RNA transfection in plant cells with modified RNA

EP4605525A1Pending Publication Date: 2025-08-27KEYGENE NV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023793805
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-10-21
Filing Date
2023-10-20
Publication Date
2025-08-27

AI Technical Summary

Technical Problem

Current methods for transient gene expression in plant cells, such as using mRNA for protein production, face challenges like low genome edit efficiency due to mRNA degradation by cellular RNases, and require optimized systems for targeted and prolonged expression of genes like CRISPR/Cas components which are only needed temporarily.

Method used

A method involving the introduction of modified RNA molecules with pseudo-uridines and N1-methyl-pseudo-uridines into plant cells, utilizing specific 5' and 3' untranslated regions and a poly(A) tail, to enhance translation efficiency and stability, allowing for prolonged transient expression of site-directed nucleases and morphogenic polypeptides.

Benefits of technology

This approach results in increased and prolonged protein expression, enabling effective targeted genomic modifications and regeneration in plant cells, with the modified RNA molecules maintaining stability and translation efficiency beyond unmodified counterparts.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000048_0000
    Figure 00000048_0000
  • Figure 00000048_0001
    Figure 00000048_0001
  • Figure 00000049_0000
    Figure 00000049_0000
Patent Text Reader

Abstract

The invention pertains to a method for producing a plant cell comprising a modified RNA molecule, comprising the steps of i) providing the plant cell; and ii) introducing the modified RNA molecule into the plant cell. The modified RNA molecule comprises a modified uridine, wherein the modified uridine is least one of a pseudo-uridine and a N1-methyl-pseudo-uridine. The modified RNA molecule further preferably comprises a 5'-UTR, a coding sequence, and a 3'-UTR. The 5'-UTR comprises a 5'-UTR of a positive-strand RNA virus or the 5'-UTR of a plant RNA transcript. The 3'-UTR comprises a poly(A) tail. The modified RNA molecule of the invention has an increased expression from the coding sequence as compared to an identical unmodified RNA molecule. The invention further pertains to the modified RNA molecule and a plant cell comprising said modified RNA molecule.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] RNA TRANSFECTION IN PLANT CELLS WITH MODIFIED RNA

[0002] Technical field

[0003] The present invention relates to the field of molecular plant biology. More in particular the invention pertains to transient gene expression in plant cells. The invention concerns the introduction of a modified RNA molecule into a plant cell to achieve prolonged transient expression, e.g. for efficient targeted genetic modification of a plant cell.

[0004] Background

[0005] Improvement of crop plants is fundamental for modern agriculture. Classical ways of introducing new traits is by introgression of heterologous genes of sexual compatible plant species. Such genes may result for instance in crops having increased resistance to (a-)biotic stresses. Apart from the sexual compatibility requirement, introgression is a time and energy consuming process requiring many crossing and selecting steps. An alternative way for introducing (trans)genes is via genetic modification, opening up the possibilities of gene transfer even beyond the kingdom borders. For instance, bacterial genes like the bacterial programmed endonucleases of the CRISPR / CAS system can be expressed in plant cells.

[0006] The usual method for the expression of proteins in plant cells uses Agrobacterium or another transformation method to stably integrate a transgene into the plant genome. If the transgene is driven by a constitutive plant promoter then the protein will be expressed throughout the plant’s lifecycle while using inducible or cell specific promoters allows transgene expression at specific times and / or in particular cell types. For instance, expression of genes conferring herbicide resistance must be stable and produced throughout the plant’s lifecycle to be effective. However, the expression of most (trans-)genes are only required to be present in a certain more or less narrow time window. This is true for genes involved in processes like development and regeneration (such as WOX5 and PLT1), which are tightly regulated and can only be used to promote regeneration when expressed for a short time. The same is true for transgenes involved in site-specific mutagenesis such as proteins of the CRISPR / Cas complex, which are only required to be present to induce the modification, but may be obsolete thereafter. There is therefore a need for transient expression methods in plant cells.

[0007] Controlled gene expression can be more easily achieved using mRNA. However, there is very little literature on the introduction of mRNAs into plant cells (usually protoplasts) for protein production, while it is a more common approach in mammalian cells. Messenger-RNA can be made in vitro and then introduced into cells and tissues using several different methods. Once in the cell the mRNA is immediately translated without the need for any promoter sequences. This is especially beneficial for plant cells, as promoter sequences have to be optimized for different plant species.

[0008] Zhang et al. (Nat Commun; 7:12617, 2016) reports the use of mRNA for the transient (transgene free) introduction of Cas9 in maize using particle bombardment, wherein the introduced mRNA comprises 5'- and 3'-untranslated repeats of the ZmUbil gene. However relatively low levels of genome edits were observed as the mRNA is unable to replicate and becomes degraded over time by cellular RNases. Therefore, a typical transient expression profile is obtained upon mRNA transfection, with high levels of protein production as soon as the mRNA is introduced into the cell which then steeply decreases over time as the mRNA is degraded and becomes less prevalent.

[0009] In mammalian cells, modified mRNA comprising pseudo-uridines (T) have been studied for transient protein expression. Kariko et al. (Mol Ther. 16(11): 1833-1840, 2008) reports mRNA comprising pseudo-uridines for enhanced translation in mammalian cells. However, the ^-mediated translational enhancement was not predictable, as in wheat extract a ~50% decrease in protein production from the MJ-containing mRNAs was found, while in bacterial cell lysates, mRNAs with T- modifications were not translated at all.

[0010] There is a need for optimized (transgene free) transient expression systems in the plant cells to meet the above indicated unmet needs.

[0011] Summary of the invention

[0012] The following summary of the invention is provided:

[0013] Embodiment 1 . A method for producing a plant cell comprising a modified RNA molecule, comprising the steps of: i) providing the plant cell; and ii) introducing the modified RNA molecule into the plant cell, wherein the modified RNA molecule comprises a modified uridine, wherein the modified uridine is least one of a pseudo-uridine and a N1-methyl-pseudo-uridine,

[0014] Embodiment 2. A method according to embodiment 1 , wherein the modified RNA molecule is a modified messenger (m)RNA molecule comprising a 5’-UTR, a coding sequence, and a 3’-UTR, wherein the 5’-UTR comprises a 5’-UTR of a positive-strand RNA virus or the 5’- UTR of a plant RNA transcript, and wherein the 3’-UTR comprises a poly(A) tail, and wherein the modified mRNA molecule has an increased expression from the coding sequence as compared to an identical unmodified mRNA molecule.

[0015] Embodiment 3. A method according to embodiment 2, wherein the 5’-UTR of the modified mRNA molecule is the 5’-UTR of a potyvirus, preferably the 5’-UTR is of a Tobacco Etch Virus (TEV).

[0016] Embodiment 4. A method according to embodiment 2 or 3, wherein the 5’-UTR of the modified mRNA molecule has at least 80% sequence identity with any one of SEQ ID NO: 1 - 46.

[0017] Embodiment 5. A method according to any one of the preceding embodiments, wherein the modified RNA molecule comprises a 5’-cap. Embodiment 6. A method according to any one of the preceding embodiments, wherein not all uridines of the modified RNA molecule are modified uridines, wherein preferably the percentage of uridines that are modified uridines is less than 95%, preferably about 10% - 90% of all uridines are modified uridines.

[0018] Embodiment 7. A method according to any one of the preceding embodiments, wherein the only modification of the modified RNA molecule is the modification of a uridine to a pseudo-uridine and / or a N1-methyl-pseudo-uridine.

[0019] Embodiment 8. A method according to any one of embodiments 2 - 7, wherein the coding sequence of the modified mRNA molecule encodes at least one of a site-directed nuclease and a plant morphogenic polypeptide.

[0020] Embodiment 9. A method according to embodiment 8, wherein at least one of; i) the site-directed nuclease is selected from the group consisting of a TAL-effector nuclease

[0021] (TALENS), a Zinc Finger Nuclease (ZFN) and a CRISPR Cas protein; and ii) the morphogenic polypeptide is a PLETHORA (PLT) polypeptide or a WUS / WOX homeobox polypeptide, wherein preferably:

[0022] - the PLT polypeptide is selected from the group consisting of PLT1 , PLT2, PLT3, PLT4, PLT5 and

[0023] PLT7, preferably PLT1 ; and

[0024] - the WUS / WOX homeobox polypeptide is selected from the group consisting of WUS1 , WUS2,

[0025] WUS3, WOX2A, WOX4, WOX5, or WOX9, preferably WOX5.

[0026] Embodiment 10. A method according to embodiment 9, wherein the coding sequence of the modified RNA molecule encodes a TALEN, preferably a TALEN having at least 80% sequence identity with any one of SEQ ID NO: 47 - 50.

[0027] Embodiment 11. A method according to any one of embodiments 2 - 10, wherein in step ii) a first and a second modified RNA molecule is introduced, wherein the coding sequence of the first modified RNA molecule encodes a first part of a TALEN and the coding sequence of the second modified RNA molecule encodes a second part of the TALEN, and wherein the first and second part of the TALEN form a functional TALEN when expressed in the plant cell.

[0028] Embodiment 12. A method according to any one of embodiments 8 - 11 , wherein the produced plant cell comprises a targeted genomic modification.

[0029] Embodiment 13. A method according to embodiment 8, wherein the coding sequence of the modified mRNA molecule encodes a site-directed nuclease, preferably a CRISPR nuclease. Embodiment 14. A method according to embodiment 13, wherein in step ii) the modified mRNA molecule is introduced in combination with a guide RNA.

[0030] Embodiment 15. A method according to any one of the preceding embodiments, wherein the modified RNA molecule is introduced in step ii) by at least one of PEG transformation, a cell penetrating peptide (CPP) and particle bombardment.

[0031] Embodiment 16. A method according to any one of the preceding embodiments, wherein the plant cell provided in step i) is part of a multicellular tissue.

[0032] Embodiment 17. A method according to any one of the preceding embodiments, comprising a step iii) of selecting the produced plant cell, or a descendant thereof, wherein the selected plant cell comprises at least one of:

[0033] - the modified RNA molecule;

[0034] - a protein expressed from the modified RNA molecule; and

[0035] - a genomic sequence comprising a targeted genomic modification.

[0036] Embodiment 18. A method according to any one of the preceding embodiments, comprising a step iii) of selecting the produced plant cell, or a descendant thereof, wherein the plant cell is selected for comprising at least one of:

[0037] - the modified RNA molecule;

[0038] - a protein expressed from the modified RNA molecule; and

[0039] - a genomic sequence comprising a targeted genomic modification.

[0040] Embodiment 19. A method according to any one of the preceding embodiments, further comprising a step of regenerating a plant from the, optionally selected, plant cell.

[0041] Embodiment 20. A modified RNA molecule as defined in any one of embodiments 1 - 11.

[0042] Embodiment 21 . A modified mRNA molecule comprising a modified uridine, wherein the modified uridine is least one of a pseudo-uridine and a N1-methyl-pseudo- uridine, wherein the mRNA molecule comprises a 5’-UTR, a coding sequence, and a 3’-UTR, wherein the 5’-UTR comprises a 5’-UTR of a positive-strand RNA virus or the 5’-UTR of a plant RNA transcript, and wherein the 3’-UTR comprises a poly(A) tail.

[0043] Embodiment 22. A modified mRNA molecule as defined in embodiment 21 , wherein the coding sequence encodes a site-directed nuclease, preferably a CRISPR nuclease. Embodiment 23. A plant cell comprising a modified RNA molecule as defined in any one of embodiments 1 - 11 , wherein preferably the plant cell is a protoplast.

[0044] Embodiment 24. A plant cell comprising a modified RNA molecule as defined in embodiment 21 or 22, wherein preferably the plant cell is a protoplast.

[0045] Embodiment 25. A plant cell according to embodiment 23 or 24, wherein the plant cell is a Solanum Lycopersicon plant cell.

[0046] Embodiment 26. Use of a modified RNA molecule as defined in any one of embodiments 1 - 11 for the transient expression of a gene product in a plant cell.

[0047] Embodiment 27. Use of a modified RNA molecule as defined in embodiment 21 or 22 for the transient expression of a gene product in a plant cell.

[0048] Embodiment 28. Use of a modified RNA molecule as defined in embodiment 22for targeted modification of a plant cell.

[0049] Definitions

[0050] Various terms relating to the methods, compositions, uses and other aspects of the present invention are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art to which the invention pertains, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definition provided herein.

[0051] It is clear for the skilled person that any methods and materials similar or equivalent to those described herein can be used for practising the present invention.

[0052] Methods of carrying out the conventional techniques used in methods of the invention will be evident to the skilled worker. The practice of conventional techniques in molecular biology, biochemistry, computational chemistry, cell culture, recombinant DNA, bioinformatics, genomics, sequencing and related fields are well-known to those of skill in the art and are discussed, for example, in the following literature references: Sambrook et al. Molecular Cloning. A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989; Ausubel et al. Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1987 and periodic updates; and the series Methods in Enzymology, Academic Press, San Diego.

[0053] The singular terms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a cell” includes a combination of two or more cells, and the like. The indefinite article "a" or "an" thus usually means "at least one".

[0054] The term “and / or” refers to a situation wherein one or more of the stated cases may occur, alone or in combination with at least one of the stated cases, up to with all of the stated cases. As used herein, the term “about” is used to describe and account for small variations. For example, the term can refer to less than or equal to ± (+ or -) 10%, such as less than or equal to ±5%, less than or equal to ±4%, less than or equal to ±3%, less than or equal to ±2%, less than or equal to ±1 %, less than or equal to ±0.5%, less than or equal to ±0.1 %, or less than or equal to ±0.05%. Additionally, amounts, ratios, and other numerical values are sometimes presented herein in a range format. It is to be understood that such range format is used for convenience and brevity and should be understood flexibly to include numerical values explicitly specified as limits of a range, but also to include all individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly specified. For example, a ratio in the range of about 1 to about 200 should be understood to include the explicitly recited limits of about 1 and about 200, but also to include individual ratios such as about 2, about 3, and about 4, and sub-ranges such as about 10 to about 50, about 20 to about 100, and so forth.

[0055] The term “comprising” is construed as being inclusive and open ended, and not exclusive. Specifically, the term and variations thereof mean the specified features, steps or components are included. These terms are not to be interpreted to exclude the presence of other features, steps or components.

[0056] The terms “protein” or “polypeptide” are used interchangeably herein and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3 dimensional structure or origin. A “fragment” or “portion” of a protein may thus still be referred to as a “protein”. An “isolated protein” is used to refer to a protein which is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell.

[0057] "Plant" refers to either the whole plant or to parts of a plant, such as tissue or organs (e.g. pollen, seeds, gametes, roots, leaves, flowers, flower buds, anthers, fruit, etc.) obtainable from the plant, as well as derivatives of any of these and progeny derived from such a plant by selfing or crossing. Non-limiting examples of plants include crop plants and cultivated plants, such as African eggplant, alliums, artichoke, asparagus, barley, beet, bell pepper, bitter gourd, bladder cherry, bottle gourd, cabbage, canola, carrot, cassava, cauliflower, celery, chicory, common bean, corn salad, cotton, cucumber, eggplant, endive, fennel, gherkin, grape, hot pepper, lettuce, maize, melon, oilseed rape, okra, parsley, parsnip, pepino, pepper, potato, pumpkin, radish, rice, ridge gourd, rocket, rye, snake gourd, sorghum, spinach, sponge gourd, squash, sugar beet, sugar cane, sunflower, tomatillo, tomato, tomato rootstock, vegetable Brassica, watermelon, wax gourd, wheat and zucchini.

[0058] "Plant cell(s)" include protoplasts, gametes, suspension cultures, microspores, pollen grains, etc., either in isolation or within a tissue, organ or organism. The plant cell can e.g. be part of a multicellular structure, such as a callus, meristem, plant organ or an explant.

[0059] “Similar conditions” for culturing the plant I plant cells means among other things the use of a similar temperature, humidity, nutrition and light conditions, and similar irrigation and day / night rhythm.

[0060] The terms “homology”, “sequence identity” and the like are used interchangeably herein. Sequence identity is herein defined as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleotide (polynucleotide) sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods. The percentage sequence identity I similarity can be determined over the full length of the sequence.

[0061] As used herein “sequence identity” refers to the extent to which two optimally aligned polynucleotide or peptide sequences are invariant throughout a window of alignment of components, e.g., nucleotides or amino acids. An “identity fraction” for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence. “Percent identity” is the identity fraction times 100.

[0062] “Sequence identity” and “sequence similarity” can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar lengths are preferably aligned using a global alignment algorithms (e.g. Needleman Wunsch) which aligns the sequences optimally over the entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g. Smith Waterman). Sequences may then be referred to as "substantially identical” or “essentially similar” when they (when optimally aligned by for example the programs GAP or BESTFIT using default parameters) share at least a certain minimal percentage of sequence identity (as defined herein). The percent of sequence identity is preferably determined using the “BESTFIT” or “GAP” program of the Sequence Analysis Software Package™ (Version 10; Genetics Computer Group, Inc., Madison, Wis.). GAP uses the Needleman and Wunsch global alignment algorithm (Needleman and Wunsch, Journal of Molecular Biology 48:443-453, 1970) to align two sequences over their entire length (full length), maximizing the number of matches and minimizing the number of gaps. A global alignment is suitably used to determine sequence identity when the two sequences have similar lengths. Generally, the GAP default parameters are used, with a gap creation penalty = 50 (nucleotides) I 8 (proteins) and gap extension penalty = 3 (nucleotides) I 2 (proteins). For nucleotides the default scoring matrix used is nwsgapdna and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignments and scores for percentage sequence identity may be determined using computer programs, such as the GCG Wisconsin Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or using open source software, such as the program “needle” (using the global Needleman Wunsch algorithm) or “water” (using the local Smith Waterman algorithm) in EmbossWIN version 2.10.0, using the same parameters as for GAP above, or using the default settings (both for ‘needle’ and for ‘water’ and both for protein and for DNA alignments, the default Gap opening penalty is 10.0 and the default gap extension penalty is 0.5; default scoring matrices are Blossum62 for proteins and DNAFull for DNA). gap extension penalty is 0.5; default scoring matrices are Blossum62 for proteins and DNAFull for DNA). “BESTFIT” performs an optimal alignment of the best segment of similarity between two sequences and inserts gaps to maximize the number of matches using the local homology algorithm of Smith and Waterman (Smith and Waterman, Advances in Applied Mathematics, 2:482-489, 1981 , Smith et al., Nucleic Acids Research 11 :2205-2220, 1983). When sequences have a substantially different overall lengths, local alignments, such as those using the Smith Waterman algorithm, are preferred.

[0063] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., Applied Math (1988) 48:1073. More particularly, preferred computer programs for determining sequence identity include the Basic Local Alignment Search Tool (BLAST) programs which are publicly available from National Center Biotechnology Information (NCBI) at the National Library of Medicine, National Institute of Health, Bethesda, Md. 20894; see BLAST Manual, Altschul et al., NCBI, NLM, NIH; Altschul et al., J. Mol. Biol. 215:403-410 (1990); version 2.0 or higher of BLAST programs allows the introduction of gaps (deletions and insertions) into alignments; for peptide sequence BLASTX can be used to determine sequence identity; and, for polynucleotide sequence BLASTN can be used to determine sequence identity.

[0064] Alternatively percentage similarity or identity may be determined by searching against public databases, using algorithms such as FASTA, BLAST, etc. Thus, the nucleic acid and protein sequences of the present invention can further be used as a “query sequence” to perform a search against public databases to, for example, identify other family members or related sequences. Such searches can be performed using the BLASTn and BLASTx programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403 — 10. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to nucleic acid molecules of the invention. BLAST protein searches can be performed with the BLASTx program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTx and BLASTn) can be used. See the homepage of the National Center for Biotechnology Information at http: / / www.ncbi.nlm.nih.gov / .

[0065] “Analogous to” in respect of a domain, sequence or position of a protein, in relation to an indicated domain, sequence or position of a reference protein, is to be understood herein as a domain, sequence or position that aligns to the indicated domain, sequence or position of the reference protein, upon alignment of the protein to the reference protein using alignment algorithms as described herein, such as Needleman Wunsch.

[0066] “Analogous to” in respect of a domain, sequence or position of a nucleic acid, in relation to an indicated domain, sequence or position of a reference nucleic acid, is to be understood herein as a domain, sequence or position that aligns to the indicated domain, sequence or position of the reference nucleic acid, upon alignment of the nucleic acid to the reference nucleic acid using alignment algorithms as described herein, such as Needleman Wunsch.

[0067] A “nucleic acid” or “polynucleotide” according to the present invention may include any polymer or oligomer of pyrimidine and purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively (See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982) which is herein incorporated by reference in its entirety for all purposes). The present invention contemplates any deoxyribonucleotide, ribonucleotide or nucleic acid component, and any chemical variants thereof, such as methylated, hydroxy methylated or glycosylated forms of these bases, and the like. Particularly preferred variants are pseudo-uridine and N1-methyl- pseudo-uridine. The polymers or oligomers may be heterogeneous or homogenous in composition, and may be isolated from naturally occurring sources or may be artificially or synthetically produced. In addition, the nucleic acids may be DNA (optionally cDNA) or RNA, or a mixture thereof, and may exist permanently or transitionally in single-stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states. An “isolated nucleic acid” is used herein to refer to a nucleic acid which is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant cell. The nucleic acid and / or protein of the invention may be at least one of a recombinant, synthetic or artificial nucleic acid and / or protein.

[0068] The terms “nucleic acid construct”, “nucleic acid vector”, “vector” and “expression construct” are used interchangeably herein and is herein defined as a man-made nucleic acid molecule resulting from the use of recombinant DNA technology. The terms “nucleic acid construct” and “nucleic acid vector” therefore does not include naturally occurring nucleic acid molecules although a nucleic acid construct may comprise (parts of) naturally occurring nucleic acid molecules.

[0069] The vector backbone may for example be a binary or superbinary vector (see e.g. U.S. Pat. No. 5,591 ,616, US 2002138879 and WO 95 / 06722), a co-integrate vector or a T-DNA vector, as known in the art and as described elsewhere herein, into which a chimeric gene is integrated or, if a suitable transcription regulatory sequence is already present, only a desired nucleic acid sequence (e.g. a coding sequence, an antisense or an inverted repeat sequence) is integrated downstream of the transcription regulatory sequence. Vectors can comprise further genetic elements to facilitate their use in molecular cloning, such as e.g. selectable markers, multiple cloning sites and the like.

[0070] The term “gene” means a nucleic acid fragment comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g. an mRNA) in a cell, operably linked to suitable regulatory regions (e.g. a promoter). A gene may comprise several operably linked fragments, such as a promoter sequence, a 5’ untranslated region, a coding region and a 3’ untranslated sequence comprising a polyadenylation site. The promoter sequence of a gene may bind transcription factors that recruit and help the RNA polymerase to start transcription. Apart from the promoter sequence, the regulatory sequences may comprise further sites that act as enhancer and / or silencers of transcription for instance by binding certain enhancer or inhibiting elements and / or by influencing the chromatin structure. The transcribed region of the gene may be annotated herein as an open reading frame (ORF) and starts with a three letter code indicated as the start codon, and ends with one of the three possible stop codons. The ORF may comprise exons and one or more introns. Upstream of the transcribed region is a 5’-UTR and downstream a 3’-UTR that make up the boundaries of the transcribed RNA. For pre-mRNA, during maturation into mRNA, the introns may be spliced out, a polyadenylated-tail (in short: poly A-tail), and optionally a 5’-cap, are added to the respective 3’ and 5’ end of the RNA thereby forming mature mRNA. Hence mature mRNA comprises at least the following nucleotide sequence elements: a 5’-UTR, exons, a 3’-UTR and a poly A-tail. Optionally, the mRNA comprises the following nucleotide sequence elements: a 5’-cap, a 5’-UTR, exons, a 3’-UTR and a poly A-tail. The combined exons of an ORF, i.e. the sequence that is translated into a protein, is indicated herein as the coding sequence or CDS. The mature mRNA may subsequently be translated into a protein in a process called translation.

[0071] “Expression” in relation to an (m)RNA refers to the process wherein said (m)RNA is translated into a biologically active protein. This process is may also be indicated as “translation” or “protein expression”. “Expression” in relation to a gene refers to the process wherein a nucleic acid region which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA (this process may also be indicated herein as “transcription”), which is biologically active, e.g. which is capable of being translated into a biologically active protein, or e.g. a regulatory non-coding RNA. Optionally, “expression” in relation to a gene may encompass both the process of transcription and translation.

[0072] The term “operably linked” refers to a linkage of polynucleotide elements in a functional relationship. A nucleic acid is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter, or rather a transcription regulatory sequence, is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked may mean that the nucleic acid sequences being linked are contiguous.

[0073] “Promoter” refers to a nucleic acid fragment that functions to control the transcription of one or more nucleic acids. A promoter fragment is preferably located upstream (5’) with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for an RNA polymerase, transcription initiation site(s) and can further comprise any other nucleotide sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter.

[0074] A “constitutive promoter” is a promoter that is active in most tissues and / or under most physiological and developmental conditions. An “inducible promoter” is a promoter that is physiologically (e.g. by external application of certain compounds) or developmentally regulated. A “tissue specific” promoter is only active in specific types of tissues or cells.

[0075] The term “cDNA” means complementary DNA. Complementary DNA is made by reverse transcribing RNA into a complementary DNA sequence. cDNA sequences thus correspond to RNA sequences that are expressed from genes. As RNA sequences expressed from the genome can undergo splicing, i.e. introns are spliced out of the pre-mRNA and exons are joined together, before being translated in the cytoplasm into proteins, it is understood that the sequence of the cDNA corresponds to the sequence of the mRNA . The cDNA sequence thus may not be identical to the genomic DNA sequence to which it corresponds as the cDNA may encode only the complete open reading frame, consisting of the joined exons, for a protein, whereas the genomic DNA sequence may comprise exon sequences interspersed by intron sequences. Genetically modifying a gene which encodes a protein may thus not only relate to modifying the sequences encoding the protein, but may also involve mutating intronic sequences of the genomic DNA and / or other gene regulatory sequences of that gene.

[0076] The term “regeneration” is herein defined as the formation of a new tissue and / or a new organ from a single plant cell, a callus, an explant, a tissue or from an organ. The regeneration pathway can be somatic embryogenesis or organogenesis. Somatic embryogenesis is understood herein as the formation of somatic embryos, which can be grown to regenerate whole plants. Organogenesis is understood herein as the formation of new organs from (undifferentiated) cells. Preferably, the regeneration is at least one of ectopic apical meristem formation, shoot regeneration and root regeneration. The regeneration as defined herein can preferably concern at least de novo shoot formation. For example, regeneration can be the regeneration of a(n) (elongated) hypocotyl explant towards a(n) (inflorescence) shoot. Regeneration may further include the formation of a new plant from a single plant cell or from e.g. a callus, an explant, a tissue or an organ. The regeneration process can occur directly from parental tissues or indirectly, e.g. via the formation of a callus.

[0077] The term “conditions that allow for regeneration” is herein understood as an environment wherein a plant cell or tissue can regenerate. Such conditions include at minimum a suitable temperature ( / .e. between 1 °C - 60°C), nutrition, day / night rhythm, irrigation and one or more plant hormones and / or plant hormone-like compounds. Furthermore, “optimal conditions that allow for regeneration” are those environmental conditions that allow for a maximum regeneration of the plant cells.

[0078] The term “wild type” as used in the context of the present invention in combination with a protein or nucleic acid means that said protein or nucleic acid consists of an amino acid or nucleotide sequence, respectively, that occurs as a whole in nature and can be isolated from organisms in nature as such, e.g. is not the result of modification techniques such as targeted or random mutagenesis or the like. A wild type protein is expressed in at least a particular developmental stage under particular environmental conditions, e.g. as it occurs in nature.

[0079] The term “endogenous” as used in the context of the present invention in combination with a protein or nucleic acid means that said protein or nucleic acid is still contained within the plant, i.e. is present in its natural environment. Often an endogenous gene will be present in its normal genetic context in the plant.

[0080] “Targeted mutagenesis” is mutagenesis that can be designed to alter a specific nucleotides or nucleic acid sequence, such as but not limited to, oligo-directed mutagenesis, RNA-guided endonucleases (e.g. the CRISPR-technology), TALENs or Zinc finger technology.

[0081] The term “sequence of interest” includes, but is not limited to, any genetic sequence preferably present within a cell, such as, for example a gene, part of a gene, or a non-coding sequence within or adjacent to a gene. The sequence of interest may be present in a chromosome, an episome, an organellar genome such as mitochondrial or chloroplast genome or genetic material that can exist independently to the main body of genetic material such as an infecting viral genome, plasmids, episomes, transposons for example. A sequence of interest may be within the coding sequence of a gene, within transcribed non-coding sequence such as, for example, leader sequences, trailer sequence or introns. Said sequence of interest may be present in a double or a single strand nucleic acid molecule. The nucleic acid sequence is preferably present in a doublestranded nucleic acid molecule. The sequence of interest may be any sequence within a nucleic acid, e.g., a gene, gene complex, locus, pseudogene, regulatory region, highly repetitive region, polymorphic region, or portion thereof. The sequence of interest may also be a region comprising genetic or epigenetic variations indicative for a phenotype or disease. Preferably, the sequence of interest is a small or longer contiguous stretch of nucleotides ( / .e. a polynucleotide) of duplex DNA, wherein said duplex DNA further comprises a sequence complementary to the target sequence in the complementary strand of said duplex DNA.

[0082] A “control plant” as referred to herein is a plant of the same species and preferably same genetic background as the plant of the invention, i.e. a plant that has been subjected to the methods as taught herein. Preferably, the control plant only differs from the putative test plant in that the control plant does not have the targeted modification as detailed herein. Preferably the control plant is grown under the same conditions as the plant subjected to a method of the invention.

[0083] A “guide RNA” or “gRNA” is understood herein as an RNA molecule comprising a guide sequence for targeting the gRNA-CAS complex to the protospacer sequence that is preferably near, at or within the sequence of interest in the nucleic acid molecule, and may be a sgRNA or the combination of a crRNA and a tracrRNA (e.g. for Cas9) or a crRNA only (e.g. in case of Cpf1). Optionally, more than one type of guide RNA may be used in the same experiment, for example aimed at two or more different sequences of interest, or even aimed at the same sequence of interest.

[0084] A “guide sequence” is to be understood herein as a part of a guide RNA that recognizes, binds and / or hybridizes to a specific site in an RNA or DNA molecule. Preferably, the guide sequence is the section of the sgRNA or crRNA which is required for targeting a gRNA-CAS complex to a specific site in a duplex DNA.

[0085] Detailed Description

[0086] In plants, transient expression of a transgene is often desired over permanent expression, e.g. due to regulatory issues or when long-term expression is hampering plant development. On the other hand, transient expression is frequently too short to achieve any desirable effect. Hence ideally, transient expression is at least sufficiently long to achieve the effect. The inventors now developed a method to achieve such desirable prolonged transient expression.

[0087] Therefore in a first aspect, provided is a method for producing a plant cell, wherein the produced plant cell comprises a modified RNA molecule. Preferably, the method comprises the steps of: i) providing the plant cell; and ii) introducing into the plant cell a modified RNA molecule.

[0088] The modified RNA molecule as defined herein comprises a modified uridine, wherein the modified uridine is preferably least one of a pseudo-uridine and a N1-methyl-pseudo-uridine. Hence a modified RNA molecule is understood herein as an RNA molecule comprising a modified uridine, and wherein the modified uridine is preferably least one of a pseudo-uridine and a N1-methyl- pseudo-uridine

[0089] Optionally, the modified RNA molecule is a non-coding RNA. Optionally said non-coding RNA serves to regulate gene expression and / or to guide an RNA-guided endonuclease towards a specific nucleotide sequence. The non-coding RNA may be involved in gene translation (e.g. a rRNA or a tRNA), in splicing (e.g. a snRNA), in the modification of ribosomal RNA (e.g. a snoRNA), in the regulation of gene expression at the posttranscriptional level (e.g. a microRNA, siRNA or piRNA) or involved in chromatin remodelling, transcriptional control, and / or posttranscriptional processing (e.g. a InoRNA) (Kukurba and Montgomery, Cold Spring Harb Protoc 2015; 11 : 951 — 969), Hence the modified RNA molecule may be selected from the group consisting of a guide RNA, a ribosomal RNA (rRNA), a transfer RNA (tRNA), a small nuclear RNA (snRNA), small nucleolar RNAs (snoRNA), micro RNA (miRNA), small interfering RNA (siRNA), a trans-acting siRNA, a tasiRNA, a piwi-interacting RNA (piRNA) and a long noncoding RNA (InoRNA).

[0090] Alternatively, the modified RNA molecule may be coding RNA, i.e. messenger RNA (mRNA) encoding a protein. Preferably, the modified RNA molecule comprises at least one of a 5’- UTR, a coding sequence and a 3’-UTR. Preferably, the modified RNA molecule has an increased protein expression from its coding sequence, preferably a coding sequence as defined herein, as compared to an identical unmodified RNA molecule.

[0091] The identical unmodified RNA molecule is understood herein to comprise the same nucleotide sequence as the modified RNA molecule, but does not comprise any pseudo-uridines and N1-methyl-pseudo-uridines, preferably not comprising any nucleic acid modifications. Hence the identical unmodified RNA molecule is preferably fully identical to the modified RNA molecule, with the exception that the unmodified RNA molecule does not comprise the described uridine modification(s), i.e. does not comprise replacements) of uridine into pseudo-uridine and / or N1- methyl-pseudo-uridine. If the modified RNA molecule comprises a 5’ cap, the control (unmodified) RNA molecule preferably also comprises a 5’ cap.

[0092] The increase in protein expression may be at least one of: i) an increased total amount (i.e. the sum of the amount of protein expressed after a transfection event over a defined time period); ii) an increased protein level (i.e. the level of protein at a certain time point after transfection, preferably the peak level of protein after transfection); and iii) a prolonged period of increased protein levels (i.e. the protein can be detected in the cell for a longer period of time as the modified mRNA is present for a longer period of time).

[0093] The translated protein level and / or total translated protein amount may be increased as compared to an identical unmodified RNA molecule. The total amount and / or protein level may be increased about at least 1 .2, 1 .4, 1 .6. 1 .8, 2, 2.5, 3, 3.5, 4.5, 5, 6, 7, 8, 9 or at least about 10 fold, preferably when determined about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 days or more after the introduction of the RNA molecule. Optionally, the total amount of protein is increased when determined over a period of about 2, 3, 4, 5, 6, 7, 8, 9, 10 or more days, wherein the first day of the period preferably starts one day after the introduction of the RNA molecule.

[0094] The increase in total amount of protein and / or increase in level of protein expressed from the modified RNA may be due to at least one of an increase in translation efficiency and increased RNA retention in the cell as compared to identical unmodified RNA molecule, preferably under otherwise identical experimental conditions (e.g. same transfection method, same or similar host cell and same or similar culture conditions).

[0095] Alternatively or in addition, the level of protein encoded by the modified RNA molecule may be increased for a prolonged period of time in the plant cell as compared to the level of protein encoded by an identical unmodified RNA molecule. The prolonged increased level can be due to the prolonged presence of the modified RNA molecule as compared to an identical unmodified RNA molecule. Preferably, a protein expressed from the modified RNA molecule can be detected over a longer period of time as compared to the protein expressed from an identical, but unmodified, RNA molecule under otherwise identical experimental conditions. Preferably when a protein encoded by the identical unmodified RNA molecule can no longer be detected, the protein encoded by the modified RNA molecule can still be detected in the plant cell for at least an additional 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more days. Preferably when the identical unmodified RNA molecule no longer can be detected, the modified RNA molecule can still be detected in the plant cell for at least an additional 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more days.

[0096] Optionally, the increased expression may be determined by transfecting plant cells with an modified RNA molecule and transfecting plant cells with an identical unmodified RNA molecule, wherein the separate transfections are preferably performed using identical experimental conditions. As the modified RNA can be present for a prolonged period of time after transfection, the number of cells expressing the protein encoded by the modified RNA molecule may be increased as compared to the number of cells expressing the protein encoded by the identical unmodified RNA molecule, under otherwise identical circumstances. The number of cells expressing the protein from the modified RNA molecule is increased least 1 .2, 1 .4, 1 .6. 1 .8, 2, 2.5, 3, 3.5, 4.5, 5, 6, 7, 8, 9 or at least about 10 fold, as compared to the number of cells expressing said protein from the unmodified RNA molecule, preferably when determined about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 days or more after the introduction of the RNA molecules. Preferably, the number of cells expressing the protein is increased at least about 2-fold after transfection with a modified RNA molecule as compared to the number of cells expressing the protein after transfection with the identical unmodified RNA molecule, preferably when determined after about 2 days.

[0097] Protein detection, and optionally quantification, can be done using any conventional method known to the person skilled in the art, such as, but limited to, western blotting, FACS analysis, microscopy etc. Equally, nucleic acid detection, and optionally quantification, can be done using any conventional method known to the person skilled in the art, such as, but limited to, (quantitative) PCR, deep-sequencing, northern blotting, etc. The introduction of the modified RNA molecule preferably results in translation of the protein encoded by the RNA molecule. The translated protein may subsequently have an effect on the plant cell, preferably a measurable and / or phenotypic effect. As a non-limiting example, the expressed protein may target a specific region in the plant’s genome and produces a (detectable) site-directed mutagenesis event. As another non-limiting example, the expressed protein may induce and / or augment regeneration of the plant cell.

[0098] The method as detailed herein may also be considered e.g. method for increasing transient gene expression in a plant cell; a method for producing a plant cell comprising a targeted genomic modification; a method for producing a plant cell expressing a transgene; a method for site-directed mutagenesis of a plant cell; a method for producing a de novo shoot; and a method for shoot regeneration.

[0099] The skilled person readily understands that further methods involving a step of introducing a modified RNA molecule in a plant cell are equally part of in the invention.

[0100] Plant cell

[0101] Step i) of the provided method is the provision of a plant cell. The plant cell may be an isolated cell or part of a multicellular structure, such as a callus, meristem, plant part, plant organ or an explant. The skilled person readily understands that the method of the invention is not limited to a certain plant cell type. In particular, the method of the invention as disclosed herein can be applied to dividing as well as non-dividing cells. The cell may be transgenic or non-transgenic. The plant cell can for example be obtainable from plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, grains and the like. A preferred plant cell is a protoplast.

[0102] The plant cell can be a cell from any plant, such as a cultivar or wild type plant. The plant cell can be a cell from a crop plant or grain plant. The plant cell is preferably obtainable from a crop plant such as a monocot or dicot or of a crop or grain plant such as cassava, corn, sorghum, soybean, wheat, oat or rice. A crop plant is a plant species which is cultivated and bred by humans. A crop plant may be cultivated for food and / or feed purposes (e.g. field crops), or for ornamental purposes (e.g. production of flowers for cutting, grasses for lawns, etc.). A crop plant as defined herein also includes plants from which non-food products are harvested, such as oil for fuel, plastic polymers, pharmaceutical products, cork and the like.

[0103] The plant cell may be of an alga, tree or production plant, fruit or vegetable (e.g., trees such as citrus trees, e.g., orange, grapefruit or lemon trees; peach or nectarine trees; apple or pear trees; nut trees such as almond or walnut or pistachio trees; nightshade plants; plants of the genus Brassica’, plants of the genus Lactuca; plants of the genus Spinacia; plants of the genus Capsicum’, plants of the genus Solanum, preferably Solanum lycopersicum.

[0104] The plant cell may be, be derived from, or obtained from a plant of that belongs to the Brassicaceae, Cucurbitaceae, Fabaceae, Gramineae, Solanaceae, Asteraceae (Compositae), Rosaceae or Poaceae.

[0105] Prefereably, the plant cell is, is derived from, or is obtained from a plant that is selected from the group consisting of maize / corn (Zea species), wheat (Triticum species), barley (e.g. Hordeum vulgare), oat (e.g. Avena sativa), sorghum (Sorghum bicolor), rye (Secale cereale), soybean (Glycine spp, e.g. G. max), cotton (Gossypium species, e.g. G. hirsutum, G. barbadense), Brassica spp. (e.g. B. napus, B. juncea, B. oleracea, B. rapa, etc), sunflower (Helianthus annuus), safflower, yam, cassava, alfalfa (Medicago sativa), rice (Oryza species, e.g. O. sativa indica cultivar-group or japonica cultivar-group), forage grasses, pearl millet (Pennisetum spp. e.g. P. glaucum), tree species (Pinus, poplar, fir, plantain, etc), tea, coffea, oil palm, coconut, vegetable species, such as pea, zucchini, beans (e.g. Phaseolus species), hot pepper, cucumber, artichoke, asparagus, eggplant, broccoli, garlic, leek, lettuce, onion, radish, turnip, tomato, potato, Brussels sprouts, carrot, cauliflower, chicory, celery, spinach, endive, fennel, beet, fleshy fruit bearing plants (grapes, peaches, plums, strawberry, mango, apple, plum, cherry, apricot, banana, blackberry, blueberry, citrus, kiwi, figs, lemon, lime, nectarines, raspberry, watermelon, orange, grapefruit, etc.), ornamental species (e.g. Rose, Petunia, Chrysanthemum, Lily, Gerbera species), herbs (mint, parsley, basil, thyme, etc.), woody trees (e.g. species of Populus, Salix, Quercus, Eucalyptus), fibre species e.g. flax (Linum usitatissimum) and hemp (Cannabis sativa). The plant tissue may also be from a tree or production plant, fruit or vegetable (e.g., trees such as citrus trees, e.g., orange, grapefruit or lemon trees; peach or nectarine trees; apple or pear trees; nut trees such as almond or walnut or pistachio trees; nightshade plants; plants of the genus Brassica; plants of the genus Lactuca; plants of the genus Spinacia; plants of the genus Capsicum; plants of the genus Solanum, preferably Solanum lycopersicum). Preferably, the plant is a plant of the genus Solanum. A preferred plant for use in the method provided herein is a Solanum lycopersicum or Capsicum annuum plant.

[0106] In another preferred embodiment, the plant tissue is from a plant that is selected from the group consisting of asparagus, barley, blackberry, blueberry, broccoli, cabbage, canola, carrot, cassava, cauliflower, chicory, cocoa, coffee, cotton, cucumber, eggplant, grape, hot pepper, lettuce, maize, melon, oilseed rape, pepper, potato, pumpkin, raspberry, rice, rye, sorghum, spinach, squash, strawberry, sugar cane, sugar beet, sunflower, sweet pepper, tobacco, tomato, water melon, wheat, and zucchini.

[0107] The plant cell may be an isolated plant cell, preferably a protoplast, or the plant cell may be comprised in a multicellular structure. The plant cell may be part of a specific plant structure, such as, but not limited to, pollen, seeds, gametes, roots, leaves, flowers, flower buds, anthers and / or fruit. The modified RNA molecule may be introduced in a cell of any part of a provided plant. The modified RNA molecule can be introduced in a cell of the shoot system and / or in a cell of the root system. The modified RNA molecule can be introduced in cells of a root, stem, fruit, leaf, internode, and / or a flower. The modified RNA molecule may be introduced in cells of a seedling. The modified RNA molecule may be introduced in a seed. As a non-limiting example, the modified RNA molecule can be introduced in cells of a true leaf, epicotyl, cotyledon, hypocotyl and / or in a cell of the radicle. Optionally, the modified RNA molecule is introduced in cells of a cotyledon. The modified RNA molecule can be introduced in a cell of a provided plant, preferably in a cell of a cotyledon of said plant, wherein the plant is a young seedling consisting of the radicle (embryonic root), the hypocotyl (embryonic shoot), and the cotyledons. Optionally, the modified RNA molecule is introduced in a cell of a provided plant, preferably in a cell of a cotyledon of said plant, about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14 days, preferably about 7-10 days, after sowing.

[0108] Modified RNA molecule

[0109] Preferably, the introduced modified RNA molecule comprises a 5’-UTR, a coding sequence, and a 3’-UTR. As compared to an identical unmodified RNA molecule, the modified RNA molecule as defined herein results in an increased expression of the encoded protein when introduced in a plant cell. The 5’-UTR of the modified RNA molecule preferably comprises a 5’-UTR of a positive-strand RNA virus or the 5’-UTR of a plant RNA transcript. Preferably, the 3’-UTR of the modified RNA molecule comprises a poly(A) tail.

[0110] Modified uridine

[0111] The RNA molecule for use in the method provided herein comprises a modified uridine. The modified uridine is preferably at least one of a pseudo-uridine (T) and a N1-methyl-pseudo-uridine (ml1). The modified RNA molecule may comprise a uridine, a pseudo-uridine and a N1-methyl- pseudo-uridine. Alternatively, the RNA molecule may comprise only one type of uridine modification, i.e. comprises a pseudo-uridine or a N1-methyl-pseudo-uridine. The RNA molecule may comprise a uridine and a modified uridine, i.e. the RNA molecule may comprise a uridine, as well as a pseudo-uridine and / or a N1-methyl-pseudo-uridine. Alternatively, all uridines in the RNA molecule are replaced for modified uridines, i.e. are replaced for a pseudo-uridine and / or a N1- methyl-pseudo-uridine.

[0112] Preferably, the modified RNA molecule comprises a uridine and a modified uridine, wherein the modified uridine is a pseudo-uridine and / or a N1-methyl-pseudo-uridine. Hence preferably, not all uridines are replaced for modified uridines. Preferably, at most about 95%, 94%, 93%, 92%, 91 %, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81 %, 80%, 78%, 76%, 74%, 72%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or at most about 20% of all uridines in the RNA molecule are replaced for modified uridines. Preferably, at least about 8%, 10%, 12%, 14%, 16%, 18%, 20%, 22%, 24%, 26%, 28% at least about 30% of the uridines in the RNA molecule are replaced for modified uridines. Preferably about 10% - 90%, 20% - 85%, 30% - 80%, 40% - 70% or about 45% - 65% of all uridines in the RNA molecule are replaced for modified uridines. Preferably about 10% - 90%, about 25% - 85%, or about 50% - 80% of all uridines in the RNA molecule are replaced for modified uridines. The uridines that are not replaced for the modified uridines, are unmodified uridines. In an embodiment, at most about 95%, 94%, 93%, 92%, 91 %, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81 %, 80%, 78%, 76%, 74%, 72%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or at most about 20% of all uridines in the RNA molecule are replaced for pseudouridines. Preferably, at least about 8%, 10%, 12%, 14%, 16%, 18%, 20%, 22%, 24%, 26%, 28% at least about 30% of the uridines in the RNA molecule are replaced for pseudo-uridines. Preferably about 10% - 90%, 20% - 85%, 30% - 80%, 40% - 70% or about 45% - 60% of all uridines in the RNA molecule are replaced for pseudo-uridines. Preferably about 10% - 90%, about 25% - 85%, or about 50% - 80% of all uridines in the RNA molecule are replaced for pseudo-uridines. The uridines that are not replaced for pseudo-uridines, are unmodified uridines.

[0113] In another embodiment, at most about 95%, 94%, 93%, 92%, 91 %, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81 %, 80%, 78%, 76%, 74%, 72%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, or at most about 20% of all uridines in the RNA molecule are replaced for N1-methyl-pseudo-uridines. Preferably, at least about 8%, 10%, 12%, 14%, 16%, 18%, 20%, 22%, 24%, 26%, 28% at least about 30% of the uridines in the RNA molecule are replaced for N1-methyl- pseudo-uridines. Preferably about 10% - 90%, 20% - 85%, 30% - 80%, 40% - 70% or about 45% - 60% of all uridines in the RNA molecule are replaced for N1-methyl-pseudo-uridines. Preferably about 10% - 90%, about 25% - 85%, or about 50% - 80% of all uridines in the RNA molecule are replaced for N1-methyl-pseudo-uridines. The uridines that are not replaced for N1-methyl-pseudo- uridines, are unmodified uridines.

[0114] A uridine or “unmodified uridine” is the naturally occurring glycosylated pyrimidine analog containing uracil attached to a ribose ring and one of the five standard nucleosides which make up (e.g. naturally occurring) nucleic acids. A pseudo-uridine (5-(p-D-Ribofuranosyl)pyrimidine- 2,4(1 H,3H)-dione), “1” or “5-ribosyluracil” is an isomer of the nucleoside uridine in which the uracil is attached via a carbon-carbon instead of a nitrogen-carbon glycosidic bond. Pseudo-uridine is known to be one of the most abundant RNA modifications in cellular RNA. N1-methyl-pseudo- uridine (5-[(2S,3R,4S,5R)-3,4-Dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-1-methylpyrimidine-2,4- dione) or “ml MJ” is a natural archaeal tRNA component as well as a known synthetic pyrimidine nucleoside. It is the methylated derivative of pseudo-uridine and has been used e.g. as a component of the SARS-CoV-2 mRNA vaccines tozinameran and elasomeran.

[0115] Preferably, the only nucleic acid modification of the modified RNA molecule is a modified uridine as described herein. Preferably, the modified RNA molecule does not comprise a cytidine, guanosine and / or adenosine modification. The modified RNA molecule may comprise a 5’-cap.

[0116] Elements of the RNA molecule

[0117] The modified RNA molecule for use in a method as defined herein preferably comprises the following three elements: i) a 5’-UTR; ii) a coding sequence; and iii) a 3’-UTR. 5’-UTR

[0118] The modified RNA molecule comprises a 5’-UTR. The 5’-UTR preferably induces or enhances the translation of the coding sequence. Optionally, the 5’-UTR promotes translation even in the absence of the 5’ m7G cap. Preferably, the 5’-UTR is from, or is derived from, the 5’-UTR of a positive-strand RNA virus or the 5’-UTR from a plant transcript.

[0119] Preferably, the 5’UTR is from, or is derived from, the 5’-UTR of a positive-strand RNA virus. The genome of a positive-strand RNA virus can act as messenger RNA and the 5’-UTR can thus be used to promote translation of the coding sequence. The 5’-UTR can be derived from a positive strand RNA virus of the phyla Kitrinoviricota, Lenarviricota, and Pisuviricota (in particular the classes Pisoniviricetes and Stelpaviricetes). Preferably, the 5’-UTR is obtained, or derived from, a positivestrand RNA virus of the phylum Pisuviricota, and preferably of the class Stelpaviricetes. Preferably, the sequence of the 5’-UTR is, or is derived from, the 5’-UTR of the order Patatavirales and preferably of the family Potyviridae. Preferably, the sequence of the 5’-UTR of the modified RNA molecule is, or is derived from, the 5’-UTR of the genus Potyvirus.

[0120] The 5’-UTR of the modified RNA molecule is preferably from, of derived from, the 5’-UTR of a Potyvirus selected from the group consisting of Bean common mosaic virus (BCMV), Bean common mosaic necrosis virus (BCMCV) Bean yellow mosaic virus (BYMV), Beet mosaic virus (BtMV), Chilli veinal mottle virus (ChiVMV), Clover yellow vein virus (CIYW), Cocksfoot streak virus (CSV), Cowpea aphid-borne mosaic virus (CABMV), Daphne virus Y (DVY), Dasheen mosaic virus (DMV), East Asian Passiflora virus (EAPV), Fritillary virus Y (FVY), Japanese yam mosaic virus (JYMV), Johnsongrass mosaic virus (JGMV), Konjak mosaic virus (KoMV), Leek yellow stripe virus (LYSV), Lettuce mosaic virus (LMV), Lily mottle virus (LMoV), Maize dwarf mosaic virus (MDMV), Narcissus yellow stripe virus (NYSV), Onion yellow dwarf virus (OYDV), Papaya leaf distortion mosaic virus (PLDMV), Papaya ringspot virus (PRSV), Pea seed-borne mosaic virus (PSbMV), Peanut mottle virus (PeMV), Peanut stripe virus (PStV), Pennisetum mosaic virus (PenMV), Pepper mottle virus (PepMoV), Peru tomato mosaic virus (PTV), Plum pox virus (PPV), Potato virus A (PVA), Potato virus V (PVV), Potato virus Y (PVY), Scallion mosaic virus (ScaMV), Shallot yellow stripe virus (SYSV), Soybean mosaic virus (SMV), Sugarcane mosaic virus (SCMV), Sweet potato feathery mottle virus (SPFMV), Thunberg fritillary mosaic virus (TFMV), Tobacco etch virus (TEV), Tobacco vein mottling virus (TVMV), Turnip mosaic virus (TuMV), Watermelon mosaic virus (WMV), Wild potato mosaic virus (WPMV), Wisteria vein mosaic virus (WVMV), Yam mosaic virus (YMV), Zucchini yellow mosaic virus (ZYMV) and Ryegrass mosaic rymovirus (RMV). A preferred 5’-UTR of the modified RNA molecule is from, or is derived from, the 5’-UTR of a Tobacco etch virus (TEV). The 5’-UTR of the modified RNA molecule may be a sequence analogous to the 5’-UTR of a Tobacco etch virus (TEV).

[0121] Preferably, the 5’-UTR of the modified RNA molecule comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or about 100% sequence identity with any one of SEQ ID NO: 1 - 45. Preferably, the 5’-UTR of the modified RNA molecule comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or about 100% sequence identity with SEQ ID NO: 37, i.e. the 5’-UTR of the Tobacco etch virus (TEV)

[0122] Alternatively, the 5’-UTR of the modified RNA molecule may comprise a 5’-UTR sequence from a plant RNA transcript, or a sequence derived thereof. A preferred 5’-UTR is a 5’-UTR from a highly expressed gene. A preferred 5’-UTR is from, or is derived from, a plant ubiquitin gene, preferably a maize ubiquitin gene (ZmUbi). The 5’-UTR of ZmUbi has been used previously in the art to control Cas9 expression in maize (Zhang et al (2016), supra). A preferred 5’-UTR of the modified RNA molecule may therefore comprise a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or about 100% sequence identity with SEQ ID NO: 46 (ZmUbi).

[0123] The RNA molecule comprising a 5’-UTR as defined herein is preferably a modified RNA molecule as defined herein. However, also provided herein is a method for producing a plant cell comprising an RNA molecule, comprising the steps of: i) providing the plant cell; and ii) introducing the RNA molecule into the plant cell, wherein the RNA molecule comprises a 5’-UTR, a coding sequence, and a 3’-UTR, wherein the 5’-UTR comprises a 5’-UTR of a positive-strand RNA virus or the 5’- UTR of a plant RNA transcript, and wherein the 3’-UTR comprises a poly(A) tail, and wherein the RNA molecule has an increased protein expression as compared to an identical RNA molecule not comprising said 5’-UTR (control). The increased protein expression may be at least one of: i) an increased total amount (i.e. the sum of the amount of protein expressed after a transfection event over a defined time period); ii) an increased protein level (i.e. the level of protein at a certain time point after transfection, preferably the peak level of protein after transfection); and iii) a prolonged period of increased protein levels (i.e. the protein can be detected in the cell for a longer period of time as the mRNA is present for a longer period of time). Preferably in this embodiment, the 5’-UTR of the identical (control) RNA molecule comprises the same length and the same number of nucleotides, but the nucleotide sequence is scrambled.

[0124] 3’-UTR

[0125] The modified RNA molecule comprises a 3’-UTR. Regulatory regions within the 3'-UTR are known to influence polyadenylation, translation efficiency, localization, and stability of the mRNA. The modified RNA molecule is preferably designed such that it has an optimal translation efficiency and stability. As a non-limiting example, it is known that a 3'-UTR may comprise binding sites for regulatory proteins as well as microRNAs (miRNAs). Preferably, the 3’-UTR of the modified RNA molecule is devoid from any binding site for a plant microRNA, preferably the modified RNA molecule does not have a binding site for a plant microRNA that is known to be expressed in the provided plant cell. Hence preferably, the modified RNA molecules is devoid of plant microRNA response elements (MREs).

[0126] Alternatively or in addition, the 3’-UTR of the modified RNA molecule does not comprise a silencer sequence. A silencer RNA sequence is a sequence capable of binding a repressor that inhibits protein translation. The 3’-UTR of the modified RNA molecule preferably does not comprise a silencer sequence that can bind to a repressor that is known to be expressed in the provided cell.

[0127] Alternatively or in addition, the 3’-UTR of the modified RNA molecule does not comprise a AU-rich element (ARE) that could affect the stability of the modified RNA molecule. The modified RNA molecule preferably does not comprise at least one of a class I, class II, class III, group 1 , group 2, group 3, group 4 and a group 5 ARE.

[0128] Alternatively or in addition, the 3’-UTR of the modified RNA molecule may comprise a 3’- UTR sequence from a plant RNA transcript, or a sequence derived thereof. A preferred 3’-UTR is a 3’-UTR from a highly expressed gene. A preferred 3’-UTR is from, or is derived from, a plant ubiquitin gene, preferably a maize ubiquitin gene (ZmUbi).

[0129] The length of the 3’-UTR may be short (1-500 bp), medium (501-2,000 bp), or long (> 2,000 bp) (Srivastava A.K. et al, Trends Plant Sci. 2018, 23(3): 248-259). In general, a shorter 3’- UTR is more stable than a longer 3’-UTR. Hence preferably, the modified RNA molecule has a short 3’-UTR. The 3’-UTR may have about 1 - 5 nt, about 1 - 10, about 1 - 50 nt, about 1 - 100 nt, about 1 -200 nt or about 1 - 300 nt. Preferably, the 3’-UTR comprises or consists of the nucleotide sequence ACCCAGCTT.

[0130] The 3’-UTR may be designed to comprise a secondary structure, e.g. a stem-loop structure, that further aids in the stability of the modified RNA molecule.

[0131] The 3’-UTR preferably comprises a poly(A) tail. The poly(A) tail may protect the modified RNA molecule from degradation in the cytoplasm. The poly(A) tail comprises a stretch of adenine bases. A poly(A) tail is well-known for the person skilled in the art and the skilled artisan readily understands that such stretch may have a variable length. Optionally the poly(A) tail may indicated herein as An, wherein n is about 10 - 1000, preferably about 20 - 800, about 40 - 700, about 60 - 600, about 80 - 500, about 90 - 400 or wherein n is about 100 - 300. Preferably, n is about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475 or wherein n is about 500. Preferably, n is about 200.

[0132] 5’-cap

[0133] Optionally, the modified RNA molecule for use in the method described herein comprises a 5’-cap. The 5’-cap may further aid in the stability of the modified RNA molecule. The 5’-cap is well-known in the art for the skilled person. It contains a guanine nucleotide connected to the RNA via an unusual 5' to 5' triphosphate linkage. This guanosine is methylated on the 7 position. The 5’-cap may also be referred to as 7-methylguanylate cap, or m7G. Optionally, the 5’-cap may comprise additional modifications, such as a methylated 2'-hydroxy group on the first ribose sugar, or methylated 2'-hydroxy groups on the first two ribose sugars. Optionally, the modified RNA molecule may comprise at its 5’-end a 5'-trimethylguanosine cap, a 5'-monomethylphosphate cap, or the modified RNA molecule is optionally capped with NAD+, NADH, or 3'-dephospho-coenzyme A.

[0134] Optionally, the modified RNA molecule does not comprise a (cap) modification at the 5’-end.

[0135] Coding sequence

[0136] The modified RNA molecule comprises a sequence coding for a protein of interest. Preferably the sequence encoding for the protein of interest is codon optimized for expression in plant cells. Optionally said protein of interest is a protein encoded by a transgene or an endogenous gene for the plant cell of the method provided herein. Optionally, the protein of interest is derived from a protein encoded by an endogenous gene having one or more mutations, wherein said one or more mutations may result in an increased activity and / or a gain-of-function. The modification(s) of said RNA molecule provides for an increased expression of the protein of interest, as compared to a control. The control is preferably an identical RNA molecule, but comprising unmodified uridines. The control RNA molecule is preferably introduced into the plant cell using the same experimental conditions as for introducing the modified RNA molecule. Preferably, the control RNA molecule and modified RNA molecule may be introduced into an identical plant cell under identical conditions.

[0137] The invention is not limited to any particular protein of interest. The protein of interest may be an enzyme, a reporter protein, a hormone, a morphogenic polypeptide, or a site-directed nuclease. The protein of interest may be an enzyme, e.g. selected from the group consisting of carbohydrases (including cellulases, amylases, pectinases and lactases), proteases, lipases, phytases, laccases, polymerases and nucleases. The protein of interest may be a reporter protein, such as, but not limited to green FP ( (e)GFP), blue FP (BFP), cyan FP (CFP), yellow FP (YFP), orange FP (OFP) and red FP (RFP). The protein of interest may be a hormone, preferably a plant hormone, such as, but not limited an auxin or a cytokinin. The protein of interest may be a morphogenic polypeptide, preferably a morphogenic polypeptide as described herein. Preferably the protein of interest is a site-directed nuclease.

[0138] Preferably, the site-directed nuclease is a programmable nuclease or a “site-directed nuclease” such as, but not limited to, a transcription activator-like endonuclease (TALEN), a zinc finger nuclease (ZFN), a meganuclease, a clustered regularly interspaced short palindromic repeats (CRISPR)-nuclease and an Argonaute. The site-directed nuclease may have endonuclease activity, preferably being capable of introducing a double strand break in duplex DNA, or may be modified to show reduced endonuclease activity, e.g. rendering nickase, preferably being capable of introducing a single strand break in duplex DNA, or abolished nuclease activity, rendering a dead nuclease. Preferably, the coding sequence encodes a TALEN, a CRISPR-nuclease, a WOX5 or a PLT1 protein.

[0139] The coding sequence of the modified RNA molecule as defined herein may encode a protein of interest, wherein the protein of interest is a site-directed nuclease. A site-directed (endo)nuclease is understood herein as a protein (optionally when forming a complex with a nucleic acid) that modifies, e.g. cleaves, a (double-stranded) nucleic acid molecule at a target sequence.

[0140] The protein of interest, preferably the site-directed nuclease, may comprise a nuclear localisation signal (NLS) to direct the expressed protein to the nucleus of the plant cell. The NLS may be located at the C-terminus and / or at the N-terminus of the protein of interest. Any known nuclear localisation signal would be suitable for use in the invention. Preferred nuclear localisation signals include, but are not limited to the NLS of the SV40 Large T-antigen MEDPTMAPKKKRKV (SEQ ID NO: 81), the monopartite NLS PKKKRKV (SEQ ID NO: 82) and the NLS of nucleoplasmin KRPAATKKAGQAKKKK (SEQ ID NO: 83). The protein of interest may comprise two or more nuclear localisation signals, e.g. one or more at the N-terminus and one or more at the C-terminus. The protein of interest may comprise two or more different nuclear localisation signals, e.g. the NLS at the C-terminus may differ from the NLS at the N-terminus.

[0141] Introducing the expression of a site-directed nuclease in the plant cell, optionally in combination with the presence of a guide, preferably a guide RNA, preferably results in a targeted modification of the plants genome. The targeted modification is preferably a mutation, e.g. an insertion or deletion (indel), of one or more nucleotides. Hence the produced plant cell comprising the modified RNA molecule may comprise a targeted genomic modification. The targeted genomic modification can be transferred to one or more cells, e.g. by cell division. Hence encompassed herein is a plant cell, or descendent thereof, comprising the targeted genomic modification, but not comprising the modified RNA molecule, and not comprising the optional guide. The cell comprising the targeted genomic modification may be developed into a multicellular tissue comprising the genomic modification. The method of the invention may thus further comprise a step of developing or producing a multicellular tissue, preferably a plant, having a targeted genomic modification, and wherein preferably the multicellular tissue does not comprise the modified RNA molecule.

[0142] Developing a plant from the plant cell comprising the targeted genomic modification can be done using any conventional method known in the art. As a non-limiting example, the cell comprising the targeted genomic modification may regenerate, develop into pollen and / or egg cells, followed by self-pollination or the pollination of a second plant, preferably comprising cells having the same or a different targeted genomic modification

[0143] Alternatively, a meristem cell having a targeted genomic modification may develop into a plant by means of regeneration e.g. after decapitation. As a non-limiting example, one or more plant cells of a plant, preferably one or more cells of a cotyledon, may be transfected with a modified RNA molecule, followed by decapitation of preferably the shoot apical meristem. The subsequently newly formed meristem cells may comprise the targeted genomic modification and these newly formed meristem cells may regenerate into a plant comprising cells having the targeted genomic modification. Alternatively, the plant may first be decapitated, followed by transfection and subsequent genomic modification of the newly formed meristem cell. The newly formed meristem cell may regenerate into a plant comprising cells having the targeted genomic modification.

[0144] • TALEN

[0145] The protein of interest is preferably a transcription activator-like effector nuclease (TALEN). Hence the modified RNA molecule preferably comprises a coding sequence, wherein the coding sequence encodes a TALEN. TALENs are well-known for the person skilled in the art and are constructed by fusing a TAL effector DNA binding domain (TALE) to an effector domain, preferably a (non-specific) DNA cleavage domain, such as a Fokl cleavage domain. TALENs are known in the art to be effective in plant cells. The term "Transcriptional Activator-Like Effector1', “TALE” or “TAL effector DNA binding domain" as used herein, refers to proteins comprising a DNA binding domain, which contains a highly conserved 33- 34 amino acid sequence comprising a highly variable two-amino acid motif (Repeat Variable Diresidue, RVD). The RVD motif is known to determine the binding specificity to a nucleic acid sequence, and can be engineered according to methods well known to those of skill in the art to specifically bind a desired DNA sequence (see, e.g., \NO2f \ QIQ7 Q, WO2011 / 072246 and WO2015027134, the entire contents of each of which are incorporated herein by reference). The simple relationship between amino acid sequence and DNA recognition has allowed for the engineering of specific DNA binding domains by selecting a combination of repeat segments containing the appropriate RVDs.

[0146] A preferred conserved 34 amino acid sequence of the TALE has at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any one of SEQ ID NO: 47 - 50. Positions 12 and 13 constitute the two amino acid motif (RVD) and may be amended to achieve sequence-specific DNA binding. A preferred RVD is selected from the group consisting of two amino acid combinations HD, NG, Nl, NN, NS, N-, HG, H-, IG, NK, HA, ND, HI, HN, NA, SN and YG, e.g. as described in WO201 1072246, which incorporated herein by reference. Preferably, the RVD is “Nl” for targeting an adenine, is “NG” for targeting a thymine, is “NN” for targeting a guanine and / or is “HD” for targeting a cytosine. Preferably for targeting an adenine, the TALE has at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 47. Preferably for targeting a thymine, the TALE has at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 48. Preferably for targeting a guanine, the TALE has at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 49. Preferably for targeting a cytosine, the TALE has at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 50.

[0147] The coding sequence of the modified RNA molecule may encode for a number of TALEs, optionally linked to a nuclease domain, thereby forming a TALEN. The separate TALE domains of the TALEN preferably have at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 51 , wherein optionally positions 34 -39 (constituting the RVD) may be altered to achieve sequence-specific DNA binding. Preferably, nucleotide position 34 - 39 of SEQ ID NO: 51 may encode the amino acid residues “Nl” for targeting an adenine, encode the amino acid residues “NG” for targeting an thymine, encode the amino acid residues “NN” for targeting a guanine or encode the amino acid residues “HD” for targeting an cytosine.

[0148] The coding sequence of the modified RNA molecule preferably encodes a TALEN, wherein the TALEN comprises a number of TALEs, wherein each TALE may target a single nucleotide. The number of TALEs is thus dependent on the length of the targeted nucleotide sequence. As a non- limiting example for targeting a 17 or a 18 bp nucleotide sequence, the encoded TALEN preferably comprises respectively 17 or 18 TALEs.

[0149] The term "Transcriptional Activator-Like Element Nuclease" or “TALEN’ as used herein, refers to an engineered nuclease, comprising a transcriptional activator like effector DNA binding domain (TALE) linked to a DNA cleavage domain, for example, a Fokl domain. A number of modular assembly schemes for generating engineered TALE constructs have been reported previously and are known for the person skilled in the art.

[0150] Transcription activator- like effector nucleases (TALENs) are fusions of a restriction endonuclease cleavage domain, preferably a Fokl domain, with a DNA-binding transcription activator-like effector (TALE) repeat array. Other useful endonuclease domains may include, for example, Hhal, Hindlll, Notl, BbvCI, EcoRI, Bgl II and Alwl. Preferably, the cleavage domain is a Fokl domain.

[0151] TALENs can be engineered to reduce off-target cleavage activity and thus to specifically bind a target DNA sequence and can thus be used to cleave a target DNA sequence, e.g., in a (plant) genome, in vitro or in vivo. Such engineered TALENs can be used to edit genomes in vivo or in vitro, e.g. for the creation of indels, for gene knockouts or knock-ins via induction of DNA breaks at a target genomic site, for targeted gene knockout through non-homologous end joining (NHEJ), ortargeted genomic sequence replacement through homology-directed repair (HDR) using an exogenous DNA template.

[0152] TALENs can be designed to practically cleave any desired target DNA sequence, including naturally occurring and synthetic sequences. Preferred TALENs are fusions of the Fokl restriction endonuclease cleavage domain with a DNA-binding TALE repeat array. These arrays comprise multiple 34-amino acid TALE repeat sequences, each of which uses a repeat-variable di-residue (RVD), preferably the amino acids at positions 12 and 13, to recognize a single nucleotide. Examples of RVDs that enable recognition of each of the four DNA base pairs are known, enabling arrays of TALE repeats to be constructed that can bind virtually any DNA sequence.

[0153] The TALE may be linked to a catalytic domain of Fokl, also annotated herein as a “Fokl domain”. The Fokl domain acts as a dimer and is thus only active upon dimerization, e.g. when forming a homodimer or a heterodimer. Optionally, TALENs can be engineered to be active only as heterodimers through the use of obligate heterodimeric Fokl variants (e.g. as described in Cade, L. et al. 2012, Highly efficient generation of heritable zebrafish gene mutations using homo- and heterodimeric TALENs. Nucleic Acids Res 40, 8001-8010). In this configuration, two distinct TALEN monomers are each designed to bind one target half- site and to cleave within the DNA spacer sequence between the two half-sites.

[0154] Therefore preferably, the method comprises a step ii) of introducing into a plant cell a first and a second modified RNA molecule as defined herein, i.e. introducing a combination of modified RNA molecules. The first modified RNA molecule comprises a first coding sequence encoding a first part of a TALEN and the second modified RNA molecule comprises a second coding sequence encoding a second part of the TALEN, wherein the first and second part of the TALEN form a functional TALEN, i.e. a TALEN that is capable of introducing a double-stranded break at the targeted sequence. The first part of the TALEN preferably comprises a first TALE linked to a Fokl monomer and the second part of the TALEN preferably comprises a second TALE linked a Fokl monomer. The two Fokl monomers may form a homodimer or heterodimer that is capable of cleaving the double-stranded DNA. Hence the first and second TALE can hybridize to or near a sequence of interest, or to or near the complement of a sequence of interest, preferably a sequence of interest as defined herein. Preferably, the first and second TALE hybridize to complementary DNA strands at an orientation and spacing that allow the Fokl domains to form a dimer and cleave the DNA.

[0155] In cells, e.g., in plant cells, TALEN-induced double-strand breaks can result in site-directed mutagenesis events, such as the creation of indels, targeted gene knockout through non- homologous end joining (NHEJ) or targeted genomic sequence replacement through homology- directed repair (HDR) using an exogenous DNA template. Previously, TALENs have been successfully used to manipulate genomes in a variety of organisms, including plant cells (as reviewed in e.g. Tzfira, T. et al. (2012) Genome modifications in plant cells by custom-made restriction enzymes. Plant Biotechnol. J. 10, 373-389; Curtin, S.J. et al. (2012) Genome engineering of crops with designer nucleases. Plant Genome 5, 42-50).

[0156] • CRISPR nuclease

[0157] The modified RNA molecule may comprise a coding sequence encoding a CRISPR- nuclease, preferably a CRISPR-nuclease as defined herein. Preferably, the nuclease is a Type II CRISPR-nuclease, e.g., Cas9 (e.g., the protein of SEQ ID NO: 74, encoded by SEQ ID NO: 75, or the protein of SEQ ID NO: 76) or a Type V CRISPR-nuclease, e.g. Cpf1 (e.g., the protein of SEQ ID NO: 77, encoded by SEQ ID NO: 78) or Mad7 (e.g. the protein of SEQ ID NO: 79 or 80), or a protein derived thereof, having preferably at least about 70%, 80%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to said protein over its whole length. Preferably, the site-directed nuclease is a Type II CRISPR-nuclease, preferably a Cas9 nuclease.

[0158] The skilled person knows how to prepare a modified RNA molecule as defined herein, comprising a sequence encoding the site-directed nuclease, such as a sequence encoding a CRISPR-nuclease. In the prior art, numerous reports are available on the design of a CRISPR- nuclease and its use. See for example the review by Haeussler et al (J Genet Genomics. (2016)43(5):239-50. Doi: 10.1016 / j.jgg.2O16.04.008.) on the design of guide RNA and its combined use with a CAS-protein (originally obtained from S. pyogenes), or the review by Lee et al. (Plant Biotechnology Journal (2016) 14(2) 448-462). Optionally, the site-directed nuclease is a CRISPR- nuclease being either a nickase or (endo)nuclease.

[0159] The site-directed nuclease expressed by the modified RNA may comprise or consist of a whole type II or type V CRISPR-nuclease or variant or functional fragment thereof. Optionally, such fragment binds the guide RNA, but e.g. may lack one or more residues required for nuclease activity. Preferably, the site-directed nuclease is a Cas9 protein. The Cas9 protein may be derived from the bacteria Streptococcus pyogenes (SpCas9; NCBI Reference Sequence NC_017053.1 ; UniProtKB - Q99ZW2), Geobacillus thermodenitrificans (UniProtKB - A0A178TEJ9), Corynebacterium ulcerous (NCBI Refs: NC_015683.1 , NC_017317.1); Corynebacterium diphtheria (NCBI Refs: NC_016782.1 , NC_016786.1); Spiroplasma syrphidicola (NCBI Ref: NC_021284.1); Prevotella intermedia (NCBI Ref: NC_017861 .1); Spiroplasma taiwanense (NCBI Ref: NC_021846.1); Streptococcus iniae (NCBI Ref: NC_021314.1); Belliella baltica (NCBI Ref: NC_018010.1); Psychroflexus torquisl (NCBI Ref: NC_018721 .1); Streptococcus thermophilus (NCBI Ref: YP_820832.1); Listeria innocua (NCBI Ref: NP_472073.1); Campylobacter jejuni (NCBI Ref: YP_002344900.1); or Neisseria meningitidis (NCBI Ref: YP_002342100.1). Encompassed are Cas9 variants from these, having an inactivated HNH or RuvC domain homologues to SpCas9,, e.g. the SpCas9_D10A or SpCas9_H840A, or a Cas9 having equivalent substitutions at positions corresponding to D10 or H840 in the SpCas9 protein, rendering a nickase.

[0160] The site-directed nuclease may be, or may be derived from, Cpf1 , e.g. Cpf1 from Acidaminococcus sp; UniProtKB - U2UMQ6. The variant may be a Cpf1 -nickase having an inactivated RuvC or NUC domain, wherein the RuvC or NUC domain has no nuclease activity anymore. The skilled person is well aware of techniques available in the art such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis that allow for inactivated nucleases such as inactivated RuvC or NUC domains. An example of a Cpf1 nickase with an inactive NUC domain is Cpf1 R1226A (see Gao et al. Cell Research (2016) 26:901-913, Yamano et al. Cell (2016) 165(4): 949-962). In this variant, there is an arginine to alanine (R1226A) conversion in the NUC-domain, which inactivates the NUC-domain.

[0161] The site-directed nuclease may be, or may be derived from, CRISPR-Cas<t>, a nuclease that is about half the size of Cas9. CRISPR-Cas<t> uses a single crRNA for targeting and cleaving the nucleic acid as is described e.g. in Pausch et al (CRISPR-Cas<f> from huge phages is a hypercompact genome editor, Science (2020); 369(6501):333-337).

[0162] An active, partly inactive or dead site-directed nuclease, preferably an active, partly inactive or dead CRISPR-nuclease complex may serve to guide a fused functional domain to a specific site in the DNA as determined by the guide RNA. Hence, the site-directed nuclease may be fused to a functional domain. Optionally, such functional domain is an endonuclease domain or a domain for epigenetic modification, for example a histone modification domain.

[0163] In an embodiment, the modified mRNA molecule as disclosed herein comprises a coding sequence encoding an inactive CAS protein (e.g. dCas9, dCpfl) fused to a restriction enzyme such as, but not limited to, Fok1 or Clo51 , preferably as described in WO2014 / 144288, WO2016 / 205554, Tsai et al. Nat Biotechnol. 2014 Jun; 32(6): 569-576, or Cheng et al Biotechnol J. 2022 Jul;17(7): e2100571 , all of which are incorporated herein by reference). Preferably, the fusion protein has a sequence of any one of SEQ ID NO: 84 - 86, or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 805, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with any one of SEQ ID NO: 84 - 86.

[0164] In an embodiment, the modified mRNA molecule as disclosed herein comprises a coding sequence encoding an inactive CAS protein (e.g. dCas9, dCpfl) fused to a domain for epigenetic modification. The domains for epigenetic modification can be selected from the group consisting of a deaminase, methyltransferase, a demethylase, a deacetylase, a methylase, a deacetylase, a deoxygenase, a glycosylase and an acetylase (Cano-Rodriguez et al, Curr Genet Med Rep (2016) 4:170-179). The methyltransferase may be selected from the group consisting of G9a, Suv39h1 , DNMT3, PRDM9 and Dot1 L. The demethylase may be LSDI .The deacetylase may be SIRT6 or SIRT3.

[0165] Optionally, the functional domain is a deaminase, or functional fragment thereof, selected from the group consisting of an apolipoprotein B mRNA-editing complex (APOBEC) family deaminase, an activation-induced cytosine deaminase (AID), an ACF1 / ASE deaminase, an adenine deaminase, and an ADAT family deaminase. Alternatively or in addition, the deaminase or functional fragment thereof may be ADAR1 or ADAR2, or a variant thereof. The apolipoprotein B mRNA-editing complex (APOBEC) family of cytosine deaminase enzymes encompasses eleven proteins that serve to initiate mutagenesis in a controlled and beneficial manner. Preferably, the APOBEC deaminase is selected from the group consisting of APOBEC1 , APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4 and Activation-induced (cytidine) deaminase. Preferably, the cytosine deaminase of the APOBEC family is activation-induced cytosine (or cytidine) deaminase (AID) or apolipoprotein B editing complex 3 (APOBEC3). Preferably, the deaminase domain fused to the CRISPR-nuclease an APOBEC1 family deaminase.

[0166] Another exemplary suitable type of deaminase domain that may be fused to the site- directed nuclease, preferably to the CRISPR-nuclease, is an adenine or adenosine deaminase, for example an ADAT family of adenine deaminase. Further, the adenine deaminase may be TadA or a variant thereof, preferably as described in Gaudelli et al., 2017 (Gaudelli et al. 2017 Nature 551 : 464-471). Further, the nuclease, preferably the CRISPR-nuclease, may be fused to an adenine deaminase domain, e.g. derived from ADAR1 or ADAR2. The deaminase domain of the present invention may comprise or consist of a whole deaminase protein or a fragment thereof which has catalytic activity. Preferably, the deaminase domain has deaminase activity. Optionally, the nuclease element, preferably the CRISPR-nuclease, is further fused to an UDG inhibitor (UGI) domain.

[0167] The site-directed nuclease, preferably the CRISPR-nuclease, may be fused to a reverse transcriptase, e.g. as described in Anzalone AV, et al (Nature (2019), 576, pages149-157), preferably for use in prime-editing.

[0168] The site-directed nuclease encoded by the modified RNA molecule may be an Argonaute protein. Argonaute (Ago) proteins bind small RNA or DNA guides, which provide base-pairing specificity for recognition and cleavage of complementary nucleic acid targets (Kaya et al. PNAS 2016 Apr 12; 113(15): 4057-4062). The Argonaute proteins may cleave DNA, in a process known as DNA interference as described e.g. in Kuzmenko et al (Nature (2020), 587, 632 - 637). Optionally, the Argonaute protein is complexed with or fused one or more functional domains or proteins, preferably at least one of a helicase and topoisomerase domain, preferably to unwind the genomic DNA.

[0169] Preferably in step ii) of the method of the invention the modified RNA molecule may be introduced in combination with a guide, preferably a guide RNA. The guide may be introduced simultaneously, before or after the introduction of the modified RNA molecule. Preferably, the guide is introduced after the introduction of the modified RNA molecule. Preferably the site-directed nuclease is expressed from the modified RNA molecule, prior to the introduction of the guide. Preferably, step ii) comprises a step of introducing in a plant cell a modified RNA molecule and a guide, wherein the guide is introduced simultaneously, or about 1 , 2, 3, 4 or about 5 days after introduction of the modified RNA molecule.

[0170] The guide directs the complex to a defined target site in a (double-stranded) nucleic acid molecule, also named the protospacer sequence. The guide comprises a sequence for targeting the site-directed nuclease complex to a protospacer sequence that is preferably near, at or within a sequence of interest in the genome of the plant cell.

[0171] In case the site-directed nuclease forms a CRISPR-endonuclease complex, the guide may be a guide RNA that is a single guide (sg)RNA molecule, or the combination of a crRNA and a tracrRNA (e.g. for Cas9) as separate molecules, or a crRNA molecule only (e.g. in case of Cpf1 and Cas<t>). Optionally, the guide RNA is a single guide (sg)RNA (e.g. for Cas9) or a crRNA only (e.g. in case of Cpf1 and Cas<t>).

[0172] The guide, preferably a guide RNA, for use in a method of the invention may comprise a sequence that can hybridize to or near a sequence of interest, preferably a sequence of interest as defined herein. The guide, preferably a guide RNA, preferably comprises a nucleotide sequence that is fully complementary to a sequence in the sequence of interest i.e. the sequence of interest comprises a protospacer sequence. Alternatively or in addition, the guide, preferably a guide RNA, for use in the invention may comprise a sequence that can hybridize to or near the complement of a sequence of interest.

[0173] Optionally, the modified RNA molecule as defined herein may comprise an additional functional element. Preferably, said element may be located in at least one of: after (the optional) 5’-cap of the modified RNA molecule; before the 5’-UTR; in between the 5’-UTR and the coding sequence; in between the coding sequence and the 3’-UTR; within the 3’-UTR, but before the poly(A) tail; and after the 3’-UTR (and after the poly(A) tail),

[0174] As a non-limiting example, the additional functional element may be a guide, preferably a guideRNA. The guide may or may not comprise a modified uridine as defined herein. The modified RNA molecule may comprise a 5’-UTR, a coding sequence and a 3’-UTR, preceded or followed by a guide sequence. Optionally, the modified RNA molecule comprises a cleavable spacer sequence, such as, but not limited to, a tRNA or tRNA-like structure. As a non-limiting example, the cleavable sequence may be located in between the additional functional element, preferably a guide RNA, and the 5’-UTR, coding sequence, and / or 3’-UTR of the modified RNA molecule.

[0175] In addition or alternatively, the additional functional element may be a mobile element, wherein the mobile element enables intercellular translocation of the modified RNA molecule from one plant cell to another plant cell. Preferably, the mobile element is a (plant) tRNA. Optionally, the modified RNA molecule comprises an element and / or an editing RNA as described in WO2022219175, which is incorporated herein by reference.

[0176] Optionally the modified RNA molecule encodes a site-directed nuclease, wherein the site- directed nuclease is a TALEN, a ZFP or ZFN, or a meganuclease such as l-Scel, l-Crel or l-Dmol. Optionally, the site-directed nuclease is active, e.g. is capable of inducing a DSB, as a dimer. The expressed site-directed nuclease may be designed to target to a specific location in the genome of a plant cell to achieve a targeted genetic modification. Said target site is preferably near, at or within a sequence of interest in the genome of the plant cell.

[0177] • Morphogenic polypeptide

[0178] The coding sequence of the modified RNA molecule may encode a morphogenic polypeptide. As used herein, the term “regeneration factor3’, “morphogenic polypeptide" or “morphogenic developmental polypeptide" means a polypeptide that when ectopically expressed stimulates formation of a somatically-derived structure that can produce a plant. More precisely, ectopic expression of the morphogenic polypeptide stimulates the de novo formation of a somatic embryo or an organogenic structure, such as a shoot meristem, that can produce a plant. This stimulated de novo formation occurs either in the cell in which the morphogenic polypeptide is expressed, or in a neighbouring cell. A morphogenic polypeptide can be a transcription factor that regulates expression of other genes, or a polypeptide that influences hormone levels in a plant tissue, both of which can stimulate morphogenic changes.

[0179] Preferably, the encoded morphogenic developmental polypeptide is at least one of a WUS / WOX homeobox polypeptide, a PLT (PLETHORA) protein, a polypeptide comprising two AP- 2 DNA binding domains and WIND1. Preferably, the morphogenic developmental polypeptide encoded by the modified RNA molecule is at least one of a WUS / WOX homeobox polypeptide and a PLT protein. Preferably, the morphogenic developmental polypeptide encoded by the coding sequence of the modified RNA molecule is at least one of a WOX5 homeobox polypeptide and a PLT1 protein.

[0180] The WUS / WOX homeobox polypeptide encoded by the modified RNA molecule is preferably selected from the group consisting of WUS1 , WUS2, WUS3, WOX2A, WOX4, WOX5, WOX5A, or WOX9 polypeptide (see e.g. US patents 7,348,468 and 7,256,322 and US Patent Application Publication Numbers 2017 / 0121722 and 2007 / 0271628, herein incorporated by reference in their entirety and van der Graaff et al., 2009, Genome Biology 10:248). The functional WUS / WOX homeobox polypeptide encoded by the modified RNA molecule can be obtained from or derived from any plant. A functional WUS / WOX polypeptide contains a homeobox DNA binding domain, a WUS box, and an EAR repressor domain and are e.g. listed in Table 1 of WO2020214986, in particular SEQ ID NO: 246 - 310 of WO2020214986, which sequences are incorporated herein by reference.

[0181] A preferred WUS / WOX homeobox polypeptide encoded by the coding sequence of the modified RNA molecule is WOX5. The amino acid sequence of the WOX5 protein preferably has at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 87. SEQ ID NO: 87 is the Arabidopsis thaliana WOX5 protein. In an embodiment, the WOX5 amino acid sequence is or is derived from AT3G11260, a homolog thereof, or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT3G11260 or its homolog. In an embodiment, the WOX5 protein is encoded by a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 88. The nucleotide sequence encoding the WOX5 protein can be, or can be derived from the gene AT3G11260, a homolog thereof or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT3G11260 or its homolog. The percentage identity can be determined over the full length of the genomic sequence. Alternatively the percentage identity can be determined over the full length of the coding sequence of the gene.

[0182] The PLT protein is preferably selected from the group consisting of PLT1 , PLT2, PLT3, PLT4, PLT5 and PLT7. Preferably, the PLT protein is at least one of PLT1 , PLT4 and PLT5. Preferably, the PLT protein is PLT1. The amino acid sequence of the PLT1 protein can have at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 89. SEQ ID NO: 89 is the Arabidopsis thaliana PLT1 protein. In an embodiment, the PLT1 amino acid sequence is or is derived from AT3G20840, a homolog thereof, or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT3G20840 or its homolog. In an embodiment, the PLT1 protein is encoded by a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 90. The nucleotide sequence encoding the PLT1 protein can be, or can be derived from the gene AT3G20840, a homolog thereof or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT3G20840 or its homolog. The percentage identity can be determined over the full length of the genomic sequence. Alternatively the percentage identity can be determined over the full length of the coding sequence of the gene.

[0183] The amino acid sequence of the PLT2 protein can have at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 91. SEQ ID NO: 91 is the Arabidopsis thaliana PLT2 protein. In an embodiment, the PLT2 amino acid sequence is or is derived from AT 1 G51190, a homolog thereof, or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT1 G51190 or its homolog. In an embodiment, the PLT2 protein is encoded by a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 92. The nucleotide sequence encoding the PLT2 protein can be, or can be derived from the gene AT1 G51190, a homolog thereof or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT1 G51190 or its homolog. The percentage identity can be determined over the full length of the genomic sequence. Alternatively the percentage identity can be determined over the full length of the coding sequence of the gene.

[0184] The amino acid sequence of the PLT3 protein can have at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 93. SEQ ID NO: 93 is the Arabidopsis thaliana PLT3 protein. In an embodiment, the PLT3 amino acid sequence is or is derived from AT5G10510, a homolog thereof, or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT5G10510 or its homolog. In an embodiment, the PLT3 protein is encoded by a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 94. The nucleotide sequence encoding the PLT3 protein can be, or can be derived from the gene AT5G10510, a homolog thereof or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT5G10510 or its homolog. The percentage identity can be determined over the full length of the genomic sequence. Alternatively the percentage identity can be determined over the full length of the coding sequence of the gene.

[0185] The amino acid sequence of the PLT4 protein can have at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 95. SEQ ID NO: 95 is the Arabidopsis thaliana PLT4 protein. In an embodiment, the PLT4 amino acid sequence is or is derived from AT5G17430, a homolog thereof, or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT5G17430 or its homolog. In an embodiment, the PLT4 protein is encoded by a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 96. The nucleotide sequence encoding the PLT4 protein can be, or can be derived from the gene AT5G17430, a homolog thereof or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT5G17430 or its homolog. The percentage identity can be determined over the full length of the genomic sequence. Alternatively the percentage identity can be determined over the full length of the coding sequence of the gene.

[0186] The amino acid sequence of the PLT5 protein can have at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 97. SEQ ID NO: 97 is the Arabidopsis thaliana PLT5 protein. In an embodiment, the PLT5 amino acid sequence is or is derived from AT5G57390, a homolog thereof, or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT5G57390 or its homolog. In an embodiment, the PLT5 protein is encoded by a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 98. The nucleotide sequence encoding the PLT5 protein can be, or can be derived from the gene AT5G57390, a homolog thereof or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT5G57390 or its homolog. The percentage identity can be determined over the full length of the genomic sequence. Alternatively the percentage identity can be determined over the full length of the coding sequence of the gene.

[0187] The amino acid sequence of the PLT7 protein can have at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 99. SEQ ID NO: 99 is the Arabidopsis thaliana PLT7 protein. In an embodiment, the PLT7 amino acid sequence is or is derived from AT5G65510, a homolog thereof, or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT5G65510 or its homolog. In an embodiment, the PLT7 protein is encoded by a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 100. The nucleotide sequence encoding the PLT7 protein can be, or can be derived from the gene AT5G65510, a homolog thereof or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT5G65510 or its homolog. The percentage identity can be determined over the full length of the genomic sequence. Alternatively the percentage identity can be determined over the full length of the coding sequence of the gene.

[0188] The polypeptide comprising two AP-2 DNA binding domains is preferably a polypeptide selected from the group consisting of an ODP2, BBM2, BMN2, or BMN3 polypeptide. The amino acid sequence of the ODP2 protein can have at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with any one of SEQ ID NO: 101. In an embodiment, the OPD2 protein is encoded by a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 102. The amino acid sequence of the BBM2 protein can have at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 103. In an embodiment, the BBM2 protein is encoded by a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 104.

[0189] The amino acid sequence of the WOUND INDUCED DEDIFFERENTIATION 1 (WIND1) protein can have at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 105. SEQ ID NO: 105 is the Arabidopsis thaliana WIND1 protein. In an embodiment, the WIND1 amino acid sequence is or is derived from AT1 G78080, a homolog thereof, or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT1 G78080 or its homolog. In an embodiment, the WIND1 protein is encoded by a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 106. The nucleotide sequence encoding the WIND1 protein can be, or can be derived from the gene AT1 G78080, a homolog thereof or a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity with AT1 G78080 or its homolog. The percentage identity can be determined over the full length of the genomic sequence. Alternatively the percentage identity can be determined over the full length of the coding sequence of the gene. Optionally, the morphogenic developmental polypeptide is a LEC1 (preferably any one of SEQ ID NO: 2, 8, 10, 12, 14, 16, 18, 20, or 22 in US 6,825,397, which is disclosed herein by reference, or a homolog thereof having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity thereto), a SHORT ROOT protein (SHR, preferably having SEQ ID NO: 107 or having a sequence encoded by SEQ ID NO: 108, or a homolog thereof having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity thereto) or SCARECROW protein (SCR, preferably having SEQ ID NO: 109 or having a sequence encoded by SEQ ID NO: 110, or a homolog thereof having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity thereto).

[0190] Optionally, the modified RNA molecule comprises two or more coding sequences, wherein the coding sequence are e.g. separated by an internal ribosome entry site. Optionally, the modified RNA molecule may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more coding sequences. Optionally, a first coding sequence may encode a WUS / WOX homeobox polypeptide, preferably WOX5, and a second coding sequence may encode a PLETHORA polypeptide, preferably PLT1. Alternatively, the first coding sequence may encode a first part of a TALEN as defined herein and the second coding sequence may encode a second part of a TALEN as defined herein.

[0191] Expression of one more morphogenic polypeptides, preferably one or more morphogenic polypeptides as defined herein, preferably results in the de novo formation of a shoot or shoot meristem and the optional regeneration into a plant. Hence encompassed herein is also a plant part, preferably a shoot, or a plant obtained by the method provided herein.

[0192] Combination of modified RNA molecules

[0193] Optionally in step ii) of the method of the invention, a combination of two or more RNA molecules is introduced into the provided plant cell, wherein at least one of the RNA molecules is a modified RNA molecule. Optionally, a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more RNA molecules is introduced, wherein at least one of those molecules is a modified RNA molecule. Optionally, about at least 25%, 50%, 75% or about 100% of the RNA molecules introduced into the plant cell are modified RNA molecules.

[0194] A preferred combination of RNA molecules is a combination of RNA molecules encoding morphogenic polypeptides, preferably a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10 RNA molecules, wherein each RNA molecule encodes a different morphogenic polypeptide, preferably a morphogenic polypeptide as specified herein. A preferred combination of RNA molecules is a combination of a first and a second RNA molecule, wherein the first RNA molecule encodes a PLETHORA polypeptide and a second RNA molecule encodes a WUS / WOX homeobox polypeptide. Preferably, the PLETHORA polypeptide is PLT1 and / or preferably the WUS / WOX homeobox polypeptide is WOX5. Preferably, at least one of the first and second RNA molecule is a modified RNA molecule.

[0195] Alternatively, a preferred combination is a combination of RNA molecules, wherein one of the RNA molecules encodes a site-directed nuclease and one of the RNA molecules is guide RNA. Optionally, the combination of RNA molecules comprises one RNA molecule encoding a site- directed nuclease and 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 1000 or more RNA molecules encoding guide RNAs. These different guide RNAs may optionally target different genes, different locations of the same gene or different allelic variants of the same gene. The encoded site-directed nuclease is preferably a CRISPR protein as defined herein. Preferably at least the RNA molecule encoding the site-directed nuclease is a modified RNA molecules. Optionally all or part of the guide RNAs comprise a pseudo-uridine and / or a N1-methyl-pseudo-uridine as defined herein.

[0196] Alternatively a preferred combination of RNA molecules is a combination of RNA molecules encoding a TALEN, preferably a combination as described herein. A preferred combination is a combination of a first and second modified RNA molecule, wherein the coding sequence of the first modified RNA molecule encodes a first part of a TALEN and the coding sequence of the second modified RNA molecule encodes a second part of the TALEN, and wherein the first and second part of the TALEN form a functional TALEN when expressed in the plant cell. The combination may comprise additional first and second parts of a TALEN, whereby the different functional TALENs may optionally target different genes, different locations of the same gene or different allelic variants of the same gene.

[0197] Alternatively, a preferred combination is a combination of: i) one or more modified RNA molecules encoding a site-specific nuclease, preferably encoding a TALEN,; and ii) one or more modified RNA molecule encoding a morphogenic polypeptide, preferably encoding a WOX5 and / or a PLT1 .

[0198] Introduction into the plant cell

[0199] The modified RNA molecule(s) can be introduced into a plant cell using any conventional method known in the art. Non-limiting examples of suitable delivery systems include chemical-based transfection (e.g. using calcium phosphate, dendrimers, cyclodextrin, polymers, liposomes, or nanoparticles), non-chemical-based methods (e.g. electroporation, cell squeezing, sonoporation, optical transfection, protoplast fusion, impalefection, heat shock and hydrodynamic delivery) and particle-based methods (e.g. a gene gun or magnet-assisted transfection).

[0200] The modified RNA molecule may be introduced into the cell using a carrier suitable for delivery of the RNA into the cell. A preferred carrier is selected from the group consisting of a lipoplex, a liposome, a polymersome, a polyplex, a dendrimer, an inorganic nanoparticle, a virosome and cell-penetrating peptides. Optionally, the modified RNA molecule may be introduced using particle bombardment or using cell-penetrating peptides (CPP). Preferred cell penetrating peptides are described in Miyamoto et al. 2021 . A preferred CPP is BP100-(KH)g or dTat-Sar- EED4, wherein BP100-(KH)g preferably comprises the sequence KKLFKKILKYLKHKHKHKHKHKHKHKHKH (381 ODa, SEQ ID NO: 52) and / or wherein dTat-Sar- EED4 preferably comprises the sequence RRRQRRKKR (SEQ ID NO: 53)-(Sar)e-GWWG(SEQ ID NO: 54) (2253Da, Sar = Sarcosine linker). The molar ratio of the modified RNA molecule : CPP is preferably at least about 1 : 1 , preferably about 1 : 5, 1 : 10, 1 : 16 or about 1 : 20, preferably about 1 : 16. Optionally, particle bombardment may be used to introduce the modified RNA molecule(s) into plant pollen.

[0201] The modified RNA molecule may be introduced into the plant cells using an aqueous medium, wherein the aqueous medium comprises PEG. Any suitable medium can be used, preferably the medium has a pH value of between 5 - 8, preferably between 6 - 7.5. Besides the modified RNA molecule, the medium may further comprise polyethylene glycol. Polyethylene glycol (PEG) is a polyether compound with many applications from industrial manufacturing to medicine. PEG is also known as polyethylene oxide (PEG) or polyoxyethylene (POE). The structure of PEG is commonly expressed as H-(O-CH2-CH2)n-OH. Preferably, the PEG used is an oligomer and / or polymer, or mixtures thereof, preferably with a molecular mass below 20,000 g / mol.

[0202] The aqueous medium preferably comprises 100 - 400 mg / ml PEG, for example, between 150 and 300 mg / ml, for example between 180 and 250 mg / ml. A preferred PEG is PEG 4000 Sigma- Aldrich no. 81240. ( / .e. having an average Mn 4000; Mn is the average molecular weight). Preferably the used PEG has a Mn of about 1000 - 10 000, for example between 2000 - 6000). Optionally, the aqueous medium comprising PEG does not comprise more than about 0.001 %, 0.01 %, 0.05%, 0.1 %, 1 %, 2%, 5%, 10% or 20% (v / v) glycerol. Preferably, the medium comprises less than about 0.001 %, 0.01 %, 0.05%, 0.1 %, 1 %, 2%, 5%, 10% or 20% (v / v) glycerol. Preferably, the aqueous medium comprises less than about 0.1 %, for example, less than 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01 %, 0.009%, 0.008%, 0.007%, 0.006%, 0.005%, 0.004%, 0.003%, 0.002%, 0.001 % , 0.0009%, 0.0008%, 0.0007%, 0.0006%, 0.0005%, 0.0004%, 0.0003%, 35 0.0002% or 0.0001 % (v / v) glycerol. Optionally, the aqueous medium comprising the modified RNA molecule is completely free of glycerol.

[0203] Optionally, the cell cycle of the plant cells is synchronized when introducing the modified RNA molecule, preferably synchronizing the plant cells in the S-phase, the M-phase, the G1 and / or G2 phase of the cell cycle.

[0204] Provided herein is also an aqueous medium as defined herein comprising a modified RNA molecule, and a composition comprising a plant cell, a modified RNA molecule and the aqueous medium as defined herein.

[0205] Selecting and regenerating the produced plant cell

[0206] The method of the invention may further comprise a step of selecting the produced plant cell, or a descendant thereof. Preferably the selected plant cell comprises at least one of the modified RNA molecule, a protein expressed from the modified RNA molecule, and, preferably in case the modified RNA molecule encodes a programmed endonuclease, a genomic sequence comprising a targeted genomic modification. Hence, the plant cell may be selected by detecting the expressed protein, detecting the modified RNA molecule and / or detecting the targeted modification.

[0207] Such detection methods are well-known for the person skilled in the art. Depending on the expressed protein, modified RNA molecule, or targeted genomic modification, the skilled person can select the appropriate experimental design. Such exemplary methods include, but is not limited to, northern blotting, western blotting, (quantitative) PCR, deep-sequencing analysis, FACS analysis, phenotypic analysis, etc.

[0208] The method as provided herein may comprise a step of regenerating the, optionally selected, plant cell or a descendant thereof. Optionally the regenerated plant cell comprises a targeted modification. Optionally, introducing the expression of a morphogenic polypeptide as defined herein is essential for the plant cell to be able to regenerate.

[0209] Further aspects

[0210] In an aspect, provided is a modified RNA molecule as described herein. Preferably, the modified RNA molecule is for use in a method as described herein. The modified RNA molecule may have any length, preferably suitable for delivery into the plant cell and / or expression of the encoded protein in the plant cell. Preferably the length of the modified RNA molecule is about 50 - 50000 nucleotides (nt), 100 - 10000 nt, 200 - 8000 nt, 300 - 7000 nt 400 - 6000 nt, 500 - 5000 nt, 600 - 4000 nt, 700 - 3000 nt, 800 - 2000 nt or about 900 - 1000 nt.

[0211] In an aspect, provided is a combination of modified RNA molecules as described herein. Preferably, the combination is for use in a method as described herein.

[0212] In an aspect, provided is a plant, plant part or plant cell obtainable by a method described herein, or a descendant thereof. Optionally, the plant, plant part or plant cell comprises a modified RNA molecule as described herein. Optionally, the plant cell is a protoplast. Optionally, the plant part is a plant pollen. Optionally, at least part of the plant obtainable by the method of the invention comprises a targeted genomic modification. Optionally, the plant is not exclusively obtainable by an essentially biological process. Optionally, the plant is a transgenic plant. Optionally, the plant cell, plant part or plant is a Solanum lycopersicon. The plant cell, plant part or plant obtainable by a method provided herein may subsequently be propagated to e.g. obtain a culture of cells, (part of) a plant or any descendants thereof.

[0213] The invention also pertains to progeny, or descendant, of a plant cell, plant part or plant obtainable by a method of the invention. Optionally, the progeny or descendant does not comprise a modified RNA molecule as defined herein. Optionally, the progeny, or descendant, comprises a genomic modification previously introduced by a method as described herein.

[0214] Further, provided herein is a plant product obtainable from the plant cell, plant part or plant as defined herein, e.g. selected from the group consisting of fruits, leaves, plant organs, plant fats, plant oils, plant starch, and plant protein fractions, either crushed, milled or still intact, mixed with other materials, dried, frozen, and so on. These products may be non-propagating. Optionally, said plant product comprises at least or at least part of one of the modified RNA molecule and or (part of) the genome comprising the targeted genomic modification.

[0215] In an aspect, a kit of parts is provided, preferably a kit of parts for use in the method as described herein. Preferably, the kit of parts comprises a modified RNA molecule as defined herein and a solution for dissolving or diluting the modified RNA molecule. The solution may e.g. be a physiological buffer, a growth medium for plants or plant cells or an aqueous medium as described herein. Further provided is the use of a modified RNA molecule as described herein for the transient expression of a gene product in a plant cell.

[0216] In addition, provided is the use of a modified RNA molecule as described herein for targeted genomic modification of a plant cell.

[0217] In addition, provided herein is the use of a modified RNA molecule as described herein for the regeneration of a plant cell.

[0218] Having now generally described the invention, the same will be more readily understood through reference to the following example which is provided by way of illustration and is not intended to be limiting of the present invention.

[0219] Figure legends

[0220] Figure 1 . Percentage of fluorescent cells after transfection of tomato protoplasts with either a control GFP plasmid (pKG7460), unmodified GFP mRNA (GFP), pseudo-uridine modified GFP mRNA (GFP-Pu) or N1-methyl-pseudo-uridine modified GFP mRNA (GFP-mPu). The percentage fluorescent cells are shown on the y-axis and the time in hours on the x-axis.

[0221] Figure 2. Percentage of fluorescent cells 48h after transfection of tomato protoplasts with either a control GFP plasmid (20 pg plasmid DNA carrying a 35S::GFP cassette) or a GFP mRNA carrying different ratios of uridine I N1-methyl-uridine. For the control, no mRNA was added to the transfection. The percentage fluorescent cells are shown on the y-axis and the percentage mPu modifications on the x-axis.

[0222] Figure 3. Activity of unmodified and modified SpCas9 mRNA in tomato protoplasts. Different sample times are shown on the x-axis (hrs) and the percentage indels detected on the y-axis.

[0223] Figure 4. Percentage GFP positive tomato protoplasts at different time points after transfection with a GFP control plasmid (7460), no mRNA (control), TEV 5’UTR-GFP mRNA (TEV-GFP), PsBMV 5’UTR-GFP mRNA (PSbMV-GFP) or ZmUbi 5’UTR-GFP-ZmUbi 3’UTR mRNA (ZmUTR-GFP).

[0224] Figure 5. Determining the optimal mRNA:CPP molar ratio. Either the TEV-WOX5 or TEV-PLT1 mRNA was incubated with increasing molar ratios of the CPP BP100-(KH)g . Molar ratios mRNA:CPP; lane 1 , no CPP; lane 2, 5x molar excess CPP; lane 3, 8x molar excess CPP; lane 4, 16x molar excess CPP; lane 5, 40x molar excess CPP.

[0225] Examples

[0226] Example 1. Increased expression of mRNA containing the modified nucleotides pseudouridine or

[0227] N1-methyl-pseudouridine in tomato protoplasts To examine whether the modified RNA nucleotides pseudo-uridine (Pu) or N1-methyl- pseudouridine (mPu) enhance the expression of mRNA in plant cells experiments were performed using GFP and tomato protoplasts. Using in vitro transcription a GFP mRNA with a 5’UTR sequence derived from the Tobacco Etch Virus (TEV), (SEQ ID NO: 64, wherein nt 1- 18 is the T7 promoter, nt 19 - 162 is the TEV 5’-UTR and GFP ORF is nt 163 - 924) was generated with and without the modified nucleotides pseudouridine or N1-methyl-pseudouridine. These were then transfected to tomato protoplasts and the level of GFP protein quantified using fluorescence flow cytometry. The GFP mRNA containing either of the modified nucleotides gave a significantly enhanced GFP expression as compared to the unmodified GFP mRNA (figure 1).

[0228] Constructs

[0229] The GFP ORF with a NLS tag fused to the 3’ end was synthesized with the Tobacco Etch Virus (TEV) 5’-UTR. The T7 promoter was included for / n vitro transcription and an unique restriction site (Mfel) for vector linearization. Similar plasmid designs were used for the in vitro transcription of SpCas9 (KG11683; SEQ ID NO: 65, wherein nt 1 - 18 is the T7 promoter, nt 19 - 162 is the TEV TEV 5’-UTR and the SpCas9 ORF is nt 163 - 4302). Plasmids were linearized with Mfe\ and purified using a Qiagen PCR Purification kit. mRNA synthesis

[0230] Per reaction 1 pg linearized plasmid vector was used for synthesis using the High Scribe T7 ARCA mRNA kit (New England Biolabs, E2060S) following the manufacturer’s instructions. Partially modified mRNA (including UTP-triphosphate in the reaction) was synthesized using the same procedure but 25nmol pseudouridine or N1-methyl-pseudouridine (Trilink Biotechnologies N-1019 & N-1105) was also included. Fully modified mRNAs (replacing all UTP with either Pu or mPu) was done using the High Yield T7 ARCA mRNA synthesis kit (Jena Biosciences). The mRNA was then purified (Qiagen RNAeasy kit).

[0231] Guide RNA synthesis

[0232] The guide RNA for gene Solyc07g043010 was produced using the New England Biolabs EnGen sgRNA Synthesis kit (E3322) using the primer 19_03079 (5 -

[0233] 7TC7A 7ACG C7C C7AT GCAAAGATATATAGACTCATCGTTTTAGAGCTAGA-3’ (SEQ ID NO: 55): italics, T7 promoter; underlined, seed sequence) giving the sgRNA having SEQ ID NO: 66. Modified sgRNA with improved endonuclease resistance and the same sequence as SEQ ID NO: 66 was synthesized by Synthego (Synthego.com).

[0234] Protoplast transfection

[0235] In vitro shoot cultures of Solanum lycopersicon var Moneyberg were maintained on MS20 medium with 0.8% agar in high plastic jars at 16 / 8 h photoperiod of 2000 lux at 25°C and 60-70% RH. Young leaves (1 g) were gently sliced perpendicularly to the mid nerve to ease the penetration of the enzyme mixture. Sliced leaves were transferred to the enzyme mixture (2% Cellulase Onozuka RS, 0.4% Macerozyme Onozuka R10 in CPW9M) and cell wall digestion was allowed to proceed overnight in the dark at 25°C. The obtained protoplasts were filtered through a 50 pm nylon sieve and were harvested by centrifugation for 5 minutes at 800 rpm. Protoplasts were re-suspended in CPW9M (Frearson, 1973) medium and 3 mL CPW18S (Frearson, 1973) was added at the bottom of each tube using a long-neck glass Pasteur pipette. Live protoplasts were harvested by centrifugation for 10 minutes at 800 rpm as the cell fraction at the interface between the sucrose and CPW9M medium. Protoplasts were counted and resuspended in MaMg (Negrutiu, 1987) medium at a final density of 106per mL.

[0236] For the protoplast transfections 40pg mRNA was mixed with 250 pL (250000 protoplasts) of the protoplast suspension and 250 pL of PEG solution (400g / l polyethylene glycol) 4000, Sigma- Aldrich #81240; 0.1 M Ca(NOs)2) was then added and the transfection was allowed to take place for 20 minutes at room temperature. A plasmid carrying a 35S::GFP cassette was also transfected as a control. Then, 10 mL of 0.275 M Ca(NOs)2 solution was added and thoroughly, but gently mixed in. The protoplasts were harvested by centrifugation for 5 minutes at 800 rpm and re-suspended in 9M culture medium at a density of 0.5 x 106per ml and transferred to a 4cm diameter petri dish. The number of cells expressing GFP and the level of this expression was quantified using a Accurri fluorescence flow cytometer by sampling the transfection at four different time points (62500 cells per measurement).

[0237] Results

[0238] Partial incorporation of Pseudouridine or N1-methyl-pseudouridine enhances mRNA expression in tomato protoplasts

[0239] Equimolar amounts of unmodified GFP mRNA or GFP mRNA incorporating pseudouridine (Pu) or N1-methyl-pseudouridine (mPu) nucleotides were transfected to tomato protoplasts. The number of GFP fluorescent cells at different time points was then determined. For the unmodified GFP mRNA the percentage of GFP positive cells drops in a linear fashion over the course of the experiment while the decrease in GFP signal of the modified GFP mRNAs remains constant or shows a reduced decrease over time. GFP fluorescence can be related to the GFP mRNA lifetime in the cell and / or the level of translation.

[0240] As a control a plasmid carrying a 35S::GFP cassette was used. As this construct must first be transcribed the signal is lower than that of the mRNA at the first time points but then becomes higher. The intensity of the GFP signal when using the control GFP plasmid is also higher (4 fold) than the signal observed using any of the mRNAs.

[0241] The Tobacco Etch Virus (TEV) 5’UTR (Carrington et al. 1990) stimulates GFP expression as a GFP mRNA lacking this did not show expression in protoplasts (data not shown). In addition we scrambled the TEV 5’UTR sequence, fused to the GFP and produced mRNA from this construct. No GFP signal was seen when this mRNA was transfected to tomato protoplasts (data not shown). Therefore the TEV 5’ UTR contains specific sequences that promote translation activity. The TEV 5’UTR has been previously used to enhance mRNA expression in both plant and animal cells (Nicolaisen et al. FEBS Lett, 303(2-3):169-72, 1992; Kariko et al. 2008, supra). We now show that the TEV 5’UTR also promotes translation of modified RNA molecules in plant cells.

[0242] The results shown in Figure 1 used partially modified GFP mRNA, produced by including both uridine and Pu or mPu in the synthesis reaction. According to the manufacturers protocol this leads to up to 50% replacement of UTP by the modified nucleotides. To study the expression of fully modified mRNAs in plant cells we used an alternative synthesis kit (Jena Biosciences) to produce GFP mRNA in which all of the uridines were replaced by Pu or mPu. Fully modified GFP mRNA was not expressed in tomato protoplasts.

[0243] We therefore tested the effect of different amounts of the modified nucleotide N1-methyl- pseudo-urdine on mRNA translation in tomato protoplasts. To this end, GFP mRNA was synthesized in vitro with both uridine (UTP) and the modified nucleotide N1-methyl-uridine (mPu) in the reaction. When equal molar amounts of UTP and mPu are included in the synthesis reaction, it can be reasonably assumed that half (50%) of the U’s in the mRNA are actually mPu. By adding different ratios of UTP and mPu to the reaction mRNAs can be made that are modified to different degrees. mPu modified GFP mRNA was transfected to tomato protoplasts and the percentage fluorescent cells was measured after 48 hours. As shown in Figure 2, fully modified mRNA (100% mPu) is inactive at this time point (and all other time points tested (2hr, 6hrs, 24hrs), data not shown).

[0244] Higher activity of SpCas9 mRNA incorporating Pu and mPu nucleotides

[0245] From the initial experiments, GFP mRNA modified with Pu or mPu showed higher expression in tomato protoplasts than the unmodified mRNA. To confirm this effect was not specific to the GFP ORF we replaced the GFP ORF for SpCas9.

[0246] The vector KG11683 has the TEV 5’UTR fused to the SpCas9 ORF (SEQ ID NO: 65). This vector was used to generate unmodified and partially modified SpCas9 mRNA which was then transfected to tomato protoplasts together with a guide RNA targeting the gene Solyc07g043010. This guide RNA is known to be very efficient at producing indels in experiments using SpCas9 ribonucleoproteins (RNPs). The SpCas9 mRNAs and the guide RNA were transfected to tomato protoplasts at a 1 :1 molar ratio and these were sampled at multiple time points. Genomic DNA was isolated from each sample and was used as a template to create amplicons of the Solyc07g04310 target region using 19_03122 + 19_03123. Nested PCR products were generated using 19_03152 + 19_03153 and a final PCR round is done to add barcodes to the products. The primers are shown in Table 1. These amplicons were sequenced and the percentage of reads containing indel mutations was quantified (Figure 3).

[0247] The partially modified SpCas9 mRNAs produced significantly more indels, particularly at the later time points. Incorporation of Pu or mPu nucleotides increased the percentage of indels approximately 2 fold after 48 hrs. No significant differences between the types and ratios of small indels generated by the different mRNAs were found and were all similar to the indels generated after RNP transfection to protoplasts

[0248] Activity of TALEN mRNA incorporating Pu and mPu nucleotides

[0249] To evaluate the potency of a modified RNA molecule encoding TALEN, the tomato gene Solyc04g045660 is targeted using TALEN mRNA. To this end, two sequences encoding TALENs were designed fused to the tobacco etch virus 5’ UTR (Talen 1 , SEQ ID NO: 71 , wherein nt 1-18 is the T7 promoter, nt 19 - 162 is the TEV 5’-UTR, nt 163 - 4086 is the TALEN1 ORF, and Talen 2, SEQ ID NO: 72, wherein nt 1-18 is the T7 promoter, nt 19 - 162 is the TEV 5’-UTR, nt 163 - 4188 is the TALEN2 ORF) and are synthesized on a vector. These vectors are used to generate unmodified and partially modified mRNAs as described above. The mRNA of both TALENs are transfected to tomato protoplasts and the cells analysed for indels in the sequence of interest using amplicon sequencing and gene specific primers. The sequence targeted by TALEN1 and TALEN2 is depicted in SEQ ID NO: 73, wherein nt 1 - 17 is targeted by TALEN1 and nt . 43 - 60 is targeted by TALEN2.

[0250] Example 2. Potyvirus 5’UTRs promote high levels of translation

[0251] Experiments were done to compare the levels of translation conferred by different potyvirus 5’UTRs and the UTRs of a highly expressed maize gene (ZmUbi) that has been shown to drive SpCas9 mRNA translation in wheat seedlings (Zhang et al, 2016). Plasmid constructs carrying the TEV 5’UTR-GFP (SEQ ID NO: 64), PSbMV 5’UTR-GFP (SEQ ID NO: 69, wherein nt 1 - 18 is the T7 promoter, nt 19 - 165 is the PSbMV 5’-UTR, and the GFP ORF is nt 166 - 927) and ZmUbi 5’UTR- GFP-ZmUbi 3’UTR (SEQ ID NO: 70, wherein nt 1 - 18 is the T7 promoter, nt 19 - 323 is the ZmUbi 5’-UTR, the GFP ORF is nt 324 - 1085 and the ZmUbi 3’-UTR is nt 1086 - 1297) were used for mRNA production as described, in this case without modified nucleotides. These mRNAs were then transfected to tomato protoplasts and the GFP expression measured over time (Figure 4).

[0252] Both the TEV and PSbMV 5’UTRs promote expression in high numbers of protoplasts at early time points with the TEV 5’UTR performing slightly better at later time points. Although showing some activity, the ZmUTR was significantly less active at all time points. These results show that the potyvirus 5’UTRs are optimal for driving mRNA expression in plant cells and superior to the maize UTRs from the highly constitutively expressed ubiquitin gene. Example 3. Cell penetrating peptide mediated introduction of regeneration promoting mRNAs into tomato and paprika

[0253] The WOX5 and PLT1 genes, when expressed together, are able to induce plant regeneration upon induced temporary expression (WO 2019 / 21 1296). Such temporal WOX5 and PLT1 expression is essential for correct regeneration and while effective, this approach presently requires the creation of transgenic lines and a significant investment in tissue culture processes. We reasoned that in vitro synthesized WOX5 and PLT1 modified mRNAs, when introduced into plant tissues by CPPs, would also be able to stimulate regeneration. The transient mRNA expression profile will be sufficient to switch on the plant regeneration pathway. The modified mRNAs can be introduced into the leaves of young seedlings grown under normal greenhouse conditions and so avoiding the tissue culture.

[0254] Constructs and mRNA synthesis

[0255] Plasmids with the WOX5 and PLT1 ORFs fused to the TEV 5’UTR were synthesized (WOX5 (KG1 1681 ; SEQ ID NO: 67, wherein nt 1 - 18 is the T7 promoter, nt 19 - 162 the TEV 5’-UTR and the WOX5 ORF is nt 163 - 711); PLT1 (KG11685; SEQ ID NO: 68, wherein nt 1 - 18 is the T7 promoter, nt 19 - 162 the TEV 5’-UTR and the PLT1 ORF is nt 163 - 1887). These plasmids were digested with Mfe\ and purified with a Qiagen PCR purification kit. mRNA synthesis was done as described above, also incorporating modified RNA nucleotides (pseudouridine or N1-methyl- pseudouridine).

[0256] Cell Penetrating Peptides

[0257] The cell penetrating peptides described in Miyamoto et al. 2021 , BP100-(KH)g and dTat-Sar-EED4, were synthesized (https: / / activotec.com). The CPPs have the following sequences: BP100-(KH)g KKLFKKILKYLKHKHKHKHKHKHKHKHKH (381 ODa, SEQ ID NO: 52); dTat-Sar-EED4, RRRQRRKKR(SEQ ID NO: 53)-(Sar)6-GWWG(SEQ ID NO: 54) (2253Da, Sar = Sarcosine linker).

[0258] Preparation of mRNA / CPP complexes

[0259] To determine the optimal molar ratio of mRNA and CPP to obtain correct complex formation (N / P=0.5; Watanabe et al. 2021) gel shift assays were done. 0.5 pmol mRNA was mixed with either a 5x, 8x, 16x or 40x molar excess of the CPP BP100-(KH)g in a 10pl. Complexes were formed by incubation at 25°C for 15 minutes. 2pl 6x loading buffer (without SDS) was added at the samples were run on a 1 % agarose gel. For the plant treatments the optimal molar ratio mRNA:CPP of 1 :16 was used. In total 3pg mRNA was used (857ng WOX5 mRNA (3.3 pmol) and 2120ng PLT1 mRNA (3.3 pmol)), mixed with 106 pmol BP100-(KH)g and complexes were allowed to form at 25°C for 15 minutes. Then 10 nmol of CPP dTat-Sar-EED4 was added. The volume was then increased to 10OpI with MS10 medium and used for leaf infiltration. Similarly when the SpCas9 mRNA was also included in the mixture 3.05pg of RNA was used in total (337 ng WOX5 mRNA, (1 ,3pmol); 842ng PLTI mRNA (1 .3pmol); 1820ng SpCas9 mRNA (1 .3pmol); 50ng sgRNA (1.3pmol)) and processed in the same way. Infiltration experiments

[0260] Seeds from tomato (Moneyberg TMV+) or paprika (Capsicum Annuum c.v. Maor; Israel) were surface sterilized and germinated on MS20 medium in a growth chamber. After 14 days the mRNA:CPP complexes were infiltrated into the leaves. The apical meristem was then removed and the seedlings were maintained on hormone free MS20 medium until regeneration had occurred.

[0261] Results

[0262] Determining the optimal mRNA:CPP binding ratios

[0263] Before infiltration, the optimal molar mRNA:CPP ratio was established wherein the most active complexes are formed. This has been defined as the N / P ratio = 0.5 and can be visualized on an agarose gel shift assay as the point at which the nucleic acid shows a clear shift in mobility but is able to enter the gel and does not remain in the loading well. To determine this for the WOX5 and PLT1 unmodified and modified mRNAs, these were mixed with different molar ratios of the CPP BP100-(KH)g and the resulting gel shift was determined on an agarose gel (Figure 5).

[0264] The binding studies showed that a molar ratio mRNA:CPP of 1 :16 approximates most closely the N / P = 0.5 ratio, which is optimal for the subsequent experiments. Identical results were seen when the modified mRNAs were used, showing that these do not affect CPP binding.

[0265] Induction of regeneration on tomato and paprika seedlings

[0266] Leaves of tomato or paprika seedlings are infiltrated with complexes of (modified) mRNA:CPP and maintained until regeneration has occurred.

[0267] Combining regeneration and genome editing

[0268] The WOX5 and PLT1 modified mRNAs induce regeneration in plant tissues, and these can be combined with the genome editing reagents; the modified SpCas9 mRNA and guide RNA. CPPs can deliver all of these mRNAs to the same cell where mutations can occur and which can then regenerate into a mutant plant.

[0269] The WOX5, PLT1 , SpCas9 and guide RNA are mixed at an equal molar ratio and complexed with the CPPs. These are infiltrated into seedlings and regenerated plants are allowed to develop. These are then genotyped for the presence of an indel mutation at the target site.

[0270] 4. Bombardment of pollen with SpCas9 mRNA and guide RNA to create plant mutants without tissue culture steps

[0271] We have demonstrated that the modified SpCas9 mRNA (in combination with the guide RNA) is able to produce a high frequency of indel mutations when introduced into protoplasts. The modified Cas9 mRNA can thus also be used to create mutations in other plant tissues. The ability of the modified SpCas9 RNA molecule, in combination with a guide RNA, to create mutations in pollen is tested, which can then be used to fertilize plants. Hence, these pollen mutations can be transferred to the next generation. This avoids the use of any transgenic lines or tissue culture infrastructure. It also has the potential to be applied to any plant species. Biolistic transformation (bombardment) is suitable for the introduction of the RNA molecules into pollen.

[0272] As a non-limiting example, tobacco pollen are bombarded with both modified SpCas9 mRNA and (optionally modified) guide RNA to introduce indel mutations in the PDS1 gene. The frequency of indel mutations is then determined and the pollen can be used to fertilize tobacco flowers and transfer the indel mutations to the next generation.

[0273] Guide RNA and sequencing

[0274] A guide RNA targeting the tobacco PDS1 gene was made using the following primer (5 - TTCTAATACGACTCACTATAGGCTGCATGGAAAGATGATGAGTTTTAGAGCTAGA-3’, (SEQ ID NO: 111) with the EnGen sgRNA synthesis kit (neb.com). After pollen bombardment genomic DNA is isolated and used for sequencing library preparation. The primers NtPDSI F and NtPDSI R are used to generate an amplicon containing the PDS1 target site and a nested PCR (using NtPDSI nF and NtPDSI nR) is done on these PCR products to produce a small amplicons. These are then used for library production in an additional PCR round using P5 and barcoded P7 Illumina primers.

[0275] Pollen bombardment

[0276] 3pg SpCas9 mRNA (2.1 pmol; unmodified, modified with pseudouridine, modified with N1-methyl- pseudouridine)) and the PDS1 sgRNA (2.1 pmol) are bound to gold particles using established protocols. Nicotiana tabacum SR1 pollen is germinated for 1 hr in high humidity and then bombarded with the coated gold particles using a BioRad apparatus. The pollen is incubated for 24 hours on pollen germination medium and then used for genomic DNA isolation.

Claims

Claims1 . A method for producing a plant cell comprising a modified mRNA molecule, comprising the steps of: i) providing the plant cell; and ii) introducing the modified messenger (m)RNA molecule into the plant cell, wherein the modified mRNA molecule comprises a modified uridine, wherein the modified uridine is least one of a pseudo-uridine and a N1-methyl-pseudo-uridine, wherein the mRNA molecule comprises a 5’-UTR, a coding sequence, and a 3’-UTR, wherein the 5’-UTR comprises a 5’-UTR of a positive-strand RNA virus or the 5’- UTR of a plant RNA transcript, and wherein the 3’-UTR comprises a poly(A) tail, and wherein the modified mRNA molecule has an increased expression from the coding sequence as compared to an identical unmodified mRNA molecule.

2. A method according to claim 1 , wherein the 5’-UTR of the modified mRNA molecule is the 5’-UTR of a potyvirus, preferably the 5’-UTR is of a Tobacco Etch Virus (TEV).

3. A method according to claim 1 or 2, wherein the 5’-UTR of the modified mRNA molecule has at least 80% sequence identity with any one of SEQ ID NO: 1 - 46.

4. A method according to any one of the preceding claims, wherein the modified mRNA molecule comprises a 5’-cap.

5. A method according to any one of the preceding claims, wherein not all uridines of the modified mRNA molecule are modified uridines, wherein preferably the percentage of uridines that are modified uridines is less than 95%, preferably about 10% - 90% of all uridines are modified uridines.

6. A method according to any one of the preceding claims, wherein the only modification of the modified mRNA molecule is the modification of a uridine for a pseudo-uridine and / or a N1- methyl-pseudo-uridine.

7. A method according to any one of the preceding claims, wherein the coding sequence of the modified mRNA molecule encodes a plant morphogenic polypeptide.

8. A method according to any one of claims 1 - 6, wherein the coding sequence of the modified mRNA molecule encodes a site-directed nuclease, preferably a CRISPR nuclease or a TALENs.

9. A method according to claim 8, wherein in step ii) the modified mRNA molecule is introduced in combination with a guide RNA.

10. A method according to any one of the preceding claims, wherein the modified mRNA molecule is introduced in step ii) by at least one of PEG transformation, a cell penetrating peptide (CPP) and particle bombardment.

11. A method according to any one of the preceding claims, comprising a step iii) of selecting the produced plant cell, or a descendant thereof, wherein the plant cell is selected for comprising at least one of:- the modified mRNA molecule;- a protein expressed from the modified mRNA molecule; and- a genomic sequence comprising a targeted genomic modification.

12. A method according to any one of the preceding claims, further comprising a step of regenerating a plant from the, optionally selected, plant cell.

13. A modified mRNA molecule comprising a modified uridine, wherein the modified uridine is least one of a pseudo-uridine and a N1-methyl-pseudo-uridine, wherein the mRNA molecule comprises a 5’-UTR, a coding sequence, and a 3’-UTR, wherein the 5’-UTR comprises a 5’-UTR of a positive-strand RNA virus or the 5’- UTR of a plant RNA transcript, and wherein the 3’-UTR comprises a poly(A) tail.

14. A plant cell comprising a modified mRNA molecule as defined in any one of claims 1 - 8, wherein preferably the plant cell is a protoplast.

15. Use of a modified mRNA molecule as defined in claim 13 for the transient expression of a gene product in a plant cell.