule and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule; wherein any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogues and wherein the at least two nucleotides in the target binding domain that do not identify a corresponding nucleotide in the target nucleic acid molecule can be any of the four canonical bases that is not specific to the target dictated by the at least six nucleotides in the target binding domain or universal or degenerate bases. An exemplary barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence bound by at least one complementary primary nucleic acid molecule, wherein the complementary primary nucleic acid molecule comprises a first detectable label and at least a second detectable label, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain and each of the at least three attachment positions have a different nucleic acid sequence, and wherein the at least first detectable label and at least second detectable label of each complementary primary nucleic acid molecule bound to each position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that is bound by the target binding domain. The at least two nucleotides in the target binding domain that do not identify a corresponding nucleotide in the target nucleic acid molecule can be any of the four canonical bases that is not specific to the target dictated by the at least six nucleotides in the target binding domain or universal or degenerate bases.
[0145] In some aspects, at least one nucleotide in a target binding domain that does not identify a corresponding nucleotide in a target nucleic acid molecule can precede the nucleotides in the target binding domain that identify corresponding nucleotides in the target nucleic acid molecule. In some aspects, at least one nucleotide in a target binding domain that does not identify a corresponding nucleotide in a target nucleic acid can follow the nucleotides in the target binding domain that identify corresponding nucleotides in the target nucleic acid molecule.
[0146] In other aspects, an exemplary target binding domain can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein the at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in the target nucleic acid molecule; wherein none of the at least six nucleotides or any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogues.
[0147] In aspects comprising a sequencing probe and a primary nucleic acid molecule, the present disclosure also provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least ten nucleotides and is capable of binding a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in the target nucleic acid molecule and wherein at least four nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence bound by at least one complementary primary nucleic acid molecule, wherein the complementary primary nucleic acid molecule comprises at first detectable label and at least a second detectable label, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain and each of the at least three attachment positions have a different nucleic acid sequence, wherein the at least first detectable label and at least second detectable label of each complementary primary nucleic acid molecule bound to each position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that is bound by the target binding domain.
[0148] In aspects comprising a sequencing probe, a primary nucleic acid molecule and a secondary nucleic acid molecule, the present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs recited in Table 1. An exemplary target binding domain comprises at least eight nucleotides and is capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in the target nucleic acid molecule and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule; wherein any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogues and wherein the at least two nucleotides in the target binding domain that do not identify a corresponding nucleotide in the target nucleic acid molecule can be any of the four canonical bases that is not specific to the target dictated by the at least six nucleotides in the target binding domain or universal or degenerate bases. An exemplary barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence bound by at least one complementary primary nucleic acid molecule, wherein the complementary primary nucleic acid molecule is further bound by at least one complementary secondary nucleic acid molecule comprising at first detectable label and at least a second detectable label, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain and each of the at least three attachment positions have a different nucleic acid sequence, and wherein the at least first detectable label and at least second detectable label of each complementary secondary nucleic acid molecule bound to each position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that is bound by the target binding domain.
[0149] In other aspects, an exemplary target binding domain can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein the at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in the target nucleic acid molecule; wherein none of the at least six nucleotides or any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogues.
[0150] In aspects comprising a sequencing probe, a primary nucleic acid molecule and a secondary nucleic acid molecule, the present disclosure also provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least ten nucleotides and is capable of binding a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in the target nucleic acid molecule and wherein at least four nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence bound by at least one complementary primary nucleic acid molecule, wherein the complementary primary nucleic acid molecule is further bound by at least one complementary secondary nucleic acid molecule comprising at first detectable label and at least a second detectable label, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain and each of the at least three attachment positions have a different nucleic acid sequence, wherein the at least first detectable label and at least second detectable label of each complementary secondary nucleic acid molecule bound to each position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that is bound by the target binding domain.
[0151] In aspects comprising a sequencing probe, a primary nucleic acid molecule, a secondary nucleic acid molecule and a tertiary nucleic acid molecule, the present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs recited in Table 1. An exemplary target binding domain comprises at least eight nucleotides and is capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in the target nucleic acid molecule and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule; wherein any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogues and wherein the at least two nucleotides in the target binding domain that do not identify a corresponding nucleotide in the target nucleic acid molecule can be any of the four canonical bases that is not specific to the target dictated by the at least six nucleotides in the target binding domain or universal or degenerate bases. An exemplary barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence bound by at least one complementary primary nucleic acid molecule, wherein the complementary primary nucleic acid molecule is further bound by at least one complementary secondary nucleic acid molecule, and wherein the at least one complementary secondary nucleic acid molecule is further bound by at least one complementary tertiary nucleic acid molecule comprising at first detectable label and at least a second detectable label, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain and each of the at least three attachment positions have a different nucleic acid sequence, and wherein the at least first detectable label and at least second detectable label of each complementary tertiary nucleic acid molecule bound to each position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that is bound by the target binding domain.
[0152] In other aspects, an exemplary target binding domain can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein the at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in the target nucleic acid molecule; wherein none of the at least six nucleotides or any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogues.
[0153] In aspects comprising a sequencing probe, a primary nucleic acid molecule, a secondary nucleic acid molecule and a tertiary nucleic acid molecule, the present disclosure also provides a sequencing probe comprising a target binding domain and a barcode domain; wherein the target binding domain comprises at least ten nucleotides and is capable of binding a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying a corresponding (complementary) nucleotide in the target nucleic acid molecule and wherein at least four nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence bound by at least one complementary primary nucleic acid molecule, wherein the complementary primary nucleic acid molecule is further bound by at least one complementary secondary nucleic acid molecule, and wherein the at least one complementary secondary nucleic acid molecule is further bound by at least one complementary tertiary nucleic acid molecule comprising at first detectable label and at least a second detectable label, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain and each of the at least three attachment positions have a different nucleic acid sequence, wherein the at least first detectable label and at least second detectable label of each complementary tertiary nucleic acid molecule bound to each position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that is bound by the target binding domain.
[0154] In a related instance provided for illustrative purposes, there is also provided sequencing probes and reporter probes having detectable labels on both a secondary nucleic acid molecule and a tertiary nucleic acid molecule. For example, a secondary nucleic acid molecule can bind a primary nucleic acid molecule and the secondary nucleic acid molecule can comprise both a first detectable label and an at least second detectable label and also be bound to at least one tertiary molecule comprising a first detectable label and an at least second detectable label. The first and at least second detectable labels located on the secondary nucleic acid molecule can have the same emission spectra or can have different emission spectra. The first and at least second detectable labels located on the tertiary nucleic acid molecule can have the same emission spectra or can have different emission spectra. The emission spectra of the detectable labels on the secondary nucleic acid molecule can be the same or can be different than the emission spectra of the detectable labels on the tertiary nucleic acid molecule.
[0155] Figure 4 is an illustrative schematic of an exemplary reporter probe of the present disclosure that comprises an exemplary primary nucleic acid molecule, secondary nucleic acid molecule and tertiary nucleic acid molecule. At the 3' end, the primary nucleic acid comprises a first domain, wherein the first domain comprises a twelve nucleotide sequence that hybridizes to a complementary attachment region within an attachment position of a sequencing probe barcode domain. At the 5' end is a second domain that is hybridized to six secondary nucleic acid molecules. The exemplary secondary nucleic acid molecules depicted in turn comprise a first domain in the 5' end that hybridizes to the primary nucleic acid molecule and a domain that in the 3' portion that hybridizes to five tertiary nucleic acid molecules.
[0156] A tertiary nucleic acid molecule comprises at least two domains. The first domain is capable of binding to a secondary nucleic acid molecule. The second domain of a tertiary nucleic acid is capable of binding to a first detectable label and at least second detectable label. The second domain of a tertiary nucleic acid can be bound to the first detectable label and at least second detectable label by the direct incorporation of one or more fluorescently-labeled nucleotide monomers into the sequence of the second domain of the tertiary nucleic acid. The second domain of the secondary nucleic acid molecule can be bound by the first detectable label and at least second detectable label by hybridizing short polynucleotides that are labeled to the second domain of the secondary nucleic acid. These short polynucleotides, called "labeled-oligos," can be labeled by direct incorporation of fluorescently-labeled nucleotide monomers or by other methods of labeling nucleic acids that are known to one of skill in that art. The exemplary tertiary nucleic acid molecules depicted in Figure 4, which may be considered "labeled oligos" comprise a first domain that hybridizes to a secondary nucleic acid molecule and a second domain that is fluorescently labeled by indirect attachment of the labels during oligonucleotide synthesis using, for example, NHS chemistry or incorporation of one or more fluorescently-labeled nucleotide monomers during the synthesis of the tertiary nucleic acid molecule. The labeled-oligos can be DNA, RNA or PNA.
[0157] Labeled oligos can comprise a cleavable linker between the fluorescent moiety and the polynucleotide molecule. Preferably, the cleavable linker is photo-cleavable. The cleavable linker can also be chemically or enzymatically-cleavable.
[0158] In alternative aspects, the second domain of a secondary nucleic acid is capable of binding to a first detectable label and at least second detectable label. The second domain of the secondary nucleic acid can be bound to the first detectable label and at least second detectable label by the direct incorporation of one or more fluorescently-labeled nucleotide monomers into the sequence of the second domain of the secondary nucleic acid. The second domain of the secondary nucleic acid molecule can be bound by the first detectable label and at least second detectable label by hybridizing short polynucleotides that are labeled to the second domain of the secondary nucleic acid. These short polynucleotides, called labeled-oligos, can be labeled by direct incorporation of fluorescently-labeled nucleotide monomers or by other methods of labeling nucleic acids that are known to one of skill in that art.
[0159] A primary nucleic acid molecule can comprise about 100, about 95, about 90, about 85, about 80 or about 75 nucleotides. A primary nucleic acid molecule can comprise about 100 to about 80 nucleotides. A primary nucleic acid molecule can comprise about 90 nucleotides. A secondary nucleic acid molecule can comprise about 90, about 85, about 80, about 75 or about 70 nucleotides. A secondary nucleic acid molecule can comprise about 90 to about 80 nucleotides. A secondary nucleic acid molecule can comprise about 87 nucleotides. A secondary nucleic acid molecule can comprise about 25, about 20, about 15, or about 10 nucleotides. A tertiary nucleic acid molecule can comprise about 20 to about 10 nucleotides. A tertiary nucleic acid molecule can comprise about 15 nucleotides.
[0160] Reporter probes of the present disclosure can be of various designs. For example, a primary nucleic acid molecule can be hybridized to at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) secondary nucleic acid molecules. Each secondary nucleic acid molecule can be hybridized to at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) tertiary nucleic acid molecules. To create a reporter probe that is labeled with a particular dual color combination, the reporter probe is designed such that the probe comprises secondary nucleic acid molecules, tertiary nucleic acid molecules, labeled-oligos or any combination of secondary nucleic acid molecules, tertiary nucleic acid molecules and labeled-oligos that are labeled with each color of the particular dual color combination. For example, Figure 4 depicts a reporter probe of the present disclosure that comprises 30 total dyes, with 15 dyes for color 1 and 15 dyes for color 2. To prevent color-swapping or cross hybridization between different fluorescent dyes, each tertiary nucleic acid or labeled-oligo that is bound to a specific label or fluorescent dye comprises a unique nucleotide sequence.
[0161] In a related instance provided for illustrative purposes, there is provided a 5x5 reporter probe. A 5x5 reporter probe comprises a primary nucleic acid, wherein the primary nucleic acid comprises a first domain of 12 nucleotides. The primary nucleic acid also comprises a second domain, wherein the second domain comprises a nucleotide sequence that can be hybridized to 5 secondary nucleic acid molecules. Each secondary nucleic acid comprises a nucleotide sequence such that 5 tertiary nucleic acids that are bound by detectable labels can hybridize to each secondary nucleic acid.
[0162] In a related instance provided for illustrative purposes, there is provided a 4x3 reporter probe. A 4x3 reporter probe comprises a primary nucleic acid, wherein the primary nucleic acid comprises a first domain of 12 nucleotides. The primary nucleic acid also comprises a second domain, wherein the second domain comprises a nucleotide sequence that can be hybridized to 4 secondary nucleic acid molecules. Each secondary nucleic acid comprises a nucleotide sequence such that 3 tertiary nucleic acids that are bound to detectable labels can hybridize to each secondary nucleic acid.
[0163] In a related instance provided for illustrative purposes, there is provided a 3x4 reporter probe. A 3x4 reporter probe comprises a primary nucleic acid, wherein the primary nucleic acid comprises a first domain of 12 nucleotides. The primary nucleic acid also comprises a second domain, wherein the second domain comprises a nucleotide sequence that can be hybridized to 3 secondary nucleic acid molecules. Each secondary nucleic acid comprises a nucleotide sequence such that 4 tertiary nucleic acids that are bound to detectable labels can hybridize to each secondary nucleic acid.
[0164] In a related instance provided for illustrative purposes, there is provided a Spacer 3x4 reporter probe. A Spacer 3x4 reporter probe comprises a primary nucleic acid, wherein the primary nucleic acid comprises a first domain of 12 nucleotides. Located between the first domain and second domain of the primary nucleic acid is a spacer region consisting of 20 to 40 nucleotides. The spacer is identified as 20 to 40 nucleotides long; however, the length of a spacer is non-limiting and it can be shorter than 20 nucleotides or longer than 40 nucleotides. The second domain of the primary nucleic acid comprises a nucleotide sequence that can hybridize to 3 secondary nucleic acid molecules. Each secondary nucleic acid comprises a nucleotide sequence such that 4 tertiary nucleic acids that are bound to detectable labels can hybridize to each secondary nucleic acid.
[0165] In some aspects, a primary nucleic acid can comprise a first domain that is 12 nucleotides long. However, the length of the first domain of a primary nucleic acid is non-limited and can be less than 12 or more than 12 nucleotides. In one example, the first domain of a primary nucleic acid is 14 nucleotides. In another example, the first domain of a primary nucleic acid is 9 nucleotides. In a further example, the first domain of a primary nucleic acid is 8 nucleotides. Exemplary sequences for a 9 nucleotide first domain of a primary nucleic acid of a reporter probe include those in Table 15. Table 15 Reporter Position 9-mer Sequence Color Reporter Position 9-mer Sequence Color 1CATTGGGTTBB2CGGGGTTTAGR1CTGGTATGTBG2CAAATTGGTGY1CAGTGAGTGBR2CGAAGTGGTRR1CAGGAAGGTBY2CTGTTAGGGYR1CGATGGATGGG2CGTGTTGTGYY1CGGTGGAATGR3CTTTGGTTTBB1CAAAAGAGGGY3CGAGTGGGABG1CAGGAGAAARR3CTAGTAGGGBR1CAAGGGTAGYR3CTTTGTGTTBY1CGAGATGAGYY3CATGGGGTGGG2CTTGTGATGBB3CGAAGTTGAGR2CGGGTTAGABG3CGGTGATTTGY2CGTATGGTTBR3CTATTGTGGRR2CGATTGGTABY3CTTAGGGAGYR2CATGGTGTAGG3CGGTGGAGGYY
[0166] Any of the features of a specific reporter probe design of the present disclosure can be combined with any of the features of another reporter probe design of the present disclosure. For example, a 5x5 reporter probe can be modified to contain a spacer region of approximately 20 to 40 nucleotides between the complementary nucleic and the primary nucleic acid. In another example, a 4x3 reporter probe can be modified such that the 4 secondary nucleic acids comprise a nucleotide sequence that allows 5 tertiary nucleic acids that are bound to detectable labels to hybridize to each secondary nucleic acid, thereby creating a 4x5 reporter probe.
[0167] Without wishing to be bound by theory, a 5x5 reporter contains more fluorescent labels (25) than a 4x3 reporter (12) and therefore the fluorescent intensity of the 5x5 reporter will be greater. The fluorescence detected in any given field of view FOV is a function a variety of variable including the fluorescent intensity of the given reporter probes and the number of optionally bound target molecules within that FOV. The number of optionally bound target molecules per field of view (FOV) can be from 1 to 2.5 million targets per FOV. Typical numbers of bound target molecules per FOV are 20,000 to 40,000, 220,000 to 440,000 or 1 million to 2 million target molecules. Typical FOVs are .05 mm 2< to 1mm 2< . Further examples of typical FOVs are .05 mm 2< to .65mm 2< .
[0168] In a related instance provided for illustrative purposes, there is provided reporter probe designs in which the secondary nucleic acid molecules comprise "extra-handles" that are not hybridized to a tertiary nucleic acid molecule and are distal to the primary nucleic acid molecule. In some aspect, an "extra-handle" can be 12 nucleotides long ("12 mer"); however, their lengths are non-limited and can be less than 12 or more than 12 nucleotides. The "extra-handles" can each comprise the nucleotide sequence of the first domain of the primary nucleic acid molecule to which the secondary nucleic acid molecule is hybridized. Thus, when a reporter probe comprises "extra-handles", the reporter probe can hybridize to a sequencing probe either via the first domain of the primary nucleic acid molecule or via an "extra-handle." Accordingly, the likelihood that a reporter probe binds to a sequencing probe is increased. The "extra-handle" design can also improve hybridization kinetics. Without being bound by any theory, the "extra-handles" can increase the effective concentration of the reporter probe's complementary nucleic acid. A 5x4 "extra-handles" reporter probe is expected to yield approximately 4750 fluorescent counts per standard FOV. A 5x3 "extra-handles" reporter probe, a 4x4 "extra-handles" reporter probe, a 4x3 "extra-handles" reporter probe and a 3x4 "extra-handles" reporter probe are all expected to yield approximately 6000 fluorescent counts per standard FOV. Any reporter probe design of the present disclosure can be modified to include "extra-handles".
[0169] Individual secondary nucleic acid molecules of a reporter probe can hybridize to tertiary nucleic acid molecules that are all labeled with the same detectable label. For example, the left panel of Figure 5 depicts a "5x6" reporter probe. A 5x6 reporter probe comprises one primary nucleic acid that comprises a second domain, wherein the second domain comprises a nucleotide sequence hybridized to 6 secondary nucleic acid molecules. Each secondary nucleic acid comprises a nucleotide sequence such that 5 tertiary nucleic acid molecules that are bound to detectable labels hybridized to each secondary nucleic acid. Each of the 5 tertiary nucleic acid molecules that bind to a particular secondary nucleic acid molecule are labeled with the same detectable label. Three of the secondary nucleic acid molecules bind to tertiary nucleic acid molecules labeled with a yellow fluorescent dye and the other three secondary nucleic acid bind to tertiary nucleic acid molecules labeled with a red fluorescent dye, for example.
[0170] Individual secondary nucleic acid molecules of a reporter probe can hybridize to tertiary nucleic acid molecules that are labeled with different detectable labels. For example, the middle panel of Figure 5 depicts a "3x2x6" reporter probe design. A "3x2x6" reporter probe comprises one primary nucleic acid that comprises a second domain, wherein the second domain comprises a nucleotide sequence hybridized to 6 secondary nucleic acid molecules. Each secondary nucleic acid comprises a nucleotide sequence such that 5 tertiary nucleic acids that are bound to detectable labels hybridized to each secondary nucleic acid. Each secondary nucleic acid binds to both tertiary nucleic acid molecules labeled with a yellow fluorescent dye and to tertiary nucleic acid molecules labeled with a red fluorescent dye. In this specific example, three secondary nucleic acid molecules bind two red and three yellow tertiary nucleic acid molecules, while the other three secondary nucleic acid molecules bind two red and three yellow tertiary nucleic acid molecules. Each secondary nucleic acid molecule can bind to any number of tertiary nucleic acid molecules bound by different detectable labels. In the middle panel of Figure 5, the tertiary nucleic acid molecules bound to an individual secondary nucleic acid molecule are arranged such that the colors of the label alternate (i.e. red-yellow-red-yellow-red or yellow-red-yellow-red-yellow).
[0171] In any of the described reporter probe designs, tertiary nucleic acids labeled with different detectable labels can be arranged in any order along the secondary nucleic acid. For example, the right panel of Figure 5 depicts a "Fret resistant 3x2x6" reporter probe that is similar to the 3x2x6 reporter probe design except in the arrangement (e.g., linear order or grouping) of red and yellow tertiary nucleic acid molecules along each secondary nucleic acid molecule.
[0172] Figure 6 depicts more exemplary reporter probe designs of the present disclosure that include individual secondary nucleic acid molecules that bind to varying tertiary nucleic acid molecules. The left panel depicts a "6x1x4.5" reporter probe that comprises one primary nucleic acid molecule, wherein the primary nucleic acid molecule comprises a second domain, wherein the second domain comprises a nucleotide sequence hybridized to six secondary nucleic acid molecules. Each secondary nucleic acid molecule is hybridized to five tertiary nucleic acid molecules. Four of the five tertiary nucleic acid molecules that hybridize to each secondary nucleic acid molecule are directly labeled with the same color detectable label. The fifth tertiary nucleic acid, denoted as the branching tertiary nucleic acid, is bound to 5 labeled-oligos of the other color of the dual color combination. Of the six secondary nucleic acids, three of them bind to a branching tertiary nucleic acid labeled with one color of the dual color combination (in this example red), while the other three secondary nucleic acids bind to a branching tertiary nucleic acid labeled with the other color of the dual color combination (in this example yellow). In total, the 6x1x4.5 reporter probe is labeled with 54 total dyes, 27 dyes for each color. The middle panel of Figure 6 depicts a "4x1x4.5" reporter probe that shares the same overall architecture as the 6x1x4.5 reporter probe, except that the primary nucleic acid of the 4x1x4.5 reporter probe binds only 4 secondary nucleic acids, such that there are a total of 36 dyes, 18 for each color.
[0173] A reporter probe can comprise the same number of dyes for each color of the dual color combination. A reporter probe can comprise a different number of dyes for each color of the dual color combination. The selection as to which color has more dyes within a reporter probe can be made on the basis of the energy level of light that the two dyes absorb. For example, the right panel of Figure 6 depicts a "5x5 energy optimized" reporter probe design. This reporter probe design comprises 15 yellow dyes (which are higher energy) and 10 red dyes (which are lower energy). In this example, the 15 yellow dyes can constitute a first label and the 10 red dyes can constitute a second label.
[0174] A detectable moiety, label or reporter can be bound to a secondary nucleic acid molecule, a tertiary nucleic acid molecule or to a labeled-oligo in a variety of ways, including the direct or indirect attachment of a detectable moiety such as a fluorescent moiety, colorimetric moiety and the like. One of skill in the art can consult references directed to labeling nucleic acids. Examples of fluorescent moieties include, but are not limited to, yellow fluorescent protein (YFP), green fluorescent protein (GFP), cyan fluorescent protein (CFP), red fluorescent protein (RFP), umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, cyanines, dansyl chloride, phycocyanin, phycoerythrin and the like.
[0175] Fluorescent labels and their attachment to nucleotides and / or oligonucleotides are described in many reviews, including Haugland, Handbook of Fluorescent Probes and Research Chemicals, Ninth Edition (Molecular Probes, Inc., Eugene, 2002); Keller and Manak, DNA Probes, 2nd Edition (Stockton Press, New York, 1993); Eckstein, editor, Oligonucleotides and Analogues: A Practical Approach (IRL Press, Oxford, 1991); and Wetmur, Critical Reviews in Biochemistry and Molecular Biology, 26:227-259 (1991). Particular methodologies applicable to the disclosure are disclosed in the following sample of references: U.S. Patent Nos. 4,757,141; 5,151,507; and 5,091,519. One or more fluorescent dyes can be used as labels for labeled target sequences, e.g., as disclosed by U.S. Patent Nos. 5,188,934 (4,7-dichlorofluorescein dyes); 5,366,860 (spectrally resolvable rhodamine dyes); 5,847,162 (4,7-dichlororhodamine dyes); 4,318,846 (ether-substituted fluorescein dyes); 5,800,996 (energy transfer dyes); Lee et al. 5,066,580 (xanthine dyes); 5,688,648 (energy transfer dyes); and the like. Labelling can also be carried out with quantum dots, as disclosed in the following patents and patent publications: U.S. Patent Nos. 6,322,901; 6,576,291; 6,423,551; 6,251,303; 6,319,426; 6,426,513; 6,444,143; 5,990,479; 6,207,392; 2002 / 0045045; and 2003 / 0017264. As used herein, the term "fluorescent label" comprises a signaling moiety that conveys information through the fluorescent absorption and / or emission properties of one or more molecules. Such fluorescent properties include fluorescence intensity, fluorescence lifetime, emission spectrum characteristics, energy transfer, and the like.
[0176] Commercially available fluorescent nucleotide analogues readily incorporated into nucleotide and / or oligonucleotide sequences include, but are not limited to, Cy3-dCTP, Cy3-dUTP, Cy5-dCTP, Cy5-dUTP (Amersham Biosciences, Piscataway, NJ), fluorescein- 12-dUTP, tetramethylrhodamine-6-dUTP, TEXAS RED ™< -5-dUTP, CASCADE BLUE ™< -7-dUTP, BODIPY TMFL-14-dUTP, BODIPY TMR-14-dUTP, BODIPY TMTR-14-dUTP, RHODAMINE GREEN ™< -5-dUTP, OREGON GREENR ™< 488-5-dUTP, TEXAS RED ™< - 12-dUTP, BODIPY TM 630 / 650- 14-dUTP, BODIPY TM 650 / 665- 14-dUTP, ALEXA FLUOR ™< 488-5-dUTP, ALEXA FLUOR ™< 532-5-dUTP, ALEXA FLUOR ™< 568-5-dUTP, ALEXA FLUOR ™< 594-5-dUTP, ALEXA FLUOR ™< 546- 14-dUTP, fluorescein- 12-UTP, tetramethylrhodamine-6-UTP, TEXAS RED ™< -5-UTP, mCherry, CASCADE BLUE ™< -7-UTP, BODIPY TM FL-14-UTP, BODIPY TMR-14-UTP, BODIPY TM TR-14-UTP, RHODAMINE GREEN ™< -5-UTP, ALEXA FLUOR ™< 488-5-UTP, LEXA FLUOR ™< 546- 14-UTP (Molecular Probes, Inc. Eugene, OR) and the like. Alternatively, the above fluorophores and those mentioned herein can be added during oligonucleotide synthesis using for example phosphoroamidite or NHS chemistry. Protocols are known in the art for custom synthesis of nucleotides having other fluorophores (See, Henegariu et al. (2000) Nature Biotechnol. 18:345). 2-Aminopurine is a fluorescent base that can be incorporated directly in the oligonucleotide sequence during its synthesis. Nucleic acid could also be stained, a priori, with an intercalating dye such as DAPI, YOYO- 1 , ethidium bromide, cyanine dyes (e.g., SYBR Green) and the like.
[0177] Other fluorophores available for post-synthetic attachment include, but are not limited to, ALEXA FLUOR ™< 350, ALEXA FLUOR ™< 405, ALEXA FLUOR ™< 430, ALEXA FLUOR ™< 532, ALEXA FLUOR ™< 546, ALEXA FLUOR ™< 568, ALEXA FLUOR ™< 594, ALEXA FLUOR ™< 647, BODIPY 493 / 503, BODIPY FL, BODIPY R6G, BODIPY 530 / 550, BODIPY TMR, BODIPY 558 / 568, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY 576 / 589, BODIPY 581 / 591, BODIPY TR, BODIPY 630 / 650, BODIPY 650 / 665, Cascade Blue, Cascade Yellow, Dansyl, lissamine rhodamine B, Marina Blue, Oregon Green 488, Oregon Green 514, Pacific Blue, Pacific Orange, rhodamine 6G, rhodamine green, rhodamine red, tetramethyl rhodamine, Texas Red (available from Molecular Probes, Inc., Eugene, OR), Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7 (Amersham Biosciences, Piscataway, NJ) and the like. FRET tandem fluorophores can also be used, including, but not limited to, PerCP-Cy5.5, PE-Cy5, PE-Cy5.5, PE-Cy7, PE-Texas Red, APC-Cy7, PE-Alexa dyes (610, 647, and 680), APC-Alexa dyes and the like.
[0178] Metallic silver or gold particles can be used to enhance signal from fluorescently labeled nucleotide and / or oligonucleotide sequences (Lakowicz et al. (2003) BioTechniques 34:62).
[0179] Other suitable labels for an oligonucleotide sequence can include fluorescein (FAM, FITC), digoxigenin, dinitrophenol (DNP), dansyl, biotin, bromodeoxyuridine (BrdU), hexahistidine (6xHis), phosphor-amino acids (e.g., P-tyr, P-ser, P-thr) and the like. The following hapten / antibody pairs can be used for detection, in which each of the antibodies is derivatized with a detectable label: biotin / a-biotin, digoxigenin / a-digoxigenin, dinitrophenol (DNP) / a-DNP, 5-Carboxyfluorescein (FAM) / a-FAM.
[0180] Detectable labels described herein are spectrally resolvable. "Spectrally resolvable" in reference to a plurality of fluorescent labels means that the fluorescent emission bands of the labels are sufficiently distinct, i.e., sufficiently non-overlapping, that molecular tags to which the respective labels are attached can be distinguished on the basis of the fluorescent signal generated by the respective labels by standard photodetection systems, e.g., employing a system of band pass filters and photomultiplier tubes, or the like, as exemplified by the systems described in U.S. Patent Nos. 4,230,558; 4,811,218; or the like, or in Wheeless et al., pgs. 21-76, in Flow Cytometry: Instrumentation and Data Analysis (Academic Press, New York, 1985). Spectrally resolvable organic dyes, such as fluorescein, rhodamine, and the like, means that wavelength emission maxima are spaced at least 20 nm apart, and in another aspect, at least 40 nm apart. For chelated lanthanide compounds, quantum dots, and the like, spectrally resolvable means that wavelength emission maxima are spaced at least 10 nm apart, or at least 15 nm apart.
[0181] The presence of 3 attachment positions in the barcode domain, each with up to 10 potential dual color combinations, allows for up to 1000 color combinations to exist. If the reporter probes are pooled in less than 1000 probes per pool then the ability to use parity checking to overcome errors can be utilized. There are many potential parity schemes that can exist that will allow parity checking, a single example scheme is shown in Figure 32. In this example the actual colors present are not used as the parity check but rather the presence of single (S) color reporter probes (e.g. Red) and Multicolor (M) reporter probes (e.g. Red / Yellow) at each attachment position in the barcode domain are. As can be seen in the parity design the knowledge of the status (S or M) of any two reporter positions allows prediction of the third position. In the example shown an observation of S in any two positions requires the unobserved position to be M, observation of S and an M in any two positions means the other position must be S, while observation of two M reporter probes requires the other position to be M. This means that in order to get a code of three reporter probes with incorrectly detected reporter colors, two incorrect calls have to be made. Figure 32 shows the results of a simulation at 5% reporter probe error that shows the increase in filtering of errors when parity checking is applied. There are multiple parity systems that can be applied this is just one example.
[0182] Another error correction routine is to swap color palette for each pool of reporter probes. A color palette is the set of reporter probes that are actually used for measuring a pool. Multiple reporter probes are not used in any pool, if 500 reporter probes are in a pool then only ½ the possible color combinations are needed. The simplest way to implement this is to have two palettes, palette A containing 500 reporter probes and palette B containing the other 500 reporter probes. Thus if sequencing pools 1,3,5,7 have palette A and pools 2,4,6,8 have palette B then running pools in the order 1,2,3,4,5,6,7,8 means each successive sequencing pool will have a separate palette. Thus, barcodes from pool 2 would do not exist in the preceding and following pools (e.g. pools 1 and 3). This allows for simple automated troubleshooting and limiting of detections errors.
[0183] A reporter probe can comprise one or more cleavable linker modifications. The one or more cleavable linker modifications can be positioned anywhere in the reporter probe. A cleavable linker modification can be located between the first and second domains of a primary nucleic acid molecule of a reporter probe. A cleavable linker modification can be present between the first and second domains of the secondary nucleic acid molecules of a reporter probe. A cleavable linker modification can be present between the first and second domains of the primary nucleic acid molecule and secondary nucleic acid molecules of a reporter probe. The left panel of Figure 7 depicts an exemplary reporter probe of the present disclosure comprising cleavable linker modification between the first and second domains of the primary nucleic acid and between the first and second domains of the secondary nucleic acids. In such instances as exemplified in the left panel of Figure 7, the cleavable linker modifications may include one or more cleavable moieties such as those exemplified in the left panel of Figure 7.
[0184] A cleavable linker modification can be a compound of the Formula (I): or a stereoisomer or salt thereof, wherein: R 1 is hydrogen, halogen, C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, wherein said C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynl are each independently optionally substituted with at least one substituent R 10 ; R 2 is O, NH, or N(C 1-6 alkyl); R 3 is cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, each optionally substituted with at least one substituent R 10 ; each R 4 and R 7 are independently C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynyl, wherein said C 1-6 alkyl, C 2-6 alkenyl, C 2-6 alkynl are each independently optionally substituted with at least one substituent R 10 ; R 5 and R 9 are each independently cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, each optionally substituted with at least one substituent R 10 ; R 6 is O, NH or N(C 1-6 alkyl); R 8 is O, NH, or N(C 1-6 alkyl); each R 10 is independently hydrogen, halogen, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, haloC 1-6 alkyl, haloC 2-6 alkenyl, haloC 2-6 alkynyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, -CN, -NO 2 , oxo, -OR 11 , -SO 2 R 11 , -SO 3 -< , -COR 11 , -CO 2 R 11 , -CONR 11 R 12 , - C(=NR 11 )NR 12 R 13 , -NR 11 R 12 , -NR 12 COR 12 , -NR 11 CONR 12 R 13 , -NR 11 CO 2 R 12 , -NR 11 SONR 12 R 13 , -NR 11 SO 2 NR 12 R 13 , or -NR 11 SO 2 R 12 ; and R 11 , R 12 , and R 13 , which may be the same or different, are each independently hydrogen, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, haloC 1-6 alkyl, haloC 2-6 alkenyl, haloC 2-6 alkynyl, C 1-6 alkyloxyC 1-6 alkyl-, cycloalkyl, heterocyclyl, aryl, or heteroaryl.
[0185] In one aspect, R 1 is C 1-6 alkyl, preferably C 1-3 alkyl such as methyl, ethyl, propyl or isopropyl; R 2 is NH or N(C 1-6 alkyl); R 3 is a 5- to 6-membered cycloalkyl, preferably cyclohexyl; R 4 is C 1-6 alkyl, preferably C 1-3 alkylene such as methylene, ethylene, propylene, or isopropylene; R 5 is a 5- to 6- membered heterocyclyl comprising one nitrogen atom and 0 or 1 additional heteroatoms selected from N, O and S, wherein said heterocyclyl is optionally substituted with one or two R 10 ; R 6 is O; R 7 is C 1-6 alkyl, preferably C 1-3 alkylene such as methylene, ethylene, propylene, or isopropylene; R 8 is O; R 9 is a 5- to 6- membered heterocyclyl comprising one nitrogen atom and 0 or 1 additional heteroatoms selected from N, O and S, wherein said heterocyclyl is optionally substituted with one or two R 10 ; and each R 10 is independently halogen, C 1-6 alkyl, haloC 1-6 alkyl, oxo, -SO 2 H, or -SO 3 -< .
[0186] In one aspect, R 3 is cyclohexyl, R 4 is methylene, R 5 is 1H-pyrrole-2,5-dione, and R 9 is pyrrolidine-2,5-dione, optionally substituted with SO 3 -< .
[0187] The linker compound can be or a stereoisomer or salt thereof
[0188] The linker compound can be or a stereoisomer or salt thereof.
[0189] The linker compound or linker modification can be
[0190] The linker compound or linker modification can be or
[0191] A cleavable linker modification or a cleavable moiety can be
[0192] Reporter probes can be assembled by mixing together three stock solutions together with water. One stock solution contains primary nucleic acid molecules, one stock solution contains secondary nucleic acid molecules and the final stock solution contains the tertiary nucleic acid molecules. Table 2 depicts exemplary amounts of each stock solution that can be mixed to assemble particular reporter probe designs. Table 2Reporter probe DesignVolume (µl) of primary nucleic acid molecules (10 µM stock)Volume (µl) of secondary nucleic acid molecules (10 µM stock)Volume (µl) of tertiary nucleic acid molecules (10 µM stock)Volume (µl) of Water5x414.52.2592.255x314.51.892.74x41.284.52.2591.974x31.284.51.892.423x41.84.52.2591.45 Target Nucleic Acid (not claimed)
[0193] In a related instance provided for illustrative purposes, there is provided methods for sequencing a nucleic acid using the sequencing probes disclosed herein. The nucleic acid that is to be sequenced using the method of the present disclosure is herein referred to as a "target nucleic acid". The term "target nucleic acid" shall mean a nucleic acid molecule (DNA, RNA, or PNA) whose sequence is to be determined by the probes, methods, and apparatuses of the disclosure. In general, the terms "target nucleic acid", "target nucleic acid molecule,", "target nucleic acid sequence," "target nucleic acid fragment," "target oligonucleotide" and "target polynucleotide" are used interchangeably and are intended to include, but not limited to, a polymeric form of nucleotides that can have various lengths, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Non-limiting examples of nucleic acids include a gene, a gene fragment, an exon, an intron, intergenic DNA (including, without limitation, heterochromatic DNA), messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, small interfering RNA (siRNA), non-coding RNA (ncRNA), cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of a sequence, isolated RNA of a sequence, nucleic acid probes, and primers. Prior to sequencing using the methods of the present disclosure, the identity and / or sequence of the target nucleic is known. Alternatively, the identity and / or sequence is unknown. It is also possible that a portion of the sequence of a target nucleic acid is known prior to sequencing using the methods of the present disclosure. For example, the method can be directed at determining a point mutation in a known target nucleic acid molecule.
[0194] The present methods directly sequence a nucleic acid molecule obtained from a sample, e.g., a sample from an organism, and, preferably, without a conversion (or amplification) step. As an example, for direct RNA-based sequencing, the present methods do not require conversion of an RNA molecule to a DNA molecule (i.e., via synthesis of cDNA) before a sequence can be obtained. Since no amplification or conversion is required, a nucleic acid sequenced in the present disclosure will retain any unique base and / or epigenetic marker present in the nucleic acid when the nucleic acid is in the sample or when it was obtained from the sample. Such unique bases and / or epigenetic markers are lost in sequencing methods known in the art.
[0195] The present methods can be used to sequence at single molecule resolution. In other words, the present methods allow the user to generate a final sequence based on data collected from a single target nucleic acid molecule, rather than having to combine data from different target nucleic acid molecules, preserving any unique features of that particular target.
[0196] The target nucleic acid can be obtained from any sample or source of nucleic acid, e.g., any cell, tissue, or organism, in vitro, chemical synthesizer, and so forth. The target nucleic acid can be obtained by any art-recognized method. The nucleic acid can be obtained from a blood sample of a clinical subject. The nucleic acid can be extracted, isolated, or purified from the source or samples using methods and kits well known in the art.
[0197] A target nucleic acid can be fragmented by any means known in the art. Preferably, the fragmenting is performed by an enzymatic or a mechanical means. The mechanical means can be sonication or physical shearing. The enzymatic means can be performed by digestion with nucleases (e.g., Deoxyribonuclease I (DNase I)) or one or more restriction endonucleases.
[0198] When a nucleic acid molecule comprising the target nucleic acid is an intact chromosome, steps should be taken to avoid fragmenting the chromosome.
[0199] The target nucleic acid can include natural or non-natural nucleotides, comprising modified nucleotides or nucleic acid analogues, as well-known in the art.
[0200] The target nucleic acid molecule can include DNA, RNA, and PNA molecules up to hundreds of kilobases in length (e.g. 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 200, 500, or more kilobases). A target nucleic acid molecule can comprise about 50 to about 400 nucleotides, or about 90 to about 350 nucleotides.Capture Probes (not claimed)
[0201] The target nucleic acid can be immobilized (e.g., at one, two, three, four, five, six, seven, eight, nine, ten, or more positions) to a substrate.
[0202] Exemplary useful substrates include those that comprise a binding moiety selected from the group consisting of ligands, antigens, carbohydrates, nucleic acids, receptors, lectins, and antibodies. The capture probe comprises a substrate binding moiety capable of binding with the binding moiety of the substrate. Exemplary useful substrates comprising reactive moieties include, but are not limited to, surfaces comprising epoxy, aldehyde, gold, hydrazide, sulfhydryl, NHS-ester, amine, alkyne, azide, thiol, carboxylate, maleimide, hydroxymethyl phosphine, imidoester, isocyanate, hydroxyl, pentafluorophenyl-ester, psoralen, pyridyl disulfide or vinyl sulfone, polyethylene glycol (PEG), hydrogel, or mixtures thereof. Such surfaces can be obtained from commercial sources or prepared according to standard techniques. Exemplary useful substrates comprising reactive moieties include, but are not limited to, OptArray-DNA NHS group (Accler8), Nexterion Slide AL (Schott) and Nexterion Slide E (Schott).
[0203] The substrate can be any solid support known in the art, e.g., a coated slide and a microfluidic device, which is capable of immobilizing a target nucleic acid. The substrate can be a surface, membrane, bead, porous material, electrode or array. The substrate can be a polymeric material, a metal, silicon, glass or quartz for example. The target nucleic acid can be immobilized onto any substrate apparent to those of skill in the art.
[0204] When the substrate is an array, the substrate can comprise wells, the size and spacing of which is varied depending on the target nucleic acid molecule to be attached. In one example, the substrate is constructed so that an ultra-dense ordered array of target nucleic acids is attached. Examples of the density of the array of target nucleic acids on a substrate include from 500,000 to 10,000,000 target nucleic acid molecules per mm 2< , from 1,000,000 to 4,000,000 target nucleic acid molecules per mm 2< or from 850,000 to 3,500,000 target nucleic acid molecules per mm 2< .
[0205] The wells in the substrate are locations for attachment of a target nucleic acid molecule. The surface of the wells can be functionalized with reactive moieties described above to attract and bind specific chemical groups existing on the on the target nucleic acid molecules or capture probes bound to the target nucleic acid molecules to attract, immobilize and bind the target nucleic acid molecule. These functional groups are well known to be able to specifically attract and bind biomolecules through various conjugation chemistries.
[0206] For single nucleic acid molecule sequencing on a substrate such as an array, a universal capture probe or universal sequence complementary to the substrate binding moiety of a capture probe is attached to each well. A single target nucleic acid molecule is then bound to the universal capture probe or universal sequence complementary to the substrate binding moiety of a capture probe bound to the capture probe and sequencing can commence.
[0207] For single nucleic acid molecule sequencing on a substrate such as an array, a single target nucleic acid molecule can be bound to a capture probe. The substrate binding moiety of the capture probe can then be bound to an adapter oligonucleotide. The adapter nucleotide is then bound to a lawn oligonucleotide that is attached to each well and sequencing can commence. Exemplary sequences for lawn oligonucleotides are shown in Table 8. Table 8 Exemplary Lawn Oligo SequenceSEQ ID NO.5AmMC6 / TGGTGAGGTTGTTGGTAGTAGTGAGTTTGTAGGGT1005AmMC6 / TGGTGAGGTTGTTGGTAGTAGTGAG1015AmMC6 / TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT1025AmMC6 / CATCTCAAACACCTTCTACAATATGACCTAACACAC1035AmMC6 / GTGATGGTTATAAGAGGTGTTGATATATTTATAGTA1045AmMC6 / TATTGATATTGAGAAAGCGTTTGATGATGTATTGAT1055AmMC6 / TAGTTATGTAGTAGTTTGCGAAAGAGTTATAGTTAT106 / 5AmMC6 / ACTACCCTACTCTACCCTTCTAAGATATACATATAC1075AmMC6 / TG / isodG / TGA / isodG / GTT / isodG / TTG / isodG / TA / isodG / TA / isodG / TGA / isodG / TTT / isodG / TAG / isodG / GT1085[BiotinTEG] / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / L-dT / / 3AmMO / 1145amMC6 = 5' amine with a 6 carbon linker; isodG = isoguanine; 3AmMO = 3' 5[BiotinTEG] = 5' Biotin-TEG
[0208] Each of the nucleic acids comprising a lawn oligonucleotide or an adapter oligonucleotide can independently be a canonical base or a modified nucleotide or nucleic acid analogue. Typical modified nucleotides or nucleic acid analogues useful in a lawn oligonucleotide or an adapter oligonucleotide are isoguanine and isocytosine. Alternatively still, each of the nucleic acids comprising the lawn oligonucleotides can independently be L-DNA. In some aspects, a lawn oligonucleotide can comprise L-DNA. A lawn oligonucleotide can consist of L-DNA. A lawn oligonucleotide can consist essentially of L-DNA. The use of modified nucleotides or nucleotide analogues such as isoguanine and isocytosine or L-DNA, for example, can improve binding efficiency and accuracy of an adapter oligonucleotide to an appropriate complementary nucleic acid sequence within a lawn oligonucleotide while minimizing binding elsewhere.
[0209] A lawn oligonucleotide can further comprise a 5' amine with a 6 carbon linker, herein referred to as 5AmMC6. 5AmMC6 can be used to attach a lawn oligonucleotide to a substrate.
[0210] An example of a capture probe, adaptor oligonucleotide and lawn oligo complex is shown in Figure 33. In this Figure, an exemplary adapter sequence and an exemplary capture probe sequence that hybridize are in green, the sequence that is the reverse complement of an exemplary lawn oligo is in blue and the exemplary sequence in red on the capture probe hybridizes with a target gene, which in this example is the gene TP53.1. The sequence of the exemplary capture probe is 3'-CCGGTCAACCGTTTTGTAGAACAACTCCCGTCCCCTCACTCACTAGCCTCCAGTACC GAAAGC-5' (SEQ ID No: 111). The sequence of the exemplary adapter sequence is 5'-GAGTGATCGGAGGTCATGGCTTTCGAC / iMe-isodC / CTA / iMe-isodC / AAA / iMe-isodC / TCA / iMe-isodC / TA / iMe-isodC / TA / iMe-isodC / CAA / iMe-isodC / AAC / iMe-isodC / TCA / iMe-isodC / CA-3' (SEQ ID No: 110). The sequence of the sequence of the exemplary lawn oligonucleotide is TG / iisodG / GAT / iisodG / TTT / iisodG / AGT / iisodG / AT / iisodG / AT / iisodG / GTT / iisodG / TTG / iisod G / AGT / iisodG / GT / 5AmMC6 (SEQ ID NO: 108).
[0211] In some aspects, a lawn oligonucleotide can comprise at least one affinity moiety, at least two affinity moieties, at least three affinity moieties, at least four affinity moieties, at least five affinity moieties, at least six affinity moieties, at least seven affinity moieties, at least eight affinity moieties, at least nine affinity moieties or at least ten affinity moieties. The affinity moiety can be biotin. Thus, a lawn oligonucleotide can comprise at least one biotin moiety, at least two biotin moieties, at least three biotin moieties, at least four biotin moieties, at least five biotin moieties, at least six biotin moieties, at least seven biotin moieties, at least eight biotin moieties at least nine biotin moieties or at least ten biotin moieties.
[0212] In some aspects, a capture probe of the present disclosure that is hybridized to a target nucleic acid can comprise at least one first affinity moiety, such as, but not limited to, a biotin moiety. The capture probe hybridized to the target nucleic acid can then hybridize, either directly or indirectly, with at least one lawn oligonucleotide on a substrate, wherein the at least one lawn oligonucleotide comprises at least one first affinity moiety, such as, but not limited to, a biotin moiety. After hybridization of the capture probe to the lawn oligonucleotide, the resultant capture probe-target nucleic acid-lawn oligonucleotide complex can be incubated with a second affinity moiety, wherein the second affinity moiety is able to bind to the first affinity moiety located on the capture probe and the first affinity moiety located on the lawn oligonucleotide. In a non-limiting example, if the first affinity moiety located on the capture probe and the first affinity moiety located on the lawn oligonucleotide are both biotin, neutravidin can be used as a second affinity moiety. The second affinity moiety will bind to the first affinity moiety located on the capture probe and the first affinity moiety located on the lawn oligonucleotide, creating a protein bridge that is herein referred to as a "protein lock". A protein lock can be used to more stably immobilize a target nucleic acid onto a substrate. Figure 67 shows a schematic illustration of a protein lock using biotinylated capture probes and lawn oligonucleotides and neutravidin.
[0213] The target nucleic acid can be bound by one or more capture probes (i.e. two, three, four, five, six, seven, eight, nine, ten or more capture probes). A capture probe comprises a domain that is complementary to a portion of the target nucleic acid and a domain that comprises a substrate binding moiety. The portion of the target nucleic acid to which a capture probe is complementary can be an end of the target nucleic acid or not towards an end. A capture probe can comprise a cleavable moiety between a domain that is complementary to a portion of the target nucleic acid and a domain that comprises a substrate binding moiety.
[0214] Alternatively, a capture probe can comprise a first domain that is complementary to a portion of the target nucleic acid, a second domain that comprises a substrate binding moiety, and a third domain that comprises a different substrate binding moiety. A capture probe can comprise a cleavable moiety between any domains.
[0215] A capture probe can be phosphorylated at the 5' end. Alternatively, a capture probe can comprise at least one phosphorothioate bond. A capture probe can comprise at least two phosphorothioate bonds. Preferably, the at least one or the at least two phosphorothioate bonds are located at the 5' end of the capture probe.
[0216] The substrate binding moiety of the capture probe can be biotin and the substrate can be avidin (e.g., streptavidin). Useful substrates comprising avidin are commercially available including TB0200 (Accelr8), SAD6, SAD20, SAD100, SAD500, SAD2000 (Xantec), SuperAvidin (Array-It), streptavidin slide (catalog #MPC 000, Xenopore) and STREPTAVIDINnslide (catalog #439003, Greiner Bio-one). The substrate binding moiety of the capture probe can be avidin (e.g., streptavidin) and the substrate can be biotin. Useful substrates comprising biotin that are commercially available include, but are not limited to, Optiarray-biotin (Accler8), BD6, BD20, BD100, BD500 and BD2000 (Xantec).
[0217] The substrate binding moiety of the capture probe can be a reactive moiety that is capable of being bound to the substrate by photoactivation. The substrate can comprise the photoreactive moiety, or the first portion of the nanoreporter can comprise the photoreactive moiety. Some examples of photoreactive moieties include aryl azides, such as N((2-pyridyldithio)ethyl)-4-azidosalicylamide; fluorinated aryl azides, such as 4-azido-2,3,5,6-tetrafluorobenzoic acid; benzophenone-based reagents, such as the succinimidyl ester of 4-benzoylbenzoic acid; and 5-Bromo-deoxyuridine.
[0218] The substrate binding moiety of a capture probe can be a nucleic acid that can hybridize to a binding moiety of a substrate that is complementary. Each of the nucleic acids comprising a substrate binding moiety of a capture probe can independently be a canonical base or a modified nucleotide or nucleic acid analogue. At least one, at least two, at least three, at least four, at least five, or at least six nucleotides in the substrate binding moiety of a capture probe can be modified nucleotides or nucleotide analogues. Typical ratios of modified nucleotides or nucleotide analogues to canonical bases in a substrate binding moiety of a capture probe are 1:2 to 1:8. Typical modified nucleotides or nucleic acid analogues useful in a substrate binding moiety of a capture probe are isoguanine and isocytosine.
[0219] The substrate binding moiety of the capture probe can be immobilized to the substrate via other binding pairs apparent to those of skill in the art. After binding to the substrate, the target nucleic acid can be elongated by applying a force (e.g., gravity, hydrodynamic force, electromagnetic force "electrostretching", flow-stretching, a receding meniscus technique, and combinations thereof) sufficient to extend the target nucleic acid. A capture probe can comprise or be associated with a detectable label, i.e., a fiducial spot.
[0220] The target nucleic acid can be bound by a second capture probe which comprises a domain that is complementary to a second portion of the target nucleic acid. The second portion of the target nucleic acid bound by the second capture probe is different than the first portion of the target nucleic acid bound by the first capture probe. The portion can be an end of the target nucleic acid or not towards an end. Binding of a second capture probe can occur after or during elongation of the target nucleic acid or to a target nucleic acid that has not been elongated. The second capture probe can have a binding as described above.
[0221] The target nucleic acid can be bound by a third, fourth, fifth, sixth, seventh, eighth, ninth or tenth capture probe which comprises a domain that is complementary to a third, fourth, fifth, sixth, seventh, eighth, ninth or tenth portion of the target nucleic acid. The portion can be an end of the target nucleic acid or not towards an end. Binding of a third, fourth, fifth, sixth, seventh, eighth, ninth or tenth capture probe can occur after or during elongation of the target nucleic acid or to a target nucleic acid that has not been elongated. The third, fourth, fifth, sixth, seventh, eighth, ninth or tenth capture probe can have a binding as described above.
[0222] The capture probe is capable of isolating a target nucleic acid from a sample. Here, a capture probe is added to a sample comprising the target nucleic acid. The capture probe binds the target nucleic acid via the region of the capture probe that his complementary to a region of the target nucleic acid. When the target nucleic acid contacts a substrate comprising a moiety that binds the capture probe's substrate binding moiety, the nucleic acid becomes immobilized onto the substrate.
[0223] Figure 8 shows the capture of a target nucleic acid using a two capture probe system of the present disclosure. Genomic DNA is denatured at 95°C and hybridized to a pool of capture reagents. This pool of capture reagents comprise the oligonucleotides Probe A, Probe B, and anti-sense block probes. Probe A comprises a biotin moiety at the 3' end of the probe and a sequence that is complementary to the 5' end of the target nucleic acid. Probe B comprises a purification binding sequence that can be bound by paramagnetic beads at the 5' end of the probe and a nucleotide sequence that is complementary to the 3' end of the target nucleic acid. The anti-sense block probe comprises a nucleotide sequence that is complementary to the anti-sense strand of the portion of the target nucleic acid that is to be sequenced. After hybridization with the capture reagents, a sequencing window is created on the target nucleic acid between the hybridized Probe A and Probe B. The target nucleic acid is purified using paramagnetic beads that bind to the 5' sequence of Probe B. Any excess capture reagents or complementary anti-sense DNA strands are washed away, resulting in the purification of the intended target nucleic acid. The purified target nucleic acid is then flowed through a flow chamber that includes a surface that can bind to the biotin moiety on the hybridized Probe A, such as streptavidin. This results in the tethering of one end of the target nucleic acid to the surface of the flow cell. To capture the other end, the target nucleic acid is flow-stretched and a biotinylated probe complementary to the purification binding sequence of Probe B is added. Upon hybridizing to the purification binding sequence of Probe B, the biotinylated probe can bind to the surface of the flow cell, resulting in a captured target nucleic acid molecule that is elongated and bound to the flow cell surface at both ends.
[0224] To ensure that a user "captures" as many target nucleic acid molecules as possible from high fragmented samples, it is helpful to include a plurality of capture probes, each complementary to a different region of the target nucleic acid. For example, there can be three pools of capture probes, with a first pool complementary to regions of the target nucleic acid near its 5' end, a second pool complementary to regions in the middle of the target nucleic acid, and a third pool near its 3' end. This can be generalized to "n-regions-of-interest" per target nucleic acid. In this example, each individual pool of fragmented target nucleic acid bound to a capture probe comprising or bound to a biotin tag. 1 / nth of input sample (where n = the number of distinct regions in target nucleic acid) is isolated for each pool chamber. The capture probe binds the target nucleic acid of interest. Then the target nucleic acid is immobilized, via the capture probe's biotin, to an avidin molecule adhered to the substrate. Optionally, the target nucleic acid is stretched, e.g., via flow or electrostatic force. All n-pools can be stretched-and-bound simultaneously, or, in order to maximize the number of fully stretched molecules, pool 1 (which captures most 5' region) can be stretched and bound first; then pool 2, (which captures the middle-of-target region) is then can be stretched and bound; finally, pool 3 is can be stretched and bound.
[0225] A target nucleic acid can be captured using a "two bead-based step purification" system of the present disclosure. There are four capture probes, Probe A, Probe B, Probe C and Probe D. Probe A comprises an OA-sequence, a nucleic acid sequence that is complementary to the 5' end of the target nucleic acid, and a nucleic acid sequence attached to a biotin moiety. An OA-sequence can comprise the nucleotide sequence CGAAAGCCATGACCTCCGATCACTC (SEQ ID NO: 109) and can bind to a lawn oligonucleotide. The nucleic acid sequence attached to the biotin moiety is connected to the nucleic acid sequence that is complementary to the 5' end of the target nucleic acid via a cleavable linker. Probe B and Probe C comprise a nucleic acid sequence that is complementary to the target nucleic acid and a nucleic acid sequence attached to a biotin moiety. The nucleic acid sequence that is attached to the biotin moiety is connected to the nucleic acid sequence that is complementary to the target nucleic acid via a cleavable linker. Probe D comprises a nucleic acid sequence complementary to the 3' end of the target nucleic acid, a purification binding sequence called a G-sequence, and a biotin moiety. The biotin moiety is connected to the G-sequence via a cleavable linker. The four capture probes are first hybridized to the target nucleic acid. All of the probes hybridize at non-overlapping positions along the target nucleic acid, with Probe B and Probe C hybridizing between Probe A and Probe D. The target nucleic acid is then purified using streptavidin paramagnetic beads that bind to the biotin moieties on the capture probes. Excess, non-target genomic DNA is washed away from the beads. The target nucleic acid-capture probe complexes are then released from the streptavidin magnetic beads by cleavage of the cleavable linkers within each capture probe. The target nucleic acid-capture probe complexes are further purified using paramagnetic beads that bind to the purification G-sequence on probe D. Excess capture probes are washed away and the target nucleic acid-capture probe complexes are eluted from the paramagnetic beads.
[0226] A target nucleic acid can be captured using a "one bead-based step purification with lambda exonuclease" system of the present disclosure. There are four capture probes, Probe A, Probe B, Probe C and Probe D. Probe A comprises a sequence that is complementary to the 5' end of the target nucleic acid sequence. The 5' end of Probe A comprises two phosphorothioate bonds. Probe B, Probe C and Probe D comprise a nucleic acid sequence attached to a biotin moiety at the 3' end of the probes and a nucleic acid sequence that is complementary to the target nucleic acid at the 5' end of the probes. The 5' ends of Probe B, Probe C and Probe D are phosphorylated. Probe A, Probe B, Probe C and Probe D hybridize at non-overlapping positions along the target nucleic acid. After hybridization of the probes to the target nucleic acid, the target nucleic acid is purified using streptavidin paramagnetic beads. Excess gDNA and capture probes are washed away. The target nucleic acid-capture probe complex is eluted from the beads. Then Probe B, Probe C and Probe D are digested using lambda exonuclease, which preferentially degrades double-stranded DNA that is phosphorylated at the 5' end.
[0227] A target nucleic acid can be captured using a "one bead-based step purification with FEN1" system of the present disclosure. There are four capture probes, Probe A, Probe B, Probe C and Probe D. Probe A comprises a 3' nucleic acid sequence that does not hybridize to the target nucleic acid, a nucleic acid sequence that is complementary to the 5' end of the nucleic acid, and a 5' nucleic acid sequence that does not hybridize to the target nucleic acid and that comprises a biotin moiety. Probe B and Probe C comprise a 3' nucleic acid sequence that does not hybridize to the target nucleic acid, a nucleic acid sequence that is complementary to the target nucleic acid, and a 5' nucleic acid sequence that does not hybridize to the target nucleic acid and that comprises a biotin moiety. Probe D comprises a 3' sequence that does not hybridize to the target nucleic acid and a 5' sequence that is complementary to the target nucleic acid. Probe A, Probe B, Probe C and Probe D hybridize to the target nucleic acid such that Probe A is adjacent to Probe B such that the 5' nucleic acid sequence that does not hybridize to the target nucleic acid sequence and that comprises a biotin moiety on Probe A and the 3' nucleic acid sequence that does not hybridize to the target nucleic acid on Probe B form a branched double stranded DNA substrate with a 5' DNA flap, and Probe B is adjacent to Probe C such that the 5' nucleic acid sequence that does not hybridize to the target nucleic acid sequence and that comprises a biotin moiety on Probe B and the 3' nucleic acid sequence that does not hybridize to the target nucleic acid on Probe C form a branched double stranded DNA substrate with a 5' DNA flap, and Probe C is adjacent to Probe D such that the 5' nucleic acid sequence that does not hybridize to the target nucleic acid sequence and that comprises a biotin moiety on Probe C and the 3' nucleic acid sequence that does not hybridize to the target nucleic acid on Probe D form a branched double stranded DNA substrate with a 5' DNA flap. After hybridization of the probes to the target nucleic acid sequence, the target nucleic acid is purified using streptavidin paramagnetic beads. Excess genomic DNA and excess probes are washed away from the beads. The target nucleic acid is eluted from the beads by incubating with Thermostable Flap Endonuclease 1 (FEN1). FEN1 cleaves the 5' DNA flaps, thereby separating the biotin moieties from the hybridized capture probes, releasing the target nucleic acid-capture probe complex.
[0228] The present disclosure also allows a user to capture and concurrently sequence a plurality of target nucleic acids, a plurality of capture probes can be hybridized to a mixed sample of target nucleic acids. A plurality of target nucleic acids can include a group of more than one nucleic acid, in which each nucleic acid contains the same sequence, or a group of more than one nucleic acid, in which each nucleic acid does not necessarily contain the same sequence. Likewise, the plurality of capture probes can include either a group of more than one capture probe that are identical in sequence, or a group of more than one capture probe that are not necessarily identical in sequence. For example, using a plurality of capture probes that all contain the same sequence can allow the user to capture a plurality of target nucleic acids that all contain the same sequence. By sequencing this plurality of target nucleic acids containing the same sequence, a higher level of sequencing accuracy can be achieved due to data redundancy. In another example, two or more specific genes of interest can be captured and sequenced concurrently using a group of capture probes that includes capture probes complementary to each gene of interest. This allows the user to perform multiplexed sequencing of specific genes. Figure 9 shows the results from an experiment using the present methods to capture and detect a multiplex cancer panel, composed of 100 targets, using a FFPE sample.
[0229] A capture probe can also comprise a domain that binds (e.g. hybridizes) to a "multiplexing oligo". A multiplexing oligo can comprise at least three domains. The first domain can comprise a nucleic acid sequence that hybridizes to a capture probe. The second domain can comprise a unique nucleic acid sequence that identifies a sample. The third domain can comprise a substrate binding moiety. A plurality of multiplexing oligos can be used in combination with capture probes of the present disclosure to concurrently sequence a plurality of target nucleic acids from at least two samples. Multiplexing oligos can be used to concurrently sequence a plurality of target nucleic acids from at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 100 or at least 1000 samples.
[0230] An example of the use of multiplexing oligos to concurrently sequence three target nucleic acid molecules from three samples is as follows: a target nucleic acid from each of the three samples (Sample 1, Sample 2 and Sample 3) is hybridized to two capture probes, Probe A and Probe B. Probe A comprises two domains. The first domain comprises a substrate binding moiety. The second domain comprises a sequence complementary to the 5' end of the target nucleic acid. Probe B comprises two domains. The first domain comprises a sequence complementary to the 3' end of the target nucleic acid. The second domain comprises a sequence complementary to a multiplex oligo. After the two capture probes are hybridized to the target nucleic acid, the second domain of Probe B is hybridized to a multiplex oligo. The multiplex oligo comprises three domains. The first domain comprises a sequence complementary to the second domain of Probe B. The second domain comprises a unique nucleic acid sequence that identifies the sample. The third domain comprises a substrate binding moiety. After hybridization of the multiplexing oligo, an endonuclease cleavage step is performed to remove any overhanging DNA on the target nucleic acid such that Probe A is hybridized to the 5' end of the target nucleic acid and Probe B is hybridized to the 3' end of the target nucleic acid. After endonuclease treatment, the multiplexing oligo is ligated to the 3' end of the target nucleic acid and Probe B is then removed. The target nucleic acid-Probe A complex is further purified and subsequently sequenced. Since each target nucleic acid from each sample is ligated to a multiplexing oligo, the sample from which the target nucleic acid was derived can be identified by sequencing the multiplexing oligo.
[0231] When complete sequencing coverage is desired, the number of distinct capture probes required is inversely related to the size of target nucleic acid fragment. In other word, more capture probes will be required for a highly-fragmented target nucleic acid. For sample types with highly fragmented and degraded target nucleic acids (e.g., Formalin-Fixed Paraffin Embedded Tissue) it can be useful to include multiple pools of capture probes. On the other hand, for samples with long target nucleic acid fragments, e.g., in vitro obtained isolated nucleic acids, a single capture probe at a 5' end can be sufficient.
[0232] The region of the target nucleic acid between two capture probes or after one capture probe and before a terminus of the target nucleic acid is referred herein as a "sequencing window". The sequencing window created when two capture probes are used to capture a target nucleic acid is labeled in Figure 8. The sequencing window is a portion of the target nucleic acid that is available to be bound by a sequencing probe. The minimum sequencing window is a target binding domain length (e.g., 4 to 10 nucleotides) and a maximum sequencing window is the majority of a whole chromosome.
[0233] When large target nucleic acid molecules are sequenced using the present methods, a "blocker oligo" or a plurality of blocker oligos can be hybridized along the length of the target nucleic acid to control the size of the sequencing window. Blocker oligos hybridize to the target nucleic acid at specific locations, thereby preventing the binding of sequencing probes at those locations, creating smaller sequencing windows of interest. By creating smaller sequencing windows, the sequencing reactions is confined to specific regions of interest on the target DNA molecule, increasing the speed and accuracy of sequencing. The use of blocker oligos is particularly useful when sequencing particular mutations at known locations within a target nucleic acid, as the entire target nucleic acid does not need to be sequenced. In a non-limiting example, the methods of the present disclosure can be used for the targeted sequencing of two heterozygous sites to distinguish between two different haplotypes.
[0234] A capture probe can comprise a nucleic acid molecule complex. A nucleic acid molecule complex can comprise a partially double-stranded nucleic acid molecule. In some aspects, a partially double-stranded nucleic acid molecule can comprise a target specific domain, a duplex domain, a single-stranded purification sequence, a cleavable moiety, a single-stranded overhang domain, a sample specific domain, a substrate specific domain or any combination thereof.
[0235] In some aspects, any one strand of a partially double-stranded nucleic acid molecule can comprise about 40 to about 150 nucleotides, or about 60 to about 135 nucleotides, or about 10 to about 90 nucleotides, or about 25 to about 75 nucleotides, or about 60 nucleotides, or about 50 to about 100 nucleotides.
[0236] In some aspects, any one strand of a partially double-stranded nucleic acid molecule can comprise at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten affinity moieties.
[0237] In some aspects, any one strand of a partially double-stranded nucleic acid molecule can comprise at least one cross-linking moiety. A cross-linking moiety can be a chemical cross-linking moiety or a photoreactive cross-linking moiety.
[0238] A capture probe can comprise a single-stranded nucleic acid molecule. In aspects, a single-stranded nucleic acid molecule can comprise a target specific domain, a duplex domain, a single-stranded purification sequence, a cleavable moiety, a single-stranded overhang domain, a sample specific domain, a substrate specific domain or any combination thereof.
[0239] A target specific domain, a duplex domain, a single-stranded purification sequence, a cleavable moiety, a single-stranded overhang domain, a sample specific domain or a substrate specific domain can comprise at least one natural base or comprise no natural bases. In some aspects, a target specific domain, a duplex domain, a single-stranded purification sequence, a cleavable moiety, a single-stranded overhang domain, a sample specific domain or a substrate specific domain can comprise at least one modified nucleotide or nucleic acid analog or comprise no modified nucleotides
[0240] A target specific domain, a duplex domain, a single-stranded purification sequence, a cleavable moiety, a single-stranded overhang domain, a sample specific domain or a substrate specific domain can comprise any combination of natural bases (e.g. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more natural bases) and modified nucleotides or nucleic acid analogs (e.g. 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified When present in a combination, the natural bases and modified nucleotides or nucleic acid analogs can be arranged in any order.
[0241] A target specific domain can comprise a nucleic acid sequence that is complementary to a portion of a target nucleic acid molecule and that hybridizes to a target nucleic acid molecule. In some aspects, a target specific domain can comprise about 10 to about 150 nucleotides, or about 25 to about 100 nucleotides, or about 35 to about 100 nucleotides, or about 25 to about 125 nucleotides, or about 15 to about 100 nucleotides.
[0242] In some aspects, a target specific domain can hybridize within at least about 100 base pairs of the 3' end of a target nucleic acid molecule. In some aspects, a target specific domain can hybridize within at least about 100 of the 5' end of a target nucleic acid molecule.
[0243] A duplex domain can comprise a nucleic acid sequence that is capable of annealing to another nucleic acid strand to form a partially or fully double-stranded nucleic acid molecule. In some aspects, a duplex domain can comprise about 14 to about 45 nucleotides, or about 25 to about 35 nucleotide, or about 30 nucleotides, or about 10 to about 60 nucleotides, or about 30 to about 50 nucleotides
[0244] A single-stranded purification sequence can comprise a nucleic acid sequence suitable for use in purification. A single-stranded purification sequence can comprise an F tag. A single-stranded purification can comprise an F-like tag. A single stranded purification sequence can comprise the nucleotide sequence AACATCACACAGACC (SEQ ID NO: 112). A single stranded purification sequence can comprise the nucleotide sequence GTCTATCATCACAGC (SEQ ID NO: 113).
[0245] A single-stranded purification sequence can comprise at least one affinity moiety, or at least two affinity moieties, or at least three affinity moieties, or at least four affinities, or at least five affinity moieties, or at least six affinity moieties, or at least seven affinity moieties, or at least eight affinity moieties, or at least nine affinity moieties or at least ten affinity moieties. The affinity moiety can be biotin. Thus, in some aspects, a single-stranded purification sequence can comprise at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine or at least ten biotin moieties.
[0246] A single stranded purification sequence can comprise at least 50 nucleotides, or about 15 to about 50 nucleotides.
[0247] A cleavable moiety can comprise an enzymatically cleavable moiety. An enzymatically cleavable can comprise a USER sequence for cleavage by the USER enzyme. Alternatively, a cleavable moiety can comprise a photo-cleavable moiety.
[0248] A single-stranded overhang domain can comprise a single-stranded nucleic acid sequence that is capable of forming together with a target nucleic acid molecule a 5'-overhanging flap structure.
[0249] A sample specific domain can comprise a nucleic acid sequence that identifies the biological sample from which the target nucleic acid molecule was obtained. A sample specific domain can comprise L-DNA. A sample specific domain can comprise D-DNA. A sample specific domain can comprise a combination of L-DNA and D-DNA. A sample specific domain can hybridize to any probe of the present disclosure. A sample specific domain can comprises about 28 nucleotides.
[0250] In some aspects, a sample specific domain can comprise at least one attachment position or at least two attachment positions. In the aspects wherein a sample specific domain comprises at least one attachment position or at least two attachment positions, an attachment position can comprise about 14 nucleotides, or about 10 nucleotides, or about 8 nucleotides.
[0251] A substrate specific domain can comprise a nucleic acid sequence that hybridizes to a complementary nucleic acid molecule attached to a substrate. The substrate can be an array. A substrate specific domain can comprise a nucleic acid sequence that hybridizes to a lawn oligonucleotide.
[0252] A substrate specific domain can comprise a poly-A sequence. A substrate specific domain can comprise a poly-T sequence. A substrate specific domain can comprise an L-poly-A sequence, wherein the nucleotides of the poly A sequence are L-DNA. A substrate specific domain can comprise an L-poly-T sequence, wherein the nucleotides of the poly T sequence are L-DNA. A substrate specific domain can comprise L-DNA. A substrate specific domain can comprise about 30 nucleotides.
[0253] Figure 34 shows a schematic illustration of an exemplary capture probe comprising a nucleic acid molecule complex called a "c5 probe complex" bound to a target nucleic acid. The c5 probe complex comprises a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule comprises a target specific domain hybridized to the target nucleic acid, a duplex domain that is annealed to the other strand of the partially double-stranded nucleic acid molecule, a first single-stranded purification sequence and a cleavable moiety located between the target specific domain and the duplex domain. In this non-limiting example, the single-stranded purification sequence comprises an F-like tag and the cleavable moiety comprises an enzymatically cleavable USER sequence. The other strand of the partially double-stranded nucleic acid molecule comprises a duplex domain that is annealed to the other strand of the partially double-stranded nucleic acid molecule and a single-stranded overhang domain. In this non-limiting example, the single-stranded overhang domain and the target nucleic acid molecule form a 5'-overhanging flap structure.
[0254] Figure 34 also shows a schematic illustration of an exemplary capture probe comprising a nucleic acid molecule complex called a "c3 probe complex" bound to a target nucleic acid. The c3 probe complex comprises a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule comprises a target specific domain hybridized to the target nucleic acid, a duplex domain that is annealed to the other strand of the partially double-stranded nucleic acid molecule and a cleavable moiety located between the target specific domain and the duplex domain. In this non-limiting example, the cleavable moiety comprises an enzymatically cleavable USER sequence. The other strand of the partially double-stranded nucleic acid molecule comprises a duplex domain that is annealed to the other strand of the partially double-stranded nucleic acid molecule, a sample specific domain, a substrate specific domain, a single-stranded purification sequence and a cleavable moiety located between the single-stranded purification sequence and the substrate specific domain. In this non-limiting example, the sample specific domain comprises L-DNA, the substrate specific domain comprises L-DNA, the single-stranded purification sequence comprises an F tag and the cleavable moiety is a photo-cleavable moiety.
[0255] Figure 41 shows a schematic illustration of an exemplary capture probe comprising a nucleic acid molecule complex called a "c3.2 probe complex" bound to a target nucleic acid molecule. The c3.2 probe complex comprises a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule comprises a target specific domain hybridized to the target nucleic acid and a duplex domain that is annealed to the other strand of the partially double-stranded nucleic acid molecule. In some aspects, this strand can optionally comprise at least one first affinity moiety. In some aspects, this strand can optionally comprise a cleavable moiety located between the target specific domain and the duplex domain. The other strand of the partially double-stranded nucleic acid molecule comprises a duplex domain that is annealed to the other strand of the partially double-stranded nucleic acid molecule and a substrate specific domain. In some aspects, this strand can optionally comprise at least one, or at least two, or at least three second affinity moieties.
[0256] Figure 41 also shows a schematic illustration of an exemplary capture probe comprising a nucleic acid molecule complex call the "c5.2 probe complex" bound to a target nucleic acid molecule. The c5.2 probe complex comprises a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule comprises a target specific domain hybridized to the target nucleic acid, a duplex domain that is annealed to the other strand of the partially double-stranded nucleic acid molecule. In some aspects, this strand can optionally comprise cleavable moiety located between the target specific domain and the duplex domain. The other strand of the partially double-stranded nucleic acid molecule comprises a duplex domain that is annealed to the other strand of the partially double-stranded nucleic acid molecule, a sample specific domain and a first single-stranded purification sequence, a first cleavable moiety located between the duplex domain and the sample specific domain and a second cleavable moiety located between the sample specific domain and the first single-stranded purification sequence. In some aspects, the first single-stranded purification sequence can comprise at least one affinity moiety, for example, at least one biotin moiety. In some aspects, the first single-stranded purification sequence can be replaced with at least one biotin moiety, such that the other strand of the partially double-stranded nucleic acid molecule comprises a duplex domain that is annealed to the other strand of the partially double-stranded nucleic acid molecule, a sample specific domain, at least one biotin moiety, a first cleavable moiety located between the duplex domain and the sample specific domain and a second cleavable moiety located between the sample specific domain and the at least one biotin moiety.
[0257] Sample preparation methods of the present disclosure (not claimed)
[0258] In a related instance provided for illustrative purposes, there is provided methods of sample preparation comprising immobilizing a target nucleic acid molecule to a substrate.
[0259] Sample preparation methods can comprise a CRISPR-based fragmentation step (see, e.g., Baker and Mueller, "CRISPR-mediated isolation of specific megabase segments of genomic DNA", Nucleic Acids Research 2017, 45(19), e165; Tsai et al., "Amplification-free, CRISPR-Cas9 targeted enrichment and SMRT sequencing of repeat-expansion disease causative genomic regions", bioRxiv 203919; doi: https: / / do1.org / 10.1101 / 203919; Nachmanson et al., "Targeted genome fragmentation with CRISPR / Cas9 improves hybridization capture, reduces PCR bias, and enables efficient high-accuracy sequencing of small targets", bioRxiv 207027; doi: https: / / doi.org / 10.1101 / 207027). CRISPR fragmentation can comprise in vitro fragmenting genomic DNA (gDNA) obtained from a biological sample by cleaving proximal to protospacer adjacent motif (PAM) sites located within gDNA. A PAM site can comprise the nucleotide sequence NGG, wherein N is any nucleobase. Alternatively, a PAM site can comprise the nucleotide sequence NGA, wherein N is any nucleobase. The fragments produced by CRISPR-based fragmentation can be purified using biotinylated CRISPR-complexes or with an anti-CAS9 antibody
[0260] A method for capturing a target nucleic acid can comprise (1) fragmenting gDNA using a CRISPR-based fragmentation step; (2) contacting the fragmented gDNA with at least two capture probes, wherein at least one of the at least two capture probes is a c5 probe complex as described above, and at least one of the at least two capture probes is a c3 probe complex as described above, such that a c3 probe complex and a c5 probe complex hybridize to a target nucleic acid to form the complex shown in Figure 34; (3) removing the 5'-overhanging flap structure by contacting the composition with FEN1; (4) ligating the 3' end of the target nucleic acid to the 5' end of the strand of the c3 probe complex that comprises the substrate specific domain; (5) binding the single-stranded purification sequence of the c5 probe complex to a first substrate; (6) cleaving the cleavable moieties located between the duplex domain and the target specific domain of each of the c3 and c5 probe complexes; (7) binding the single-stranded purification sequence of the c3 probe complex to a second substrate; (8) cleaving the cleavable moiety located between the single-stranded purification sequence and the substrate specific domain of the ligated c3 probe complex; and (9) hybridizing the substrate specific domain to a complementary nucleic acid molecule attached to a third substrate.
[0261] In some aspects of the preceding method, step (9) can be performed before step (8).
[0262] In some aspects of the preceding method, steps (3) and (4) can be performed concurrently. In some aspects of the preceding method, steps (3) and (4) can be performed simultaneously.
[0263] In some aspects, the preceding method can optionally include a step in between steps (6) and (7), wherein target nucleic acid-capture probe complexes derived from different biological samples are pooled together. In this aspect, the target nucleic acid-capture probe complexes derived from different samples will comprise c3 probe complexes comprising unique sample specific domains, such that the target specific domain identifies the biological sample from which each target nucleic acid was obtained.
[0264] An example of a sample preparation method of the present disclosure is shown in Figures 34-40. In this non-limiting example, gDNA obtained from a biological sample is first fragmented using CRISPR-based fragmentation. After fragmentation, a target nucleic acid is hybridized to two capture probes as shown in Figure 34. In this non-limiting example, the two capture probes are a c3 probe complex and a c5 probe complex, as described above. The c3 probe complex and the c5 probe complex hybridize to the target nucleic acid at non-overlapping locations along the target nucleic acid. The c3 probe complex hybridizes to the target nucleic acid via the target specific domain within no more than 8 nucleotides of the 3' end of the target nucleic acid such and the c5 probe complex hybridizes to the target nucleic acid via the target specific domain such that the c5 probe complex hybridized 5' to the c3 probe complex. The single-stranded overhang domain of the c5 probe complex and the target nucleic acid molecule form a 5'-overhanging flap structure. After hybridization of the two capture probes, the target nucleic acid-capture probe complex is incubated with FEN1 and ligase. The FEN1 removes the 5'-overhanging flap structure and the 3' end of the target nucleic acid is ligated to the strand of the c3 probe complex that comprises the substrate specific domain by the ligase, as shown in Figure 35. The resultant complex, shown in Figure 36 is bound to the F-like beads that hybridize to the F-like tag present in the c5 probe complex. The beads are washed and USER enzyme is added. The USER enzyme cleaves the cleavable moieties located between the target specific domains and the duplex domains of both the c3 probe complex and the c5 probe complex, thereby releasing the target nucleic acid from the F-like beads, as shown in Figure 37. The eluted complex, as shown in Figure 38 is further purified using SPRI beads to. The purified complex is then bound to F-beads that hybridize to the F tag present in the c3 probe complex. After washing, the target nucleic acid is eluted from the F-beads by exposing the beads to UV light, thereby cleaving the photocleavable moiety in the c3 probe complex located between the substrate specific domain and the F tag, as shown in Figure 39. The resultant complex is then bound to a substrate by hybridizing the substrate specific domain of ligated c3 probe complex to a complementary nucleic acid attached to the substrate, as shown in Figure 40.
[0265] An example of another sample preparation method of the present disclosure is shown in Figures 41-46. In this non-limiting example, gDNA obtained from a biological sample is first fragmented, for example, by CRISPR-based fragmentation. After fragmentation, a target nucleic acid is hybridized to two capture probes as shown in Figure 41. In this non-limiting example, the two capture probes are a c3.2 probe complex and a c5.2 probe complex, as described above. The c3 probe complex and the c5 probe complex hybridize to the target nucleic acid at non-overlapping locations along the target nucleic acid. The c5.2 probe complex hybridizes to the target nucleic acid via the target specific domain such that the c5.2 probe complex hybridizes 5' to the c3.2 probe complex. After hybridization of the two capture probes, the target nucleic acid is ligated to the one strand of the c3.2 probe complex and one strand of the c5.2 complex, as shown in Figure 42. The ligation can comprise enzymatic ligation, autoligation, chemical ligation or any combination thereof. In aspects comprising enzymatic ligation, the enzymatic ligation can be performed using a high fidelity, template-directed nick ligase. The resultant complex, shown in Figure 42, can then be bound to beads comprising at least one oligonucleotide that hybridizes to the single-stranded purification sequence. The beads can be washed and the cleavable moiety located between the sample specific domain and the single-stranded purification sequence can be cleaved, thereby releasing the target nucleic acid from the beads, as shown in Figure 43. The resultant complex can then be immobilized onto a substrate by hybridizing the substrate specific domain to an oligonucleotide attached to the substrate as shown in Figure 44. The substrate / oligonucleotide complex can be any array of the present disclosure.
[0266] The preceding method can further comprise hybridizing at least one reporter probe to the sample specific domain, wherein the reporter probe comprises a first detectable label and a second detectable label. The first and the second detectable label can then be identified, thereby identifying the sample from which the target nucleic acid originated based on the identity of the first detectable label and the second detectable label.
[0267] Alternatively, the preceding method can further comprising hybridizing a first reporter probe to the sample specific domain, wherein the reporter probe comprises a first detectable label and a second detectable label. The first and the second detectable label can then be identified. The first detectable label and the second detectable label can then be removed, and a second reporter probe comprising a third detectable label and a fourth detectable label can be hybridized to the sample specific domain. The third detectable label and the fourth detectable label can then be identified, thereby identifying the sample from which the target nucleic acid originated based on the identity of the first detectable label, the second detectable label, the third detectable label and the fourth detectable label.
[0268] After identifying the sample from which the target nucleic acid originated, the cleavable moiety located between the sample specific domain and the duplex domain can be cleaved, as shown in Figure 45, thereby releasing the sample specific domain.Methods of the Present Disclosure
[0269] The invention provides a method for identifying the presence of a predetermined nucleotide sequence in a target nucleic acid as recited by the claims.
[0270] In a related instance provided for illustrative purposes, the sequencing method of the present disclosure comprises reversibly hybridizing at least one sequencing probe disclosed herein to a target nucleic acid.
[0271] A method for sequencing a nucleic acid can comprise (1) hybridizing a sequencing probe described herein to a target nucleic acid. The target nucleic acid can optionally be immobilized to a substrate at one or more positions. An exemplary sequencing probe can comprise a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs recited in Table 1. An exemplary target binding domain comprises at least eight nucleotides hybridized to the target nucleic acid, wherein at least six nucleotides in the target binding domain can identify a corresponding nucleotide in the target nucleic acid molecule (for example, those six nucleotides identify the complementary six nucleotides with the target molecule to which it is hybridized) and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule (for example, those at least two nucleotides do not identify the complementary two nucleotides with the target molecule to which it is hybridized); wherein any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogues; and wherein the at least two nucleotides in the target binding domain that do not identify a corresponding nucleotide in the target nucleic acid molecule can be any of the four canonical bases that is not specific to the target dictated by the at least six nucleotides in the target binding domain or universal bases or degenerate bases. An exemplary barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence capable of being bound by a complementary nucleic acid molecule, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain and each of the at least three attachment positions have a different nucleic acid sequence, and wherein the nucleic acid sequence of each position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that is bound by the target binding domain.
[0272] In other aspects, an exemplary target binding domain can comprise at least six nucleotides hybridized to the target nucleic acid, wherein the at least six nucleotides in the target binding domain can identify a corresponding nucleotide in the target nucleic acid molecule (for example, when the target binding domain sequence is exactly six nucleotides, those six nucleotides identify the complementary six nucleotides with the target molecule to which it is hybridized); wherein none of the at least six nucleotides or any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogues.
[0273] Following hybridizing of a sequencing probe to the target nucleic acid, the method comprises (2) binding a first complementary nucleic acid molecule comprising a first detectable label and an at least second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (3) detecting the first and at least second detectable label of the bound first complementary nucleic acid molecule; (4) identifying the position and identity of at least two nucleotides in the immobilized target nucleic acid. For example, when the first complementary nucleic acid molecule comprises two detectable labels, the two detectable labels identify the at least two nucleotides in the immobilized target nucleic acid.
[0274] Following detection of the at least two detectable labels, removing the at least two detectable labels from the first complementary nucleic acid molecule. Thus, the method further comprises (5) binding to the first attachment position a first hybridizing nucleic acid molecule lacking a detectable label, thereby unbinding the first complementary nucleic acid molecule comprising the detectable labels, or contacting the first complementary nucleic acid molecule comprising the detectable labels with a force sufficient to release the first detectable label and at least second detectable label. Thus, following step (5) no detectable labels are bound to the first attachment positions. The method further comprises (6) binding a second complementary nucleic acid molecule comprising a third detectable label and an at least fourth detectable to a second attachment position of the at least three attachment positions of the barcode domain; (7) detecting the third and at least fourth detectable label of the bound second complementary nucleic acid molecule; (8) identifying the position and identity of at least two nucleotides in the optionally immobilized target nucleic acid; (9) repeating steps (5) to (8) until each attachment position of the at least three attachment positions in the barcode domain have been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected, thereby identifying the linear order of at least six nucleotides for at least a first region of the immobilized target nucleic acid that was hybridized by the target binding domain of the sequencing probe; and (10) removing the sequencing probe from the optionally immobilized target nucleic acid.
[0275] The method can further comprise (11) hybridizing a second sequencing probe to a target nucleic acid that is optionally immobilized to a substrate at one or more positions, and wherein the target binding domain of the first sequencing probe and the second sequencing probe are different; (12) binding a first complementary nucleic acid molecule comprising a first detectable label and an at least second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (13) detecting the first and at least second detectable label of the bound first complementary nucleic acid molecule; (14) identifying the position and identity of at least two nucleotides in the optionally immobilized target nucleic acid; (15) binding to the first attachment position a first hybridizing nucleic acid molecule lacking a detectable label, thereby unbinding the first complementary nucleic acid molecule or complex comprising the detectable labels, or contacting the first complementary nucleic acid molecule or complex comprising the detectable labels with a force sufficient to release the first detectable label and at least second detectable label; (16) binding a second complementary nucleic acid molecule comprising a third detectable label and an at least fourth detectable label to a second attachment position of the at least three attachment positions of the barcode domain; (17) detecting the third and at least fourth detectable label of the bound second complementary nucleic acid molecule; (18) identifying the position and identity of at least two nucleotides in the immobilized target nucleic acid; (19) repeating steps (15) to (18) until each attachment position of the at least three attachment positions in the barcode domain have been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected, thereby identifying the linear order of at least six nucleotides for at least a second region of the immobilized target nucleic acid that was hybridized by the target binding domain of the second sequencing probe; and (20) removing the second sequencing probe from the optionally immobilized target nucleic acid.
[0276] The method can further comprise assembling each identified linear order of nucleotides in the at least first region and at least second region of the immobilized target nucleic acid, thereby identifying a sequence for the immobilized target nucleic acid.
[0277] Steps (5) and (6) can occur sequentially or concurrently. The first and at least second detectable labels can have the same emission spectrum or can have different emission spectra. The third and at least fourth detectable labels can have the same emission spectrum or can have different emission spectra.
[0278] The first complementary nucleic acid molecule can comprise a cleavable linker. The second complementary nucleic acid molecule can comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule can each comprise a cleavable linker. Preferably, the cleavable linker is photo-cleavable. The release force can be light. Preferably, UV light. The light can be provided by a light source selected from the group consisting of an arc-lamp, a laser, a focused UV light source, and light emitting diode.
[0279] The first complementary nucleic acid molecule and the first hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. For example, the first hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence as that portion of the first complementary nucleic acid molecule that binds to a first attachment position of the at least three attachment positions of the barcode domain. The first hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to the first attachment position in the barcode domain.
[0280] The second complementary nucleic acid molecule and the second hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The second hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to the second attachment position in the barcode domain.
[0281] In a related instance provided for illustrative purposes, there is provided a method for sequencing a nucleic acid comprising (1) hybridizing a sequencing probe described herein to a target nucleic acid. The target nucleic acid can optionally be immobilized to a substrate at one or more positions. An exemplary sequencing probe can comprise a target binding domain and a barcode domain; wherein the target binding domain comprises any of the constructs recited in Table 1. An exemplary target binding domain comprises at least eight nucleotides hybridized to the target nucleic acid, wherein at least six nucleotides in the target binding domain can identify a corresponding nucleotide in the target nucleic acid molecule (for example those six nucleotides identify the complementary six nucleotides with the target molecule to which it is hybridized) and wherein at least two nucleotides in the target binding domain do not identify a corresponding nucleotide in the target nucleic acid molecule (for example, those at least two nucleotides do not identify the complementary two nucleotides with the target molecule to which it is hybridized); wherein any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogues; and wherein the at least two nucleotides in the target binding domain that do not identify a corresponding nucleotide in the target nucleic acid molecule can be any of the four canonical bases that is not specific to the target dictated by the at least six nucleotides in the target binding domain or universal bases or degenerate bases. An exemplary barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence capable of being bound by a complementary nucleic acid molecule, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain and each of the at least three attachment positions have a different nucleic acid sequence, and wherein the nucleic acid sequence of each position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid that is bound by the target binding domain.
[0282] In other aspects, an exemplary target binding domain can comprise at least six nucleotides hybridized to the target nucleic acid, wherein the at least six nucleotides in the target binding domain can identify a corresponding nucleotide in the target nucleic acid molecule (for example, when the target binding domain sequence is exactly six nucleotides, those six nucleotides identify the complementary six nucleotides with the target molecule to which it is hybridized); wherein none of the at least six nucleotides or any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogues.
[0283] Following hybridizing of a sequencing probe to the target nucleic acid, the method comprises (2) binding a first complementary nucleic acid molecule comprising a first detectable label and an at least second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (3) detecting and recording the first and at least second detectable label of the bound first complementary nucleic acid molecule.
[0284] Following detection and recording of the at least two detectable labels, removing the at least two detectable labels from the first complementary nucleic acid molecule. Thus, the method further comprises (4) binding to the first attachment position a first hybridizing nucleic acid molecule lacking a detectable label, thereby unbinding the first complementary nucleic acid molecule comprising the detectable labels, or contacting the first complementary nucleic acid molecule comprising the detectable labels with a force sufficient to release the first detectable label and at least second detectable label. Thus, following step (4) no detectable labels are bound to the first attachment positions. The method further comprises (5) binding a second complementary nucleic acid molecule comprising a third detectable label and an at least fourth detectable to a second attachment position of the at least three attachment positions of the barcode domain; (6) detecting and recording the third and at least fourth detectable label of the bound second complementary nucleic acid molecule; (7) repeating steps (4) to (6) until each attachment position of the at least three attachment positions in the barcode domain have been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected and recorded; (8) identifying the position and identity of the at least six nucleotides for at least a first region of the immobilized target nucleic acid that was hybridized to the target binding domain of the sequencing probe using the detectable labels recorded in step (3), step (6) and step (7); and (9) removing the sequencing probe from the optionally immobilized target nucleic acid.
[0285] The method can further comprise (10) hybridizing a second sequencing probe to a target nucleic acid that is optionally immobilized to a substrate at one or more positions, and wherein the target binding domain of the first sequencing probe and the second sequencing probe are different; (11) binding a first complementary nucleic acid molecule comprising a first detectable label and an at least second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (12) detecting and recording the first and at least second detectable label of the bound first complementary nucleic acid molecule; (13) binding to the first attachment position a first hybridizing nucleic acid molecule lacking a detectable label, thereby unbinding the first complementary nucleic acid molecule or complex comprising the detectable labels, or contacting the first complementary nucleic acid molecule or complex comprising the detectable labels with a force sufficient to release the first detectable label and at least second detectable label; (14) binding a second complementary nucleic acid molecule comprising a third detectable label and an at least fourth detectable label to a second attachment position of the at least three attachment positions of the barcode domain; (15) detecting and recording the third and at least fourth detectable label of the bound second complementary nucleic acid molecule; (16) repeating steps (13) to (15) until each attachment position of the at least three attachment positions in the barcode domain have been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected and recorded; (17) identifying the position and identity of the at least six nucleotides for at least a second region of the immobilized target nucleic acid that was hybridized by the target binding domain of the second sequencing probe using the detectable labels recorded in step (12), step (15) and step (16); and (18) removing the second sequencing probe from the optionally immobilized target nucleic acid.
[0286] The method can further comprise assembling each identified linear order of nucleotides in the at least first region and at least second region of the immobilized target nucleic acid, thereby identifying a sequence for the immobilized target nucleic acid.
[0287] Steps (4) and (5) can occur sequentially or concurrently. The first and at least second detectable labels can have the same emission spectrum or can have different emission spectra. The third and at least fourth detectable labels can have the same emission spectrum or can have different emission spectra.
[0288] The first complementary nucleic acid molecule can comprise a cleavable linker. The second complementary nucleic acid molecule can comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule can each comprise a cleavable linker. Preferably, the cleavable linker is photo-cleavable. The release force can be light. Preferably, UV light. The light can be provided by a light source selected from the group consisting of an arc-lamp, a laser, a focused UV light source, and light emitting diode.
[0289] The first complementary nucleic acid molecule and the first hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. For example, the first hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence as that portion of the first complementary nucleic acid molecule that binds to a first attachment position of the at least three attachment positions of the barcode domain. The first hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to the first attachment position in the barcode domain.
[0290] The second complementary nucleic acid molecule and the second hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The second hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to the second attachment position in the barcode domain.
[0291] The preceding method can further comprise a medium suitable for recording of the detectable labels. This medium can be a suitable computer readable medium.
[0292] In a related instance provided for illustrative purposes, there is further provided methods of sequencing a nucleic acid utilizing a plurality of sequencing probes disclosed herein. For example, the target nucleic acid is hybridized to more than one sequencing probe and each probe can sequence the portion of the target nucleic acid to which it is hybridized.
[0293] In a related instance provided for illustrative purposes, there is also provided a method for sequencing a nucleic acid comprising (1) hybridizing at least one first population of first sequencing probes comprising a plurality of the sequencing probes described herein to a target nucleic acid that is optionally immobilized to a substrate at one or more positions; (2) binding a first complementary nucleic acid molecule comprising a first detectable label and an at least second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (3) detecting the first and at least second detectable label of the bound first complementary nucleic acid molecule; (4) identifying the position and identity of at least two nucleotides in the immobilized target nucleic acid; (5) binding to the first attachment position a first hybridizing nucleic acid molecule lacking a detectable label, thereby unbinding the first complementary nucleic acid molecule comprising the detectable labels, or contacting the first complementary nucleic acid molecule comprising the detectable labels with a force sufficient to release the first detectable label and at least second detectable label; (6) binding a second complementary nucleic acid molecule comprising a third detectable label and an at least fourth detectable to a second attachment position of the at least three attachment positions of the barcode domain; (7) detecting the third and at least fourth detectable label of the bound second complementary nucleic acid molecule; (8) identifying the position and identity of at least two nucleotides in the optionally immobilized target nucleic acid; (9) repeating steps (5) to (8) until each attachment position of the at least three attachment positions in the barcode domain have been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule has been detected, thereby identifying the linear order of at least six nucleotides for at least a first region of the immobilized target nucleic acid that was hybridized by the target binding domain of the sequencing probe; and (10) removing the at least one first population of first sequencing probes from the optionally immobilized target nucleic acid.
[0294] The method can further comprise (11) hybridizing at least one second population of second sequencing probes comprising a plurality of the sequencing probes disclosed herein to a target nucleic acid that is optionally immobilized to a substrate at one or more positions, and wherein the target binding domain of the first sequencing probe and the second sequencing probe are different; (12) binding a first complementary nucleic acid molecule comprising a first detectable label and an at least second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (13) detecting the first and at least second detectable label of the bound first complementary nucleic acid molecule; (14) identifying the position and identity of at least two nucleotides in the optionally immobilized target nucleic acid; (15) binding to the first attachment position a first hybridizing nucleic acid molecule lacking a detectable label, thereby unbinding the first complementary nucleic acid molecule or complex comprising the detectable labels, or contacting the first complementary nucleic acid molecule or complex comprising the detectable labels with a force sufficient to release the first detectable label and at least second detectable label; (16) binding a second complementary nucleic acid molecule comprising a third detectable label and an at least fourth detectable label to a second attachment position of the at least three attachment positions of the barcode domain; (17) detecting the third and at least fourth detectable label of the bound second complementary nucleic acid molecule; (18) identifying the position and identity of at least two nucleotides in the immobilized target nucleic acid; (19) repeating steps (15) to (18) until each attachment position of the at least three attachment positions in the barcode domain have been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule has been detected, thereby identifying the linear order of at least six nucleotides for at least a second region of the immobilized target nucleic acid that was hybridized by the target binding domain of the sequencing probe; and (20) removing the at least one second population of second sequencing probes from the optionally immobilized target nucleic acid.
[0295] The method can further comprise assembling each identified linear order of nucleotides in the at least first region and at least second region of the immobilized target nucleic acid, thereby identifying a sequence for the immobilized target nucleic acid.
[0296] Steps (5) and (6) can occur sequentially or concurrently. The first and at least second detectable labels can have the same emission spectrum or can have different emission spectra. The third and at least fourth detectable labels can have the same emission spectrum or can have different emission spectra.
[0297] The first complementary nucleic acid molecule can comprise a cleavable linker. The second complementary nucleic acid molecule can comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule can each comprise a cleavable linker. Preferably, the cleavable linker is photo-cleavable. The release force can be light. Preferably, UV light. The light can be provided by a light source selected from the group consisting of an arc-lamp, a laser, a focused UV light source, and light emitting diode.
[0298] The first complementary nucleic acid molecule and the first hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The first hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to the first attachment position in the barcode domain.
[0299] The second complementary nucleic acid molecule and the second hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The second hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to the second attachment position in the barcode domain.
[0300] In a related instance provided for illustrative purposes, there is provided a method for sequencing a nucleic acid comprising (1) hybridizing at least one first population of first sequencing probes comprising a plurality of the sequencing probes described herein to a target nucleic acid that is optionally immobilized to a substrate at one or more positions; (2) binding a first complementary nucleic acid molecule comprising a first detectable label and an at least second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (3) detecting and recording the first and at least second detectable label of the bound first complementary nucleic acid molecule; (4) binding to the first attachment position a first hybridizing nucleic acid molecule lacking a detectable label, thereby unbinding the first complementary nucleic acid molecule comprising the detectable labels, or contacting the first complementary nucleic acid molecule comprising the detectable labels with a force sufficient to release the first detectable label and at least second detectable label; (5) binding a second complementary nucleic acid molecule comprising a third detectable label and an at least fourth detectable to a second attachment position of the at least three attachment positions of the barcode domain; (6) detecting and recording the third and at least fourth detectable label of the bound second complementary nucleic acid molecule; (7) repeating steps (4) to (6) until each attachment position of the at least three attachment positions in the barcode domain have been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected and recorded; (8) identifying the position and identity of the at least six nucleotides for at least a first region of the immobilized target nucleic acid that was hybridized by the target binding domain of the sequencing probe using the detectable labels recorded in step (3), step (6) and step (7); and (9) removing the at least one first population of first sequencing probes from the optionally immobilized target nucleic acid.
[0301] The method can further comprise (10) hybridizing at least one second population of second sequencing probes comprising a plurality of the sequencing probes disclosed herein to a target nucleic acid that is optionally immobilized to a substrate at one or more positions, and wherein the target binding domain of the first sequencing probe and the second sequencing probe are different; (11) binding a first complementary nucleic acid molecule comprising a first detectable label and an at least second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (12) detecting and recording the first and at least second detectable label of the bound first complementary nucleic acid molecule; (13) binding to the first attachment position a first hybridizing nucleic acid molecule lacking a detectable label, thereby unbinding the first complementary nucleic acid molecule or complex comprising the detectable labels, or contacting the first complementary nucleic acid molecule or complex comprising the detectable labels with a force sufficient to release the first detectable label and at least second detectable label; (14) binding a second complementary nucleic acid molecule comprising a third detectable label and an at least fourth detectable label to a second attachment position of the at least three attachment positions of the barcode domain; (15) detecting and recording the third and at least fourth detectable label of the bound second complementary nucleic acid molecule; (16) repeating steps (13) to (15) until each attachment position of the at least three attachment positions in the barcode domain have been bound by a complementary nucleic acid molecule comprising two detectable labels, and the two detectable labels of the bound complementary nucleic acid molecule have been detected and recorded; (17) identifying the position and identity of the least six nucleotides for at least a second region of the immobilized target nucleic acid that was hybridized by the target binding domain of the second sequencing probe using the detectable labels recorded in step (12), step (15) and step (16); and (18) removing the at least one second population of second sequencing probes from the optionally immobilized target nucleic acid.
[0302] The method can further comprise assembling each identified linear order of nucleotides in the at least first region and at least second region of the immobilized target nucleic acid, thereby identifying a sequence for the immobilized target nucleic acid.
[0303] Steps (4) and (5) can occur sequentially or concurrently. The first and at least second detectable labels can have the same emission spectrum or can have different emission spectra. The third and at least fourth detectable labels can have the same emission spectrum or can have different emission spectra.
[0304] The first complementary nucleic acid molecule can comprise a cleavable linker. The second complementary nucleic acid molecule can comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule can each comprise a cleavable linker. Preferably, the cleavable linker is photo-cleavable. The release force can be light. Preferably, UV light. The light can be provided by a light source selected from the group consisting of an arc-lamp, a laser, a focused UV light source, and light emitting diode.
[0305] The first complementary nucleic acid molecule and the first hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The first hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to the first attachment position in the barcode domain.
[0306] The second complementary nucleic acid molecule and the second hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The second hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to a flanking single-stranded polynucleotide adjacent to the second attachment position in the barcode domain.
[0307] The preceding method can further comprise a medium suitable for recording of the detectable labels. This medium can be a suitable computer readable medium.
[0308] The sequencing methods are further described herein.
[0309] Figure 10 shows a schematic overview of a single exemplary sequencing cycle of the present disclosure. Although immobilizing a target nucleic acid prior to sequencing is not required for the instant methods, in this example, the method begins with a target nucleic acid that has been captured using capture probes and bound to a flow cell surface as shown in the left upper-most panel. A pool of sequencing probes is then flowed into the flow cell to allow sequencing probes to hybridize to the target nucleic acid. In this example, the sequencing probes are those depicted in Figure 1. These sequencing probes comprise a 6-mer sequence within the target binding domain that hybridizes to the target nucleic acid. The 6-mer is flanked on either side by (N) bases which can be a universal / degenerate base or composed of any of the four canonical bases that is not specific to the target dictated by bases b 1 - b 2 - b 3 - b 4 - b 5 - b 6 . Using 6-mer sequences, a set of 4096 (4^6) sequencing probes enables the sequencing of any target nucleic acid. For this example, the set of 4096 sequencing probes are hybridized to the target nucleic acid in 8 pools of 512 sequencing probes each. The 6-mer sequences in the target binding domain of the sequencing probes will hybridize along the length of the target nucleic acid at positions where there is a perfect complementary match between the 6-mer and the target nucleic acid, as shown in upper middle panel of Figure 10. In this example, a single sequencing probe hybridizes to the target nucleic acid. Any unbound sequencing probes are washed out of the flow cell.
[0310] These sequencing probes also comprise a barcode domain with three attachment positions R 1 , R 2 and R 3 , as described above. The attachment regions within attachment position R 1 comprise one or more nucleotide sequences that correspond to the first dinucleotide of the 6-mer of the sequencing probe. Thus, only reporter probes comprising complementary nucleic acids that correspond to the identity of the first dinucleotide present in the target binding domain of the sequencing probe will hybridize to attachment position R 1 . Likewise, the attachment regions within attachment position R 2 of the sequencing probe correspond to the second dinucleotide present in the target binding domain and the attachment regions within attachment position R 3 of the sequencing probe correspond to the second dinucleotide present in the target binding domain
[0311] The method continues in the right upper-most panel of Figure 10. A pool of reporter probes is flowed into the flow cell. Each reporter probe in the reporter probe pool comprises a detectable label, in the form of a dual color combination, and a complementary nucleic acid that can hybridize to a corresponding attachment region within the attachment position R 1 of a sequencing probe. The dual color combination and the complementary nucleic acid of a particular reporter probe correspond to one of 16 possible dinucleotides, as described above. Each pool of reporter probes is designed such that the dual color combination that corresponds to a specific dinucleotide is established before sequencing. For example, in the sequencing experiment depicted in Figure 10, for the first pool of reporter probes that is hybridized to attachment position R 1 , the dual color combination Yellow-Red can correspond to the dinucleotide Adenine-Thymine. After hybridization of the reporter probe to attachment position R 1 , as shown in the upper right panel of Figure 10, any unbound reporter probes are then washed out of the flow cell and the detectable label of the bound reporter probe is recorded to determine the identity of the first dinucleotide of the 6-mer.
[0312] The detectable label attributed to the reporter probe hybridized to attachment position R 1 is removed. To remove the detectable label, the reporter probe can include a cleavable linker and the addition of the appropriate cleaving agent can be added. Alternatively, a complementary nucleic acid lacking a detectable label is hybridized to attachment position R 1 of the sequencing probe and displaces the reporter probe with the detectable label. Irrespective of the method of removing the detectable label, the attachment position R 1 no longer emits a detectable signal. The process by which an attachment position of a barcode domain that was previously emitting a detectable signal is rendered no longer able to emit a detectable signal is referred to herein as "darkening".
[0313] A second pool of reporter probes is flowed into the flow cell. Each reporter probe in the reporter probe pool comprises a detectable label, in the form of a dual color combination, and a complementary nucleic acid that can hybridize to a corresponding attachment region within attachment position R 2 of a sequencing probe. The dual color combination and the complementary nucleic acid of a particular reporter probe correspond to one of 16 possible dinucleotides. It is possible that a particular dual color combination corresponds to one dinucleotide in the context of the first pool of reporter probes, and a different dinucleotide in the context of the second pool of reporter probes. After hybridization of the reporter probes to attachment position R 2 , as shown in the bottom right panel of Figure 10, any unbound reporter probes are then washed out of the flow cell and the detectable label is recorded to determine the identity of the second dinucleotide of the 6-mer present in the sequencing probe.
[0314] To remove the detectable label at position R 2 , the reporter probe can include a cleavable linker and the addition of the appropriate cleaving agent can be added. Alternatively, a complementary nucleic acid lacking a detectable label is hybridized to attachment position R 2 of the sequencing probe and displaces the reporter probe with the detectable label. Irrespective of the method of removing the detectable label, the attachment position R 2 no longer emits a detectable signal.
[0315] A third pool of reporter probes is then flowed into the flow cell. Each reporter probe in the third reporter probe pool comprises a detectable label, in the form of a dual color combination, and a complementary nucleic acid that can hybridize to a corresponding attachment region within attachment position R 3 of a reporter probe. The dual color combination and the complementary nucleic acid of a particular reporter probe correspond to one of 16 possible dinucleotides. After hybridization of the reporter probes to position R 3 , as shown in the bottom middle panel of Figure 10, any unbound reporter probes are then washed out of the flow cell and the detectable label is recorded to determine the identity of the third dinucleotide of the 6-mer present in the sequencing probe. In this way, all three dinucleotides of the target binding domain are identified and can be assembled together to reveal the sequence of the target binding domain and therefore the sequence of the target nucleic acid.
[0316] To continue to sequence the target nucleic acid, any bound sequencing probes can be removed from the target nucleic acid. The sequencing probe can be removed from the target nucleic acid even if a reporter probe is still hybridized to position R 3 of the barcode domain. Alternatively, the reporter probe hybridized to position R 3 can be removed from the barcode domain prior to the removal of the sequencing probe from the target binding domain, for example, by using the darkening procedures as described above for reporters at positions R 1 and R2.
[0317] The sequencing cycle depicted in Figure 10 can be repeated any number of times, beginning each sequencing cycle either with the hybridization of the same pool of sequencing probes to the target nucleic acid molecule or with the hybridization of a different pool of sequencing probes to the target nucleic acid. It is possible that the second pool of sequencing probes bind to the target nucleic acid at a position that overlaps the position at which the first sequencing probe or pool of sequencing probes were bound during the first sequencing cycle. Thereby certain nucleotides within the target nucleic acid can be sequenced more than once and using more than one sequencing probe.
[0318] Figure 11 depicts a schematic of one full cycle of the sequencing method of the present disclosure and the corresponding imaging data collected during this cycle. In this example, the sequencing probe used are those depicted in Figure 1 and the sequencing steps are the same as those depicted in Figure 10 and described above. After the sequencing domain of the sequencing probe is hybridized to the target nucleic acid, a reporter probe is hybridized to the first attachment position (R 1 ) of the sequencing probe. The first reporter probe is then imaged to record color dots. In Figure 11, the color dots are labeled with dotted circles. The color dots correspond to a single sequencing probe that is being recorded during the full cycle. In this example, 7 sequencing probes are recorded (1 to 7). The first attachment position of the barcode domain is then darkened and a dual fluorescence reporter probe is hybridized to the second attachment position (R 2 ) of the sequencing probe. The second reporter probe is then imaged to record color dots. The second attachment position of the barcode domain is then darkened and a dual fluorescence reporter is hybridized to the third attachment position (R 3 ) of the sequencing probe. The third reporter probe is then imaged to record color dots. The three color dots from each sequencing probe 1 to 7 are then arranged in order. Each color spot is then mapped to a specific dinucleotide using the decoding matrix to reveal the sequence of the target binding domain of sequencing probes 1 to 7.
[0319] During a single sequencing cycle, the number of reporter probe pools needed to determine the sequence of the target binding domain of any sequencing probes bound to a target nucleic acid is identical to the number of attachment positions in the barcode domain. Thus, for a barcode domain having three positions, three reporter probe pools will be cycled over the sequencing probes.
[0320] A pool of sequencing probes can comprise a plurality of sequencing probes that are all identical in sequence or a plurality of sequencing probes that are not all identical in sequence. When a pool of sequencing probes include a plurality of sequencing probes that are not all identical in sequence, each different sequencing probe can be present in the same number, or different sequencing probes can be present in different numbers.
[0321] Figure 12 shows an exemplary sequencing probe pool configuration of the present disclosure in which the eight color combinations specified above are used to design eight different pools of sequencing probes when the sequencing probe contains: (a) a target binding domain that has 6 nucleotides (6-mer) that specifically binds to the target nucleic acid and (b) three attachment positions (R 1 , R 2 and R 3 ) in the barcode domain. There are a possible 4096 unique 6-mer sequences (4x4x4x4x4x4=4096). Given that each of the three attachment positions in the barcode domain can be hybridized to a complementary nucleic acid bound by one of eight different color combinations, there are 512 unique sets of 3 color combinations possible (8*8*8=512). For example, a probe where R 1 hybridizes to a complementary nucleic acid bound to the color combination GG, R 2 hybridizes to a complementary nucleic acid bound to the color combination BG, and R 3 hybridizes to a complementary nucleic acid bound to the color combination YR, the set of 3 color combinations is accordingly GG-BG-YR. Within a pool of sequencing probes, each unique set of three color combinations will correspond to a unique 6mer within the target binding domain. Given each pool contains 512 unique 6mers, and there are a total of 4096 possible 6mers, eight pools are needed to sequence all possible 6mers (4096 / 512=8). The specific sequencing probes that are placed in each of the 8 pools is determined to ensure optimal hybridization of each sequencing probe to the target nucleic acid. To ensure optimal hybridization several precautions are taken including: (a) separating perfect 6mer complements into different pools; (b) separating 6mers with a high Tm and a low Tm into different pools; and (c) separating 6mers into different pools based on empirically-learned hybridization patterns.
[0322] Figure 13 shows the difference between the sequencing probes described in US Patent Publication No. 20160194701 and the sequencing probes of the present disclosure. As depicted on the left panel of Figure 13, US Patent Publication No. 20160194701 describes a sequencing probe with a barcode domain that comprises six attachment positions that are hybridized to complementary nucleic acids. Each complementary nucleic acids is bound to one of four different fluorescent dyes. In this configuration, each color (red, blue, green, yellow) corresponds to one nucleotide (A, T, C, or G) in the target binding domain. This probe design creates 4096 unique probes (4^6). As depicted in the right panel of Figure 13, in one example of the present disclosure, the barcode domain of each sequencing probe comprises 3 attachment positions that are hybridized to complementary nucleic acids, as depicted in the right panel of Figure 13. Unlike US Patent Publication No. 20160194701, these complementary nucleic acids are bound by 1 of 8 different color combinations (GG, RR, GY, RY, YY, RG, BB, and RB). Each color combination corresponds to a specific dinucleotide in the target binding domain. This configuration creates 512 unique probes (8^3). To cover all possible hexamer combinations within a target binding domain (4096), 8 separate pools of these 512 unique probes are needed to sequence an entire target nucleic acid. Since 8 color combinations are used to label the complementary nucleic acid, but there are 16 possible dinucleotides, certain color combinations will correspond to different dinucleotides depending on which pool of sequencing probes is being used. For example, in Figure 13, in the 1 st< , 2 nd< , 3 rd< , and 4 th< pools of sequencing probes, the color combination BB corresponds to the dinucleotide AA and the color combination GG corresponds to the dinucleotide AT. In the 5 th< , 6 th< , 7 th< , and 8 th< pools of sequencing probes, the color combination BB corresponds to the dinucleotide CA and the color combination CT corresponds to the dinucleotide AT.
[0323] A plurality of sequencing probes (i.e. more than one sequencing probe) can be hybridized within the sequencing window. During sequencing, the identity and spatial position of the detectable labels bound to each sequencing probe in the plurality of hybridized sequencing probes is recorded. This allows for subsequent identification of both the position and identity of a plurality of dinucleotides. In other words, by hybridizing a plurality of sequencing probes simultaneously to a single target nucleic acid molecule, multiple positions along the target nucleic acid can be sequenced concurrently, increasing the speed of sequencing.
[0324] In some aspects, a single sequencing probe can be hybridized to a captured target nucleic acid molecule. In some aspects, a plurality of sequencing probes can be hybridized to a captured target nucleic acid molecule. A sequencing window between two hybridized 5' and 3' capture probes can allow for the hybridization of a single sequencing probe or a plurality of sequencing probes along the length of the target nucleic acid molecule. By hybridizing a plurality of sequencing probes along the length of the target nucleic acid molecule, more than one location on the target nucleic acid molecule can be sequence concurrently, increasing the speed of sequencing. The fluorescence signal from individual probes of a plurality of probes bound along the length of a target nucleic acid can be spatially resolved.
[0325] In some aspects, sequencing probes can bind at even intervals along the length of target nucleic acid. In some aspects, sequencing probes need not bind at even intervals along the length of a target nucleic acid. The signals from a plurality of sequencing probes bound along the length of a target nucleic acid can be spatially resolved to obtain sequencing information at multiple locations of a target nucleic acid concurrently.
[0326] The distribution of probes along a length of target nucleic acid is critical for resolution of detectable signal. There are occasions when too many probes in a region can cause overlap of their detectable label, thereby preventing resolution of two nearby probes. This is explained as follows. Given that one nucleotide is 0.34 nm in length and given that the lateral (x-y) spatial resolution of a sequencing apparatus is about 200nm, a sequencing apparatus's resolution limit is about 588 base pair (i.e., a 1 nucleotide / 0.34nm x 200nm). That is to say, the sequencing apparatus mentioned above would be unable to resolve signals from two probes hybridized to a target nucleic acid when the two probes are within about 588 base pair of each other. Thus, two probes, depending on the resolution of the sequencing apparatus, will need be spaced approximately 600bp's apart before their detectable label can be resolved as distinct "spots". So, at optimal spacing, there should be a single probe per 600bp of target nucleic-acid. Preferably, each sequencing probe in a population of probes will bind no closer than 600 nucleotides from each other. A variety of software approaches (e.g., utilize fluorescence intensity values and wavelength dependent ratios) can be used to monitor, limit, and potentially deconvolve the number of probes hybridizing inside a resolvable region of a target nucleic acid and to design probe populations accordingly. Moreover, detectable labels (e.g., fluorescent labels) can be selected that provide more discrete signals. Furthermore, methods in the literature (e.g., Small and Parthasarthy: "Superresolution localization methods." Annu. Rev. Phys Chem., 2014; 65:107-25) describe structured-illumination and a variety of super-resolution approaches which decrease the resolution limit of a sequencing microscope up to 10's-of-nanometers. Use of higher resolution sequencing apparatuses allow for use of probes with shorter target binding domains.
[0327] As mentioned above, designing the Tm of probes can affect the number of probes hybridized to a target nucleic acid. Alternately or additionally, the concentration of sequencing probes in a population can be increased to increase coverage of probes in a specific region of a target nucleic acid. The concentration of sequencing probes can be reduced to decrease coverage of probes in a specific region of a target nucleic acid, e.g., to above the resolution limit of the sequencing apparatus.
[0328] While the resolution limit for two detectable labels is about 600 nucleotides, this does not hinder the powerful sequencing methods of the present disclosure. In certain aspects, a plurality of the sequencing probes in any population will not be separated by 600 nucleotides on a target nucleic acid. However, statistically (following a Poisson distribution), there will be target nucleic acids that only have one sequencing probe bound to it, and that sequencing probe is the one optically resolvable. For target nucleic acids that have multiple probes bound within 600 nucleotides (and thus are not optically resolvable), the data for these unresolvable sequencing probes may be discarded. Importantly, the methods of the present disclosure provide multiple rounds of binding and detecting pluralities of sequencing probes. Thus, it is possible in some rounds the signal from all the sequencing probes are detected, in some rounds the signal from only a portion of the sequencing probes are detected and in some rounds the signal from none of the sequencing probes is detected. In some aspects, the distribution of the sequencing probes bound to the target nucleic acid can be manipulated (e.g., by controlling concentration or dilution) such that only one sequencing probe binds per target nucleic acid.
[0329] Randomly, but in part depending on the length of the target binding domain, the Tm of the probes, and concentration of probes applied, it is possible for two distinct sequencing probes in a population to bind within 600 nucleotides of each other.
[0330] Alternately or additionally, the concentration of sequencing probes in a population can be reduced to decrease coverage of probes in a specific region of a target nucleic acid, e.g., to above the resolution limit of the sequencing apparatus, thereby producing a single read from a resolution-limited spot.
[0331] If the sequence, or part of the sequence, of a target nucleic acid is known prior to sequencing the target nucleic acid using the methods of the present disclosure, the sequencing probes can be designed and chosen such that no two sequencing probes will bind to the target nucleic acid within 600 nucleotides of each other.
[0332] Prior to hybridizing sequencing probes to a target nucleic acid, one or more complementary nucleic acid molecules can be bound by a first detectable label and an at least second detectable label can be hybridized to one or more of the attachment positions within the barcode domain of the sequencing probes. For example, prior to hybridization to a target nucleic acid, one or more complementary nucleic acid molecules bound by a first detectable label and an at least second detectable label can be hybridized to the first attachment position of each sequencing probe. Thus, when contacted with its target nucleic acid, the sequencing probes are capable of emitting a detectable signal from the first attachment position and it is unnecessary to provide a first pool of complementary nucleic acids or reporter probes that are directed to the first position on the barcode domain. In another example, one or more complementary nucleic acid molecules bound by a first detectable label and an at least second detectable label can be hybridized to all of the attachment positions within the barcode domain of the sequencing probes. Thus, in this example, a six nucleotide sequence can be read without needing to sequentially replace complementary nucleic acids. Use of this pre-hybridized sequencing probe-reporter probe complex would reduce the time to obtain sequence information since many steps of the described method are omitted. However, this probe would benefit from detectable labels that are non-overlapping, e.g., fluorophores are excited by non-overlapping wavelengths of light or the fluorophores emit non-overlapping wavelengths of light
[0333] In some aspects of the methods of the present disclosure, the signal intensity from a recorded color dot can be used to more accurately sequence a target nucleic acid. In some aspects, the spot intensity of a particular color within a color dot can be used to determine the probability that a specific color dot corresponds to color combinations that are the duplicity of one color (i.e. BB, GG, YY, or RR).
[0334] The darkening of a position within a barcode domain can be accomplished by strand cleavage at a cleavable linker modification present within the reporter probes that are hybridized to that position. Figure 14 depicts the use of a cleavable linker modification to darken a barcode position during a sequencing cycle. The first step, depicted on the furthest left panel of Figure 14, comprises hybridizing a primary nucleic acid of a reporter probe to the first attachment position of a sequencing probe. The primary nucleic acid hybridizes to a specific, complementary sequence within an attachment region of the first position of the barcode domain. The first and second domains of the primary nucleic acid are covalently linked by a cleavable linker modification. In the second step, the detectable labels are then recorded to determine the identity and position of a specific dinucleotide in the target binding domain of the sequencing probe. In the third step, the first position of the barcode domain is darkened by cleaving the reporter probe at the cleavable linker modification. This releases the second domain of the primary nucleic acid, thereby releasing the detectable labels. The first domain of the primary nucleic acid molecule, now lacking any detectable label, is left hybridized to the first attachment position of the barcode domain, thereby the first position of the barcode domain no longer emits a detectable signal and will not be able to hybridize to any other reporter probe in subsequent sequencing steps. In the final step, depicted in the furthest right panel of Figure 14, a reporter probe is hybridized to the second position of the barcode domain to continue sequencing.
[0335] An attachment position of a barcode domain can be darkened by displacing any secondary or tertiary nucleic acid in the reporter probe that is bound by a detectable label while still allowing the primary nucleic acid molecule of the reporter probe to remain hybridized to the sequencing probe. This displacement can be accomplished by hybridizing to the primary nucleic acid secondary or tertiary nucleic acids that are not bound by a detectable label. Figure 15 is an illustrative example of an exemplary sequencing cycle of the present disclosure in which a position within a barcode domain is darkened by displacement of labeled secondary nucleic acids. The far left panel of Figure 15 depicts the start of a sequencing cycle in which a primary nucleic acid molecule of a reporter probe is hybridized to the first attachment position of a barcode domain of a sequencing probe. Secondary nucleic acid molecules bound to a detectable label are then hybridized to the primary nucleic acid molecule and the detectable label is recorded. To darken the first position of the barcode domain, the secondary nucleic acid molecules bound to a detectable label are displaced by secondary nucleic acid molecules that lack a detectable label. In the next step of the sequencing cycle, a reporter probe comprising detectable labels is hybridized to the second position of the barcode domain. An attachment position of a barcode domain can be darkened by displacing any primary nucleic acid molecule of the reporter probe by hybridizing to the sequencing probe at the corresponding barcode domain attachment position nucleic acids that are not bound by a detectable label. In those instances where a barcode domain comprises at least one single-stranded nucleic acid sequence adjacent or flanking at least one attachment position, the nucleic acid not bound by a detectable label can displace a primary nucleic acid molecule by hybridizing to the flanking sequence and a portion of the barcode domain occupied by the primary nucleic acid molecule. If needed, the rate of detectable label exchange can be accelerated by incorporating small single-stranded oligonucleotides that accelerate the rate of exchange of detectable labels (e.g., "Toe-Hold" Probes; see, e.g., Seeling et al., "Catalyzed Relaxation of a Metastable DNA Fuel"; J. Am. Chem. Soc. 2006, 128(37), pp12211-12220).
[0336] The complementary nucleic acids comprising a detectable label or reporter probes can be removed from the attachment region but not replaced with a hybridizing nucleic acid lacking a detectable label. This can occur, for example, by adding a chaotropic agent, increasing the temperature, changing salt concentration, adjusting pH, and / or applying a hydrodynamic force. In these examples, fewer reagents (i.e., hybridizing nucleic acids lacking detectable labels) are needed.
[0337] The methods of the present disclosure can be used to concurrently capture and sequence RNA and DNA molecules, including mRNA and gDNA, from the same sample. The capture and sequencing of both RNA and DNA molecules from the same sample can be performed in the same flow cell. In some aspects, the methods of the present disclosure can be used to concurrently capture, detect, and sequence both gDNA and mRNA from a FFPE sample.
[0338] The sequencing method of the present disclosure further comprise steps of assembling each identified linear order of nucleotides for each region of an immobilized target nucleic acid, thereby identifying a sequence for the immobilized target nucleic acid. The steps of assembling uses a non-transitory computer-readable storage medium with an executable program stored thereon. The program instructs a microprocessor to arrange each identified linear order of nucleotides for each region of the target nucleic acid, thereby obtaining the sequence of the nucleic acid. Assembling can occur in "real time", i.e., while data is being collected from sequencing probes rather than after all data has been collected or post complete data acquisition.
[0339] The raw specificity of the sequencing method of the present disclosure is approximately 94%. The accuracy of the sequencing method of the present disclosure can be increased to approximately 99% by sequencing the same base in a target nucleic acid with more than one sequencing probe. Figure 16 depicts how the sequencing method of the present disclosure allows for the sequencing of the same base of a target nucleic acid with different sequencing probes. The target nucleic acid in this example is a fragment of NRAS exon2 (SEQ ID NO: 1). The particular base of interest is a cytosine (C) that is highlighted in the target nucleic acid. The base of interest will be hybridized to two different sequencing probes, each with a distinct footprint of hybridization to the target nucleic acid. In this example, sequencing probes 1 to 4 (barcode 1 to 4) bind three nucleotides to the left of the base of interest, while sequencing probes 5 to 8 (barcodes 5 to 8) bind 5 nucleotides to the left of the base of interest. Thereby, the base of interest will be sequenced by two different probes, thereby increasing the amount of base calls for that specific position, and thereby increasing overall accuracy at that specific position. Figure 17 shows how multiple different base calls for a specific nucleotide position on the target nucleotide, recorded from one or more sequencing probes, can be combined to create a consensus sequence (SEQ ID NO: 2), thereby increasing the accuracy of the final base call.
[0340] The terms "Hyb & Seq chemistry," "Hyb & Seq sequencing," and "Hyb & Seq" refer to the methods of the present disclosure described above.Arrays of the present disclosure and methods using said arrays (not claimed)
[0341] In a related instance provided for illustrative purposes, there is provided compositions and methods for immobilizing nucleic acid molecules, including arrays and methods of using arrays, as described in detailed herein.
[0342] In a related instance provided for illustrative purposes, there is provided a composition comprising a planar solid support substrate; a first layer on the planar solid support substrate; a second layer on the first layer; wherein the second layer comprises a plurality of nanowells, wherein each nanowell provides access to an exposed portion of the first layer, wherein each nanowell comprises a plurality of first oligonucleotides covalently attached to the exposed portion of the first layer.
[0343] In a related instance provided for illustrative purposes, there is provided a composition comprising: a planar solid support substrate; a first layer on the planar solid support substrate in contact with a first surface of the planar solid support substrate; a second layer on the first layer in contact with a second surface of the first layer, wherein the second surface of the first layer is not in contact with a surface of the planar solid support substrate; wherein the second layer comprises a plurality of nanowells, wherein each nanowell provides access to an exposed portion of the first layer, wherein each nanowell comprises a plurality of first oligonucleotides covalently attached to the exposed portion of the first layer.
[0344] A first layer can comprise a first surface in contact with a surface of a planar solid support substrate and a second surface in contact with a second layer but not in contact with a surface of the planar solid support substrate.
[0345] A second layer can comprise a first surface in contact with a surface of a first layer and a second surface exposed to the environment.
[0346] Figure 47 is a schematic cross section of an exemplary array of the present disclosure. The array comprises a planar solid support substrate 101, a first layer 102 on the planar solid support substrate 101, and a second layer 103 on the first layer 102. The second layer 103 comprises a plurality of nanowells 104. Each nanowell 104 is open on two sides thereby exposing a portion of the first layer in each nanowell 105. A plurality of first oligonucleotides 106 is covalently attached to the exposed first layer 105 in each nanowell.
[0347] In some aspects, a planar solid support substrate can be a surface, membrane, bead, porous material or electrode. A planar solid support substrate can comprise, but is not limited to, a polymeric material, a metal, silicon, glass or quartz for example.
[0348] In some aspects, a first layer 102 can comprise an oxide film, such as, but not limited to, silicon dioxide.
[0349] In some aspects, a first layer 102 can have a thickness of about 50 to about 150 nm. A first layer 102 can have a thickness of about 90 nm.
[0350] In some aspects, a second layer 103 can comprise, but is not limited to, bis(trimethylsilyl)amine, also known as hexamethyldisilazane (HMDS or HDMS).
[0351] In some aspects, a second layer 103 can comprises a material that is not chemically reactive, such that the second layer does not bind biological macromolecules.
[0352] In some aspects, a second layer 103 can have a thickness of about 1 nm to about 10 nm. A second layer 103 can have a thickness of about 3 nm to about 4 nm.
[0353] In some aspects, the planar solid support substrate comprises silicon, the first layer comprises silicon dioxide and the second layer comprises HMDS.
[0354] In some aspects, the planar solid support substrate comprises glass, the first layer comprises silicon dioxide and the second layer comprises HMDS.
[0355] In some aspects, a second layer can comprise about 0.1×10 5< and about 100×10 7< nanowells per square millimeter. A second layer can comprise about 0.1×10 6< and about 100×10 6< nanowells per square millimeter. A second layer can comprise about 1×10 6< and about 10×10 6< nanowells per square millimeter. A second layer can comprise about 2×10 6< and about 5×10 6< nanowells per square millimeter. A second layer can comprise about 3×10 6< nanowells per square millimeter.
[0356] As used herein, "density of nanowells" refers to the number of nanowells present within a specified surface area. For example, a second layer that has a surface area of 1.0 mm 2< and that comprises 1.0×10 6< nanowells is said to have a density of nanowells that is 1.0×10 6< nanowells / mm 2< .
[0357] In some aspects, the density of nanowells can be between about 0.1×10 5< and about 100×10 7< nanowells / mm 2< . The density of nanowells can be between about 0.1×10 6< and about 100×10 6< nanowells / mm 2< . ...
Claims
1. A method for identifying the presence of a predetermined nucleotide sequence in a target nucleic acid comprising (1) hybridizing a target binding domain of a first probe to a first region of a target nucleic acid, wherein the probe comprises a target binding domain and a barcode domain; wherein the target binding domain is at least 12 nucleotides in length; wherein the barcode domain comprises a synthetic backbone, the barcode domain comprising at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, wherein the barcode domain consists of L-DNA, wherein each of the at least three attachment positions have a different nucleic acid sequence; and wherein each attachment position in the barcode domain is about 6 to about 20 nucleotides in length; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (3) identifying the at least one first and the at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment position; (4) removing the at least one first and the at least one second detectable label hybridized to the first attachment position; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment position of the at least three attachment positions of the barcode domain; (6) identifying the at least one third and the at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (7) removing the at least one third and the at least one fourth detectable label hybridized to the second attachment position; (8) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of the at least three attachment positions of the barcode domain; (9) identifying the at least one fifth and the at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position, thereby determining the presence of the predetermined nucleotide sequence based on at least the identity of the at least one first detectable label, the at least one second detectable label, the at least one third detectable label, the at least one fourth detectable label, the at least one fifth detectable label and the at least one sixth detectable label.
2. The method of claim 1, wherein the probe comprises a double-stranded DNA spacer between the target binding domain and the barcode domain.
3. The method of any one of the preceding claims, wherein the number of nucleotides in the target binding domain is greater than the number of attachment positions in the barcode domain, preferably wherein the barcode domain comprises at least four attachment positions.
4. The method of any one of the preceding claims, wherein each attachment position in the barcode domain comprises a single attachment region.
5. The method of any one of the preceding claims, wherein each attachment position in the barcode domain is: a) about 9 nucleotides in length; b) about 12 nucleotides in length; c) about 14 nucleotides in length; or d) about 16 nucleotides in length.
6. The method of any one of the preceding claims, wherein the at least one nucleic acid sequence of each attachment position comprises a 3' terminal guanosine nucleotide, preferably wherein the at least one nucleic acid sequence of each attachment position comprises at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide or any combination thereof and a 3' terminal guanosine nucleotide.
7. The method of any one of the preceding claims, wherein each nucleotide of the at least 12 nucleotides of the target binding domain is D-DNA.
8. The method of any one of the preceding claims, preferably wherein a) steps (4) and (5) occur sequentially or concurrently; or b) steps (7) and (8) occur sequentially or concurrently.
9. The method of any one of the preceding claims, wherein a) the first and second detectable labels have the same emission spectrum or have different emission spectra; b) the third and fourth detectable labels have the same emission spectrum or have different emission spectra; or c) the fifth and sixth detectable labels have the same emission spectrum or have different emission spectra.
10. The method of any one of the preceding claims, wherein the first complementary nucleic acid molecule, the second complementary nucleic acid molecule and the third complementary nucleic acid molecule each comprise a cleavable linker.
11. The method of any one of the preceding claims, wherein the first complementary nucleic acid molecule comprises a reporter probe comprising a primary nucleic acid, wherein the primary nucleic acid molecule comprises at least two domains, a first domain that hybridizes to the first attachment position of the barcode domain and a second domain that is hybridized to six secondary nucleic acid molecules, wherein each of the secondary nucleic acid molecules is hybridized to five tertiary nucleic molecules, wherein each of the tertiary nucleic acid molecules comprises a detectable label.
12. The method of claim 11, wherein the primary nucleic acid molecule comprises a cleavable linker located between the first domain and the second domain, preferably wherein the cleavable linker is a photocleavable linker.
13. The method of claim 11 or claim 12, wherein each of the secondary nucleic acid molecules comprises at least two domains, a first domain that hybridizes to the second domain of the primary nucleic acid molecule; and a second domain that hybridizes to the five tertiary nucleic acid molecules, preferably wherein each of the secondary nucleic acid molecules comprises a cleavable linker located between the first domain and the second domain, preferably wherein the cleavable linker is a photocleavable linker.
14. The method of any one of claims 11-13, wherein removing the at least one first and the at least one second detectable label hybridized to the first attachment position comprises cleaving the cleavable linker between the first domain and the second domain of the primary nucleic acid, cleaving the cleavable linker between the first domain and the second domain of each secondary nucleic acid or any combination thereof.