A biosensor comprising a genetically modified microorganism

EP4605413A1Pending Publication Date: 2025-08-27UNIV COLLEGE DUBLIN NAT UNIV OF IRELAND DUBLIN
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023794015
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-10-21
Filing Date
2023-10-19
Publication Date
2025-08-27

AI Technical Summary

Technical Problem

Current biosensors face challenges in real-time monitoring of multiple analytes simultaneously due to limited amperometric biosensors and interference from endogenous and exogenous substances, leading to inaccurate results, especially in applications like diabetes management and anaerobic digester monitoring.

Method used

A genetically modified host cell with nucleic acid modifications in genes such as manX, manY, manZ, Glk, and ptsG is used as a biosensor, capable of interacting with multiple analytes and reducing interference by immobilizing the host cell on a probe to detect specific analytes like glucose and acetate.

Benefits of technology

The modified host cell biosensor enables accurate, simultaneous detection of multiple analytes with reduced interference, improving the specificity and reliability of biosensor readings in complex samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 1.1
    Figure 1.1
Patent Text Reader

Abstract

The present invention relates to a host cell. The host cell finds utility as a biosensor by comprising at least one nucleic acid modification in the nucleic acid sequence of at least one gene. Also disclosed is the host cell for use as a biosensor, use of the host cell as a biosensor, a method of producing a biosensor, and a method of identifying the presence, absence or quantity of an analyte in a sample.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Title of the invention

[0002] A biosensor comprising a genetically modified microorganism

[0003] Field of the invention

[0004] The present invention relates to a biosensor comprising a host cell comprising at least one nucleic acid modification in the nucleic acid sequence of at least one gene. Also disclosed is the host cell, the host cell for use as a biosensor, use of the host cell as a biosensor, a method of producing a biosensor, and a method of identifying the presence, absence or quantity of an analyte in a sample.

[0005] Background to the invention

[0006] The quantitative determination of analytes in samples is of great importance. Real-time monitoring of analytes in samples is required for optimum sensing applications.

[0007] For example, the quantitative determination of analytes such as glucose in samples such as biological samples is of great importance in certain applications, for example, the maintenance of disorders such as diabetes.

[0008] As another example, optimal production of biogas in anaerobic digestors requires careful monitoring of analytes such as the metabolites acetate and propionate as markers of anaerobic digestor health.

[0009] A biosensor can be used for the quantitative determination of analytes in samples. The biosensor combines a biological component with a physicochemical detector. The biological component is usually a biologically-derived material such as a tissue, microorganism, organelle, cell receptor, enzyme, antibody, or a nucleic acid, which interacts with, binds with, or recognizes the analyte. The physicochemical detector can detect a signal such as an optical, piezoelectric, electrochemical, or electrochemiluminescence signal resulting from the interaction or binding of the analyte with the biological component, making the interaction or binding of the analyte with the biological component easily measurable and quantifiable.

[0010] Examples of electrochemical enzymatic biosensors that detect a single analyte in solution such as lactic acid, glucose, or ethanol are known in the art.

[0011] For example, commercially available glucose monitors rely on amperometric sensing of glucose by means of glucose oxidase, which oxidises glucose producing hydrogen peroxide which is detected by the electrode.

[0012] The biosensor required for real-time monitoring in such sensing applications might need to measure more than one analyte in the sample simultaneously, yet there are only a limited number of amperometric biosensors with which multiple analytes can be detected within a single sample at the same time. Additionally, reagents such as coenzymes required for enzymatic biosensors are expensive, further limiting their application to real-time monitoring.

[0013] Whole-cell biosensors do not have the same limitations, but because of their extensive metabolism, are perceived to be too non-specific and their application thus far has been limited to measurement of biological oxygen demand.

[0014] Moreover, interference during the quantitative determination of analytes in samples is a constant problem with biosensors and leads to inaccurate results. Interference in quantitative determination of analytes in samples is frequently caused by the presence of endogenous and exogenous substances as a carbon source, a component within the feedstock, a product, or a by-product of the bioprocess. For example, glucose is often a carbon source, a component within the feedstock, a product, or a by-product of many bioprocesses, thereby causing interference in the quantitative determination of the analytes in the sample.

[0015] Thus, a rapid and easy-to-use monitoring system with reduced interference is required.

[0016] Summary of the invention

[0017] According to a first aspect of the present invention, there is provided a host cell comprising at least one nucleic acid modification in the nucleic acid sequence of at least one gene selected from manX, manY, manZ, Glk, and ptsG.

[0018] According to a second aspect of the present invention, there is provided a host cell according to a first aspect of the present invention for use as a biosensor.

[0019] According to a third aspect of the present invention, there is provided use of a host cell according to a first aspect of the present invention as a biosensor.

[0020] According to a fourth aspect of the present invention, there is provided a biosensor comprising a host cell according to a first aspect of the present invention.

[0021] According to a fifth aspect of the present invention, there is provided a method of producing a biosensor, the method comprising the steps of providing a host cell, and introducing to the host cell at least one nucleic acid modification in the nucleic acid sequence of at least one gene selected from manX, manY, manZ, Glk, and ptsG.

[0022] According to a sixth aspect of the present invention, there is provided a method of identifying the presence, absence or quantity of an analyte in a sample, the method comprising contacting the sample with a host cell according to a first aspect of the present invention or a biosensor according to a fourth aspect of the present invention.

[0023] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAA15624, BAA15625, BAA15631 , BAA16258, and BAA35908.

[0024] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAA15624.1 , BAA15625.1 , BAA15631.1 , BAA16258.1 , and BAA35908.1.

[0025] Optionally, the at least one gene is selected from at least one of manX, manY, manZ.

[0026] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAA15624, BAA15625, and BAA15631.

[0027] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAA15624.1 , BAA15625.1 , and BAA15631.1.

[0028] Optionally, the at least one gene is selected from Glk, ptsG, and at least one of manX, manY, manZ.

[0029] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from BAA16258 and BAA35908, and at least one of BAA15624, BAA15625, and BAA15631.

[0030] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from BAA16258.1 and BAA35908.1 , and at least one of BAA15624.1 , BAA15625.1 , and BAA15631.1.

[0031] Optionally, the at least one gene is selected from Glk, ptsG, and manX.

[0032] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from BAA16258, BAA35908, and BAA15624.

[0033] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from BAA16258.1 , BAA35908.1 , and BAA15624.1.

[0034] Optionally, the at least one gene is selected from Glk, ptsG, and manY.

[0035] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from BAA16258, BAA35908, and BAA15625. Optionally, the at least one gene is selected from a gene having a Genbank version number selected from BAA16258.1 , BAA35908.1 , and BAA15625.1.

[0036] Preferably, the at least one gene is selected from Glk, ptsG, and manZ.

[0037] Preferably, the at least one gene is selected from a gene having a Genbank accession number selected from BAA16258, BAA35908, and BAA15631.

[0038] Preferably, the at least one gene is selected from a gene having a Genbank version number selected from BAA16258.1 , BAA35908.1 , and BAA15631.1.

[0039] Optionally, the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs and prpE.

[0040] Optionally, the at least one gene is further selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , and BAE76117.

[0041] Optionally, the at least one gene is further selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , and BAE76117.1.

[0042] Optionally, the at least one gene is selected from at least one of manX, manY, manZ, Glk, ptsG, IldD, did, adhP, adhE, ackA, acs and prpE.

[0043] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAA15624, BAA15625, BAA15631 , BAA16258, BAA35908, BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , and BAE76117.

[0044] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAA15624.1 , BAA15625.1 , BAA15631.1 , BAA16258.1 , BAA35908.1 , BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071 .1 , and BAE76117.1.

[0045] Optionally, the at least one gene is selected from at least one of manX, manY, manZ, Glk, and ptsG; and at least one of IldD, did, adhP, adhE, ackA, acs and prpE.

[0046] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAA15624, BAA15625, BAA15631 , BAA16258, and BAA35908; and at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , and BAE76117. Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAA15624.1 , BAA15625.1 , BAA15631.1 , BAA16258.1 , and BAA35908.1 ; and at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , and BAE76117.1.

[0047] Optionally, the at least one gene is further selected from at least one of glcD, glcE, glcF, ykgE, ykgF, ykgG, fdoG, fdoH, fdol, fdnG, fdnH, and fdnl.

[0048] Optionally, the at least one gene is further selected from a gene having a Genbank accession number selected from at least one of BAE77040, BAE77039, BAE77038, BAE76090, BAE76091 , BAE76092, BAE77415, BAE77416, BAE77417, BAA15123, BAA15124, and BAA15125.

[0049] Optionally, the at least one gene is further selected from a gene having a Genbank version number selected from at least one of BAE77040.1 , BAE77039.1 , BAE77038.1 , BAE76090.1 , BAE76091 .1 , BAE76092.1 , BAE77415.1 , BAE77416.1 , BAE77417.1 , BAA15123.2, BAA15124.1 , and BAA15125.1.

[0050] Optionally, the at least one gene is selected from at least one of manX, manY, manZ, Glk, ptsG, glcD, glcE, glcF, ykgE, ykgF, ykgG, fdoG, fdoH, fdol, fdnG, fdnH, and fdnl.

[0051] Optionally, the at least one gene is further selected from a gene having a Genbank accession number selected from at least one of BAA15624, BAA15625, BAA15631 , BAA16258, BAA35908, BAE77040, BAE77039, BAE77038, BAE76090, BAE76091 , BAE76092, BAE77415, BAE77416, BAE77417, BAA15123, BAA15124, and BAA15125.

[0052] Optionally, the at least one gene is further selected from a gene having a Genbank version number selected from at least one of BAA15624.1 , BAA15625.1 , BAA15631.1 , BAA16258.1 , BAA35908.1 , BAE77040.1 , BAE77039.1 , BAE77038.1 , BAE76090.1 , BAE76091.1 , BAE76092.1 , BAE77415.1 , BAE77416.1 , BAE77417.1 , BAA15123.2, BAA15124.1 , and BAA15125.1.

[0053] Optionally, the at least one gene is selected from at least one of manX, manY, manZ, Glk, and ptsG; and at least one of glcD, glcE, glcF, ykgE, ykgF, ykgG, fdoG, fdoH, fdol, fdnG, fdnH, and fdnl.

[0054] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAA15624, BAA15625, BAA15631 , BAA16258, and BAA35908; and at least one of BAE77040, BAE77039, BAE77038, BAE76090, BAE76091 , BAE76092, BAE77415, BAE77416, BAE77417, BAA15123, BAA15124, and BAA15125.

[0055] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAA15624.1 , BAA15625.1 , BAA15631.1 , BAA16258.1 , and BAA35908.1 ; and at least one BAE7741

[0056] Optionally, the at least one gene is selected from at least one of manX, manY, manZ, Glk, ptsG, IldD, did, adhP, adhE, ackA, acs, prpE, glcD, glcE, glcF, ykgE, ykgF, ykgG, fdoG, fdoH, fdol, fdnG, fdnH, and fdnl.

[0057] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAA15624, BAA15625, BAA15631 , BAA16258, BAA35908, BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , BAE76117, BAE77040, BAE77039, BAE77038, BAE76090, BAE76091 , BAE76092, BAE77415, BAE77416, BAE77417, BAA15123, BAA15124, and BAA15125.

[0058] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAA15624.1 , BAA15625.1 , BAA15631.1 , BAA16258.1 , BAA35908.1 , BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , BAE76117.1 , BAE77040.1 , BAE77039.1 , BAE77038.1 , BAE76090.1 , BAE76091.1 , BAE76092.1 , BAE77415.1 , BAE77416.1 , BAE77417.1 , BAA15123.2, BAA15124.1 , and BAA15125.1.

[0059] Optionally, the at least one gene is selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, ykgF, fdoH, and fdnH.

[0060] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , BAE76117, BAE77040, BAE76091 , BAE77416, and BAA15124.

[0061] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , BAE76117.1 , BAE77040.1 , BAE76091.1 , BAE77416.1 , and BAA15124.

[0062] Optionally, the at least one gene is manZ.

[0063] Optionally, the at least one gene is a gene having a Genbank accession number BAA15631.

[0064] Optionally, the at least one gene is a gene having a Genbank version number, BAA15631.1.

[0065] Optionally, the at least one gene is Glk.

[0066] Optionally, the at least one gene is a gene having a Genbank accession number BAA16258.

[0067] Optionally, the at least one gene is a gene having a Genbank version number BAA16258.1. Optionally, the at least one gene is ptsG.

[0068] Optionally, the at least one gene is a gene having a Genbank accession number BAA35908.

[0069] Optionally, the at least one gene is a gene having a Genbank version number BAA35908.1.

[0070] Optionally, the at least one gene is selected from at least one of manZ, Glk, ptsg, IldD, did, adhP, adhE, ackA, acs, prpE, glcD, ykgF, fdoH, and fdnH.

[0071] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAA15631 , BAA16258, BAA35908, BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , BAE761 17, BAE77040, BAE76091 , BAE77416, and BAA15124.

[0072] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAA15631.1 , BAA16258.1 , BAA35908.1 , BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , BAE76117.1 , BAE77040.1 , BAE76091.1 , BAE77416.1 , and BAA15124.

[0073] Optionally, the at least one gene is selected from at least one of manZ, Glk, and ptsG.

[0074] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAA15631 , BAA16258, and BAA35908.

[0075] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAA15631.1 , BAA16258.1 , and BAA35908.1.

[0076] Optionally, the at least one gene is further selected from at least one of IldD, did, adhP, adhE, glcD, ykgF.

[0077] Optionally, the at least one gene is further selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAE77040, and BAE76091.

[0078] Optionally, the at least one gene is further selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAE77040.1 , and BAE76091.1.

[0079] Optionally, the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs, glcD, ykgF. Optionally, the at least one gene is further selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , BAE77040, and BAE76091.

[0080] Optionally, the at least one gene is further selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , BAE77040.1 , and BAE76091.1.

[0081] Optionally, the at least one gene is further selected from at least one of IldD, did, adhP, adhE, glcD, ykgF, and fdoH.

[0082] Optionally, the at least one gene is further selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAE77040, BAE76091 , and BAE77416.

[0083] Optionally, the at least one gene is further selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAE77040.1 , BAE76091.1 , and BAE77416.1.

[0084] Optionally, the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, and ykgF.

[0085] Optionally, the at least one gene is further selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , BAE76117, BAE77040, and BAE76091.

[0086] Optionally, the at least one gene is further selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , BAE76117.1 , BAE77040.1 , and BAE76091.1.

[0087] Optionally, the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, ykgF, and fdoH.

[0088] Optionally, the at least one gene is further selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , BAE76117, BAE77040, BAE76091 , and BAE77416.

[0089] Optionally, the at least one gene is further selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , BAE76117.1 , BAE77040.1 , BAE76091.1 , and BAE77416.1. Optionally, the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, ykgF, fdoH, and fdnH.

[0090] Optionally, the at least one gene is further selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , BAE76117, BAE77040, BAE76091 , BAE77416, and BAA15124.

[0091] Optionally, the at least one gene is further selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1, BAA15126.1, BAA36121.1 , BAA16135.1, BAE78071.1, BAE76117.1 , BAE77040.1 , BAE76091.1 , BAE77416.1 , and BAA15124.1.

[0092] Optionally, the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs, glcD, ykgF, fdoH, and fdnH.

[0093] Optionally, the at least one gene is further selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , BAE77040, BAE76091 , BAE77416, and BAA15124.

[0094] Optionally, the at least one gene is further selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , BAE77040.1 , BAE76091.1 , BAE77416.1 , and BAA15124.1.

[0095] Optionally, the host cell further comprises a nucleic acid sequence of at least one gene selected from acs and acs2.

[0096] Optionally, the host cell further comprises an exogenous nucleic acid sequence of at least one gene selected from acs and acs2.

[0097] Optionally, the host cell further comprises an exogenous nucleic acid sequence of acs2.

[0098] Optionally, when the host is a bacterial cell, the bacterial host cell further comprises a yeast nucleic acid sequence of acs2.

[0099] Optionally, when the host is a bacterial cell, the bacterial host cell further comprises a saccharomyces yeast nucleic acid sequence of acs2.

[0100] Optionally, when the host is a bacterial cell, the bacterial host cell further comprises a saccharomyces cerevisiae yeast nucleic acid sequence of acs2.

[0101] Optionally, when the host is a bacterial cell, the bacterial host cell further comprises saccharomyces cerevisiae yeast nucleic acid sequence of acs2 having the Genbank accession number S. S79456. Optionally, when the host is a bacterial cell, the bacterial host cell further comprises saccharomyces cerevisiae yeast nucleic acid sequence of acs2 having the Genbank version number S. S79456.1.

[0102] Optionally, when the host is a bacterial cell, the bacterial host cell further comprises saccharomyces cerevisiae yeast nucleic acid sequence of acs2 having the nucleic acid sequence

[0103] ATGACCATCAAGGAGCATAAGGTGGTTTACGAGGCGCATAATGTGAAAGCGCTGAAAGCG

[0104] CCGCAACACTTCTACAATAGCCAACCGGGTAAAGGCTATGTTACCGACATGCAGCACTAT

[0105] CAAGAGATGTACCAGCAAAGCATCAACGAGCCGGAAAAGTTCTTTGACAAGATGGCGAAA

[0106] GAATATCTGCACTGGGATGCGCCGTACACCAAAGTTCAGAGCGGCAGCCTGAACAACGGT

[0107] GATGTGGCGTGGTTCCTGAACGGCAAGCTGAACGCGAGCTATAACTGCGTGGACCGTCAC

[0108] GCGTTTGCGAACCCGGATAAGCCGGCGCTGATTTACGAGGCGGACGATGAAAGCGACAAC

[0109] AAAATCATTACCTTCGGCGAGCTGCTGCGTAAGGTTAGCCAAATCGCGGGCGTGCTGAAA

[0110] AGCTGGGGCGTTAAGAAAGGTGATACCGTGGCGATCTACCTGCCGATGATTCCGGAAGCG

[0111] GTTATTGCGATGCTGGCGGTGGCGCGTATTGGTGCGATTCACAGCGTGGTTTTCGCGGGC

[0112] TTTAGCGCGGGTAGCCTGAAGGACCGTGTGGTTGATGCGAACAGCAAAGTGGTTATCACC

[0113] TGCGACGAGGGCAAGCGTGGTGGCAAAACCATTAACACCAAGAAAATCGTTGACGAAGGC

[0114] CTGAACGGTGTGGATCTGGTTAGCCGTATTCTGGTGTTCCAGCGTACCGGCACCGAGGGT

[0115] ATCCCGATGAAGGCGGGTCGTGATTATTGGTGGCACGAGGAAGCGGCGAAACAACGTACC

[0116] TACCTGCCGCCGGTTAGCTGCGATGCGGAAGATCCGCTGTTTCTGCTGTACACCAGCGGC

[0117] AGCACCGGTAGCCCGAAAGGTGTGGTTCACACCACCGGTGGCTATCTGCTGGGTGCGGCG

[0118] CTGACCACCCGTTACGTGTTCGACATTCACCCGGAGGATGTTCTGTTTACCGCGGGTGAT

[0119] GTGGGTTGGATCACCGGTCACACCTACGCGCTGTATGGTCCGCTGACCCTGGGTACCGCG

[0120] AGCATCATTTTCGAAAGCACCCCGGCGTACCCGGATTATGGCCGTTACTGGCGTATCATT

[0121] CAGCGTCACAAGGCGACCCACTTTTATGTTGCGCCGACCGCGCTGCGTCTGATTAAGCGT

[0122] GTGGGCGAGGCGGAAATCGCGAAATACGACACCAGCAGCCTGCGTGTTCTGGGCAGCGTG

[0123] GGCGAGCCGATTAGCCCGGATCTGTGGGAGTGGTACCACGAAAAGGTTGGTAACAAAAAC

[0124] TGCGTGATTTGCGACACCATGTGGCAAACCGAAAGCGGCAGCCACCTGATTGCGCCGCTG

[0125] GCGGGTGCGGTTCCGACCAAACCGGGTAGCGCGACCGTGCCGTTCTTTGGTATCAACGCG

[0126] TGCATCATTGACCCGGTGACCGGCGTTGAGCTGGAGGGTAACGATGTGGAGGGCGTTCTG

[0127] GCGGTGAAAAGCCCGTGGCCGAGCATGGCGCGTAGCGTTTGGAACCACCACGACCGTTAT

[0128] ATGGATACCTACCTGAAGCCGTATCCGGGTCACTACTTTACCGGTGATGGTGCGGGTCGT

[0129] GACCACGATGGTTACTATTGGATTCGTGGCCGTGTTGACGATGTGGTTAACGTGAGCGGT

[0130] CACCGTCTGAGCACCAGCGAGATCGAAGCGAGCATTAGCAACCACGAGAACGTTAGCGAA

[0131] GCGGCGGTGGTTGGTATTCCGGACGAACTGACCGGCCAGACCGTGGTTGCGTATGTGAGC

[0132] CTGAAAGATGGTTACCTGCAAAACAACGCGACCGAGGGTGATGCGGAACACATCACCCCG

[0133] GATAACCTGCGTCGTGAGCTGATTCTGCAGGTTCGTGGCGAAATCGGTCCGTTTGCGAGC

[0134] CCGAAGACCATCATTCTGGTGCGTGACCTGCCGCGTACCCGTAGCGGCAAGATCATGCGT

[0135] CGTGTTCTGCGTAAAGTGGCGAGCAACGAGGCGGAACAACTGGGCGATCTGACCACCCTG

[0136] GCGAACCCGGAAGTGGTTCCGGCGATCATCAGCGCGGTGGAGAATCAGTTTTTCAGCCAG AAGAAGAAGTAA. Optionally, when the host is a bacterial cell, the bacterial host cell further comprises saccharomyces cerevisiae yeast nucleic acid sequence of acs2 having the nucleic acid sequence defined by SEQ ID NO 17.

[0137] Optionally, the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, ykgF, fdoH, fdnH, and acs2.

[0138] Optionally, the at least one nucleic acid modification is a nucleic acid mutation.

[0139] Optionally, the at least one nucleic acid modification is a nucleic acid loss-of-function mutation.

[0140] Optionally, the at least one nucleic acid modification is selected from a nucleic acid substitution, a nucleic acid insertion, and a nucleic acid deletion.

[0141] Optionally, the at least one nucleic acid modification is a nucleic acid sequence deletion.

[0142] Optionally, the at least one nucleic acid modification is a gene deletion.

[0143] Optionally, the host cell is cultured in a medium comprising a sole carbon source.

[0144] Optionally, the carbon source is an organic acid.

[0145] Optionally, the carbon source is acetic acid, citric acid, formic acid, succinic acid, propionic acid, lactic acid, optionally L- or D-lactic acid, and conjugate bases or salts each thereof.

[0146] Further optionally, the carbon source is acetic acid, succinic acid, propionic acid, and conjugate bases or salts each thereof.

[0147] Optionally, the carbon source is a sugar; more preferably monosaccharide; most preferably glucose.

[0148] Optionally, the medium further comprises at least one salt.

[0149] Optionally, the medium further comprises acetate, (sodium) citrate, formate, succinate, and / or propionate.

[0150] Further optionally, the medium further comprises acetate, succinate, and / or propionate.

[0151] Optionally, the biosensor comprises a physicochemical detector. Optionally, the physicochemical detector can detect a signal resulting from the contacting of the analyte with the host cell. Optionally, the physicochemical detector can detect a signal resulting from the use of the analyte by the host cell.

[0152] Optionally, the physicochemical detector can detect a signal selected from an optical, piezoelectric, electrochemical, electrical, or electrochemiluminescence signal.

[0153] Optionally, the physicochemical detector can detect a detection analyte.

[0154] Optionally, the physicochemical detector can detect an optical signal. Optionally, the physicochemical detector can detect an optical detection analyte.

[0155] Optionally, the physicochemical detector is a spectrophotometer that can detect an optical signal. Optionally, the physicochemical detector is a spectrophotometer that can detect an optical detection analyte.

[0156] Optionally, the physicochemical detector is a spectrophotometer that can detect an optical signal of the electromagnetic spectrum. Optionally, the physicochemical detector is a spectrophotometer that can detect an optical signal of the electromagnetic spectrum selected from x-ray, ultraviolet, visible, infrared, and / or microwave wavelengths. Optionally, the physicochemical detector is a spectrophotometer that can detect an optical signal of ultraviolet and / or visible wavelengths.

[0157] Optionally, the physicochemical detector can detect an electrochemical signal. Optionally, the physicochemical detector can detect an electrochemical detection analyte.

[0158] Optionally, the physicochemical detector can detect an electrical signal. Optionally, the physicochemical detector can detect an electrical detection analyte.

[0159] Optionally, the physicochemical detector is a voltmeter or a potentiometer that can detect an electrochemical or electrical signal. Optionally, the physicochemical detector is a voltmeter or a potentiometer that can detect an electrochemical or electrical detection analyte.

[0160] Optionally, the physicochemical detector is a voltmeter or a potentiometer that can detect an electrochemical or electrical potential. Optionally, the physicochemical detector is a voltmeter or a potentiometer that can detect an electrochemical or electrical potential caused by an electron resulting from the use of the analyte by the host cell. Optionally, the physicochemical detector is a voltmeter or a potentiometer that can detect an electrochemical or electrical potential caused by an electron resulting from the use of the analyte by the host cell flowing from an anode to a cathode.

[0161] Optionally, the presence, absence or quantity of an analyte in the sample is based on the presence, absence or quantity of a detection analyte. Optionally, the presence, absence or quantity of an analyte in the sample is based on the presence, absence or quantity of a detection analyte that is produced or decreased by the host cell.

[0162] Optionally, the detection analyte is oxygen, optionally dissolved oxygen.

[0163] Optionally, the detection analyte is oxygen, optionally dissolved oxygen, that is decreased by the host cell.

[0164] Further optionally, the detection analyte is oxygen, optionally dissolved oxygen, that is decreased by the host cell by respiring the analyte.

[0165] Optionally, the presence, absence or quantity of an analyte in the sample is based on the presence, absence or quantity of oxygen, optionally dissolved oxygen, in the sample.

[0166] Optionally, the presence, absence or quantity of an analyte in the sample is proportionate on the presence, absence or quantity of oxygen, optionally dissolved oxygen, in the sample.

[0167] Optionally, the presence, absence or quantity of an analyte in the sample is directly proportionate on the presence, absence or quantity of oxygen, optionally dissolved oxygen, in the sample.

[0168] Optionally, the detection analyte is an electron.

[0169] Optionally, the detection analyte is an electron that is produced by the host cell.

[0170] Further optionally, the detection analyte is an electron that is produced by the host cell by oxidising the analyte.

[0171] Optionally, the presence, absence or quantity of an analyte in the sample is based on the presence, absence or quantity of electrons in the sample.

[0172] Optionally, the presence, absence or quantity of an analyte in the sample is proportionate on the presence, absence or quantity of electrons in the sample.

[0173] Optionally, the presence, absence or quantity of an analyte in the sample is directly proportionate on the presence, absence or quantity of electrons in the sample.

[0174] Optionally, the presence, absence or quantity of an analyte in the sample is based on the presence, absence or quantity of an electrochemical or electrical potential caused by electrons in the sample. Optionally, the presence, absence or quantity of an analyte in the sample is based on the presence, absence or quantity of an electrochemical or electrical potential caused by electrons in the sample flowing from an anode to a cathode.

[0175] Optionally, the host cell is immobilised to a probe.

[0176] Optionally, the probe is a probe arranged to detect the presence, absence or quantity of a detection analyte produced by the host cell.

[0177] Optionally, the probe is an oxygen probe, optionally a dissolved oxygen probe.

[0178] Optionally, the sample is contacted with the host cell for at least 15 minutes, optionally at least 30 minutes, optionally at least 1 hour, optionally at least 3 hours, optionally at least 6 hours, optionally at least 12 hours, optionally at least 24 hours, optionally at least 36 hours, optionally at least 48 hours.

[0179] Optionally, the sample is contacted with the host cell for at least 30 minutes - 48 hours, optionally at 1 - 36 hours, optionally 3-36 hours, optionally 6-36 hours, optionally 12-36 hours.

[0180] Optionally, the host cell is a bacterial cell.

[0181] Optionally, the host cell is selected from the phylum Pseudomonadota.

[0182] Optionally, the host cell is selected from the class Gammaproteobacteria.

[0183] Optionally, the host cell is selected from the order Enterobacterales.

[0184] Optionally, the host cell is selected from the family Enterobacteriaceae.

[0185] Optionally, the host cell is selected from the genus Escherichia.

[0186] Optionally, the host cell is selected from the species: Escherichia coli (E. coli).

[0187] Optionally, the host cell is an Escherichia coli (E. coli) strain Escherichia coli K-12, optionally Escherichia coli K-12 W3110.

[0188] Optionally, the biosensor is a sugar biosensor.

[0189] Optionally, the biosensor is a monosaccharide biosensor.

[0190] Optionally, the biosensor is a glucose biosensor. Optionally, the analyte is a sugar.

[0191] Optionally, the analyte is a monosaccharide.

[0192] Optionally, the analyte is glucose.

[0193] Optionally, the biosensor is an organic acid (or conjugate base or salt thereof) biosensor.

[0194] Optionally, the biosensor is an acetic acid, formic acid, succinic acid, propionic acid, lactic acid, optionally L- or D-lactic acid, or conjugate base or salt each thereof biosensor.

[0195] Optionally, the biosensor is an acetate, formate, succinate, or propionate biosensor.

[0196] Optionally, the analyte is an organic acid or conjugate base or salt thereof.

[0197] Optionally, the analyte is selected from acetic acid, formic acid, succinic acid, propionic acid, and conjugate bases or salts each thereof.

[0198] Optionally, the analyte is selected from acetate, formate, succinate, and propionate.

[0199] According to a seventh aspect of the present invention, there is provided a host cell comprising at least one nucleic acid modification in the nucleic acid sequence of at least one gene selected from at least one of IldD, did, adhP, adhE, glcD, ykgF.

[0200] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAE77040, and BAE76091.

[0201] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAE77040.1 , and BAE76091.1.

[0202] Optionally, the at least one gene is selected from at least one of IldD, did, adhP, adhE, ackA, acs, glcD, ykgF.

[0203] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , BAE77040, and BAE76091 . Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1, BAA15126.1 , BAA36121.1, BAA16135.1 , BAE78071.1, BAE77040.1 , and BAE76091.1.

[0204] Optionally, the at least one gene is selected from at least one of IldD, did, adhP, adhE, glcD, ykgF, and fdoH.

[0205] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAE77040, BAE76091 , and BAE77416.

[0206] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAE77040.1 , BAE76091.1 , and BAE77416.1.

[0207] Optionally, the at least one gene is selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, and ykgF.

[0208] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , BAE76117, BAE77040, and BAE76091.

[0209] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , BAE76117.1 , BAE77040.1 , and BAE76091.1.

[0210] Optionally, the at least one gene is selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, ykgF, and fdoH.

[0211] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , BAE76117, BAE77040, BAE76091 , and BAE77416.

[0212] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , BAE76117.1 , BAE77040.1 , BAE76091.1 , and BAE77416.1.

[0213] Optionally, the at least one gene is selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, ykgF, fdoH, and fdnH. Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121, BAA16135, BAE78071, BAE76117, BAE77040, BAE76091 , BAE77416, and BAA15124.

[0214] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , BAE76117.1 , BAE77040.1 , BAE76091.1 , BAE77416.1 , and BAA15124.1.

[0215] Optionally, the at least one gene is selected from at least one of IldD, did, adhP, adhE, ackA, acs, glcD, ykgF, fdoH, and fdnH.

[0216] Optionally, the at least one gene is selected from a gene having a Genbank accession number selected from at least one of BAE77687, BAE76610, BAA15126, BAA36121 , BAA16135, BAE78071 , BAE77040, BAE76091 , BAE77416, and BAA15124.

[0217] Optionally, the at least one gene is selected from a gene having a Genbank version number selected from at least one of BAE77687.1 , BAE76610.1 , BAA15126.1 , BAA36121.1 , BAA16135.1 , BAE78071.1 , BAE77040.1 , BAE76091.1 , BAE77416.1 , and BAA15124.1.

[0218] Optionally, the host cell further comprises a nucleic acid sequence of at least one gene selected from acs and acs2.

[0219] Optionally, the host cell further comprises an exogenous nucleic acid sequence of at least one gene selected from acs and acs2.

[0220] Optionally, the host cell further comprises an exogenous nucleic acid sequence of acs2.

[0221] Optionally, when the host is a bacterial cell, the bacterial host cell further comprises a yeast nucleic acid sequence of acs2.

[0222] Optionally, when the host is a bacterial cell, the bacterial host cell further comprises a saccharomyces yeast nucleic acid sequence of acs2.

[0223] Optionally, when the host is a bacterial cell, the bacterial host cell further comprises a saccharomyces cerevisiae yeast nucleic acid sequence of acs2.

[0224] Optionally, when the host is a bacterial cell, the bacterial host cell further comprises saccharomyces cerevisiae yeast nucleic acid sequence of acs2 having the Genbank accession number S. S79456.

[0225] Optionally, when the host is a bacterial cell, the bacterial host cell further comprises saccharomyces cerevisiae yeast nucleic acid sequence of acs2 having the Genbank version number S. S79456.1. Optionally, when the host is a bacterial cell, the bacterial host cell further comprises saccharomyces cerevisiae yeast nucleic acid sequence of acs2 having the nucleic acid sequence

[0226] ATGACCATCAAGGAGCATAAGGTGGTTTACGAGGCGCATAATGTGAAAGCGCTGAAAGCG

[0227] CCGCAACACTTCTACAATAGCCAACCGGGTAAAGGCTATGTTACCGACATGCAGCACTAT

[0228] CAAGAGATGTACCAGCAAAGCATCAACGAGCCGGAAAAGTTCTTTGACAAGATGGCGAAA

[0229] GAATATCTGCACTGGGATGCGCCGTACACCAAAGTTCAGAGCGGCAGCCTGAACAACGGT

[0230] GATGTGGCGTGGTTCCTGAACGGCAAGCTGAACGCGAGCTATAACTGCGTGGACCGTCAC

[0231] GCGTTTGCGAACCCGGATAAGCCGGCGCTGATTTACGAGGCGGACGATGAAAGCGACAAC

[0232] AAAATCATTACCTTCGGCGAGCTGCTGCGTAAGGTTAGCCAAATCGCGGGCGTGCTGAAA

[0233] AGCTGGGGCGTTAAGAAAGGTGATACCGTGGCGATCTACCTGCCGATGATTCCGGAAGCG

[0234] GTTATTGCGATGCTGGCGGTGGCGCGTATTGGTGCGATTCACAGCGTGGTTTTCGCGGGC

[0235] TTTAGCGCGGGTAGCCTGAAGGACCGTGTGGTTGATGCGAACAGCAAAGTGGTTATCACC

[0236] TGCGACGAGGGCAAGCGTGGTGGCAAAACCATTAACACCAAGAAAATCGTTGACGAAGGC

[0237] CTGAACGGTGTGGATCTGGTTAGCCGTATTCTGGTGTTCCAGCGTACCGGCACCGAGGGT

[0238] ATCCCGATGAAGGCGGGTCGTGATTATTGGTGGCACGAGGAAGCGGCGAAACAACGTACC

[0239] TACCTGCCGCCGGTTAGCTGCGATGCGGAAGATCCGCTGTTTCTGCTGTACACCAGCGGC

[0240] AGCACCGGTAGCCCGAAAGGTGTGGTTCACACCACCGGTGGCTATCTGCTGGGTGCGGCG

[0241] CTGACCACCCGTTACGTGTTCGACATTCACCCGGAGGATGTTCTGTTTACCGCGGGTGAT

[0242] GTGGGTTGGATCACCGGTCACACCTACGCGCTGTATGGTCCGCTGACCCTGGGTACCGCG

[0243] AGCATCATTTTCGAAAGCACCCCGGCGTACCCGGATTATGGCCGTTACTGGCGTATCATT

[0244] CAGCGTCACAAGGCGACCCACTTTTATGTTGCGCCGACCGCGCTGCGTCTGATTAAGCGT

[0245] GTGGGCGAGGCGGAAATCGCGAAATACGACACCAGCAGCCTGCGTGTTCTGGGCAGCGTG

[0246] GGCGAGCCGATTAGCCCGGATCTGTGGGAGTGGTACCACGAAAAGGTTGGTAACAAAAAC

[0247] TGCGTGATTTGCGACACCATGTGGCAAACCGAAAGCGGCAGCCACCTGATTGCGCCGCTG

[0248] GCGGGTGCGGTTCCGACCAAACCGGGTAGCGCGACCGTGCCGTTCTTTGGTATCAACGCG

[0249] TGCATCATTGACCCGGTGACCGGCGTTGAGCTGGAGGGTAACGATGTGGAGGGCGTTCTG

[0250] GCGGTGAAAAGCCCGTGGCCGAGCATGGCGCGTAGCGTTTGGAACCACCACGACCGTTAT

[0251] ATGGATACCTACCTGAAGCCGTATCCGGGTCACTACTTTACCGGTGATGGTGCGGGTCGT

[0252] GACCACGATGGTTACTATTGGATTCGTGGCCGTGTTGACGATGTGGTTAACGTGAGCGGT

[0253] CACCGTCTGAGCACCAGCGAGATCGAAGCGAGCATTAGCAACCACGAGAACGTTAGCGAA

[0254] GCGGCGGTGGTTGGTATTCCGGACGAACTGACCGGCCAGACCGTGGTTGCGTATGTGAGC

[0255] CTGAAAGATGGTTACCTGCAAAACAACGCGACCGAGGGTGATGCGGAACACATCACCCCG

[0256] GATAACCTGCGTCGTGAGCTGATTCTGCAGGTTCGTGGCGAAATCGGTCCGTTTGCGAGC

[0257] CCGAAGACCATCATTCTGGTGCGTGACCTGCCGCGTACCCGTAGCGGCAAGATCATGCGT

[0258] CGTGTTCTGCGTAAAGTGGCGAGCAACGAGGCGGAACAACTGGGCGATCTGACCACCCTG

[0259] GCGAACCCGGAAGTGGTTCCGGCGATCATCAGCGCGGTGGAGAATCAGTTTTTCAGCCAG AAGAAGAAGTAA. Optionally, when the host is a bacterial cell, the bacterial host cell further comprises saccharomyces cerevisiae yeast nucleic acid sequence of acs2 having the nucleic acid sequence defined by SEQ ID NO 17.

[0260] Optionally, the at least one gene is selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, ykgF, fdoH, fdnH, and acs2.

[0261] According to an eighth aspect of the present invention, there is provided a multi-analyte biosensor comprising at least one host cell according to the present invention.

[0262] According to a ninth aspect of the present invention, there is provided a method of producing a multianalyte biosensor, the method comprising the steps of providing at least one host cell according to the present invention.

[0263] According to a tenth aspect of the present invention, there is provided a method of identifying, optionally simultaneously identifying the presence, absence or quantity of multiple analytes in a sample, the method comprising contacting the sample with at least one host cell of the present invention.

[0264] Brief description of the drawings

[0265] Embodiments of the present invention will be described with reference to the accompanying drawings, in which:

[0266] Figure 1 illustrates change in voltage rate measured at 30 minute intervals over a 36 hour period for the E. coli K-12 W3110 control biosensor which was provided with 200 - 1000 pL stock solutions;

[0267] Figure 2 illustrates change in voltage rate measured at 30 minute intervals over a 36 hour period for the E. coli K-12 JSK0076 exclusion biosensor which was provided with 200 - 1000 pL stock solutions;

[0268] Figure 3 illustrates Change in voltage rate measured at 30 minute intervals over a 36 hour period for the E. coli K-12 JSK0076 exclusion biosensor which was provided with 200 - 1000 pL stock solutions;

[0269] Figure 4 illustrates iterative design of biosensors, wherein following chemical analysis of leachate, E. coli was immobilised and assessed for its response to the different leachate components by assessing oxygen uptake, wherein a positive response means the biosensor needs to be genetically manipulated and the success of is determined by remeasuring the oxygen uptake, and wherein the process is repeated until the biosensor responds only to the key metabolites in the leachate; Figure 5 illustrates O2 uptake with P1 biosensor using the Vernier dissolved oxygen probe, when exposed to propionate (P), a mixture of propionate and acetate (P + A) and two different volumes of biological leachate influent (P15a), wherein the concentration of propionate in P15a, calculated using Eq 1 , matches that determined by HPLC and validates the biosensor accuracy and specificity;

[0270] Figure 6 illustrates O2 uptake by the acetate biosensors (A) JSK0042 / pGDR11-acsand (B) JSK0042 / pGDR11 -acs2 using the Vernier dissolved oxygen probe, wherein replacement of E. coli Acs with Acs2 from S. cerevisiae improved the selectivity of the biosensor to acetate and enabled the accurate measurement of acetate in biological leachate (P15a);

[0271] Figure 7 shows Vernier dissolved oxygen probe tip adjustments that are needed to fix in place cellulose membranes onto which E. coli biosensor cells have been attached, showing (a) Vernier probe tip with protruding bevels; (b) Vernier probe tip after bevels have been removed by scalpel; (c) fixing of a mixed cellulose acetate membrane to the probe tip using parafilm wrap; and (d) perforated steel guard that is fixed in place on top of the fixed cellulose acetate membrane with parafilm wrap, to protect the exposed tip;

[0272] Figure 8 illustrates formate (F)-, glucose (G)- and acetate (A)-O2 consumption responses for Glucose- (E3, E3::AFdoH and JSK0042) and acetate (A1 and A1 ::FdoH)-exclusion biosensors created using an Orion 5 star DO probe, showing (a) E3 glucose exclusion biosensor; (b) A1 acetate exclusion biosensor; (c) E3::AFdoH glucose exclusion biosensor; (d) A1 ::AFdoH acetate exclusion biosensor; and (e) JSK0042 glucose exclusion biosensor, wherein although, glucose and acetate responses remain constant for the respective glucose and acetate exclusion biosensors, the response to formate is fully removed with the removal of fdoH in acetate grown E. coli and both fdoH and fdnH in glucose grown E. coli; and

[0273] Figure 9 illustrates 02 uptake by the acetate biosensors A1 using the Vernier dissolved oxygen probe, wherein a significant response can be observed for 1 mM propionate (P) when compared to 0.4 mM acetate (A), which comparable propionate and acetate response is possibly a result of the promiscuity of E. coli’s Acs.

[0274] Examples

[0275] Embodiments of the present invention will now be described by reference to the following nonlimiting examples:

[0276] Materials and Methods

[0277] Strains, culture conditions and gene knockouts The strains, plasmids, and P1Vir phages that were used to create the respective E. co / / ' knockout strains are shown in Table 1.

[0278] Methods for gene knockout were as described in J. Sweeney, C.D. Murphy, K. McDonnell, Towards an effective biosensor for monitoring AD leachate: a knockout E. coll mutant that cannot catabolise lactate, Appl. Microbiol. Biotechnol. 99 (2015). https: / / doi.org / 10.1007 / s00253-015-6887-4. Briefly, a P1 vir phage lysate was generated from a Keio Collection strain in which the target gene has been replaced with a kanamycin cassette flanked by flippase recognition targets (FRT). P1 phage transduction replaced the wild type gene in the host E. co / / ' strain with the kanamycin cassette, which was subsequently removed by homologously recombining its FRT sites using the pCP20 helper plasmid. After the heat labile pCP20 plasmid was removed the knockout was confirmed by PCR using gene specific primers provided by Baba et al (T. Baba, T. Ara, M. Hasegawa, Y. Takai, Y. Okumura, M. Baba, K. a Datsenko, M. Tomita, B.L. Wanner, H. Mori, Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection., Mol. Syst. Biol. 2 (2006). https: / / doi.org / 10.1038 / msb4100050). Cell cultivation and cell extraction were similar to that described in J.B. Sweeney, C.D. Murphy, K. McDonnell, Development of a bacterial propionate- biosensor for anaerobic digestion monitoring, Enzyme Microb. Technol. 109 (2017) 51-57. https: / / doi.Org / 10.1016 / j.enzmictec.2017.09.011 , with some modifications.

[0279] The cell cultivation minimal media previously used was replaced with M9 minimal medium (6.8 g Na2HPC>4, 3 g KH2PO4, 0.5 g NaCI, 1 g (NH4)2SO4 and 1 mL SL-10 salts per litre) adjusted to pH 7 and autoclaved. Before being inoculated, the medium was supplemented with filter sterilised MgSC (0.4 mM), mM CaCl2 (0.1 mM) and one or more organic acids as the carbon source. Starter cultures in which 4 mL TSB was inoculated with a single colony and grown for 17 - 48 hours at 37°C were used as inocula. The volume of inoculum required varied depending on the experiments: for growth in minimal medium (100 mL) containing 30 mM organic acid or for JSK0042 / pGDR11 -acs, which required 20 mM acetate and 5 mM succinate, 4 mL inoculum was required; 1 mL was used to inoculate 100 mL of TSB. Growth of JSK0042 / pGDR11 -acs2 in 10 mM acetate required an inoculum of 2 mL TSB supplemented with sodium citrate (20 mM) and thiamine (5 pg). Cultures were incubated at 37 °C, except those growing in acetate, propionate or acetate and succinate, which were incubated at 30 °C.

[0280] Saline PBS (pH 7), instead of Tris-buffer, was used to extract and resuspend biosensor cells, submerge biosensors (20 mL) and maintain them overnight (4°C). Previously, cells were harvested at ODeoo of 1 .4 - 1 .6 with 20 mg wet cells mL1and immobilised onto the membrane surface (see J.B. Sweeney, C.D. Murphy, K. McDonnell, Development of a bacterial propionate-biosensor for anaerobic digestion monitoring, Enzyme Microb. Technol. 109 (2017) 51-57. https: / / doi.Org / 10.1016 / j.enzmictec.2017.09.011 ), whereas here JSK0042 / pGDR11 -acs2 was harvested at OD60o 0.35 - 1 .0 while all other cells were extracted between 0.9 - 1 .4. Unless stated otherwise, cell suspensions of 40 mg wet cells mL1were prepared and 200 to 500 pL immobilised onto the membrane surface.

[0281] As described in J. Sweeney, C.D. Murphy, K. McDonnell, Towards an effective biosensor for monitoring AD leachate: a knockout E. coli mutant that cannot catabolise lactate, Appl. Microbiol. Biotechnol. 99 (2015). https: / / doi.org / 10.1007 / s00253-015-6887-4, E. co / / 'knockout strains are created using; (a) donor microorganism in which a targeted wild type gene is replaced with a kanamycin cassette flanked by flippase recognition targets (FRT), (b) a P1Vir phage lysate (vector) and (c) a P1Vir phage transduction procedure. In this previously published study, the donor microorganism was a Keio Collection strains (donor microorganism) procured from the Coli Genetic Stock Centre, Yale University. However, in the present invention, donor microorganisms were also produced directly, by applying the method developed by K. a Datsenko, B.L. Wanner, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products., Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 6640-6645. https: / / doi.org / 10.1073 / pnas.120163297.

[0282] Example 1

[0283] Creation of W3110 E. coli gene knockout donor strains by PCR products and red meditated recombination

[0284] The technique developed by K. a Datsenko, B.L. Wanner, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products., Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 6640- 6645. https: / / doi.org / 10.1073 / pnas.120163297 that was applied to create E. coli gene knockout donor strains is briefly described below. For each gene knockout, 50 bp primers were designed that contain (a) homologous extensions that correspond to regions adjacent to the wild type E. coli gene that is to be removed and (b) priming sequences that correspond the the FRT flanked kanamycin cassette present within the pKD13 plasmid template. The resulting 1.4 kbp linear PCR products were purified using a agarose gel extraction kit and linearly transformed into E. coli K-12 W3110 recipient strains that had been transformed with the pKD46 plasmid containing the L-arabinose inducible Red recombinase. Expression of pKD46’s Red recombinase, facilitated Red-mediated recombination between the E. coil’s chromosome and the 1 .4 kbp linear DNA’s homologous extensions. The replacement of the donor strain’s targeted wild type gene with the FRT flanked kanamycin cassette, was confirmed by PCR. This method was used to create the three glucose catabolic knock out donor strains W311 O'.'.manZ^", W3110::glKKan, W3110 ptsKanthat were subsequently used to create the JSK0043 and JSK0076 AmanZ Aglk AptsG triple knockout strains from JSK0042 and W3110, respectively.

[0285] Table 6. Primers (Eurofins Genomics) to a.) create the linear DNA PCR products used for targeted inactivation of chromosomal genes in Escherichia coli K-12 by red meditated recombination and b.) verification of gene knockout by red meditated recombination and P1 phage transduction.

[0286] Example 2

[0287] Methods applied to create E. coll knockout strains containing one or more wild type gene knockouts using E. coli gene knockout donor strains

[0288] Once a donor strain in which a targeted wild type gene had been replaced with FRT flanked kanamycin cassettes, has been obtained, it is used to create a gene knockout specific P1 vir phage lysate. A W3110 E. coli recipient strain in which, its wild type gene is to be removed (recipient microorganism), is P1 transduced with a corresponding gene knockout P1Vir phage lysate vector. Successful P1 phage transduction results in the recipient E. co / / ' strain’s wild type gene being replaced with the FRT flanked kanamycin cassette mutant gene. A successful gene knockout is confirmed by selective growth on tryptic soy agar (TSA) containing 50-100 pg mU1kanamycin antibiotic and by PCR - using gene specific primers provided by Baba et al. (T. Baba, T. Ara, M. Hasegawa, Y. Takai, Y. Okumura, M. Baba, K. a Datsenko, M. Tomita, B.L. Wanner, H. Mori, Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection., Mol. Syst. Biol. 2 (2006). https: / / doi.org / 10.1038 / msb4100050). To allow subsequent targeted gene knockouts to be applied, the kanamycin cassette needs to be removed. This is achieved by homologously recombining the kanamycin cassette’s FRT sites using the pCP20 helper plasmid as described by K. a Datsenko, B.L. Wanner, One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products., Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 6640-6645. https: / / doi.org / 10.1073 / pnas.120163297. The verification by PCR of a 110 bp scar residue, is evidence that successful kanamycin cassette removal has occurred. The heat labile pCP20 plasmid is then removed by repeated subculturing at 37-42°C. Successful removal of the pCP20 plasmid is confirmed by the inability of the resulting E. coli strain to grow on TSA plates containing 100 pg mb1ampicillin. At this point, subsequent wild type gene knock outs can be applied to the same strain by repeating the steps outlined above. The creation of JSK0043 and JSK0076 from JSK0042 and W3110, respectively, was achieved by repeating the above steps until all three glucose catabolisng genes manZ, glk and ptsG were knocked out.

[0289] Example 3

[0290] Removal of catabolic pathways that resulted in the creation of the JSK0043 and JSK0076 glucose exclusion biosensor strains

[0291] Applying the methods described above, resulted in two E. coli K-12 W3110 derivatives designated JSK0076 and JSK0043 which with the wild type E. coli W3110 (control strain) were grown on 5 g U1succinic acid as a sole carbon source, immobilised onto separate dissolved oxygen probes and immersed in a beaker containing fresh 20 mL PBS buffer (biosensor working volume) that was changed upon completion of each biosensor reading, every 30 minutes. The exclusion biosensors’ performances were assessed in Figure 1 - Figure 3 for a 24 hour period between the biosensor’s 12 to 36 hour operational window. Within this 24 hour period, 200 - 1000 pL volumes of the three stock solutions listed below, were supplied to the biosensor working volume at 30 minute intervals: o 5 g L'1glucose, o 5 g L1succinate, o synthetic leachate (10 g L1L-lactic-, 10 g L1D-lactic-, 5 g L1acetic, 5 g L1propionic-, 2.5 g L1formic-, 1 g L1Butyric-, 1 g L1valeric-acid and 5 g L1Ethanol) + 5 g L1glucose

[0292] As described in J.B. Sweeney, K. Mcdonnell, C.D. Murphy, Enzyme and Microbial Technology Improving the specificity of E . coli acetate / propionate exclusion biosensors via iterative engineering, Enzyme Microb. Technol. 160 (2022) 110091. https: / / doi.Org / 10.1016 / j.enzmictec.2022.110091 , the exclusion biosensor’s ability to catabolise a specific analyte, is presented as an O2 consumption rate (mg 02 min-1); which is calculated by applying a conversion factor to the dissolved oxygen probe’s 1 second interval - raw voltage signal data, that is collected for a 120 second period at 30 minute intervals. In Figure 1 - Figure 3, the exclusion biosensor’s ability to catabolise analytes present within 200 - 1000 pL volumes of the three stock solutions, is calculated slightly differently from the previously described method, in that, a change in voltage rate (mV s1) is calculated directly from the dissolved oxygen probe’s 1 second interval - raw voltage signal data as opposed to applying a conversion factor to the raw voltage signal data to calculate the O2 consumption rate.

[0293] It is evident from the strong 2.5 - 2 mV s1change in voltage rate elicited by the W3110 control strain when provided with 1000 pL 5 g L1glucose and 500 pL of the 5 g L1succinic acid (positive control), that the wild type E. coli W 3110 experiences significant interference from glucose and as such, any biosensor created from this strain would suffer from interference if glucose is present within samples supplied to the biosensor. The knocking out of ptsG, glk and ManZ within JSK0076 and JSK0043, fully inactivated the glucose-specific phosphotransferase system (PTS), glucokinase and mannosespecific PTS, respectively. Although, the removal of the ptsG and glk genes fully inactivated the glucose-specific PTS and glucokinase, respectively, the mannose-specific PTS (ManXYZ) which consists of three subunits that are expressed by the manX, any & manZ genes, was inactivated by removing the manZ gene. However, ManXYZ can be inactivated by knocking out any one of these three genes and as such any microorganism in which one or any combination of PtsG, Glk, ManX, ManY and ManZ is knocked out can be used to create a biosensor strain with the aim of reducing its ability to respond to glucose.

[0294] Due to the inactivation of PtsG, Glk and ManXYZ in both JSK0076 and JSK0043, it was possible to create exclusion biosensors that exhibit no or severely reduced responses to 1000 pL - 5 g L1glucose (see Figure 2 and Figure 3) when compared to the wild type E. co / / ' W3110 strain (see Figure 1 ). For this reason, biosensors can be created from strains in which one or more of the following PtsG, Glk and ManXYZ glucose catabolising pathways have been removed, or from microorganisms in which one or more of the same genes have been removed.

[0295] JSK0076 and W3110 differed from JSK0043 in that when even a small volume of 200 pL synthetic leachate + 5 g L1glucose was provided to the respective exclusion biosensors, a very strong change in voltage rate that exceeded that of the 1000 pL 5 g L1succinic acid positive control, was produced for both (see Figure 1 and Figure 2). The JSK0043 strain, exhibited no response to either the synthetic leachate or glucose components of the synthetic leachate + 5 g L1glucose sample, which is evident from the lack of response to 1000 pL synthetic leachate + 5 g L1glucose or 1000 pL 5 g L'1glucose in Figure 3. The reason for this lack of response when compared to JSK0076 in Figure 2, is that in addition to PtsG, Glk and ManXYZ being inactivated within JSK0043, catabolic pathways that correspond to all organic acids present within the synthetic leachate were removed from E. coll in a previous study to create JSK0042 (see J.B. Sweeney, K. Mcdonnell, C.D. Murphy, Enzyme and Microbial Technology Improving the specificity of E . coli acetate / propionate exclusion biosensors via iterative engineering, Enzyme Microb. Technol. 160 (2022) 110091. https: / / doi.Org / 10.1016 / j.enzmictec.2022.110091), and from which JSK0043 was created. The removal of these catabolic pathways means that the resulting JSK0043 biosensor strain is incapable of catabolising all organic acids found within the synthetic leachate and glucose For this reason, JSK0043, its derivatives, or microorganisms in which one or more of the same genes have been removed are also possible and useful.

[0296] Catabolic pathways removed to create JSK0042 from which JSK0043 is created: L-lactate dehydrogenase (IldD), D-Lactate dehydrogenase (did), alcohol dehydrogenase (adhP), alcohol dehydrogenase (adhE), acetate kinase (ackA), acetyl-coA synthetase (acs) and propionyl-coA snthetase (prpE), were inactivated within JSK0043 by performing a corresponding single gene knockouts. Although, D-lactate / glycolate dehydrogenase (glcDEF), L-lactate dehydrogenase (ykgEFG), formate dehydrogenase O (fdoGHI) and fomate dehydrogenase N (fdnGHI) were inactivated by knocking out gldD, ykgF, fdoH and fdnH within JSK0043, respectively, knocking out any one of their three subunit genes will result in a similar inactivation. All of the dehydrogenase subunit genes listed above, are presented in Table 2.

[0297] Table 2. GenBank accession and version numbers of all E. coli K-12 W3110 genes

[0298] Example 4 Creating the JSK0042 / pGDR11-acs and JSK0042 / pGDR11-acs2 acetate biosensor “plug-in” strains The acetyl-CoA Synthetase (Acs2) gene from Saccharomyces cerevisiae was codon optimised for E. coli and cloned into a pET-28b(+) expression vector by GenScript (Piscataway, NJ, USA). As E. coli JSK0042 does not possess a T7 RNA polymerase, expression of this gene and E. con's native acs required an expression vector that possesses an IPTG inducible T5 promoter (pGdr-11 ). Creation of the pGDR11 -acs and -acs2 expression vectors required acs to be linearly amplified from E. coli W3110 by colony PCR, while acs2 was linearly amplified using the pET-28b(+)-acs2 plasmid as the template DNA. To clone the linear DNA fragments into pGDR-11 , primers that provided flanking sequences for pGdr-11 's BamHI and Hindi 11 restriction sites were used (see Table 3). Cloned plasmids were transformed into JSK0042 yielding the JSK0042 / pGDR11 -acs and JSK0042 / pGDR11 -acs2 strains. JSK0042 / pGDR11 -acs was cultivated in 4 mL TSB which was supplemented with sodium citrate (20 mM) and thiamine (5 pg) for JSK0042 / pGDR11 -acs2. This was used to inoculate flasks containing 100 mL M9 medium plus organic acids. Expression of acs and acs2 was induced by adding 50 pg L1isopropyl-p-D-thiogalactoside (IPTG) at time zero.

[0299] Table 3. Primers (Eurofins Genomics) used to linearly amplify acetyl-CoA synthetases to be cloned into the pGDR-11 expression plasmid using the BamHI and Hindlll restriction sites

[0300] Primer Description

[0301] Example 5

[0302] Biological leachate

[0303] Sludge collected from an anaerobic digestor configured to digest lignocellulosic material (as described in E.M. Prem, M. Mutschlechner, B. Stres, P. Illmer, A.O. Wagner, Lignin intermediates lead to phenyl acid formation and microbial community shifts in meso- and thermophilic batch reactors, Biotechnol. Biofuels. 14 (2021 ) 1-23. https: / / doi.org / 10.1186 / s13068-020-01855-0) was filter pressed and re-digested at lab-scale. The influent and effluent from this re-digestion process was kindly provided with corresponding chemical analysis by Dr. Andreas Wagner, University of Innsbruck, Austria. Volatile fatty acids (VFAs), lactate and formate concentrations were assessed by HPLC as described in A.O. Wagner, R. Markt, T. Puempel, P. Illmer, H. Insam, C. Ebner, Sample preparation, preservation, and storage for volatile fatty acid quantification in biogas plants, Eng. Life Sci. 17 (2017) 132-139. https: / / doi.org / 10.1002 / elsc.201600095.

[0304] Example 6

[0305] Assembly of dissolved oxygen probes

[0306] Dissolved oxygen measurements were taken using either a Thermo Scientific Orion® 5 star 083010MD (Waltham, MA, USA)- or DO-BTA Vernier® (Beaverton, OR, USA)-dissolved oxygen probe, onto which bacterial cells that were initially trapped under vacuum on cellulose membranes, were carefully cut and fixed onto the top of the probe tips using parafilm wrap as described in J.B. Sweeney, C.D. Murphy, K. McDonnell, Development of a bacterial propionate-biosensor for anaerobic digestion monitoring, Enzyme Microb. Technol. 109 (2017) 51-57. https: / / doi.Org / 10.1016 / j.enzmictec.2017.09.011. For both probe types, mixed cellulose esters membranes with a pore size of 0.45 pm (GE Healthcare) were used. For the Vernier dissolved oxygen probe the protective bevels were removed to facilitate membrane attachment and the exposed tip was protected using perforated steel guards (see Figure 7).

[0307] The raw voltage signals that were produced by the Vernier DO probes were captured at one second intervals by an Arduino Uno Rev3 using Vernier’s Arduino BT-ARD interface shield (see Figure 7). The raw voltage signals were then converted into mg O2 L1using Vernier’s “VernierLib” Arduino library which provides a linear calibration sketch, specific to DO-BTA raw voltage signals. For each biosensor sample, O2 readings that were produced at one second intervals were logged by a PC to a delaminated .TXT file. The data contained within the.TXT files for specific time intervals were then plotted together via a R program plotting function, which enabled a variable delay factor (DF) to be applied, thus ensuring that O2 consumption rates between catabolites could be compared. O2 consumption rates were calculated from the linear portion of the O2 consumption response, which occurred at two- to three-fifths the difference between the initial O2 consumption response (maximum) and minimum dissolved oxygen concentrations, in mg L1as described in J.B. Sweeney, C.D. Murphy, K. McDonnell, Development of a bacterial propionate-biosensor for anaerobic digestion monitoring, Enzyme Microb. Technol. 109 (2017) 51-57. https: / / doi.Org / 10.1016 / j.enzmictec.2017.09.011. Means were calculated from at least duplicate measurements while standard deviations were calculated from at least triplicates.

[0308] Example 7

[0309] Calculating biologically available acetate and propionate within biological leachates

[0310] To be able to efficiently estimate the mM of biologically available catabolite within a biological leachate sample, the following equation was applied: where mM standard is the concentration of the standard; mg 02 min1catabolite is the initial O2 consumption response for the BL; mg 02 min1standard is the initial O2 consumption response for the standard; mL catabolite is the volume of the BL sample; and the total working volume is 20 mL.

[0311] Example 8

[0312] Knock out of key genes for formate catabolism is necessary to create AD biological leachate reference biosensors

[0313] A synthetic leachate can be used to assess oxygen consumption by acetate and propionate biosensors. However, authentic biological leachate is likely to contain other compounds that might interfere with the biosensor. Biological leachate from an AD reactor treating lignocellulosic material, before and after re-digestion was collected and its composition determined by HPLC (see Table 4), providing a realistic model leachate that was used to refine the biosensor further.

[0314] Table 4. The concentrations of volatile fatty acids (VFA) in biological leachate influent (P15a) and effluent (P15b) from an AD reactor treating lignocellulosic material.

[0315] Influent Effluent

[0316] VFA (mM) (mM)

[0317] Acetate 26.6 1.76

[0318] Propionate 70.2 0.88

[0319] Iso-butyrate 17.88 0.36

[0320] Iso-valerate 32.04 2.84

[0321] Valerate 58.24 6.64

[0322] Lactate 0.56 0.44

[0323] Formate 0.6 1.16

[0324] There were several compounds detected that were not present in previously used synthetic leachate. The VFAs isobutyrate, isovalerate and valerate were present in relatively high concentrations; however, wild type E. coli cannot catabolise these compounds, which is one reason why this bacterium is a promising whole cell biosensor. However, formate, which is a significant component of a number of anaerobic digestion leachates, was detected and its ability to cause reference biosensor interference needed to be assessed. Following the steps outlined in Figure 4, E. coli strains A1 , which was developed previously as an acetate biosensor strain and E3, which is incapable of catabolising either acetate or propionate (see Table 1 ), were initially investigated for their ability to grow on formate as a sole carbon and energy source. Both failed to grow, which is consistent for wild type E. coli, but this did not rule out the possibility of the cells co-metabolising formate and consuming oxygen.

[0325] Therefore, E3 and A1 cells were grown on alternative carbon sources (TSB and acetate, respectively) and used as the biological element of biosensors that were then exposed to formate. As shown in Table 5, Figure 8(a) and Figure 8(b), O2 uptake was greater for both biosensors when formate was present compared to either acetate or glucose. The E3 biosensor had O2 consumption rates of 1 .96 and 1 .99 mg O2 min1for 1 mM glucose and formate, respectively and the A1 acetate biosensor had O2 consumption rates of 2.38 and 2.50 mg O2 min1for 0.45 mM acetate and 0.5 mM formate, respectively. Therefore, these biosensors are not suitable to use for the measurement of other catabolites in biological leachates that contain even small concentrations of formate. To enable the application of E. coli biosensors to measure catabolites, such as acetate, in biological leachates, their ability to catabolise formate must be removed.

[0326] Table 5. O2 consumption by E. coli biosensors upon exposure to different substrates after growth on either acetate (A1 ) or tryptone soya broth (E3) and immobilised on the Thermo Scientific Orion® 5 star dissolved oxygen probe. The concentrations of the substrates varied in the experiment and are detailed in the text. The O2 uptake curves are shown in the SI. a Not measured

[0327] E. coli possess three membrane-bound formate dehydogenases FDH-O, FDH-N and FDH-H, which are encoded by fdoGHI, fdnGHI and fdhF, respectively. As FDH-0 has been proposed as being the primary mechanism by which E. coli oxidises formate (FdOx), E3 and A1 fdoH knockout mutants designated E3 AfdoH and A1 AfdoH, were created, grown on TSB or 30 mM acetate, and immobilised as glucose and acetate exclusion biosensors, respectively. The A1 AfdoH acetate exclusion biosensor exhibited little or no formate:C>2 consumption response even when formate was provided at 20 times the concentration of acetate (see Table 5 and Figure 8(d)). In contrast, the E3 AfdoH glucose exclusion biosensor (see Figure 8(c)) performed almost identically to that of E3, with O2 consumption rates of 1 .87 and 2.32 mg O2 min1for 1 mM glucose and 1 mM formate, respectively. Therefore, a further analysis of the catabolic pathways responsible for eliciting formate:C>2 consumption responses in E3 AfdoH cells was required. FDH-0 and FDH-N’s high sequence homology and their comparable formate Km values (120 pM and 160 ±20 pM (Sawers, 2005; Sousa, Videira and Melo, 2013)) meant that the removal of FDN-H was intuitively the next step in removing glucose-grown E3 AfdoH cells’ ability to catabolise formate. A double E3 AfdoHAfdnH knockout mutant, designated JSK0042, was created, grown on TSB and immobilised as before. The formated consumption responses in the glucose grown JSK0042 cells were completely abolished even when formate was present in excess of 20 times the concentration of glucose (see Table 5 and Figure 8(e)). The remaining formate dehydrogenase, FDH-H, did not interfere with the assay. A possible explanation for this is that the enzyme functions under anaerobic conditions and the fdhfgene is repressed in the presence of oxygen.

[0328] Example 9

[0329] Formate exclusion enabled accurate propionate detection in biological leachate

[0330] Further manipulation of the previously reported propionate biosensor strain (W:ldgyepak, see Table 1 ) was needed to be able to accurately measure propionate concentrations in the biological leachate. By applying the double FDH-0 and FDH-N knockouts described above to W:ldgyepak, the propionate biosensor strain P1 was created (see Table 1 ), which was grown on 30 mM propionate, harvested and immobilised as a propionate biosensor using the Vernier dissolved oxygen probe. The O2 uptake was measured with varying concentrations of propionate and acetate, which enabled calibration of the probe and the concentration of acetate and propionate in the biological leachate influent (P15a), determined.

[0331] Figure 5 shows the O2 uptake response when the P1 biosensor was exposed to propionate, a mixture of propionate and acetate and two different volumes of influent leachate (P15a). The biosensor gave no response when exposed to much larger amount of acetate and produced identical responses with the propionate only and a mixture of propionate and acetate. Two different volumes were employed to provide a greater degree of confidence in the biosensor measurement. Each volume was aligned with the closest standard to allow for calculation of the propionate concentration using Eq. 1 ; the average concentration of the two measurements (65.5 mM) compares favourably to the concentration detected by HPLC (70 mM, see Table 4) thereby validating the biosensor for measuring propionate in biological leachates. It should be acknowledged that by already knowing the concentration of propionate in leachate it was possible to gauge what volume to use for the biosensing in the current experiments, but it is also possible to titrate the leachate so that an appropriate volume is employed. The ability to conduct biosensor readings every thirty minutes coupled with the biosensor’s stability of two to four days, means that for applications where the concentration of analytes present within biological leachates is unknown, the application of a titration step to assess the volume of leachate that will fall within a biosensor’s detection range is practically possible. Example 10

[0332] Acetyl CoA synthetase modification is essential for acetate-specific biosensing

[0333] The strain JSK0042, from which FDH-0 and FDH-N were removed, was assessed as an acetate biosensor after the native Acs (acetyl CoA synthetase) was cloned in a high expression plasmid and the strain transformed generating JSK0042 / pGDR11-acs. The strain grew poorly on acetate as its sole carbon source and as such was grown on 20 mM acetate supplemented with 5 mM succinate. These cells were harvested and used as a biosensor to measure O2 uptake upon exposure to acetate and propionate. There was an unexpectedly high 02-uptake recorded with 10 mM propionate (1.93 mg O2 min1), which was between that of 0.4 mM (1.122 mg O2 min1) and 1 mM (2.841 mg O2 min1) acetate (see Figure 6(A)). A1 cells (see Table 1) immobilised as an acetate biosensor exhibit only slightly increased O2 consumption responses for combined acetate and propionate. The difference in the measurements observed might be as a result of modifications made to the DO probe set-up, as the same A1 cells tested under the current conditions now produced a comparable O2 uptake with 0.4 mM acetate and 1 mM propionate (2.96 and 2.505 mg O2 min1, respectively) (see Figure 9). The biochemical reason for the response to propionate was possibly a result of the promiscuity of E. coli’s Acs, since it has been reported that propionate was also a substrate for the enzyme albeit with a rate that is 20% that of acetate. This would account for the response that was observed in the present invention and since the biosensor cannot reliably detect acetate if propionate is also present, modifications to the Acs were undertaken to improve selectivity for acetate.

[0334] One possible approach to improving Acs selectivity was to replace the E. coli enzyme with one that was known to have a much lower activity towards propionate. A secondary acetyl-CoA synthetase in Saccharomyces cerevisiae has propionate activity that is only 0.1% that of acetate, so this gene, acs2, was codon optimised, cloned into a pGDR11 and transformed into E. coli JSK0042, generating a strain (JSK0042 pGDR11 -acs2) in which the wild type Acs is replaced with Acs2 from yeast. This strain was grown on acetate as a sole carbon source and extensively tested on acetate-only, propionate-only, combined acetate and propionate and P15a (see Figure 6B). The response of JSK0042 / pGDR11 -acs2 to propionate (0.65 mM) was much less than that of the lowest concentration of acetate (0.15 mM), which is consistent with Acs2’s reduced ability to catabolise propionate. JSK0042 / pGDR11-acs2 is a much more appropriate acetate exclusion biosensor strain than JSK0042 / pGDR1 l -acs and was employed to measure acetate in the biological leachate. The O2 uptake response for 160 pL P15a (2.062 mg O2 mL1) aligned almost exactly to that of 0.2 mM acetate (1.934 mg O2 mb1) and as such only a single volume of P15a was assessed in triplicate. By applying Eq. 1 to 160 pL P15a and the 0.2 mM acetate standard, the concentration of biologically available acetate equated to 26.5 mM which is almost identical to what was detected using HPLC (26.6 mM, see Table 4). The present invention is based on the modification of previously developed propionate and acetate biosensors to improve selectivity, as one way to improve the selectivity of whole cell biosensors, thereby broadening their application, is to genetically tailor the catabolism of a bacterium to ensure precise removal and addition of catabolic activities. Thus, highly specific whole cell biosensors that are inexpensive and simple to operate are feasible.

[0335] The genetic modification of Escherichia coli to generate propionate and acetate exclusion biosensors, which, when attached to an oxygen electrode, accurately determine the concentration of the metabolites in a synthetic leachate. However, to fully assess their capabilities beyond the laboratory setting, testing on authentic AD biological leachates is required, since the chemical composition of these will vary depending on both the input substrate used and the biological process applied. These differences result in biological leachates possessing diverse catabolite profiles, which might interfere with any whole cell biosensor.

[0336] The present invention is based on the further development of reference exclusion biosensors that were designed in an iterative manner as shown in Figure 4, following chemical analysis of biological leachate. To determine if the compounds interfered with the whole cell biosensor, they were either employed as potential growth substrates, or their catabolism directly assessed by measuring oxygen uptake by E. coli cells. If a compound was identified as one that interfered with the biosensor, the key gene(s) required for its catabolism were deleted from the bacterial genome. The improvement of previously developed acetate and propionate biosensors can be achieved by modifying E. coli o prevent formate catabolism. Furthermore, the native promiscuous acetyl CoA synthase was replaced with a more stringent one from Saccharomyces cerevisiae, resulting in a highly specific biosensor.

[0337] The removal of formate dehydrogenase activity by knocking out fdH-0 and -N ensured that interference by formate, which is present in biological leachate, was eliminated. This modification was sufficient to generate a propionate-specific biosensor (P1) that accurately measured propionate concentration in authentic biological leachate. However, both A1 and the newly created JSK0042 / pGDR11 -acs acetate biosensor strains had an unacceptably high response to propionate. It was reasoned that this because of the relaxed substrate specificity of acetyl CoA synthetase (Acs) in E. coli and was previously unrecognised owing to the physical set-up of the original biosensor. Thus, Acs that had been cloned into the high expression plasmid and transformed into JSK0042 was replaced with the more stringent Acs2 from S. cerevisiae. The resulting strain was much less responsive to propionate and predicted the concentration of acetate in authentic biological leachate accurately.

[0338] The approach to generate whole cell biosensors using an iterative approach of genetic modification (knock-out and plug in) and testing on various substrate combinations can be widely applied to a range of AD fermentations, provided the potential interfering compounds are known. Once in place an almost real-time monitoring of the fermentation enabling optimal production of biogas might be achieved. The present invention is based on the further refinement of acetate and propionate whole cell (E. coli) exclusion biosensors following an iterative process in which key metabolites that might interfere with 02-uptake measurements are identified and genes required for their catabolism are knocked out (exclusion). Analysis of biological leachate from an AD reactor treating lignocellulosic material revealed the presence of formate, which was subsequently shown to elicit a response in previously developed E. coli biosensor strains. P1 phage transduction was employed to delete two genes encoding formate dehydrogenase, fdoH and fdnH, to eliminate formate catabolism. Deletion of these genes from the propionate biosensor strain W:ldgyepak abolished interference from formate and enabled accurate determination of propionate concentrations in biological leachate. However, the acetate biosensing strain JSK0042 / pGDR11 -acs, despite not having any response to formate, responded to propionate. It was likely that this was a result of the promiscuity of the wild type acetyl CoA synthetase, which was replaced with Acs2 from Saccharomyces cerevisiae, resolving the problem and enabling acetate determination with the biosensor. Acetate and propionate concentrations in authentic leachate influent were estimated to be 26.5 mM and 65.5 mM, respectively, using the biosensor, and 26.6 and 70 mM, respectively, by HPLC, demonstrating the accuracy and specificity of the refined biosensor.

Claims

Claims1. A host cell comprising at least one nucleic acid modification in the nucleic acid sequence of at least one gene selected from manX, manY, manZ, Glk, and ptsG.

2. A host cell according to claim 1 , wherein the at least one gene is selected from at least one of manX, manY, manZ.

3. A host cell according to claim 1 , wherein the at least one gene is selected from Glk, ptsG, and at least one of manX, manY, manZ.

4. A host cell according to claim 1 , wherein the at least one gene is selected from at least one of manZ, Glk, and ptsG.

5. A host cell according to any one of claims 1 -4, wherein the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs and prpE.

6. A host cell according to claim 5, wherein the at least one gene is selected from at least one of manX, manY, manZ, Glk, and ptsg; and at least one of IldD, did, adhP, adhE, ackA, acs and prpE.

7. A host cell according to any one of claims 1 -4, wherein the at least one gene is further selected from at least one of glcD, glcE, glcF, ykgE, ykgF, ykgG, fdoG, fdoH, fdol, fdnG, fdnH, and fdnl.

8. A host cell according to claim 7, wherein the at least one gene is selected from at least one of manX, manY, manZ, Glk, and ptsg; and at least one of glcD, glcE, glcF, ykgE, ykgF, ykgG, fdoG, fdoH, fdol, fdnG, fdnH, and fdnl.

9. A host cell according to any one of claims 1 -4, wherein the at least one gene is further selected from IldD, did, adhP, adhE, ackA, acs, prpE, glcD, glcE, glcF, ykgE, ykgF, ykgG, fdoG, fdoH, fdol, fdnG, fdnH, and fdnl.

10. A host cell according to claim 9, wherein the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, ykgF, fdoH, and fdnH.

11. A host cell according to claim 9, wherein the at least one gene is further selected from at least one of IldD, did, adhP, adhE, glcD, ykgF.

12. A host cell according to claim 9, wherein the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs, glcD, ykgF.A host cell according to claim 9, wherein the at least one gene is further selected from at least one of IldD, did, adhP, adhE, glcD, ykgF, and fdoH. A host cell according to claim 9, wherein the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, and ykgF. A host cell according to claim 9, wherein the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, ykgF, and fdoH. A host cell according to claim 9, wherein the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs, prpE, glcD, ykgF, fdoH, and fdnH. A host cell according to claim 9, wherein the at least one gene is further selected from at least one of IldD, did, adhP, adhE, ackA, acs, glcD, ykgF, fdoH, and fdnH. A host cell according to any one of claims 9-17, wherein the host cell further comprises an exogenous nucleic acid sequence of acs2. A host cell according to any one of claims 1 -18 for use as a biosensor. Use of a host cell according to any one of claims 1 -18 as a biosensor. A biosensor comprising a host cell according to any one of claims 1-18. A method of producing a biosensor, the method comprising the steps of providing a host cell, and introducing to the host cell at least one nucleic acid modification in the nucleic acid sequence of at least one gene selected from manX, manY, manZ, Glk, and ptsG. A method of identifying the presence, absence or quantity of an analyte in a sample, the method comprising contacting the sample with a host cell according to any one of claims 1- 18 or a biosensor according to claim 21 .