Methods for detecting RNA and molecular analysis in thick tissue sections

EP4615969A1Pending Publication Date: 2025-09-17JOHNS HOPKINS UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2023889783
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-05-05
Filing Date
2023-11-10
Publication Date
2025-09-17

AI Technical Summary

Technical Problem

Current in situ transcriptomic technologies are limited to 2D characterization of tissues and struggle with thick tissue sections due to low molecular diffusion and opacity, lacking effective methods for 3D characterization beyond 400 microns.

Method used

The methods involve permeabilizing and degrading DNA in tissue samples, introducing specific primers or probes, and forming a hydrogel to enhance molecular diffusion and detection efficiency, using techniques like rolling circle amplification and padlock probes to detect RNA targets in thick tissue sections up to 400 microns.

Benefits of technology

These methods significantly improve RNA detection sensitivity and efficiency in thick tissues, outperforming existing methods by more than ten-fold, enabling uniform and sensitive RNA detection across thick tissue samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 1.1
    Figure 1.1
Patent Text Reader

Abstract

Disclosed are methods for detecting a target of interest in a tissue sample. The methods comprising: a) obtaining or having obtained the tissue sample, wherein the tissue sample comprises DNA, non-RNA molecules, and RNA, wherein the RNA comprises a target of interest; b) permeabilizing the tissue sample; c) substantially degrading the DNA in the tissue sample; and d) introducing to the tissue sample a primer or a probe specific to the target of interest, wherein the primer or probe binds to the target of interest; and e) detecting the primer or probe bound to the target of interest, thereby detecting the target of interest in the tissue, sample. Also disclosed are methods of making a hydrogel within a tissue sample.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHODS FOR DETECTING RNA AND MOLECULAR ANALYSIS IN THICK TISSUE SECTIONS

[0002] CROSS REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application Nos. 63 / 424,214, filed November 10, 2022 and 63 / 500,803, filed May 8, 2023. The content of this earlier filed applications are hereby incorporated by reference herein in their entirety.

[0004] STATEMENT REGARDING FEDERALLY FUNDED RESEARCH

[0005] This invention was made with government support under grant RO1HG012357 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0006] INCORPORATION OF THE SEQUENCE LISTING

[0007] The present application contains a sequence listing that is submitted concurrently with the filing of this application, containing the file name “36406_0031Pl_SL.xml” which is 69,632 bytes in size, created on November 8, 2023, and is herein incorporated by reference in its entirety.

[0008] BACKGROUND

[0009] In situ transcriptomic technologies are limited to 2D characterization of tissue and cover a narrow depth. Methods that can molecularly profile deep tissue sections in 3D are needed.

[0010] SUMMARY

[0011] Disclosed herein are methods for detecting a target of interest in a tissue sample, the methods comprising: a) obtaining or having obtained the tissue sample, wherein the tissue sample comprises DNA, non-RNA molecules, and RNA, wherein the RNA comprises a target of interest; b) permeabilizing the tissue sample; c) substantially degrading the DNA in the tissue sample; and d) introducing to the tissue sample a primer or a probe specific to the target of interest, wherein the primer or probe binds to the target of interest; and e) detecting the primer or probe bound to the target of interest, thereby detecting the target of interest in the tissue sample.

[0012] Disclosed herein are methods of making a hydrogel within a tissue sample, the methods comprising: a) obtaining or having obtained a fixed tissue sample, wherein the tissue sample comprises DNA, non-RNA molecules, and RNA, wherein the RNA comprises a target of interest; b) permeabilizing the tissue sample; and c) substantially degrading the DNA in the tissue sample; wherein a hydrogel is formed within the tissue sample.

[0013] BRIEF DESCRIPTION OF THE DRAWINGS

[0014] FIG. 1 is a schematic of a tissue clearing method and subsequent amplification of an RNA target of interest present in the tissue using a padlock probe and rolling circle amplification.

[0015] FIGS. 2A-C show ACTB mRNA signal detection across a 400 micron thick mouse liver sample. The 400-micron tissue slice from the mouse liver was processed using methods described herein. ACTB mRNA was targeted and the RCA amplicons were detected with a probe modified with a Cy5 dye. The sample was measured with a spinning desk confocal microscope. FIG. 2A shows a 3D view (lOx) of the sample with RCA amplicons from Actb mRNA. FIG. 2B shows the lateral view of FIG. 2A. FIG. 2C shows the number of RCA amplicons counted from the sample shown in FIG. 2A. The number of RCA amplicons were quantified with Fiji.

[0016] FIGS. 3A-D show that the method described herein has a high RNA detection efficiency compared to another RNA detection method for thick tissues. The 50-micron tissue slice from the mouse liver was processed as described herein. ACTB mRNA w as targeted and the RCA amplicons w ere detected with a probe modified with a Cy5 dye using the methods described herein (Fig. 3A) compared to the Melpha-X based method (FIG. 3C). The sample was measured with a spinning desk confocal microscope. For FIGS. 3C and 3D, the Melpha-X RNA detection method was performed for thick slices (MelphaX, Wang, Y. et al., 2021, Cell, in which a hybridization chain reaction was used) as a side-by-side comparison. The same padlock oligo and enzy mes were used for FIG. 3A and FIG. 3C for comparison. FIG. 3A shows a 3D view (20x) of the sample with RCA amplicons from Actb mRNA amplified using the methods described herein. FIG. 3B shows the RCA amplicons counted in FIG. 3A. FIG. 3C shows a 3D view- (20x) of the sample with RCA amplicons from Actb mRNA detected with the MelphaX-based method. FIG. 3D show s the number of RCA amplicons counted in FIG. 3C.

[0017] FIGS. 4A-C show genomic DNA inhibited RNA detection in situ for thick tissue slices. The 400-micron tissue slice from the mouse liver was processed without DNase I treatment. ACTB mRNA was targeted and the RCA amplicons were detected wdth a probe modified with a Cy5 dye. The sample w as measured with a spinning desk confocal microscope. FIG. 4A shows a 3D view (lOx) of the 400 micron sample stained with DAPI. The distinct genomic DNA shape was observed. FIG. 4B shows a lateral view (lOx) of the 400 micron sample with RCA amplicons; Red: RCA amplicons, Blue: DAPI. The RCA amplicons were limited on the surface. FIG. 4C shows a 3D view (lOx) of the 400 micron sample after DNase I treatment. The shape of genomic DNA was completely lost. After DNase I treatment, the uniformity of the reactions dramatically improved, which is shown in FIG 2.

[0018] FIG. 5 shows a schematic description of a tissue clearing method and amplification of a target of interest with a mutation present in RNA.

[0019] FIG. 6 shows single nucleotide variants (SNVs) were selectively distinguished between C57BL / 6J and BALB / cJ using the methods disclosed herein. Three sets of two iLock padlock oligos for C57BL / 6J and BALB / cJ corresponding to each gene were separately added to the 50-micron liver slices of C57BL / 6J and BALB / cJ. The liver slices were processed as described for FIG. 5. The RCA amplicons from the iLock padlock oligos targeting C57BL / 6J SNVs were detected with a Cy5 probe (Red). The RCA amplicons from the iLock padlock oligos targeting BALB / cJ SNVs were detected with a Cy3 probe (Green). The selectivity7was evaluated based on the ratio of the number of amplicons from C57BL / 6J and BALB / cJ padlock oligos. The samples were measured with a spinning desk confocal microscope.

[0020] FIGS. 7A-B show that DNase I treatment improved the detection efficiency in the brain slices. Excitatory7neuron marker, Slcl7a7, was detected in the 30-micron brain slices of C57BL / 6J with two iLock padlock oligos. The RCA amplicons from the iLock padlock oligos were detected with a Cy5 probe (Red). Genomic DNA was visualized with DAPI (Blue). The samples were measured with a spinning desk confocal microscope.

[0021] DETAILED DESCRIPTION OF THE INVENTION

[0022] The present disclosure can be understood more readily by reference to the following detailed description of the invention, the figures and the examples included herein.

[0023] Before the present methods and compositions are disclosed and described, it is to be understood that they are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology7used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described.

[0024] Moreover, it is to be understood that unless otherw ise expressly stated, it is in no way intended that any method set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not actually recite an order to be followed by its steps or it is not otherwise specifically stated in the claims or descriptions that the steps are to be limited to a specific order, it is in no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, and the number or type of aspects described in the specification.

[0025] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided herein can be different from the actual publication dates, which can require independent confirmation.

[0026] DEFINITIONS

[0027] As used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise.

[0028] The word "or" as used herein means any one member of a particular list and also includes any combination of members of that list.

[0029] Ranges can be expressed herein as from "about" or "approximately" one particular value, and / or to "about" or "approximately" another particular value. When such a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," or "approximately," it will be understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that there are a number of values disclosed herein and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value " 10" is disclosed, then "about 10" is also disclosed. It is also understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed. As used herein, the terms "optional" or "optionally" mean that the subsequently described event or circumstance may or may not occur and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0030] As used herein, the term '‘tissue sample” is meant a tissue or organ from a subject; or a solution containing one or more molecules derived from tissue material (e.g., nucleic acid), which is assayed as described herein. The tissue sample can be obtained via biopsy such as needle biopsy, surgical biopsy, etc. In some aspects, the “tissue sample” can include for example, a specimen from a diseased tissue (e.g., cancers, parts of a cancer, and also the cancer mass as a whole and / or tissue derived from a subject that is suspected of have a disease).

[0031] As used herein, the term “comprising” can include the aspects “consisting of’ and “consisting essentially of.” “Comprising” can also mean “including but not limited to.”

[0032] The phrase '‘at least” preceding a series of elements is to be understood to refer to every element in the series. For example, “at least one” includes one, two, three, four or more.

[0033] As used herein, the term “target of interest” is nucleic acids. A target of interest can be a nucleic acid molecule which can be a portion of a gene, a regulatory- sequence, genomic DNA, cDNA, RNA including mRNA and rRNA, or others. As described herein, the target of interest can be a target nucleic acid molecule from a tissue sample, or a secondary target such as a product of an amplification reaction, etc. It may be any length. In some aspects, the target of interest can be RNA.

[0034] The term “nucleic acids” or “oligonucleotide” or grammatical equivalents herein refers to at least two nucleotides covalently linked together. Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acids. A “nucleic acid” will generally contain phosphodiester bonds, although in some cases (for example, in the construction of primers and probes, such as label probes), nucleic acid analogs are included that may have alternate backbones, comprising, for example, phosphoramide (Beaucage et al., Tetrahedron 49(10): 1925 (1993) and references therein; Letsinger, J. Org. Chem. 35:3800 (1970); Sprinzl et al., Eur. J. Biochem. 81:579 (1977); Letsinger et al., Nucl. Acids Res. 14:3487 (1986); Sawai et al, Chem. Lett. 805 (1984), Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); and Pauwels et al., Chemi ca Scripta 26: 141 91986)), phosphorothioate (Mag et al.. Nucleic Acids Res. 19: 1437 (1991); and U.S. Pat. No. 5,644,048), phosphorodithioate (Briu et al., J. Am. Chem. Soc. 111 :2321 (1989), O-methylphosphoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University- Press), and peptide nucleic acid backbones and linkages (see Egholm, J. Am. Chem. Soc. 114: 1895 (1992); Meier et al., Chern. Int. Ed. Engl. 31 : 1008 (1992); Nielsen, Nature, 365:566 (1993); Carlsson et al., Nature 380:207 (1996), all of which are incorporated by reference). Other analog nucleic acids include those with bicyclic structures including locked nucleic acids, Koshkin et al., J. Am. Chem. Soc. 120: 13252 3 (1998); positive backbones (Denpcy et al., Proc. Natl. Acad. Sci. USA 92:6097 (1995); non-ionic backbones (U.S. Pat. Nos. 5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863; Kiedrowshi et al., Angew. Chem. Inti. Ed. English 30:423 (1991); Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); Letsinger et al., Nucleoside & Nucleotide 13: 1597 (1994); Chapters 2 and 3, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y. S. Sanghui and P. Dan Cook; Mesmaeker et al., Bioorganic & Medicinal Chem. Lett. 4:395 (1994); Jeffs et al., J.

[0035] Biomolecular NMR 34: 17 (1994); Tetrahedron Lett. 37:743 (1996)) and non-ribose backbones, including those described in U.S. Pat. Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y. S. Sanghui and P. Dan Cook. Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acids (see Jenkins et al., Chem. Soc. Rev. (1995) pp 169 176). Several nucleic acid analogs are described in Rawls, C & E News Jun. 2. 1997 page 35. All of these references are hereby expressly incorporated by reference. These modifications of the ribose-phosphate backbone may be done to increase the stability and half-life of such molecules in physiological environments. For example, PNA:DNA hybrids can exhibit higher stability and thus may be used in some embodiments.

[0036] Nucleic acids may be single-stranded or double-stranded, as specified, or contain portions of both double-stranded or single-stranded sequences. The nucleic acids may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxyribo- and ribo-nucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xathanine hypoxathanine, isocytosine, isoguanine, etc.

[0037] As used herein, “concatemers” refer to a form of target polynucleotides, containing multiple copies (e.g., monomers) of a target polynucleotide or a fragment of a target nucleotide. In some aspects, the concatamer contains a sequence of interest. A concatemer can be partially double-stranded. In some aspects, the plurality of concatemers can serve as a target nucleic acid molecule for sequencing. In some aspects, the concatemers comprise a single-stranded RNA portion and a double-stranded RNA portion.

[0038] The nucleotide bases are abbreviated as follows: adenine (A), cytosine (C), guanine

[0039] (G), thymine (T), and uracil. As used herein, “substantially degrading the DNA in the tissue sample’' refers to degrading greater than 95%, 96%, 97%, 98% or 99% of the DNA that would normally be found in the tissue sample.

[0040] As used herein, “substantially” removing lipids from the tissue sample” refers to removing greater than 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% 95%, 96%, 97%, 98% or 99% of the DNA that would normally be found in the tissue sample.

[0041] All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0042] Although the foregoing disclosure has been described in some detail by way of illustration and example for purposes of clarity of understanding, certain changes and modifications may be practiced within the scope of the appended claims.

[0043] METHODS

[0044] Disclosed herein are methods for detecting a target of interest in a tissue sample. Also disclosed herein are methods for detecting RNA in a tissue sample. In some aspects, the methods comprise obtaining or having obtained a tissue sample. In some aspects, the methods can comprise permeabilizing the tissue sample. In some aspects, the methods can comprise substantially degrading the DNA in the tissue sample. In some aspects, the methods can comprise introducing to the tissue sample a primer or a probe specific to the target of interest. In some aspects, the primer or probe binds to the target of interest. In some aspects, the methods can comprise detecting the primer or probe bound to the target of interest, thereby detecting the target of interest in the tissue sample. In some aspects, the target of interest can be RNA.

[0045] In some aspects, the methods further comprise amplifying a probe bound to the target of interest using a polymerase. In such aspects by degrading or removing DNA from the tissue sample, there is no DNA that may have been present initially in the tissue sample to serve as a template for the polymerase. For example, disclosed herein are methods of hybridizing a padlock probe to a target of interest, circularizing the padlock probe and subsequently amplifying the circularized padlock probe with a DNA polymerase such as phi29 polymerase, and, by degrading or removing DNA from the tissue sample prior to hybridizing a padlock probe to a target of interest, there is no DNA that may have been present initially in the tissue sample to serve as a template for the polymerase.

[0046] Also disclosed herein are methods of making a hydrogel within a tissue sample. In some aspects, the methods can comprise obtaining or having obtained a fixed tissue sample; permeabilizing the tissue sample; and substantially degrading the DNA in the tissue sample; wherein a hydrogel is formed within the tissue sample. In some aspects, the tissue sample can comprise DNA, non-RNA molecules, and RNA. In some aspects, the RNA can comprise a target of interest. In some aspects, the non-RNA molecules can be proteins. In some aspects, the non-RNA molecules can be lipids. In some aspects, the proteins present in the tissue sample can be cross-linked. In some aspects, the tissue sample can be preserved prior to the step of obtaining or having obtained the tissue sample. In some aspects, the method can comprise preserving the tissue sample using a chemical crosslinking agent. In some aspects, the crosslinking agent can be formaldehyde, glutaraldehyde, dimethyl suberimidate, SM(PEG)12 (PEGylated, long-chain SMCC crosslinker), SM(PEG)6 (PEGylated, long-chain SMCC crosslinker), SM(PEG)2 (PEGylated SMCC crosslinker), SIAB (succinimidyl (4- iodoacetyl)aminobenzoate), BMH (bismaleimidohexane). SBAP (succinimidyl 3- (bromoacetamido)propionate), SMPT (4-succinimidyloxycarbonyl-alpha-methyl-a(2- pyridyldithio)toluene), DTSSP (3,3'-dithiobis(sulfosuccinimidyl propionate)), EMCH (N-e- maleimidocaproic acid hydrazide), SM(PEG)24 (PEGylated, long-chain SMCC crosslinker), BMPH (N-P-maleimidopropionic acid hydrazide), DTME (dithiobismaleimidoethane). BMOE (bismaleimidoethane), SMPB (succinimidyl 4-(p-maleimidophenyl)butyrate), EMCS (N-e- malemidocaproyl-oxysuccinimide ester), MBS (m-maleimidobenzoyl-N-hydroxysuccinimide ester), Sulfo-EMCS (N-s-maleimidocaproyl-oxysulfosuccinimide ester), BS(PEG)9 (PEGylated bis(sulfosuccinimidyl)suberate), Sulfo-EGS (ethylene glycol bis(sulfosuccinimidyl succinate)), LC-SPDP (succinimidyl 6-(3(2-pyridyldithio)propionamido)hexanoate). PEG12- SPDP (PEGylated, long-chain SPDP crosslinker) or derivative or a combination thereof. In some aspects, the tissue sample can have a thickness of about 20 pm to 800 pm.

[0047] Tissue sample. As disclosed herein, the tissue sample can be any 3D cell structure. In some aspects, the tissue sample can comprise DNA. non-RNA molecules, and RNA. In some aspects, the tissue can comprise lipids. In some aspects, the non-RNA molecules can be lipids. In some aspects, the non-RNA molecules can be proteins. In some aspects, the RNA can comprise a target of interest. In some aspects, the tissue sample can be from a mammal (e.g. mammalian tissue samples). In some aspects, the tissue sample can be from eukaryote. In some aspects, the tissue sample can be a human tissue samples. In some aspects, the tissue sample can be a liver tissue sample. In some aspects, the tissue sample can be a brain tissue sample. In some aspects, the tissue sample can be a skin sample. In some aspects, the tissue sample can be an organoid. In some aspects, the tissue sample can be fixed prior to or after the permeabilizing of the tissue sample step. In some aspects, the tissue sample can be fixed by contacting the tissue sample with a chemical crosslinking agent. In some aspects, the chemical crosslinking agent can be formaldehyde, glutaraldehyde, dimethyl suberimidate, SM(PEG)12 (PEGylated, long-chain SMCC crosslinker), SM(PEG)6 (PEGylated, long-chain SMCC crosslinker), SM(PEG)2 (PEGylated SMCC crosslinker), SIAB (succinimidyl (4- iodoacetyl)aminobenzoate), BMH (bismaleimidohexane), SBAP (succinimidyl 3- (bromoacetamido)propionate). SMPT (4-succinimidyloxycarbonyl-alpha-methyl-a(2- pyridyldithio)toluene), DTSSP (3,3'-dithiobis(sulfosuccinirmdyl propionate)), EMCH (N-e- maleimidocaproic acid hydrazide), SM(PEG)24 (PEGylated, long-chain SMCC crosslinker), BMPH (N-P-maleimidopropionic acid hydrazide), DTME (dithiobismaleimidoethane), BMOE (bismaleimidoethane), SMPB (succinimidyl 4-(p-maleimidophenyl)butyrate), EMCS (N-e- malemidocaproyl-oxysuccinimide ester), MBS (m-maleimidobenzoyl-N-hydroxysuccinimide ester), Sulfo-EMCS (N-s-maleimidocaproyl-oxysulfosuccinimide ester), BS(PEG)9 (PEGylated bis(sulfosuccinimidyl)suberate), Sulfo-EGS (ethylene glycol bis(sulfosuccinimidyl succinate)), LC-SPDP (succinimidyl 6-(3(2-pyridyldithio)propionamido)hexanoate), PEG12- SPDP (PEGylated. long-chain SPDP crosslinker) or derivative or a combination thereof. In some aspects, crosslinking reagents that contain reactive end groups that respond to the presence of specific functional groups by forming bonds between polymer chains can be used as crosslinkers in the methods disclosed herein.

[0048] In some aspects, the tissue sample can have a thickness of about 20 pm to 400 pm. In some aspects, the tissue sample can have a thickness of about 20. 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, or 400 pm or any thickness in between. In some aspects, the tissue sample can have a thickness of about 20 pm to 30 pm, 30 pm to 40 pm, 40 pm to 50 pm, 50 pm to 60 pm, 60 pm to 70 pm, 70 pm to 80 pm, 80 pm to 90 pm, 90 pm to 100 pm, 100 pm to 125 pm, 125 pm to 150 pm, 150 pm to 175 pm, 175 pm to 200 pm, 200 pm to 225 pm, 225 pm to 250 pm, 250 pm to 275 pm, 275 pm to 300 pm, 300 pm to 325 pm, 325 pm to 350 pm, 350 pm to 375 pm, 375 pm to 400 pm, 400 pm to 425 pm, 425 pm to 450 pm, 450 pm to 475 pm, 475 pm to 500 pm, 500 pm to 525 pm, 525 pm to 550 pm, 550 pm to 575 pm, 575 pm to 500 pm, 600 pm to 625 pm, 625 pm to 650 pm, 650 pm to 675 pm, 675 pm to 700 gm, 700 pun to 725 pm, 725 pm to 750 pm, 750 pm to 775 pm, or 775 pm to 800 pm.

[0049] In some aspects, the tissue sample, after the step of substantially degrading the DNA in the tissue sample, can have enhanced molecular diffusion compared to the tissue sample after the step of permeabilizing the tissue sample. In some aspects, the molecular diffusion can be confirmed by affirming the uniformity of RCA amplicons across the tissue samples.

[0050] Target of interest. In some aspects, the target of interest can be a nucleic acid molecule. In some aspects, the target of interest can be present in a tissue sample. In some aspects, the target of interest can be in a single region of the nucleic acid molecule. In some aspects, the target nucleic acid molecule can be in any nucleic acid sample of interest. The source, identity, and preparation of many such nucleic acid samples are known. It is preferred that nucleic acid samples known or identified for use in amplification or detection methods be used for the method described herein.

[0051] As disclosed herein, the disclosed methods can involve utilizing RNA or RNA fragments comprising one or more targets of interest in a tissue sample. In some aspects, the target of interest can be a RNA nucleic acid sequence. In some aspects, the target of interest can be single-stranded. The hybridization region and the amplification region within the target nucleic acid molecule can be defined in terms of the relationship of the target nucleic acid molecule to the primers in a set of primers. The primers can be designed to match (e.g., be complementary’ to) the chosen target of interest. In some aspects, the nucleic acid sequence to be amplified and the sites of hybridization of the primers can be separate since sequences in and around the sites where the primers hybridize can be amplified.

[0052] In some aspects, the target of interest can comprise a mutation.

[0053] In some aspects, the nucleic acid sample can be, for example, a nucleic acid sample from one or more cells, tissues, or other biological samples, such as tissue culture cells, tissues slices, and archeological samples such as bone or mummified tissue. Tissue samples can be derived from any source including, but not limited to, eukaryotes, plants, animals, vertebrates, fish, mammals, humans, non-humans, needle aspiration biopsies, cancers, tumors, tissues, cells, stool, mummified tissue, forensic sources, autopsies, archeological sources, infections, nosocomial infections, production sources, drug preparations, biological molecule productions, or protein preparations. Types of useful tissue samples include eukaryotic samples, plant samples, animal samples, vertebrate samples, fish samples, mammalian samples, human samples, non-human samples, biological samples, biopsy samples, needle aspiration biopsy samples, cancer samples, tumor samples, tissue samples, cell samples, cell lysate samples, crude cell lysate samples, tissue lysate samples, stool samples, mummified tissue samples, forensic samples, autopsy samples, archeological samples, infection samples, nosocomial infection samples, or protein preparation samples.

[0054] In some aspects, the target nucleic acid molecule can be damaged RNA from a damaged RNA tissue sample. For example, preparation of genomic samples can sometimes result in damage to the genomic RNA (for example, degradation and fragmentation). This can make amplification of the sequences in it both more difficult and provide less reliable results (by, for example, resulting in amplification of many partial and fragmented genomic sequences). Damaged RNA and damaged RNA in a tissue sample are thus useful for the disclosed methods. Any degraded, fragmented or otherwise damaged RNA or tissue sample containing such RNA can be used in the disclosed methods.

[0055] The disclosed methods can involve the sequencing of nucleic acids (e.g., a target of interest, including target nucleic acid molecules). In some aspects, the target nucleic acid molecules are RNA.

[0056] In some aspects, the target nucleic acid molecule comprises an amplification region and a hybridization region. The hybridization region can include a sequences that can be complementary' to a primer in a set of primers. The amplification region can be the portion of the amplification region that can be amplified. In some aspect, the amplification region can be downstream of or flanked by the hybridization region(s).

[0057] Permeabilizing the tissue sample. In some aspects, the method disclosed herein comprise permeabilizing a tissue sample. In some aspects, the step of permeabilizing the tissue sample can take place after the tissue sample is obtained. In some aspects, lipids can be removed or partially removing lipids from a tissue sample. In some aspects, the step of removing or partially removing lipids can be optional. In some aspects, lipids can be partially, substantially, or completely removed from the tissue sample. In some aspects, the “permeabilizing” step of the disclosed methods can encompass lipid removal or partial lipid removal and DNA degradation. In some aspects, the step of reducing or removing lipids from the tissue sample can be carried out after the step of permeabilizing the tissue sample. In some aspects, the tissue sample can be permeabilized by contacting the tissue sample with a tissue- permeabilizing agent. In some aspects, the tissue-permeabilizing agent can be a detergent or sodium dodecyl sulfate (SDS). In some aspects, the detergent can be an ionic detergent. Examples of detergents further include but are not limited to, Triton-XlOO, NP-40, and Tween- 20. In some aspects, the tissue-permeabilizing agent can be any alcohol. In some aspects, the alcohol can be methanol or ethanol.

[0058] Degrading the DNA in the tissue sample. In some aspects, the method disclosed herein comprises degrading DNA in a tissue sample. In some aspects, degrading or removing DNA in the tissue sample can allow for better hydrogel formation. In some aspects, degrading or removing DNA in the tissue sample can allow for better primer or probe hybridization to the target of interest in the tissue sample because DNA is not present as a target. In some aspects, degrading or removing DNA in the tissue sample can allow for better diffusion of molecules into the tissue. In some aspects, DNA can be degraded or removed or substantially degraded or removed by contacting the tissue sample with DNase (e g., DNase I). In some aspects, DNA can be degraded or removed or substantially degraded or removed by contacting the tissue sample with exonuclease enzymes. In some aspects, the exonuclease enzyme can be DNase I. In some aspects, the exonuclease enzyme can be any dsDNA degrading enzymes (e.g., Lambda Exonuclease, Exonuclease V, and T5 Exonuclease).

[0059] In some aspects, the step of substantially degrading the DNA in the tissue sample can be carried out or performed prior to embedding the tissue sample in a hydrogel. In some aspects, the step of substantially degrading the DNA in the tissue sample can be carried out or performed after embedding the tissue sample in a hydrogel.

[0060] Degrading non-RNA molecules in the tissue sample. In some aspects, the methods disclosed herein can further comprise substantially degrading non-RNA molecules in the tissue sample. In some aspects, non-RNA molecules can be proteins or protein molecules. In some aspects, non-RNA molecules can be lipids. In some aspects, the methods disclosed herein can further comprise degrading proteins or protein molecules in the tissue sample. In some aspects, the proteins or protein molecules can be substantially degraded by contacting the tissue sample with proteinase K. In some aspects, the step of substantially degrading non-RNA molecules in the tissue sample can be carried out at least before the step of detecting the primer or probe bound to the target of interest.

[0061] In some aspects, the proteins or protein molecules diffuse out of the hydrogel without actively removing the proteins or protein molecules from a polymerized tissue.

[0062] Hydrogels and matrices. A hydrogel is a three-dimensional (3D) network of hydrophilic polymers that maintain the structure due to chemical or physical cross-linking of individual polymer chains. Hydrogels made up of hydrophilic polymers that can be crosslinked. While hydrogels can hold water, the hydrogels described herein maintain a defined structure.

[0063] In some aspects, the hydrogels described herein can be chemical hydrogels or physical hydrogels. In some aspects, chemical hydrogels can be formed by covalent cross-linking bonds. In some aspects, physical hydrogels can have non-covalent bonds.

[0064] In some aspects, the methods disclosed herein can further comprise forming a matrix within the tissue sample. In some aspects, a matrix can be formed within the tissue sample at any time during the method. In some aspects, the time at which the matrix is formed can depend on the type of detection of the target of interest that is to be carried out. For example, a hydrogel might not be necessary if a hybridization chain reaction is to be carried out. In this case, a protein matrix can be formed by chemical fixation. For padlock detection, a hydrogel matrix can be helpful. In some aspects, the matrix can be formed or introduced after obtaining the tissue sample. In some aspects, a matrix can be formed or introduced after the step of permeabilizing the tissue sample. In some aspects, a matrix can be formed or introduced after the step of substantially degrading the DNA in the tissue sample. In some aspects, a matrix can be formed or introduced after the step of introducing to the tissue sample a primer or a probe that is specific to the target of interest. In some aspects, a protein lattice formed by chemical crosslinking during fixation can be a matrix which maintains the molecular spaces. In some aspects, a matrix can be substituted by chemical hydrogels. In some aspects, a chemical hydrogel matrix can be produced by introducing acrylamide monomers into tissue slices and activating polymer reactions.

[0065] In some aspects of the disclosed methods, a tissue sample can be embedded in a hydrogel prior to or after the step of introducing to the tissue sample a primer or a probe specific to the target of interest, wherein the primer or probe binds to the target of interest. In some aspects, the hydrogel comprises acrylamide and bisacrylamide monomers. Other monomers that can be used include, but not limited to, acrylic acid, HEMA, and NVP. In some aspects of the disclosed methods, the tissue sample can be embedded in the hydrogel by diffusing acrylamide monomers into the tissue sample and crosslinking them to form a polyacrylamide gel.

[0066] In some aspects of the disclosed methods, the tissue sample can be embedded in the hydrogel after the step of permeabilizing the tissue sample. In some aspects of the disclosed methods, the tissue sample can be embedded in the hydrogel after the step of substantially degrading the DNA in the tissue sample. In some aspects, the matrix formed within the tissue sample can be cross-linking of proteins present in the tissue sample. In some aspects of the disclosed methods, a matrix or hydrogel can be formed any time after obtaining or having obtained the tissue sample.

[0067] Primers and probes. In some aspects of the disclosed methods, the method comprises introducing to the tissue sample a primer or a probe specific to the target of interest, wherein the primer or probe binds to the target of interest. In some aspects, the probe can be an oligonucleotide probe. In some aspects, the oligonucleotide probe can be attached to the hydrogel. In some aspects, the oligonucleotide probe cam be covalently attached to the hydrogel. In some aspects, the oligonucleotide probe can be modified with an acrydite moiety.

[0068] In some aspects, the probe specific to the target of interest can be a padlock probe. In some aspects, the padlock probe can be circularized after the step of introducing to the tissue sample the probe specific to the target of interest, wherein the probe binds to the target of interest. In some aspects, the padlock probe can be circularized after hybridizing to the target of interest by contacting the polymerized tissue with a ligase.

[0069] In some aspects, the disclosed methods further comprises contacting a circularized padlock probe with a primer complementary to the padlock probe. In some aspects, the primer complementary to the padlock probe can be covalently attached to a hydrogel. In some aspects, the methods can further comprise subjecting the circularized padlock probe to rolling circle amplification (RCA) to generate an amplicon using the circularized padlock probe as a template and an oligonucleotide primer as the primer. In some aspects, the amplicon comprises a concatemerized repeat sequence corresponding to the target of interest. In some aspects, the methods further comprise detecting the concatemerized repeat sequence corresponding to the target of interest.

[0070] In some aspects, a padlock probe used in the disclosed methods can comprise terminal regions complementary to the target of interest.

[0071] In some aspects of the disclosed methods, an oligonucleotide primer can be used. The oligonucleotide primer can be complementary' to target of interest or to a part of a padlock oligo that is included by contacting the primer with the tissue sample. In some aspects, the methods can further comprise subjecting the circularized padlock probe to rolling circle amplification (RCA) to generate an amplicon using the circularized padlock probe as a template and an oligonucleotide primer as the primer, wherein the amplicon comprises a concatemerized repeat sequence corresponding to the RNA of interest. In some aspects, the oligonucleotide primer can be covalently attached to a hydrogel. In some aspects, the oligonucleotide primer can be modified with an acrydite moiety and incorporated into the hydrogel during polymerization or the permeabilization step. In some aspects, the padlock probes and oligonucleotide primers can be covalently incorporated into a polymerized or permeabilized tissue. In some aspects, the oligonucleotide primer can be modified. In some aspects, the oligonucleotide can be modified with an acrydite moiety. In some aspects, the amplification of the padlock probe can be rolling circle amplification.

[0072] Any sequence present in a target of interest can serve as a primer binding site, to which a primer or probe can hybridize to. In general, a primer binding site can be from about 3 to about 30 nucleotides in length, about 15 to about 25 in length. Primer oligonucleotides can be usually 6 to 25 bases in length.

[0073] The sequence in a primer can hybridize to another nucleic acid molecule and can be referred to as the complementary' portion of the primer. The complementary portion of a primer can be any length that supports specific and stable hybridization betw een the primer and the nucleic acid molecules (e.g., target of interest) under the reaction conditions.

[0074] Primers can have, for example, a length of 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides. 8 nucleotides, 9 nucleotides. 10 nucleotides. 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides. 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, or 40 nucleotides.

[0075] In some aspects, primers can have, for example, a length of less than 4 nucleotides, less than 5 nucleotides, less than 6 nucleotides, less than 7 nucleotides, less than 8 nucleotides, less than 9 nucleotides, less than 10 nucleotides, less than 11 nucleotides, less than 12 nucleotides, less than 13 nucleotides, less than 14 nucleotides, less than 15 nucleotides, less than 16 nucleotides, less than 17 nucleotides, less than 18 nucleotides, less than 19 nucleotides, less than 20 nucleotides, less than 21 nucleotides, less than 22 nucleotides, less than 23 nucleotides, less than 24 nucleotides, less than 25 nucleotides, less than 26 nucleotides, less than 27 nucleotides, less than 28 nucleotides, less than 29 nucleotides, less than 30 nucleotides, less than 31 nucleotides, less than 32 nucleotides, less than 33 nucleotides, less than 34 nucleotides, less than 35 nucleotides, less than 36 nucleotides, less than 37 nucleotides, less than 38 nucleotides, less than 39 nucleotides, or less than 40 nucleotides. As used herein, a “probe'’ can mean an oligonucleotide used in hybridization. In some aspects, the probes can be labeled oligonucleotides having sequence complementary to detection tags or another sequence on amplified nucleic acids. The complementary portion of a probe can be any length that supports specific and stable hybridization between the probe and its complementary sequence on the amplified RNA. In some aspects, the probe can be a padlock probe.

[0076] In some aspects, the length of the probe can vary. In some aspects, the probe can have a few specific bases and many degenerate bases. In some aspects, the length of the probe can be between 10 to 35 nucleotides, with a complementary portion of the probe being about 16 to 20 nucleotides long.

[0077] The probes as described herein can be labeled in a variety of ways including but not limited to direct or indirect attachment of radioactive moieties, fluorescent moieties, calorimetric moieties, and chemiluminescent moieties. Probes can contain any of the detection labels described herein. Examples of detection labels include but are not limited to biotin, fluorescent molecules, and a molecular beacon. Molecular beacons are probes labeled with fluorescent moieties where the fluorescent moieties fluoresce only when the detection probe is hybridized (Tyagi and Kramer, Nature Biotechnol. 14:303-309 (1995)). The use of such probes eliminates the need for removal of unhybridized probes prior to label detection because the unhybridized detection probes will not produce a signal.

[0078] Detection. The methods disclosed herein can comprise a detection step. For example, the disclosed methods can comprise a step of detecting a primer or probe bound to a target of interest. The methods described herein can be used to prepare tissue samples for detecting targets of interest. In some aspects, the detection method can be RCA detection. In some aspects, the detection method can be hybridization chain reaction (HCR). In some aspects, reverse transcription of target RNAs can be carried out followed by other modes of detection.

[0079] In some aspects, the amplification of the padlock probe can form a RNA concatamer. In some aspects, the RNA concatamer can be detected. In some aspects, the RNA concatamer can be detected by fluorescent probes or in situ sequencing.

[0080] In some aspects, the detecting step can be carried out or is performed using a confocal microscope.

[0081] Amplicons. In some aspects of the disclosed methods, a target or interest can be amplified or a probe that binds to the target of interest can be amplified to form an amplicon. An amplicon can be a fragment of RNA comprising the target or sequence of interest, a reverse transcribed DNA from an RNA target of interest or a DNA sequence of a probe that is specifically bound to a target of interest. In some aspects, the amplicon can be doublestranded. In some aspects, the amplicon comprises the sequence of interest. In some aspects, the amplicon comprises the target of interest. In some aspects, the amplicon can comprise a first and a second strand. In some aspects, the amplicon can be amplified and contacted with primers or probes.

[0082] In some aspects, a plurality of amplicons can be immobilized on a surface. In some aspects, amplicons can be generated for disposal onto an array.

[0083] In some aspects, the amplicons generated herein can comprise two or more concatemers.

[0084] Rolling Circle Amplification. The methods disclosed herein can further comprise rolling circle amplification (RCA). In RCA, amplification occurs with each rolling circle amplification primer, thereby forming a concatemer of tandem repeats (i.e., a TS-DNA) of segments complementary to the first-stage amplification target circle (ATC) being replicated by each primer. Bipolar primers can be used as second-stage primers. Since the bipolar primers have a 3'-OH at each end, they are automatically in the proper orientation for use as a primer for additional stages of amplification. In addition, because the bipolar primers have a 3'-OH at each end, they serve to curtail any strand displacement that might otherwise occur. Further, because of the presence of a 3'-OH at each end of the bipolar primer, the TS-DNA and second-stage, or higher order, ATCs (second-stage ATC, third-stage ATC, forth-stage ATC, and so on) complementary sequences can be arranged in any configuration within the primer sequence.

[0085] Detection Labels. To aid in detection and quantitation of a target of interest using the disclosed methods, detection labels can be directly incorporated into the primers or probes described herein or can be directly incorporated into amplified nucleic acids or can be coupled to detection molecules such as probes. As used herein, a detection label is any molecule that can be associated with amplified nucleic acid, directly or indirectly, and which results in a measurable, detectable signal, either directly or indirectly. Many such labels for incorporation into nucleic acids or coupling to nucleic acid or antibody probes are known to those of skill in the art. Examples of detection labels suitable for use in RCA are radioactive isotopes, fluorescent molecules, phosphorescent molecules, enzymes, antibodies, and ligands.

[0086] Examples of suitable fluorescent labels include fluorescein (FITC), 5,6-carboxymethyl fluorescein, Texas red, nitrobenz-2-oxa-l,3-diazol-4-yl (NBD), coumarin, dansyl chloride, rhodamine, 4'-6-diamidino-2-phenylinodole (DAPI), and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. Preferred fluorescent labels are fluorescein (5-carboxyfluorescein-N- hydroxysuccinimide ester) and rhodamine (5,6-tetramethyl rhodamine). Preferred fluorescent labels for combinatorial multicolor coding are FITC and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. The absorption and emission maxima, respectively, for these fluors are: FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588 nm), Cy5 (652 nm: 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm), thus allowing their simultaneous detection. The fluorescent labels can be obtained from a variety of commercial sources, including Molecular Probes, Eugene, OR and Research Organics, Cleveland, Ohio.

[0087] Labeled nucleotides can be used as a form of detection label since they can be directly incorporated into the products of RCA during synthesis. Examples of detection labels that can be incorporated into amplified DNA or RNA include nucleotide analogs such as BrdUrd (Hoy and Schimke, Mutation Research 290:217-230 (1993)), BrUTP (Wansick et al., J. Cell Biology 122:283-293 (1993)) and nucleotides modified with biotin (Langer et al., Proc. Natl. Acad. Sci. USA 78:6633 (1981)) or with suitable haptens such as digoxygenin (Kerkhof, Anal. Biochem. 205:359-364 (1992)). Suitable fluorescence-labeled nucleotides are Fluorescein- isothiocyanate-dUTP, Cyanine-3-dUTP and Cyanine-5-dUTP (Yu et al., Nucleic Acids Res., 22:3226-3232 (1994)). A preferred nucleotide analog detection label for DNA is BrdUrd (BUDR triphosphate, Sigma), and a preferred nucleotide analog detection label for RNA is Biotin-16-uridine-5'-triphosphate (Biotin- 16-dUTP, Boehringher Mannheim). Fluorescein, Cy3, and Cy5 can be linked to dUTP for direct labeling. Cy3.5 and Cy7 are available as avidin or anti-digoxy genin conjugates for secondary detection of biotin- or digoxy genin-labeled probes.

[0088] Detection labels that are incorporated into amplified nucleic acid, such as biotin, can be subsequently detected using sensitive methods well-known in the art. For example, biotin can be detected using streptavidin-alkaline phosphatase conjugate (Tropix, Inc.), which is bound to the biotin and subsequently detected by chemiluminescence of suitable substrates (for example, chemiluminescent substrate CSPD: disodium, 3 (4-methoxyspiro-[l,2,-dioxetane-3- 2'-(5'-chloro)tricyclo [3.3.1. 13, 7] decane] -4-yl) phenyl phosphate; CDP-Star.RTM. (disodium 2-chloro-5-(4-methoxyspiro{l,2-dioxetane-3-2'-(5'-chloro)tricyclo[3.3. 1. 13,7 ]decan}-4-yl) phenyl phosphate) and AMPPD.RTM. (disodium 3-(4-methoxyspiro{l,2-dioxetane-3-2'- tricyclo[3.3. 1.13,7 ]phenyl phosphate) (all available from Tropix, Inc.). A preferred detection label for use in detection of amplified RNA is acridinium-ester- labeled DNA probe (GenProbe, Inc., as described by Arnold et al., Clinical Chemistry 35: 1588-1594 (1989)). An acridinium-ester-labeled detection probe permits the detection of amplified RNA without washing because unhybridized probe can be destroyed with alkali (Arnold et al. (1989)).

[0089] Molecules that combine two or more of these detection labels are also considered detection labels. Any of the known detection labels can be used with the disclosed probes, tags, and method to label and detect nucleic acid amplified using the disclosed method. Methods for detecting and measuring signals generated by detection labels are also known to those of skill in the art. For example, radioactive isotopes can be detected by scintillation counting or direct visualization; fluorescent molecules can be detected with fluorescent spectrophotometers; phosphorescent molecules can be detected with a scanner or spectrophotometer, or directly visualized with a camera; enzymes can be detected by detection or visualization of the product of a reaction catalyzed by the enzy me; antibodies can be detected by detecting a secondary detection label coupled to the antibody. Such methods can be used directly in the disclosed method of amplification and detection. As used herein, detection molecules are molecules that interact with amplified nucleic acid and to which one or more detection labels are coupled.

[0090] The methods disclosed herein can be used to sequence unknown or known nucleic acids or be used for genotyping.

[0091] Examples

[0092] Example 1: Methods for clearing and molecular analysis in thick tissue sections

[0093] In situ transcriptomics (also known as spatial transcriptomic) technologies, which allow molecular characterization of tissues with subcellular spatial resolution, are currently employed for molecular diagnostic approaches. These approaches are 2D in practice because they are generally limited to thin tissue slices (e.g., 15 microns) due to the low- efficiencies of molecular diffusion and / or tissue opacity7. Attempts to combine spatial transcriptomics with tissue clearing approaches to improve molecular diffusion and optical penetration have been to permit a more 3D characterization of tissues. However, the performance of these approaches (sensitivity') drops precipitously w ith increasing tissue thickness, thus, no effective approaches exist for tissues thicker than 400 microns.

[0094] Disclosed herein are methods for tissue clearing and molecular amplification procedures that can be used to detect RNA in tissues as thick as 400 microns. The disclosed methods outperform existing in situ RNA detection methods by more than ten-fold. The methods disclosed herein can be further used as a molecular diagnosis approach.

[0095] Disclosed herein are methods that combine a tissue clearing approach and a molecular detection approach that complement each other for use in thick tissue sections.

[0096] In some aspects, the methods comprise replacing the entire tissue lattice with a polyacrylamide hydrogel, removing the non-RNA molecules (e.g., proteins, DNA, lipids), and creating detectable amplicons from RNA molecules that are covalently bound to the hydrogel. A summary' of this method is shown in FIG. 1. In some aspects, SDS and DNase I can be used to permeabilize the tissue and remove lipids and genomic DNA from thick fixed tissue sections, leading to increased optical clarity and greatly enhancing molecular diffusion. In some aspects, tissue clarity can be measured visually. For example, molecular diffusion can be confirmed as a consequence of uniform reactions across the tissue sample.

[0097] In some aspects, Padlock probes can be applied that target the RNAs of interest together with a Rolling Circle Amplification (RCA) primer that hybridizes to the padlock probes. In some aspects, the RCA primer can be modified with an acrydite moiety. Next, in some aspects, the hydrogel can be introduced by diffusing acrylamide monomers into the tissue section and inducing their polymerization. In some aspects, the RCA primers can get covalently incorporated into the polyacrylamide hydrogel, preserving their spatial position as well as that of the Padlock oligos and RNA molecule to which they are hybridized.

[0098] In some aspects, immediately after polymerization, proteinase K can be used to remove proteins. These two steps (hydrogel polymerization and proteinase treatment) can effectively be carried out to replace the protein lattice of the fixed tissue with a hydrogel lattice. Importantly, a protein lattice is non-uniform with its physical and chemical properties (e.g., hydrophobicity, density, charge, etc.) changing in different positions within the tissue. The hydrogel lattice, on the other hand, is uniform and porous with a molecular composition, which is known to be highly permissible to molecular and enzymatic reactions. Finally, in some aspects, a ligase enzyme can be used to circularize padlock probes and a poly merase to carry out RCA leading to local amplification of the padlock as a DNA concatemer that can be later identified using fluorescent probes or in situ sequencing chemistries. The presence of a Padlock-derived RCA amplicon in each position marks the position of a specific RNA molecule w ithin the tissue lattice. The methods described herein realizes uniform and sensitive RNA detection in thick tissues by improving oligonucleotide hybridization and enzymatic reaction efficiencies. As described herein, the Actb transcript, for example, was targeted using a Padlock probe in 400- micron thick mouse liver tissue sections (FIG. 2). The results showed uniform amplification from this target transcript across the tissue (FIGS. 2A, B), with at least 1000 amplicons per field of view of 2.4 mm2. This sensitivity and efficiency far outperformed the latest method that claims efficient detection in thick tissues (MelphaX) [Wang, Y. et al., (2021), Cell, 184(26)]. A side-by-side comparison of the disclosed methods were carried out with the MelphaX-based method on 50 micron-thick mouse liver tissue sections (FIG. 3). The results demonstrate that the disclosed method detects on average 24 folds as many Actb transcripts in the tissue as does MelphaX, indicating superior sensitivity’. It is contemplated that the disclosed methods can be readily parallelized for hundreds of different targets.

[0099] The improved performance of the disclosed methods is a result of the following DNase treatment: genomic DNA inhibits hybridization and later enzy matic reactions in situ (FIGS. 4A. B). For example, DNase treatment of the thick tissue before hybridization completely degrades genomic DNA (FIG. 4C), which uniformly improves RNA detection across the thick tissue. Tissue clearing: diffusion of oligonucleotides and other molecules is the rate-limiting step in in situ applications. For example, an 8% SDS solution during hybridization that removes lipids, thus clearing the tissue and improving diffusion. Hydrogel embedding and proteinase treatment: enzymatic reactions in tissues are not efficient because of the limited diffusion of enzymes and the physically and chemically heterogeneous makeup of the endogenous tissue lattice (which is made of crosslinked proteins). As a result, many in situ transcriptome methods are limited to the tissue surface in thin slices (~15 micron). Because hydrogel is highly porous, enzymes diffuse in the gel efficiently. Moreover, its chemically uniform and inert nature provides an excellent microenvironment for enzymatic reactions. Oligo design: padlock oligos can be used for targeting RNAs and a primer with an acrydite moiety can be used that binds to the padlock backbone. After hybridization of these oligos to target transcripts, the sample can be embedded in polyacry lamide gel that chemically captures the oligo-RNA complexes in their original cellular positions. As the hybridization rate directly determines the RNA retention rate, this permits RNAs to retained with high efficacy. Other in situ transcriptomic methods for thick tissues require multi-step chemical and hybridization reactions to reduce RNA retention rates. The tissue clearing and molecular amplification strategies described herein can each be used in thin-tissue settings. Moreover the tissue clearing aspects can be adapted to other molecular amplification strategies, including de novo and targeted in situ sequencing. Further, the methods disclosed herein are also compatible with tissue expansion.

[0100] The methods disclosed herein can also be used to gain a better understanding of biological systems and in methods for diagnosing disorders. For example, in a clinical setting, these methods are applicable in molecular histology for detailed diagnosis of disorders such as cancer.

[0101] An example of a disclosed method is described herein.

[0102] Summary Procedures;

[0103] The tissue is fixed (4% FA), 1 day at 4°C, then sliced (400 pm) using a vibrotome. These steps are followed by 0.5% SDS pre-treatment, O / N, DNase digestion in 2% triton-xlOO, and 8% SDS treatment to quench DNase (for FIG. 4B-C, these steps were removed). Hybridization (padlock and RCA primer (+acrydite), 8% SDS) for 3 days, followed by hybridization (padlock and RCA primer (+acrydite), 0.3% SDS) for one day, then gelation to capture primer-Padlock-RNA complex. Tissue cleansing (1.5 ml tube, 100 pl PK+0.9 ml digestion buffer) was carried out twice following by washing. Next, padlock ligation on RNA was performed, following by rolling circle amplification, and image analysis with Fiji.

[0104] Procedures:

[0105] First, 4% w / v PFA 40 ml was prepared using water (26 ml), lOx PBS (4 ml), and 16% w / v PFA (10 ml), and allowed to cool to 4°C before using. Mice were dissected to obtain the liver (any tissue can be used), which was washed with PBS. The tissues were incubated in the solutions at 4°C, overnight. A vibratome was used to make slices (e.g., 400 pm thickness). Other slicing techniques can be used as well (e g., Cryostat). The tissues were stored in 100% methanol at -20 °C; 70% EtOH can also be used (this step can be skipped). The fixed slices are washed with 2x saline-sodium citrate (SSC) four times on ice (lx SSC also worked; and other buffered aqueous solutions also worked). The samples were next washed with lx DNA digestion buffer + 0.5% SDS at 37 °C, overnight (shaken at 1000 rpm); this step removes lipid and permeabilizes the tissue. Higher SDS concentration might cause DNase inactivation in the later steps. Next, the sample was washed with lx DNA digestion buffer + 2% Triton-XlOO + 0.4 U / pl RNase inhibitor at 37 °C, for 2 hours, and shaken at 1000 rpm; this was carried out to remove SDS micelles, otherwise the DNase will be inactivated (this concentration was used for DNase Hi-C).

[0106] The DNase solution was prepared as described in Table 1 and the samples were incubated in the DNase solution, at 37 °C and shaken at 1000 rpm.

[0107] Table 1. DNase solution To stop the DNase reaction, the samples were placed in 2x SSC, 8% SDS solution at 37

[0108] °C for 1 hour and shaken at 1000 rpm. In some aspects, the SDS concentration can be lower. For FIGs. 4B-C, the samples the DNA digestion steps were omitted. For FIGs. 4A and C, the tissue slices were stained with DAPI and measured with a confocal microscope.

[0109] Next the samples were incubated in a hybridization buffer in a 1.5 ml tube for 1 hour at 37°C and shaken at 1000 rpm

[0110] Table 2. Hybridization buffer Followed by incubating the samples in hybridization buffer + oligos in a 1.5 ml tube (shaken at 1000 rpm). For these experiments, three oligos were used and incubated with the samples overnight using an 8% SDS solution with 20% formamide (but this concentration of formamide is arbitrary).

[0111] Table 3. Hybridization buffer plus oligos The SDS concentration was lowered to 0.3% and the samples were incubated overnight at 37 °C and shaken at 1000 rpm,

[0112] Table 4. Hybridization buffer with oligos (2% SDS) Next the samples were washed with 0.5x SSC / 0.3% SDS solution, 1 ml, two times at 37 °C and shaken at 1000 rpm fori hour each. This step is carried out to remove non-specific bindings. A SDS solution of 0.2X SSC also worked.

[0113] Table 5 shows the process for making a gel solution.

[0114] Table 5. Gel solution.

[0115] The tissue slices (samples) were washed with 100 pl of the gel solution without ammonium persulfate (APS) or tetramethylethylenediamine (TEMED). The gel solution was degassed by argon bubbling. Then the tissue slides were washed with 400 pl of the degassed gel solution without APS or TEMED, followed by being incubated for 15 mins at RT at 1000 rpm. Frame-Seal Slide Chambers (Frame-Seal™ in situ PCR and Hybridization Slide Chambers, 17 x 28 mm, 125 pl #SLF1201) were attached on a slide. 40 U / pl RNase inhibitor, 2 pl, and 5% TEMED and 5% APS, 4 pl were added to 200 pl gel solution. The tissue slices were placed on a glass slide and the activated gel solution was added. A plastic cover was used to seal the Frame-Seal Slide Chambers (Frame-Seal™ in situ PCR and Hybridization Slide Chambers, 17 x 28 mm, 125 pl #SLF1201), which were then incubated at 37 °C for 5 hours. Next, the samples were treated with Proteinase K in digestion buffer (100 pl + 900 pl), overnight at 37 °C and shaken at 1000 rpm. The digestion buffer (50 mM Tris-HCl pH 7.0, 1 mM EDTA, 6x SSC, 0.3% SDS) was used to next briefly wash the samples with 2x SSC, followed by washing with 2x SSC at RT six times, 30 minutes each and shaken at 1000 rpm. For the first wash, 2x phenylmethysulfonyl fluoride (PMSF) (originally 200x (200 mM) in DMSO) was added. If incubation was short. SDS cannot be removed. Then, later enzymatic reactions will be inhibited. Also, it is important to not cool down at this step because SDS will precipitate and it will be hard to remove. Next, the tissue samples were washed with lx SSC one time, followed by a wash with IX SplintR Ligase Buffer two times at 4 °C. The tissue samples were incubate with 1.25 U / pl SplintR ligase (NEB, cat. no. M0375L) in IX SplintR ligase buffer at 4 °C for 1 hour. Table 6. SplintR ligase buffer.

[0116] The tissue samples were incubated at 37 °C overnight. Then, the tissue samples were washed with lx RCA buffer (New England Biolab) twice.

[0117] Table 7. RCA solution.

[0118] 200 pl RCA solution was added to the sample in 1.5 ml tube, and incubated at 4 °C for 1 hour and shaken at 1000 rpm, following by another incubation at 30 °C for 6 hours and shaken at 1000 rpm. The solution was replaced with a fresh solution and the tissue samples were incubated again at 30 °C overnight and shaken at 1000 rpm. Next, the tissue samples were washed with 2x SSC, 1 ml, and then washed again with 2x SSC / 10% formamide at RT, 1 ml. Followed by adding 500 nM Cy5 probe corresponding to the padlock oligo in 2x SSC / 20% formamide and incubating the tissue samples at RT for 1 hour. Next, the tissue samples were washed with lx SSC at RT for 30 minutes twice. Measurements were carried out with a confocal microscope. The images were obtained and analyzed with Fiji, and converted to a 8 bit format. Arbitrary thresholds were applied to the images to remove the background. Circular objects were detected by applying arbitrary circularity and diameter values.

[0119] A padlock oligo targeting ACTB: gcagcgatatcgtcatCATAACAACAAAACAACCTCATTATCTCTCCACACACACTCCTCTC ACTgttgtcgacgaccagc (SEQ ID NO: 1) was used along with an RCA-primer: AGTGAGAGGAGTGTGTGTG + 5’ Acrydite (SEQ ID NO: 2), and detection probe: CATAACAACAAAACAACCTCATTATCTCTC + 5’ Cy5 (SEQ ID NO: 3).

[0120] Example 2: Methods for clearing and molecular analysis in thick tissue sections and in situ mutation detection

[0121] Described herein are methods that can be used for in situ mutation detection. Currently available commercialized in situ mutation detection techniques rely on thermodynamical differences to distinguish mutations. These techniques are validated for a few recurrent mutations in clinics (e.g., KRAS. BRAF, and EGFR , however, these methods require case-by- case basis optimizations.

[0122] Highly versatile techniques exist for SNP genotyping in vitro that could be applied to in situ mutation detection. However, some important enzymatic procedures do not perform in situ as they do in a tube. The methods disclosed herein use the hydrogel embedding strategy (described herein) to realize efficient enzymatic reactions in situ. Taking an advantage of the strategy, to the methods disclosed herein can effectively distinguish mutations / SNVs in situ. This method can be used for molecular diagnosis. Described herein are methods that use a novel oligo design, hydrogel embedding strategy, and the Invader assay (also known as iLock padlock oligo), which in combination allows selective mutation / SNV detection in situ.

[0123] A summary of this procedure is shown in FIG. 5. iLock padlock oligos that have two strands that compete with each other on the target mutation / SNV RNA base (shown as yellow strands in FIG. 5) were designed. After iLock-oligo hybridization, the tissue slice is immersed with the acrydite monomer solution, which is later activated to form the hydrogel lattice in the tissue. Here, the acrydite modified primer bridges the hydrogel and the iLock padlock oligos to maintain spatial information of RNAs. After the hydrogel formation, Proteinase K w as used to digest proteins, which increases optical clarity and greatly enhances molecular diffusion for enzymatic reactions. Taq polymerase cleaves the flap DNA strand when the invasive structure is formed on the RNA templates, leading to the clear distinguishment of mutation / SNVs from wild-type genotypes. Finally, a ligase enzyme was used to circularize the cleaved iLock padlock oligos and a polymerase to carry out RCA for local amplification of the padlock that can be later identified using fluorescent probes or in situ sequencing chemistries.

[0124] Result: The SNVs of C57BL / 6J and BALB / cJ in three genes (Apcs, Apoa2, and Rbp4) were used. Six iLock padlock oligos (2 mouse strains x 3 SNVs) were designed and these iLock padlock oligos distinguished the SNVs selectively in the 50-micron liver slices (FIG. 6). Reportedly, iLock padlock oligos showed limited efficiencies in situ [Krzywkowski, T. et al., (2019), RNA, 25(82-89)], which could be explained by the low diffusion and / or activities of enzymes in the cells / tissues. It is noteworthy that the authors used cultured cell lines which are favorable for in situ reactions because of the low amount of extracellular matrix; however, they observed sparse amplifications from the cells. The methods disclosed herein can sufficiently detect SNVs even from the liver tissue with a relatively abundant extracellular matrix and complex tissue lattice. This advancement can be attributed to the novel oligo design with the acrydite-modified primer and hydrogel-embedding strategy by which enzymatic reactions are largely accelerated while maintaining the spatial information of RNAs.

[0125] FIG. 7 shows that DNase I treatment improved the detection efficiency in the brain slices. Excitatory' neuron marker, Slcl7a7, was detected in the 30-micron brain slices of C57BL / 6J with two iLock padlock oligos. The brain slices were processed as described in FIG. 5 except that the slice shown in FIG. 7A received DNase I treatment before iLock padlock hybridization. The RCA amplicons from the iLock padlock oligos were detected with a Cy5 probe (red). Genomic DNA was visualized with DAPI (blue). The samples were measured with a spinning desk confocal microscope.

[0126] The steps of the procedure are as follows. The tissue is fixed in 4% PFA solution overnight at 4 degrees. The crosslinked tissue is sectioned to a thickness of 50 pm. The slices are stored in 100% methanol at -20 degrees before analysis to remove lipids and keep RNA intact. The slice is washed with lx SSC solution four times to remove methanol. The slice is incubated at 37 degrees with the iLock padlock oligos targeting the SNVs of interest. Here, a primer that carries an acrydite modification is hybridized to the Padlock backbone simultaneously. After hybridization, the slice is stringently washed to remove non-specific bindings of the Padlock probes. Then, acrylamide monomers are diffused into the slice and polymerized at 37 degrees for 2-8 hours, thus, introducing a polyacry lamide hydrogel into the tissue section. The acrydite moiety on the primer covalently binds the hydrogel and maintains the target RNA in place in the process. Next, proteins and lipids are degraded and removed using proteinase K treatment at 37 degrees. After transparency of the slice is observed, 2x PMSF (2 mM) is added to the slice to quench proteinase K. Then, the slice is incubated with Taq polymerase to cleave the flap structure on the target SNVs. The cleaved iLock padlock oligo is circularized by a ligase and an RCA reaction is performed on these circularized templates using phi29 DNA polymerase.

[0127] The methods described herein can be used to provide an accurate molecular diagnosis in oncology (e.g., drug response, prognosis, and metastasis prediction). Also, as this method can distinguish one base difference between RNAs, this method can be integrated into any in situ transcriptome techniques to improve their accuracy.

[0128] Example 3: Simultaneous detection of 16 genes in whole dorsal murine skin

[0129] Sixteen genes (Table 8) were simultaneously detected from the whole PO murine dorsal skin. Within the observed field of view measuring 749 pm x 749 pm x 250 pm, encompassing the epidermis, dermis, subcutaneous fat, and hair follicles, a total of 121,797 transcripts were detected. Mask images were generated to cover each hair follicle from the raw images to extract them computationally. Histologically, the stages of hair follicles are determined by the lengths of them. The premature hair follicles have shorter length while the mature ones have substantially longer shapes. Reportedly, PO murine dorsal skin comprises stages 1-6 hair follicles with different molecular compartments. The lengths of the computationally extracted hair follicles are between 50 to 350 pm, which indicates that the single hair follicles from different stages are successfully isolated. In some aspects, the tissue sample size can be 4 to 400 pm. The presence of heterogeneous cells in the developing skin hindered in-depth analysis. However, using the methods disclosed herein, the results demonstrated successful computational distinction and isolation of single hair follicles. The results show that the methods disclosed herein can be used for precise spatial characterization of molecular events and an improved and accurate diagnostic as w ell as provide a deeper understanding of biology.

[0130] Table 8. Marker genes Methods. Prepare 4% w / v paraformaldehyde (PF A) solution was prepared (40 ml) and cooled to 4 °C before using. The dorsal skin from P0 mice was dissected and wash with PBS. The tissues were incubate in the PFA solutions at 4 °C overnight, and then stored in 100% methanol at -20 °C until use. The fixed samples were washed twice with 2x SSC / 8% SDS solution at 37 °C for 30 minutes. Next, the samples were incubated with 2x SSC / 8% SDS solution / l%bMercaptoethanol solution at 37 °C overnight. The samples were then washed twice with lx DNA digestion buffer + 2% Triton-XlOO at 37 °C for 1 hour.

[0131] The DNase solution was made and the samples were incubated in the DNase solution at 37 °C overnight. Table 9. DNase solution. The DNase reaction was stopped by incubating the samples in in 2xSSC / 8% SDS solution at 37 °C for 2 hours. This step was following by incubating the sample in a hybridization buffer in a 1.5 ml tube for 1 hour at 37 °C.

[0132] Table 10. Hy bridization buffer Next, the samples were incubated in hybridization buffer + oligos at 37 °C, for 6 days.

[0133] The solution was changed every day.

[0134] Table 1 1. Hybridization buffer plus oligos. The samples were then washed with lx SSC / 0.5% SDS solution two times at 37 °C for

[0135] 1 hour each. Next, a gel solution was prepared. Table 12. Gel solution.

[0136] The samples (e g., slices) were then washed with 500 pl gel solution without APS or TEMED. and incubated for 30 minutes at RT. The gel solution was degassed by Argon bubbling. Next, 40 U / pl RNase inhibitor (2 pl) and 5 % TEMED and 5% APS 4 pl was added to 200 pl gel solution. The samples were placed on a glass slide and the activated gel solution was added. Coverslips were placed on the glass slides, and then were incubated at 37 °C for 1 hour. The samples were then treated with Proteinase K in digestion buffer (100 pl + 900 pl), overnight at 37 °C. Digestion buffer included 50 mM Tris-HCl pH 7.0, 1 mM EDTA, 2x SSC, and 2% SDS. The samples were washed with 2x SSC / 2x PMSF / 0.1% TritonXIOO at RT for 30 minutes, followed by a wash with 2x SSC at RT, 30 minutes, 5 times, and then washed two times with IX SplintR Ligase Buffer. Next, the samples were incubated with 1.25 U / pl SplintR ligase (NEB, cat. no. M0375L) in IX SplintR ligase buffer at 37 °C overnight.

[0137] Table 13. SplintR Ligase Buffer.

[0138] The samples were washed twice with lx RCA buffer (New England Biolab).

[0139] Table 14. RCA solution.

[0140] 200 pl RCA solution was added to the samples in 1.5 ml tube, and then incubated at 30 °C for 8 hours and shaken at 1000 rpm. The RCA solution was changed, and the samples were incubated at 30 °C overnight, followed by wash with 2x SSC. and then incubated in 20 mM Acryloyl -X / 2x SSC for 2 hours.

[0141] Table 15. Monomer solution.

[0142] The samples (e.g., slices) were washed with 200 pl monomer solution (2.5% Acrylamide / 0. 125% Bis-acrylamide / 2x SSC solution) without APS or TEMED. The monomer solution was degassed using argon bubbling. The tissue samples were w ashed twice with 400 pl degassed monomer solution without APS or TEMED, and incubated for 10 minutes at RT. Next, 5% TEMED, 4 pl, and 5% APS, 4 pl, was added to 200 pl of the monomers solution. Each tissue sample (e.g., slice) was placed on a coverslip with the activated monomer solution. It is important to pretreat the coverslips with slip solution (e.g., Gel Slick Solution from Lonza which helps to take off the coverslip from the sample). The coverslips were applied to the glass slides that were pretreated with Bind-Silane. The tissue samples were then incubate at 37 °C for 30 minutes. Next, the tissue samples were washed with PBS and the coverslips were removed, following by a wash with 2xSSC / 20% formamide. A solution with bridge probes and dye probes were added: 2x SSC, 20% Formamide 50 nM / bridge probe (in total, 800 nM), 200 nM / dye probes (AF488, AF546, Cy5, AF750, in total 800 nM); and incubated at RT for 2 hours. Next, the tissue samples were w ashed with 2xSSC / 20% formamide for 10 minutes at RT, followed by a wash with PBS, 6 times at 37 °C. 5 minutes each. The Illumina scanning solution was added. Images were taken with Nikon spinning disk confocal microscope. The samples w ere washed with PBS. The probes were stripped with 70% formamide / O.lx SSC at 60 degrees for 10 minutes, 6 times. Next, the tissue samples were w ashed with PBS. The hybridization and imaging steps were repeated with different sets of bridge probes and dye probes. The obtained images were processed as follows: background was subtracted; the image was registered, puncta w as extracted, ID called, a mask image was generated for each hair follicle; and the hair follicle was extracted using the mask images generated.

[0143] Padlock oligos were specifically designed for the 16 genes listed in Tables 16-18. Other probes used are listed in Table 19. The whole dorsal murine skin of C57BL / 6J was fixed, processed with the padlock oligos, and scanned from the dorsal to ventral direction with a confocal microscope. The corresponding transcripts were identified with HyblSS. The results showed a spatial distribution of the 16 genes across the sample. The developing skin sample consists of numerous hair follicles from various stages ranging from stage 2 to 6. Hair follicles were computationally isolated with manually curated mask images. The results also demonstrate that the extracted hair follicles exhibit varying lengths which reflect hair follicle stages.

[0144] Table 16. Probes and sequences.

[0145]

[0146] Table 17. Probes and sequences Table 18. Probes and sequences Table 19. Probes and sequences

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A method for detecting a target of interest in a tissue sample, the method comprising: a) Obtaining or having obtained a tissue sample, wherein the tissue sample comprises DNA, non-RNA molecules, and RNA, wherein the RNA comprises a target of interest; b) Permeabilizing the tissue sample; c) Substantially degrading the DNA in the tissue sample; and d) Introducing to the tissue sample a primer or a probe specific to the target of interest, wherein the primer or probe binds to the target of interest; and e) Detecting the pnmer or probe bound to the target of interest, thereby detecting the target of interest in the tissue sample.

2. The method of claim 1, wherein the method further comprises forming a matrix within the tissue sample.

3. The method of any of claims 1-2, wherein the tissue sample is embedded in a hydrogel prior to or after step d).

4. The method of any of claims 1-3, wherein the tissue sample is embedded in a hydrogel after step a), b), c), or step d).

5. The method of any of claims 3-4, wherein the hydrogel comprises acrylamide monomers.

6. The method of any of claims 3-5, wherein the tissue sample is embedded in the hydrogel by diffusing acrylamide monomers into the tissue sample and crosslinking them to form a polyacrylamide gel.

7. The method of any of claims 3-6, wherein the probe is an oligonucleotide probe, and wherein the oligonucleotide probe is attached to the hydrogel.The method of claim 7, wherein the oligonucleotide probe is covalently attached to the hydrogel. The method of claim 8, wherein the oligonucleotide probe is modified with an acrydite moiety. The method of any of claims 1-9, wherein the tissue sample of step a) comprises lipids. The method of claim 10, further comprising reducing or removing lipids from the tissue sample. The method of any of claims 10-11, wherein lipids are partially, substantially or completely removed from the tissue sample. The method of any of claims 1-12. further comprising degrading the non-RNA molecules in the tissue sample, wherein the non-RNA molecules are protein molecules. The method of claim 13, wherein the protein molecules are substantially degraded by contacting the tissue sample with proteinase K. The method of any of claims 1-14, wherein the tissue sample is permeabilized by contacting the tissue sample with a tissue-permeabilizing agent. The method of claim 15, wherein the tissue-permeabilizing agent is sodium dodecyl sulfate, Triton-Xl OO, Tween-20, methanol or ethanol. The method of any of claims 1-16, wherein the tissue sample is fixed prior to step b). The method of claim 17, wherein the tissue sample is fixed by contacting the tissue sample with a chemical crosslinking agent.The method of claim 18, wherein the chemical crosslinking agent is formaldehyde, glutaraldehyde, dimethyl suberimidate, SM(PEG)12 (PEGylated. long-chain SMCC crosslinker), SM(PEG)6 (PEGylated, long-chain SMCC crosslinker), SM(PEG)2 (PEGylated SMCC crosslinker), SIAB (succinimidyl (4-iodoacetyl)aminobenzoate), BMH (bismaleimidohexane), SBAP (succinimidyl 3-(bromoacetamido)propionate), SMPT (4-succinimidyloxy carbonyl-alpha-methyl-a(2-pyridyldithio)toluene), DTS SP (3,3'-dithiobis(sulfosuccinimidyl propionate)). EMCH (N-s-maleimidocaproic acid hydrazide), SM(PEG)24 (PEGylated, long-chain SMCC crosslinker), BMPH (N-|3- maleimidopropionic acid hydrazide), DTME (dithiobismaleimidoethane), BMOE (bismaleimidoethane), SMPB (succinimidyl 4-(p-maleimidopheny 1 (butyrate). EMCS (N-s-malemidocaproyl-oxysuccinimide ester). MBS (m-maleimidobenzoyl-N- hydroxysuccinimide ester), Sulfo-EMCS (N-E-maleimidocaproyl-oxysulfosuccinimide ester), BS(PEG)9 (PEGylated bis(sulfosuccinimidyl)suberate), Sulfo-EGS (ethylene glycol bis(sulfosuccinimidyl succinate)), LC-SPDP (succinimidyl 6-(3(2- pyridyldithio)propionamido)hexanoate), PEG12-SPDP (PEG} dated, long-chain SPDP crosslinker) or derivative or a combination thereof. The method of any of claims 1-19, wherein the probe specific to the target of interest is a padlock probe. The method of claim 20, wherein the padlock probe is circularized after step d). The method of claim 21, wherein the padlock probe is circularized by contacting the polymerized tissue with a ligase. The method of claim 22, further comprising contacting the circularized padlock probe with a primer complementary to the padlock probe. The method of claim 23, wherein the primer complementary to the padlock probe is covalently attached to the hydrogel. The method of any of claims 23-24, further comprising subjecting the circularized padlock probe to rolling circle amplification (RCA) to generate an amplicon using thecircularized padlock probe as a template and an oligonucleotide primer as the primer, wherein the amplicon comprises a concatemerized repeat sequence corresponding to the target of interest. The method of claim 25, further comprising detecting the concatemerized repeat sequence corresponding to the target of interest. The method of any of claims 1-26, wherein the tissue sample has a thickness of about 20 pm to 800 pm. The method of any of claims 1-27, wherein the method further comprises substantially degrading the non-RNA molecules in the tissue sample. The method of any of claims 1-28, wherein the target of interest comprises a mutation. The method of any of claims 1-29. wherein the tissue sample after step (c) has increased optical clarity and enhanced molecular diffusion compared to the tissue sample of step (b). A method of making a hydrogel within a tissue sample, the method comprising: a) Obtaining or having obtained a fixed tissue sample, wherein the tissue sample comprises DNA, non-RNA molecules, and RNA, wherein the RNA comprises a target of interest; b) Permeabilizing the tissue sample; and c) Substantially degrading the DNA in the tissue sample; thereby forming a hydrogel within the tissue sample. The method of claim 31, wherein non-RNA molecules are proteins, wherein the proteins present in the tissue sample are cross-linked. The method of claim 31, wherein the tissue sample is preserved prior to step a).

34. The method of claim 33, wherein the method comprises preserving the tissue sample using a chemical crosslinking agent.

35. The method of claim 34, wherein the crosslinking agent is formaldehyde, glutaraldehyde or a combination thereof. The method of claim 31. wherein the tissue sample has a thickness of about 20 pm to 800 pm.