Methods for treating cep290 associated disease
Patent Information
- Application Number
- EP2023833541
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-04-21
- Filing Date
- 2023-11-16
- Publication Date
- 2025-09-24
AI Technical Summary
Current therapies are inadequate for treating Leber Congenital Amaurosis 10 (LCA10), a retinal degenerative disease caused by mutations in the CEP290 gene, leading to severe visual impairment or blindness, with no approved treatments available.
The use of CRISPR/CAS-related methods for editing the CEP290 gene in retinal cells using nucleic acids and vectors, specifically administering Cas9 and guide RNAs targeted to the CEP290 gene to correct the IVS26 mutation, thereby restoring CEP290 function and improving visual function.
The method demonstrates significant improvements in visual navigation, visual acuity, dark-adapted visual sensitivity, pupillary response, macula thickness, contrast sensitivity, and quality of life scores in subjects, with measurable enhancements within specific time frames post-treatment.
Smart Images

Figure 1.1
Abstract
Description
METHODS FOR TREATING CEP290 ASSOCIATED DISEASEPRIORITY CLAIM
[0001] This application claims priority to U.S. Provisional Application No. 63 / 384,070, filed November 16, 2022, and U.S. Provisional Application No. 63 / 497,671, filed April 21, 2023, both of which are incorporated by reference in their entirety.SEQUENCE LISTING
[0002] This application contains a ST.26 compliant Sequence Listing, which was submitted in XML format via Patent Center, and is hereby incorporated by reference in its entirety. The XML copy, created on November 15, 2023, is named 1189458024WO00.xml and is 40,000 bytes in size.FIELD
[0003] The disclosure relates to CRISPR / CAS-related methods for editing of a target nucleic acid sequence, and applications thereof in connection with CEP290 associated disease.BACKGROUND
[0004] CEP290 is a 290 kilodalton (kDa) protein encoded by a 90 kilobase-pair (kb) gene, which is thought to be involved in the normal function of the eye and kidney. In cells, the CEP290 protein associates with the centrosome and with cellular scaffold proteins, and is implicated in a variety of cellular processes including cell division, the DNA damage response, and ciliogenesis. Mutations of CEP290 are observed in several diseases, including Senior-Loken syndrome, Meckel Gruber syndrome, Bardet-Biedle syndrome, Joubert Syndrome, and Leber Congenital Amaurosis 10 (LCA10).
[0005] LCA10 is an inherited retinal degenerative disease characterized by severe visual impairment or blindness at birth. The disease is inherited in an autosomal recessive fashion and is caused, in some instances, by a C.2991+1655A to G mutation (the "IVS26" mutation) in the CEP290 gene. IVS26 is a loss-of-function mutation in which a cryptic splice donor site is formed in intron 26 of the CEP290 gene, resulting in prematurely truncated CEP290 mRNA transcripts that include an aberrant 128 bp exon. The consequent loss of CEP290 function is thought to disrupt sensory cilia function in photoreceptor cells, leading to the disease.
[0006] There are currently no approved therapies for LCA10. Despite advances that have been made using gene therapy, there remains a need for therapeutics to treat retinal dystrophies, including LCA10.SUMMARY
[0007] This disclosure provides nucleic acids and vectors for efficient transduction of genome editing systems in retinal cells and cells in other tissues, as well as methods of using these vectors to treat subjects. These nucleic acids, vectors and methods represent an important step forward in the development of treatments for CEP290 associated diseases.
[0008] In certain aspects, this disclosure relates to methods of treating a subject having LCA10 comprising administering to the subject a nucleic acid encoding a Cas9, a first gRNA and a second gRNA, each gRNA targeted to a CEP290 gene of the subject to treat the subject. In certain embodiments, treating may comprise increasing the subject’s visual navigation after administration of the nucleic acid to the subject. In certain embodiments, the subject’s visual navigation may be measured using visual navigation courses. In certain embodiments, increasing the subject’s visual navigation may comprise an increase of one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or twenty one levels of the subject’s visual function navigation course level score after administration of the nucleic acid to the subject compared to the subject’s visual function navigation course level score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s visual navigation may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0009] In certain embodiments, treating may comprise reducing the subject’s Logarithm of the Minimum Angle of Resolution (LogMAR) measurement of best corrected visual acuity (BCVA) after administration of the nucleic acid to the subject. In certain embodiments, reducing the subject’s LogMAR measurement of BCVA may comprise a reduction of about 1% to about 100% (e.g., about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25%, about 30%,about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s LogMAR measurement of BCVA prior to administration of the nucleic acid to the subject. In certain embodiments, reducing the subject’s LogMAR measurement of BCVA may comprise a reduction of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4,1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2., 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5,3.6, 3.7, 3.8, 3.9, or 4.0 of the subject’s LogMAR measurement of BCVA prior to administration of the nucleic acid to the subject. In certain embodiments, reducing the subject’s LogMAR measurement of BCVA may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0010] In certain embodiments, treating may comprise increasing the subject’s dark-adapted visual sensitivity after administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s dark-adapted visual sensitivity may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s dark-adapted visual sensitivity after administration of the nucleic acid to the subject compared to the subject’s dark-adapted visual sensitivity prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s dark-adapted visual sensitivity after administration of the nucleic acid to the subject may comprise reducing the subject’s full field light sensitivity threshold (FST) (Log cd / m2). In certain embodiments, the subject’s FST (Log cd / m2) may be reduced by 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2., 2.3, 2.4, 2.5,2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, or 4.0 of the subject’s Log cd / m2 measurement of FST prior to administration of the nucleic acid to the subject. In certain embodiments, the subject’s dark-adapted visual sensitivity is measured using one or more of the group selected from blue light, white light, and red light. In certain embodiments, increasing the subject’s dark-adapted visual sensitivity may occur and / or beassayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0011] In certain embodiments, treating may comprise increasing the subject’s pupillary response after administration of the nucleic acid to the subject. In certain embodiments, the increase in the subject’s pupillary response may be measured by the change in pupil diameter in response to a light stimulus. In certain embodiments, increasing the subject’s pupillary response may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s pupillary response after administration of the nucleic acid to the subject compared to the subject’s pupillary response prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s pupillary response may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0012] In certain embodiments, treating may comprise increasing the subject’s macula thickness after administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s macula thickness may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s macula thickness after administration of the nucleic acid to the subject compared to the subject’s macula thickness prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s macula thickness may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0013] In certain embodiments, treating may comprise increasing the subject’s contrast sensitivity after administration of the nucleic acid to the subject. In certain embodiments, the increase in the subject’s contrast sensitivity may be measured using a Pelli-Robson chart. In certain embodiments, increasing the subject’s contrast sensitivity may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s contrast sensitivity after administration of the nucleic acid to the subject compared to the subject’s contrast sensitivity prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s contrast sensitivity may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0014] In certain embodiments, treating may comprise increasing the subject’s macular sensitivity after administration of the nucleic acid to the subject. In certain embodiments, the increase in the subject’s macular sensitivity may be measured using microperimetry. In certain embodiments, the increase in the subject’s macular sensitivity may be measured using a visual field test measuring the amount of light perceived in specific parts of the macula. In certain embodiments, increasing the subject’s macular sensitivity comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s macular sensitivity after administration of the nucleic acid to the subject compared to the subject’s macular sensitivity prior to administration of the nucleicacid to the subject. In certain embodiments, increasing the subject’s macular sensitivity may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0015] In certain embodiments, treating may comprise increasing the subject’s color vision score after administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s color vision score may be measured using a Farnsworth 15 score. In certain embodiments, increasing the subject’s color vision score comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s color vision score after administration of the nucleic acid to the subject compared to the subject’s color vision score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s color vision score may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0016] In certain embodiments, treating may comprise increasing the subject’s Quality of Life (QOL) score after administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s QOL score may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s QOL score after administration of the nucleic acid to the subject compared to the subject’s QOL score prior to administration of the nucleic acid to the subject. In certain embodiments, the subject’s BCVA may be worse than 1.0 LogMAR in both eyes. In certainembodiments, the QOL score may be measured using the Impact of Vision Impairment for Very Low Vision. In certain embodiments, the subject’s BCVA may be 1.0 LogMAR or better in both eyes. In certain embodiments, the QOL score may be measured using the Impact of Vision Impairment. In certain embodiments, increasing the subject’s QOL score may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 1 1 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0017] In certain embodiments, treating may comprise increasing the subject’s National Eye Institute 25-Item Visual Function Questionnaire (VFQ-25) score. In certain embodiments, the VFQ-25 score is an all domains composite score. In certain embodiments, the VFQ-25 score is a selected domains (e.g., general vision, color vision, near vision, and / or distance vision domains) score. In certain embodiments, increasing the subject’s VFQ-25 score may comprise an increase of about 1 point, about 2 points, about 3 points, about 4 points, about 5 points, about 6 points, about 7 points, about 8 points, about 9 points, about 10 points, about 11 points, about 12 points, about 13 points, about 14 points, or about 15 points of the subject’s VFQ-25 score after administration of the nucleic acid to the subject compared to the subject’s VFQ-25 score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s VFQ-25 score may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0018] In certain embodiments, treating may comprise increasing the subject’s visual field after administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s visual field may be measured using kinetic perimetry. In certain embodiments, increasing the subject’s visual field may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s visual field after administration of the nucleic acid to the subject compared to the subject’s visual field prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s visual field may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 1 1 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0019] In certain embodiments, treating may comprise increasing the subject’s Patient Global Impressions of Change score after administration of the nucleic acid to the subject. In certain embodiments, the Patient Global Impressions of Change score may be for severity (e.g., PG1C-S). In certain embodiments, the Patient Global Impressions of Change score may be for function (e.g., PGIC-F). In certain embodiments, increasing the subject’s Patient Global Impressions of Change score may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s Patient Global Impressions of Change score after administration of the nucleic acid to the subject compared to the subject’s Patient Global Impressions of Change score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s Patient Global Impressions of Change score may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0020] In certain embodiments, treating may comprise increasing the subject’s gaze tracking after administration of the nucleic acid to the subject. In certain embodiments,increasing the subject’s gaze tracking may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s gaze tracking after administration of the nucleic acid to the subject compared to the subject’s gaze tracking prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s gaze tracking may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0021] In certain embodiments, treating may comprise increasing the subject’s vision related quality of life (PRO) as measured by Visual Function Navigation (VFQ) / Children’s Visual Function Questionnaire (CVFQ) score after administration of the nucleic acid to the subject compared to the subject’s VFQ / CVFQ score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s PRO may comprise an increase of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 points of the subject’s VFQ / CVFQ score after administration of the nucleic acid to the subject compared to the subject’s VFQ / CVFQ score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s PRO may comprise an increase of > 4, > 5, > 10, > 15, > 20, > 25, > 30, > 35, > 40 points of the subject’s VFQ / CVFQ score after administration of the nucleic acid to the subject compared to the subject’s VFQ / CVFQ score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s PRO may comprise an increase of 4 to 10, 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40 points of the subject’s VFQ / CVFQ score after administration of the nucleic acid to the subject compared to the subject’s VFQ / CVFQ score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s PRO may occur about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0022] In certain embodiments, treating may comprise increasing the subject’s visual function navigation (VFN) composite score compared to the subject’s VFN composite score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s VFN composite score may comprise an increase of 1 , 2, 3, 4, 5, 6, 7, or 8 compared to the subject’s VFN composite score prior to administration of the nucleic acid to the subject. In certain embodiments, wherein increasing the subject’s VFN composite score comprises an increase of 1 to 4, 2 to 5, 3 to 6, 4 to 7, or 5 to 8, compared to the subject’s VFN composite score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s VFN composite score may comprise an increase of > 3, > 4, > 5, > 6, > 7, or > 8 compared to the subject’s VFN composite score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s VFN composite score may occur about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0023] In certain embodiments, the first gRNA may comprise a targeting domain selected from the group consisting of SEQ ID NOS: 1-3. In certain embodiments, the second gRNA may comprise a targeting domain selected from the group consisting of SEQ ID NOS: 4-6.
[0024] In certain embodiments, the nucleic acid encoding the Cas9, the first gRNA and second gRNA may be characterized in that it comprises the following targeting domain sequences a) SEQ ID NO: 1 and SEQ ID NO:4; or b) SEQ ID NO:1 and SEQ ID NO:5; or c) SEQ ID NO: 1 and SEQ ID NO:6; or d) SEQ ID NO:2 and SEQ ID NO:4; or e) SEQ ID NO:3 and SEQ ID NO:4; or f) SEQ ID NO:3 and SEQ ID NO:5. In certain embodiments, the subject may be homozygous for the C.2991+1655A to G mutation. In certain embodiments, the subject may be a pediatric subject. In certain embodiments, the nucleic acid may be an AAV vector. In certain embodiments, the AAV vector may be administered to the subject at a concentration of about 6.0x1011vg / ml, about l.lx1012vg / ml, or about 3.0 x1012. In certainembodiments, the subject may receive from about 9.Ox1010vg to about l.Ox1012vg of the AAV vector. In certain embodiments, the subject may be administered a single dose of the nucleic acid. In certain embodiments, the subject may be heterozygous for the C.2991+1655A to G mutation.
[0025] In certain embodiments, the nucleic acid may encode .S', aureus Cas9. In certain embodiments, the nucleic acid may comprise a Cas9 coding sequence according to SEQ ID NO: 10 or encodes a Cas9 comprising the sequence of SEQ ID NO: 11. In certain embodiments, the Cas9 may be a modified Cas9. In certain embodiments, the nucleic acid may comprise SEQ ID NOS: 26 or 27.
[0026] In one aspect, the disclosure relates to a method for treating or altering a cell in a subject (e.g., a human subject or an animal subject) that includes administering to the subject a nucleic acid encoding a Cas9 and first and second guide RNAs (gRNAs) targeted to the CEP290 gene of the subject. In certain embodiments, the first and second gRNAs are targeted to one or more target sequences that encompass or are proximal to a CEP290 target position. The first gRNA may include a targeting domain selected from SEQ ID NOS: 1-3 (corresponding RNA sequences in SEQ ID NOS: 18-20, respectively), while the targeting domain of the second gRNA may be selected from SEQ ID NOS: 4-6 (corresponding RNA sequences in SEQ ID NOS: 21-23, respectively). The Cas9, which may be a modified Cas9 (e.g., a Cas9 engineered to alter PAM specificity, improve fidelity, or to alter or improve another structural or functional aspect of the Cas9), may include one or more of a nuclear localization signal (NLS) and / or a poly adenylation signal. Certain embodiments are characterized by Cas9s that include both a C-terminal and an N-terminal NLS. The Cas9 is encoded, in certain embodiments, by SEQ ID NO: 10, and its expression is optionally driven by one of a CMV, EFS, or hGRKl promoter, as set out in SEQ ID NOS: 13-15 respectively. The nucleic acid also includes, in various cases, first and second inverted terminal repeat sequences (ITRs).
[0027] Continuing with this aspect of the disclosure, a nucleic acid comprising any or all of the features described above may be administered to the subject via an adeno-associated viral (AAV) vector, such as an AAV5 vector. The vector may be delivered to the retina of the subject (for example, by subretinal injection). Various embodiments of the method may be used in the treatment of human subjects. For example, the methods may be used to treat subjects suffering from a CEP290 associated disease such as LCA10, to restore CEP290 function in a subject in need thereof, and / or to alter a cell in the subject, such as a retinal cell and / or a photoreceptor cell.
[0028] In another aspect, this disclosure relates to a nucleic acid encoding a Cas9, a first gRNA with a targeting domain selected from SEQ ID NOS: 1-3 (corresponding RNA sequences in SEQ ID NOS: 18-20, respectively), and a second gRNA with a targeting domain selected from SEQ ID NOS: 4-6 (corresponding RNA sequences in SEQ ID NOS: 21-23, respectively). The nucleic acid may, in various embodiments, incorporate any or all of the features described above (e.g., the NLS and / or poly adenylation signal; the CMV, EFS or hGRKl promoter; and / or the ITRs). The nucleic acid may be part of an AAV vector, which vector may be used in medicine, for example to treat a CEP290 associated disease such as LCA10, and / or may be used to edit specific cells including retinal cells, for instance retinal photoreceptor cells. The nucleic acid may also be used for the production of a medicament.
[0029] In yet another aspect, this disclosure relates to a method of treating a subject that includes the step of contacting a retina of the subject with one or more recombinant viral vectors (e.g., AAV vectors) that encode a Cas9 and first and second gRNAs. The first and second gRNAs are adapted to form first and second ribonucleoprotein complexes with the Cas9, and the first and second complexes in turn are adapted to cleave first and second target sequences, respectively, on either side of a CEP290 target position as that term is defined below. This cleavage results in the alteration of the nucleic acid sequence of the CEP290 target position. In some embodiments, the step of contacting the retina with one or more recombinant viral vectors includes administering to the retina of the subject, by subretinal injection, a composition comprising the one or more recombinant viral vectors. The alteration of the nucleic acid sequence of the CEP290 target position can include formation of an indel, deletion of part or all of the CEP290 target position, and / or inversion of a nucleotide sequence in the CEP290 target position. The subject, in certain embodiments, is a primate.
[0030] The genome editing systems, compositions, and methods of the present disclosure can support high levels of productive editing in retinal cells, e.g., in photoreceptor cells. In certain embodiments, 10%, 15%, 20%, or 25% of retinal cells in samples modified according to the methods of this disclosure (e.g., in retinal samples contacted with a genome editing system of this disclosure) comprise a productive alteration of an allele of the CEP290 gene. A productive alteration may include, variously, a deletion and / or inversion of a sequence comprising an IVS26 mutation, or another modification that results in an increase in the expression of functional CEP290 protein in a cell. In certain embodiments, 25%, 30%, 35%, 40%, 45%, 50%, or more than 50% of photoreceptor cells in retinal samples modified according to the methods of this disclosure (e.g., in retinal samples contacted with a genomeediting system of this disclosure) comprise a productive alteration of an allele of the CEP290 gene.
[0031] In another aspect, this disclosure relates to a nucleic acid encoding a Cas9 and first and second gRNAs targeted to a CEP290 gene of a subject for use in therapy, e.g., in the treatment of CEP290-associated disease. The CEP290 associated disease may be, in some embodiments, LCA10, and in other embodiments may be selected from the group consisting of Senior-Loken syndrome, Meckel Gruber syndrome, Bardet-Biedle syndrome and Joubert Syndrome. Targeting domains of the first and second gRNAs may comprise the sequences of SEQ ID NOS: 1-3 and NOS: 4-6, respectively, and in certain embodiments the first and second gRNA targeting domains comprise: SEQ ID NOS: 1 and 4. In other embodiments, the first and second gRNA targeting domains comprise the sequences of SEQ ID NOS: 1 and 5, SEQ ID NOS: 1 and 6, SEQ ID NOS: 2 and 4, SEQ ID NOS 3 and 4, or SEQ ID NOS: 3 and 5. In still other embodiments, the first and second targeting domains comprise the sequences of SEQ ID NOS: 2 and 5, SEQ ID NOS: 2 and 6, or SEQ ID NOS: 3 and 6. The gRNAs according to this aspect of the disclosure may be unimolecular, and may comprise RNA sequences according to SEQ ID NO: 7 or SEQ ID NO: 8. Alternatively, the gRNAs may be two-part modular gRNAs according to either sequence, where the crRNA component comprises the portion of SEQ ID NO: 7 or 8 that is underlined, and the tracrRNA component comprises the portion that is double-underlined.
[0032] Continuing with this aspect of the disclosure, the Cas9 encoded by the nucleic acid is, in certain embodiments, a Staphylococcus aureus Cas9, which may be encoded by a sequence comprising SEQ ID NO: 10, or having at least 80%, 85%, 90%, 95% or 99% sequence identity thereto. The Cas9 encoded by the nucleic acid may comprise the amino acid sequence of SEQ ID NO: 11 or may share at least 80%, 85%, 90%, 95% or 99% sequence identity therewith. The Cas9 may be modified in some instances, for example to include one or more nuclear localization signals (NLSs) (e.g., a C-terminal and an N-terminal NLS) and / or a polyadenylation signal. Cas9 expression may be driven by a promoter sequence such as the promoter sequence comprising SEQ ID NO: 13, the promoter sequence comprising SEQ ID NO: 14, or the promoter sequence comprising SEQ ID NO: 15.
[0033] Staying with this aspect of the disclosure, the promoter sequence for driving the expression of the Cas9 comprises, in certain embodiments, the sequence of a human GRK1 promoter. In other embodiments, the promoter comprises the sequence of a cytomegalovirus (CMV) promoter or an EFS promoter. For example, the nucleic acid may comprise, in various embodiments, a) a CMV promoter for Cas9 and gRNAs comprising (or differing byno more than 3 nucleotides from) targeting domains according to SEQ ID NOs: 1 and 5, or b) a CMV promoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 1 and 6, or c) a CMV promoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 2 and 4, or d) a CMV promoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 3 and 4, or e) a CMV promoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 3 and 5, or f) an EFS promoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 1 and 5, or g) an EFS promoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 1 and 6, or h) an EFS promoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 2 and 4, or i) an EFS promoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 3 and 4, or j) an EFS promoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 3 and 5, or k) an hGRKl promoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 1 and 5, or g) an hGRKlpromoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 1 and 6, or h) an hGRKlpromoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 2 and 4, or i) an hGRKl promoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 3 and 4, or j) an hGRKlpromoter for Cas9 and gRNAs comprising targeting domains according to SEQ ID NOs: 3 and 5. In other embodiments, the nucleic acid comprises a CMV promoter and guide RNA targeting sequences according to SEQ ID NOS: 1 and 4. In still other embodiments, the nucleic acid comprises an hGRK promoter and guide RNA targeting sequences according to SEQ ID NOS: 2 and 5, or it comprises a CMV promoter and guide RNA targeting sequences according to SEQ ID NOS: 2 and 5, or an hGRK promoter and guide RNA targeting sequences according to SEQ ID NOS: 2 and 6, or it comprises a CMV promoter and guide RNA targeting sequences according to SEQ ID NOS: 3 and 6,. or an hGRK promoter and guide RNA targeting sequences according to SEQ ID NOS: 3 and 6, or it comprises a CMV promoter and guide RNA targeting sequences according to SEQ ID NOS: 2 and 5. And in further embodiments, the promoter is hGRK or CMV while the first and second gRNA targeting domains comprise the sequences of SEQ ID NOS: 1 and 5, SEQ ID NOS: 1 and 6, SEQ ID NOS: 2 and 4, SEQ ID NOS 3 and 4, or SEQ ID NOS: 3 and 5.
[0034] In another aspect, the present disclosure relates to adeno-associated virus (AAV) vectors comprising the nucleic acids described above. AAV vectors comprising the foregoing nucleic acids may be administered to a variety of tissues of a subject, though incertain embodiments the AAV vectors are administered to a retina of the subject, and / or are administered by subretinal injection. The AAV vector may comprise an AAV5 capsid.
[0035] An additional aspect of this disclosure relates to a nucleic acid as described above, for delivery via an AAV vector also as described above. The nucleic acid includes in some embodiments, first and second inverted terminal repeat sequences (ITRs), a first guide RNA comprising a targeting domain sequence selected from SEQ ID NOS: 1-3, a second guide RNA comprising a targeting domain sequence selected from SEQ ID NOS: 4-6, and a promoter for driving Cas9 expression comprising a sequence selected from SEQ ID NOS: 13- 15. In certain embodiments, the nucleic acid includes first and second ITRs and first and second guide RNAs comprising a guide RNA sequence selected from SEQ ID NOS: 7 and 8 (e.g., both first and second guide RNAs comprise the sequence of SEQ ID NO: 8). The nucleic acid may be used in the treatment of human subjects, and / or in the production of a medicament.
[0036] The nucleic acids and vectors according to these aspects of the disclosure may be used in medicine, for instance in the treatment of disease. In some embodiments, they are used in the treatment of a CEP290- associated disease, in the treatment of LCA10, or in the treatment of one or more of the following: Senior-Loken syndrome, Meckel Gruber syndrome, Bardet-Biedle syndrome, and / or loubert Syndrome. Vectors and nucleic acids according to this disclosure may be administered to the retina of a subject, for instance by subretinal injection.
[0037] This disclosure also relates to recombinant viral vectors comprising the nucleic acids described above, and to the use of such viral vectors in the treatment of disease. In some embodiments, one or more viral vectors encodes a Cas9, a first gRNA and a second gRNA for use in a method of altering a nucleotide sequence of a CEP 290 target position wherein (a) the first and second gRNAs are adapted to form first and second ribonucleoprotein complexes with the Cas9, and (b) the first and second ribonucleoprotein complexes are adapted to cleave first and second cellular nucleic acid sequences on first and second sides of a CEP290 target position, thereby altering a nucleotide sequence of the CEP290 target position. In use, the one or more recombinant viral vectors is contacted to the retina of a subject, for instance by subretinal injection.
[0038] Another aspect of this disclosure relates to AAV vectors, AAV vector genomes and / or nucleic acids that may be carried by AAV vectors, which encode one or more guide RNAs, each comprising a sequence selected from - or having at least 90% sequence identity to - one of SEQ ID NOS: 7 or 8 (corresponding RNA sequences in SEQ ID NOS: 24 and 25,respectively), a sequence encoding a Cas9 and a promoter sequence operably coupled to the Cas9 coding sequence, which promoter sequence comprises a sequence selected from - or having at least 90% sequence identity to - one of SEQ ID NOS: 13-15. The Cas9 coding sequence may comprise the sequence of SEQ ID NO: 10, or it may share at least 90% sequence identity therewith. Alternatively or additionally, the Cas9 coding sequence may encode an amino acid sequence comprising SEQ ID NO: 11, or sharing at least 90% sequence identity therewith. In certain embodiments, the AAV vector, vector genome or nucleic acid further comprises one or more of the following: left and right ITR sequences, optionally selected from - or having at least 90% sequence identity to - SEQ ID NOS: 16 and 17, respectively; and one or more U6 promoter sequences operably coupled to the one or more guide RNA sequences. The U6 promoter sequences may comprise, or share at least 90% sequence identity with, SEQ ID NO: 9.
[0039] This listing is intended to be exemplary and illustrative rather than comprehensive and limiting. Additional aspects and embodiments may be set out in, or apparent from, the remainder of this disclosure and the claims.DESCRIPTION OF THE DRAWINGS
[0040] This application contains at least one drawing executed in color. Copies of this application with color drawing(s) will be provided by the Office upon request and payment of the necessary fees.
[0041] The accompanying drawings exemplify certain aspects and embodiments of the present disclosure. The depictions in the drawings are intended to provide illustrative, and schematic rather than comprehensive, examples of certain aspects and embodiments of the present disclosure. The drawings are not intended to be limiting or binding to any particular theory or model, and are not necessarily to scale. Without limiting the foregoing, nucleic acids and polypeptides may be depicted as linear sequences, or as schematic, two- or three- dimensional structures; these depictions are intended to be illustrative, rather than limiting or binding to any particular model or theory regarding their structure.
[0042] FIGS. 1A-D include schematic depictions of exemplary AAV viral genomes according to certain embodiments of the disclosure. FIG. 1A shows an AAV genome for use in altering a CEP290 target position which encodes, inter alia, two guide RNAs having specific targeting domains selected from SEQ ID NOS: 1-3 and 4-6 and an 5. aureus Cas9. FIG. IB shows an AAV genome that may be used for a variety of applications, including without limitation the alteration of the CEP290 target position, encoding two guide RNAscomprising the sequences of SEQ ID NOS: 7 and / or 8 and an S', aureus Cas9. FIG. 1C shows an AAV genome encoding one or two guide RNAs, each driven by a U6 promoter, and an S. aureus Cas9. In the figure, N may be 1 or two. FIG. ID shows an AAV genome for use in altering a CEP290 target position which encodes two guide RNAs comprising SEQ ID NOs:l and 4 (DNA sequences) and an S. aureus Cas9. In certain embodiments, the AAV genome having the configuration illustrated in FIG. ID may comprise the sequence set forth in SEQ ID NO:26. In certain embodiments, the genome having the configuration illustrated in FIG. ID may comprise the sequence set forth in SEQ ID NO:27.
[0043] FIG. 2 illustrates the genome editing strategy implemented in certain embodiments of this disclosure.
[0044] FIG. 3 schematically depicts a gRNA used in certain embodiments of the disclosure.
[0045] FIGS. 4A-4C show the different tests used to measure Best Corrected Visual Acuity (BCVA) and FIG. 4D shows details about the Full Field Light Sensitivity Threshold (FST) study. Patients who were able to read letters were evaluated with Early Treatment Diabetic Retinopathy Study (ETDS) / Logarithm of the Minimum Angle of Resolution (LogMAR) Visual acuity shown in FIG. 4A, while patients unable to read letters were evaluated with the Lea Symbols 15-line pediatric eye chart shown in FIG. 4B. If patient’s BCVA test results were 20 / 800 equivalent (logMAR 1.6) or worse in at least one eye, patients were then assessed for low visual acuity using the Berkeley Rudimentary Visual Test (BRVT) shown in FIG. 4C. FIG. 4D shows the details related to the FST study.
[0046] FIG. 5 depicts the four different Ora Visual Navigation Courses (Ora-VNC™) with decreasing difficulty to assess relative levels of visual function. The courses have a logarithmic distribution of light levels which align with how BCVA is determined and is appropriate for the broad range of visual acuities (20 / 50 to LP) observed with LCA10. The most challenging course, the Low Contrast Visual Navigation Challenge (LCVNC), is shown on the left and includes a low contrast path with multiple turns, numerous obstacles, and 8 illumination levels. Patients able to pass the LCVNC course may obtain a visual navigation course score of 14 to 21. The least challenging course is the Backlit Room Exit (BRE), which includes an illuminated path, no turns, illuminated obstacles, and 2 illumination levels. Patients that pass the BRE course may obtain a visual navigation course score of 1 to 2.
[0047] FIGS. 6A-6C show efficacy data for 6 months (M6) for Subject 1 from Cohort 1 (low dose). FIG. 6A shows the results measuring BCVA (LogMAR). A reduction in the change in BCVA (LogMAR) from baseline indicates an improvement in BCVA (LogMAR). The solid line indicates the results for the Study Eye and the dashed line shows the results forthe Contralateral (CL) Eye. FIG. 6B shows results measuring the Full Field Light Sensitivity Threshold (FST). A reduction in the change of FST (Log cd / m2) indicates an increase in retinal sensitivity. The solid and dashed lines with triangles indicate the results for the Study Eye and Contralateral (CL) Eye, respectively, when presented with blue stimuli. The solid and dashed lines with circles indicate the results for the Study Eye and Contralateral CL) Eye, respectively, when presented with red stimuli. The solid and dashed lines with squares indicate the results for the Study Eye and Contralateral (CL) Eye, respectively, when presented with white stimuli. FIG. 6C shows the results measuring visual navigation. An increase in the change of mobility (Levels of Navigation Course) indicates that the subject has obtained a higher course level score (i.e., level that is more difficult), which indicates an improvement in navigation and mobility. The solid line indicates the results for the Study Eye and the dashed line shows the results for the Contralateral (CL) Eye.
[0048] FIGS. 7A and 7B show efficacy data for 9 months (M9) for Subject 2 from Cohort 1 (low dose). FIG. 7A shows the results measuring BCVA (LogMAR). A reduction in the change in BCVA (LogMAR) indicates an improvement in BCVA (LogMAR). The solid line indicates the results for the Study Eye and the dashed line shows the results for the Contralateral (CL) Eye. FIG. 7B shows the results measuring visual navigation. An increase in the change of mobility (Levels of Navigation Course) indicates that the subject has obtained a higher course level score (i.e., level that is more difficult), which indicates an improvement in navigation and mobility. The solid line indicates the results for the Study Eye and the dashed line shows the results for the Contralateral (CL) Eye.
[0049] FIGS. 8A-8C show efficacy data for 6 months (M6) for Subject 1 from Cohort 2 (mid dose). FIG. 8A shows an improvement in BCVA as a change in BCVA (LogMAR). The solid line indicates the results for the Study Eye and the dashed line shows the results for the Contralateral (CL) Eye. FIG. 8B shows results measuring the Full Field Light Sensitivity Threshold (FST). A reduction in the change of FST (Log cd / m2) indicates an increase in retinal sensitivity. The solid and dashed lines with triangles indicate the results for the Study Eye and Contralateral (CL) Eye, respectively, when presented with blue stimuli. The solid and dashed lines with circles indicate the results for the Study Eye and Contralateral (CL) Eye, respectively, when presented with red stimuli. The solid and dashed lines with squares indicate the results for the Study Eye and Contralateral (CL) Eye, respectively, when presented with white stimuli. FIG. 8C shows the results measuring visual navigation. An increase in the change of mobility (Levels of Navigation Course) indicates that the subject has obtained a higher course level score (i.e., level that is more difficult), which indicates animprovement in navigation and mobility. The solid line indicates the results for the Study Eye and the dashed line shows the results for the Contralateral (CL) Eye.
[0050] FIGS. 9A-9C show efficacy data for 3 months (M3) for Subject 2 from Cohort 2 (mid dose). FIG. 9A shows the results measuring BCVA (LogMAR). A reduction in the change in BCVA (LogMAR) indicates an improvement in BCVA (LogMAR). The solid line indicates the results for the Study Eye and the dashed line shows the results for the Contralateral (CL) Eye. FIG. 9B shows results measuring the Full Field Light Sensitivity Threshold (FST). A reduction in the change of FST (Log cd / m2) indicates an increase in retinal sensitivity. The solid and dashed lines with triangles indicate the results for the Study Eye and Contralateral (CL) Eye, respectively, when presented with blue stimuli. The solid and dashed lines with circles indicate the results for the Study Eye and Contralateral (CL) Eye, respectively, when presented with red stimuli. The solid and dashed lines with squares indicate the results for the Study Eye and Contralateral (CL) Eye, respectively, when presented with white stimuli. FIG. 9C shows the results measuring visual navigation. An increase in the change of mobility (Levels of Navigation Course) indicates that the subject has obtained a higher course level score (i.e., level that is more difficult), which indicates an improvement in navigation and mobility. The solid line indicates the results for the Study Eye and the dashed line shows the results for the Contralateral (CL) Eye.
[0051] FIGS. 10A-10C show efficacy data for 3 months (M3) for Subject 3 from Cohort 2 (mid dose). FIG. 10A shows the results measuring BCVA (LogMAR). A reduction in the change in BCVA (LogMAR) indicates an improvement in BCVA (LogMAR). The solid line indicates the results for the Study Eye and the dashed line shows the results for the Contralateral (CL) Eye. FIG. 10B shows results measuring the Full Field Light Sensitivity Threshold (FST). A reduction in the change of FST (Log cd / m2) indicates an increase in retinal sensitivity. The solid and dashed lines with triangles indicate the results for the Study Eye and Contralateral (CL) Eye, respectively, when presented with blue stimuli. The solid and dashed lines with circles indicate the results for the Study Eye and Contralateral (CL) Eye, respectively, when presented with red stimuli. The solid and dashed lines with squares indicate the results for the Study Eye and Contralateral (CL) Eye, respectively, when presented with white stimuli. FIG. 10C shows the results measuring visual navigation. An increase in the change of mobility (Levels of Navigation Course) indicates that the subject has obtained a higher course level score (i.e., level that is more difficult), which indicates an improvement in navigation and mobility. The solid line indicates the results for the Study Eye and the dashed line shows the results for the Contralateral (CL) Eye.
[0052] FIGS. 11A-11N show individual full field stimulus threshold (FST) change from baseline. Subjects who showed a positively trending outcome were Cohort 2 Subject 2; Cohort 2 Subject 5; Cohort 3 Subject 3, and Cohort 4 Subject 1. Subjects who had light perception BCVA at baseline were Cohort 1 Subject 2; Cohort 2 Subject 5; Cohort 3 Subject 3; and Cohort 4 Subject 1. Improved FST thresholds > 0.6 logCD / m2 were seen in four subjects. Of these, three out of four had visual acuity of light perception (LP) at baseline. One subject was unable to do the assessment. For FIGS. 11A-11L: the solid line with circles represents results for the study eye tested with red light, the solid line with squares represents results for the study eye tested with white light, the solid line with triangles represent results for the study eye tested with blue light, the dashed line with circles represents results for the contralateral eye tested with red light, the dashed line with squares represents results for the contralateral eye tested with white light, and the dashed line with triangles represents results for the contralateral eye tested with blue light. For FIGS. 11M and UN: the red solid line with squares represents results for the study eye tested with red light, the black solid line with squares represents results for the study eye tested with white light, the blue solid line with squares represents results for the study eye tested with blue light, the red dashed line with circles represents results for the contralateral eye tested with red light, the black dashed line with circles represents results for the contralateral eye tested with white light, and the blue dashed line with circles represents results for the contralateral eye tested with blue light.Subjects were analyzed at baseline, post-operative treatment (Post-Op) at month 3, Post-Op at month 6, Post-Op at month 9, Post-Op at month 12, and Post-Op at month 18. The direction of improved sensitivity is downward on the Y axis (negative value indicates improvement). Patient demographics are shown in Table 8.
[0053] FIGS. 12A-12C show the full field light sensitivity threshold (FST) white light mean change from baseline by cohort. The analysis of the three cohorts show a positive trend. For the mid-dose adult cohort, two out of five subjects reached a > 0.6 log threshold. For the high dose adult cohort, one out of four subjects reached the > 0.6 log threshold. The solid line represents results from the study eye and the dashed line represents results from the contralateral eye. Subjects were analyzed at baseline, Post-Op at month 3, Post-Op at month 6, Post-Op at month 9, and Post-Op at month 12. The direction of improved sensitivity is downward on the Y axis (negative value indicates improvement).
[0054] FIGS. 13A-13N show the individual best corrected visual acuity (BCVA) change from baseline. FDA criterion for clinically meaningful change is > 0.3 LogMAR. In addition to what is shown in FIG. 13L, Cohort 3 Subject 5 showed an improvement inBCVA of 0.7 logMAR in the Study Eye at month 3 (M3). Cohort 2 Subject 1 and Cohort 4 Subject 1 showed a positive outcome > 0.3 logMAR. Cohort 4 Subject l’s response is confounded by improvement in contralateral eye. Subjects who had light perception BCVA at baseline were Cohort 1 Subject 2, Cohort 2 Subject 5; Cohort 3 Subject 3; and Cohort 4 Subject 1. Cohort 2 Subject 1 and Cohort 4 Subject 1 were homozygous for the CEP290 IVS26 mutation. The direction of improved sensitivity is downward on the Y axis. The solid line with squares represents results from the study eye. The dashed line with circles represents results from the contralateral eye. Subjects were analyzed at baseline, Post-Op at month 3, Post-Op at month 6, Post-Op at month 9, Post-Op at month 12, and Post-Op at month 18. The direction of improved sensitivity is downward on the Y axis (negative value indicates improvement). Patient demographics are shown in Table 8.
[0055] FIGS. 14A-14C show the best corrected visual acuity (BCVA) mean change from baseline by cohort. The solid line represents results from the study eye. The dashed line represents results from the contralateral eye. Subjects were analyzed at baseline, Post-Op at month 3, Post-Op at month 6, Post-Op at month 9, Post-Op at month 12, and / or Post-Op at month 18. The direction of improved sensitivity is downward on the Y axis (negative value indicates improvement). Patient demographics are shown in Table 8.
[0056] FIGS. 15A-15N show the individual visual function navigational (VFN) score change from baseline. Improved VFN Scores of > 3 were seen in three subjects who were distributed evenly across the three doses and all improved to a more difficult course. Three subjects showed a positively trending outcome (three light level) (Cohort 1 Subject 2, Cohort 2 Subject 2, Cohort 3 Subject 3). One mid-dose adult (Cohort 2 Subject 1) improved up through month 9 (M9) (results were positively trending). One homozygous patient showed improvement (Cohort 2 Subject 1). Visual Navigation Course = VNC, Backlit Room Exit BRE, High Contrast Room Exit (HCRE), High Contrast Visual Navigation Challenge (HCVNC), Low Contrast Visual Navigation Challenge (LCVNC). VNC (light grey) = VNC passed with treated eye at baseline. VNC (dark grey) = VNC passed with treated eye at last visit. BRE (light grey) = BRE passed with treated eye at baseline. BRE (dark grey) = BRE passed with treated eye at last visit. HCRE (light grey) = HCRE passed with treated eye at baseline. HCRE (dark grey) = HCRE passed with treated eye at last visit. LCVNC (light grey) = LCVNC passed with treated eye at baseline. LCVNC (dark grey) = LCVNC passed with treated eye at last visit. HCVNC (light grey) = HCVNC passed with treated eye at baseline. HCVNC (dark grey) = HCVNC passed with treated eye at last visit. The light grey box in each of FIGS. 15A-15L shows the name of the most difficult course navigatedwith the study eye at Baseline. The dark grey box shows the name of the most difficult course navigated with the study eye at the most recent visit. The visual navigation composite (VNC) score is plotted in FIGS. 15A-15N. In addition to the information on the composite score change provided in the graphs, the names of the course show whether the subject was able to navigate a more difficult course. Solid line with squares represent results from the study eye. Dashed line with circles represent results from the contralateral eye. Triangles and dashed line represent results from both eyes. Three subjects have best corrected visual acuity of light perception (LP) at baseline (Cohort 1 Subject 2, Cohort 3 Subject 3, and Cohort 2 Subject 5). Subjects were analyzed at baseline, Post-Op at month 3, Post-Op at month 6, Post-Op at month 9, and Post-Op at month 12. Composite score (Y-axis) is based on the Ora Visual Navigation Courses (Ora- VNC™) (see FIG. 5). The direction of improved sensitivity is upward on the Y axis. Patient demographics are shown in Table 8.
[0057] FIGS. 16A-16C show the visual functional navigation (VFN) score mean change from baseline over time. The group analysis (based on cohort) shows a positive trend. Subjects were analyzed at baseline, Post-Op at month 3, Post-Op at month 6, Post-Op at month 9, and / or Post-Op at month 12. The solid line represents results from the study eye. The dashed line represents results from the contralateral eye. The direction of improved sensitivity is upward on the Y axis. Patient demographics are shown in Table 8.
[0058] FIGS. 17A-17N show individual National Eye Institute 25-Item Visual Function Questionnaire (VFQ-25) composite score change from baseline over time. Subjects were analyzed at baseline, Post-Op at month 3, Post-Op at month 6, Post-Op at month 9, Post-Op at month 12, and Post-Op at month 18. Cohort 1 Subject 2, Cohort 2 Subject 1, Cohort 2 Subject 3, Cohort 2 Subject 4, and Cohort 3 Subject 3 have minimal clinically important difference in all domains composite score change (defined as a 4 point-change) (see Minimal clinically important change defined according to Aflibercept (Eylea): Treatment of Neovascular (Wet) Age-Related Macular Degeneration (wAMD) [Internet]. Ottawa (ON): Canadian Agency for Drugs and Technologies in Health; 2015 Aug. Table 33, Validity and Minimal Clinically Important Differences of Outcome Measures. Available on the world wide web at ncbi.nlm.nih.gov / books / NB K349601 / table / T40 / #. Cohort 1 Subject 2, Cohort 2 Subject 1, Cohort 2 Subject 3, Cohort 2 Subject 4, Cohort 2 Subject 5, and Cohort 3 Subject 3 have minimal clinically important difference composite score change by four selected domains (selected domains: general vision, color vision, near vision, distance vision domains (see Table 9)). The direction of improved sensitivity is upward on the Y axis. The VFQcomposite score is shown on the Y axis for FIGS. 17A-17N. Patient demographics are shown in Table 8.
[0059] FIGS. 18A-18C show VFQ-25 composite score (CS) change for adult low and mid cohorts. Subjects were analyzed at baseline, Post-Op at month 3, Post-Op at month 6, PostOp at month 9, Post-Op at month 12, and / or Post-Op at month 18. The direction of improved sensitivity is upward on the Y axis. The VFQ composite score is shown on the Y axis. Patient demographics are shown in Table 8.
[0060] FIGS. 19A-19N show individual full field stimulus threshold (FST) change from baseline. Improved FST thresholds > 0.6 logCD / m2based on red light sensitivity were seen in 6 / 14 subjects: Cohort 2 Subject 2; Cohort 2 Subject 5; Cohort 3 Subject 3; Cohort 3 Subject 5; Cohort 4 Subject 1; and Cohort 4 Subject 2. Of these, three subjects had visual acuity of light perception (LP) at baseline: Cohort 2 Subject 5, Cohort 3 Subject 3, and Cohort 4 Subject 1. Two of the responders (Cohort 3 Subject 5, Cohort 4 Subject 1) showed >1 log unit improvements in sensitivity, close to the maximal possible improvement. In four of the six responders, improvements occurred by month 3. Both pediatric participants were responders. The solid light grey line represents results for the study eye tested with red light, the solid black line represents results for the study eye tested with white light, the solid medium grey line represent results for the study eye tested with blue light, the dashed light grey line represents results for the contralateral eye tested with red light, the dashed dark grey line represents results for the contralateral eye tested with white light, and the dashed medium grey line represents results for the contralateral eye tested with blue light. Subjects were analyzed at baseline, post-operative treatment (Post-Op) at month 3, Post-Op at month 6, Post-Op at month 9, Post-Op at month 12, and Post-Op at month 18. The direction of improved sensitivity is upward on the Y axis (negative value indicates improvement). Patient demographics are shown in Table 8.
[0061] FIGS. 20A-20N show the individual best corrected visual acuity (BCVA) change from baseline. FDA criterion for clinically meaningful change is > 0.3 LogMAR. Improved BCVA of > 0.3 LogMAR was seen in four subjects: Cohort 1 Subject 1; Cohort 2 Subject 1; Cohort 3 Subject 5; and Cohort 4 Subject 1. Three of four responders improved as early as month 3. Cohort 2 Subject 1 and Cohort 4 Subject 1 were homozygous for the CEP290 IVS26 mutation and showed improved BCVA of > 0.3 LogMAR. Cohort 3 Subject 5 had a further 0.3 LogMAR gain at month 6, and Cohort 1 Subject 1 demonstrated improvement at month 6 but was unable to attend subsequent visits. Cohort 2 Subject 1 had an additional 0.6 logMAR gain at month 12 which was sustained at month 18. The solid line with squaresrepresents results from the study eye. The dashed line with circles represents results from the contralateral eye. Subjects were analyzed at baseline, Post-Op at month 3, Post-Op at month 6, Post-Op at month 9, Post-Op at month 12, Post-Op at month 18, and Post-Op at month 24. The direction of improved sensitivity is upward on the Y axis (negative value indicates improvement). Patient demographics are shown in Table 8.
[0062] FIGS. 21A-21N show the individual visual function navigational (VFN) score change from baseline. Improved VFN Scores of > 3 were seen in five subjects who were distributed evenly across the three doses and all improved to a more difficult assessment: Cohort 1 Subject 2; Cohort 2 Subject 1; Cohort 2 Subject 2; Cohort 4 Subject 1; and Cohort 4 Subject 2. Cohort 2 Subject 1 was considered a responder despite having a change of 2 at month 12 (M12) because this subject had knee injury at the M12 visit, potentially confounding the M12 result. Therefore the responder decision was based on Cohort 2 Subject l’s month (M9) visit. Two responders navigated more complex courses compared with baseline and one demonstrated sustained improvement (up to two years). Both pediatric participants were responders. Visual Navigation Course = VNC, Backlit Room Exit BRE, High Contrast Room Exit (HCRE), High Contrast Visual Navigation Challenge (HCVNC), Low Contrast Visual Navigation Challenge (LCVNC). VNC (light grey) = VNC passed with treated eye at baseline. VNC (dark grey) = VNC passed with treated eye at last visit. BRE (light grey) = BRE passed with treated eye at baseline. BRE (dark grey) = BRE passed with treated eye at last visit. HCRE (light grey) = HCRE passed with treated eye at baseline. HCRE (dark grey) = HCRE passed with treated eye at last visit. LCVNC (light grey) = LCVNC passed with treated eye at baseline. LCVNC (dark grey) = LCVNC passed with treated eye at last visit. HCVNC (light grey) = HCVNC passed with treated eye at baseline. HCVNC (dark grey) = HCVNC passed with treated eye at last visit. The light grey box in each figure shows the name of the most difficult course navigated with the study eye at Baseline. The dark grey box shows the name of the most difficult course navigated with the study eye at the most recent visit. The visual navigation composite (VNC) mobility score is plotted in FIGS. 21A-21N. In addition to the information on the composite score change provided in the graphs, the names of the course show whether the subject was able to navigate a more difficult course. Solid line with squares represents results from the study eye. Dashed line with circles represents results from the contralateral eye. Triangles and dashed grey line represent results from both eyes. Subjects were analyzed at baseline, PostOp at month 3, Post-Op at month 6, Post-Op at month 9, Post-Op at month 12, Post-Op at month 18, and Post-Op at month 24. Composite score (Y-axis) is based on the Ora VisualNavigation Courses (Ora-VNC™) (see FIG. 5). The direction of improved sensitivity is upward on the Y axis. Patient demographics are shown in Table 8.
[0063] FIGS. 22A-22N show the individual vision-related quality of life (QoL) - change from baseline composite score. Improvement of > 4 points in composite score was seen in six subjects: Cohort 1 Subject 2; Cohort 2 Subject 3; Cohort 2 Subject 4; Cohort 2 Subject 5; Cohort 3 Subject 2; and Cohort 3 Subject 5. Subjects were analyzed at baseline (BL), PostOp at month 3, Post-Op at month 6, Post-Op at month 9, Post-Op at month 12, Post-Op at month 18, and Post-Op at month 24. Patient demographics are shown in Table 8.
[0064] FIGS. 23A-23B show the viral shedding assessed in tear samples collected from the treated eye and blood samples. FIG. 23A depicts tear samples collected from inside the lower eyelid of both the treated and untreated eye. The highest quantity of viral genomes was observed 2-days post AAV5-SEQ ID NO:27 administration and viral clearance was achieved by day 7 for most participants. FIG. 23B depicts blood samples collected 2-days post AAV5-SEQ ID NO:27 administration contained the highest observed quantity of viral genomes and viral clearance was achieved by day 7 for most participants. LoD, Limit of detection.
[0065] FIGS. 24A-24C show the assessment of the innate and adaptive immune response to AAV5 and SaCas9. FIG. 24A depicts the innate immune response to AAV5 and SaCas9 was assessed pre- and post AAV5-SEQ ID NO:27 administration. Most participants with a pre-existing innate immune response also had a post-treatment response. FIG. 24B depicts the adaptive immune response to AAV5 was assessed by measuring BAB levels pre- and post-AAV5-SEQ ID NO:27 administration. FIG. 24C depicts the adaptive immune response to AAV5 was assessed by measuring nAB levels pre- and post-AAV5-SEQ ID NO:27 administration. AAV, adeno- associated virus; BAB, binding antibodies; nAB, neutralizing antibody; NC, Not collected; SaCas9, Staphylococcus aureus Cas9.
[0066] FIGS. 25A-25C show the structural-functional relationships in treated CEP290 patients. FIG. 25A images show the retinal structure of two pediatric subjects dosed in Cohort (C) 4 (Subjects 1 and 2). En-face images (square panels on left for both the “Control eye” and “Study eye”) display near-infrared fundus autofluorescence (NIR-FAF) that originates mainly from retinal pigment epithelium (RPE) melanin. NIR-FAF images at month 6 (M6) have been co-registered to the baseline (BL) image of each eye to allow comparisons. Cross-sectional images (rectangular panels on right for both the “Control eye” and “Study eye”) are optical coherence tomography (OCT) scans along the horizontal meridian crossing the fovea. Lower signals in Subject 1 were caused by corneal scarring andcataracts resulting from eye pocking. Calibration bars are shown on the lower right. FIG. 25B depicts full-field stimulus testing (FST) sensitivities in the subjects related to predicted function. White and grey bars are FST sensitivities measured with a blue (467 nm) and red (637 nm) stimuli, respectively. Spectral sensitivity differences demonstrated both subjects show cone-mediated sensitivities. After treatment there was recovery of the cone-mediated sensitivities (diagonal arrows), which at 6 months post-treatment fell close to the normal limits (horizontal dashed line) as predicted from the preservation of the central cone photoreceptors in both patients. FIG. 25C depicts improvement in FST sensitivities plotted as a function of the baseline dark-adapted cone-sensitivity loss. Dashed line represents the cut-off for FST efficacy. Symbols represent low- (Cl, SI), mid- (C2, SI; C2, S2; C2, S3; C2, S4; C2, S5; C4, S I; C4, S2) and high-dose (C3, SI; C3, S2; C3, S3; C3, S4; C3, S5) groups; unfilled symbols represent untreated control eyes.DETAILED DESCRIPTIONDefinitions and Abbreviations
[0067] Unless otherwise specified, each of the following terms has the meaning set forth in this section.
[0068] The indefinite articles "a" and "an" denote at least one of the associated noun, and are used interchangeably with the terms "at least one" and "one or more." For example, the phrase "a module" means at least one module, or one or more modules.
[0069] The conjunctions "or" and "and / or" are used interchangeably.
[0070] ' 'Domain" is used to describe a segment of a protein or nucleic acid. Unless otherwise indicated, a domain is not required to have any specific functional property.
[0071] An "indel" is an insertion and / or deletion in a nucleic acid sequence. An indel may be the product of the repair of a DNA double strand break, such as a double strand break formed by a genome editing system of the present disclosure. An indel is most commonly formed when a break is repaired by an "error prone" repair pathway such as the NHEJ pathway described below. Indels are typically assessed by sequencing (most commonly by "next-gen" or "sequencing-by-synthesis" methods, though Sanger sequencing may still be used) and are quantified by the relative frequency of numerical changes (e.g., ±1, ±2 or more bases) at a site of interest among all sequencing reads. DNA samples for sequencing can be prepared by a variety of methods known in the art, and may involve the amplification of sites of interest by polymerase chain reaction (PCR) or the capture of DNA ends generated bydouble strand breaks, as in the GUIDEseq process described in Tsai 2016 (incorporated by reference herein). Other sample preparation methods are known in the art. Indels may also be assessed by other methods, including in situ hybridization methods such as the FiberComb™ system commercialized by Genomic Vision (Bagneux, France), and other methods known in the art.
[0072] " CEP290 target position" and "CEP290 target site" are used interchangeably herein to refer to a nucleotide or nucleotides in or near the CEP290 gene that are targeted for alteration using the methods described herein. In certain embodiments, a mutation at one or more of these nucleotides is associated with a CEP290 associated disease. The terms "CEP290 target position" and "CEP290 target site" are also used herein to refer to these mutations. For example, the IVS26 mutation is one non-limiting embodiment of a CEP290 target position / target site.
[0073] ' 'Non-homologous end joining" or "NHEJ" as used herein refers to ligation mediated repair and / or non- template mediated repair including canonical NHEJ (cNHEJ), alternative NHEJ (altNHEJ), microhomology -mediated end joining (MMEJ) and synthesis-dependent microhomology-mediated end joining (SD-MMEJ).
[0074] "Replacement" or "replaced" as used herein with reference to a modification of a molecule does not require a process limitation but merely indicates that the replacement entity is present.
[0075] "Subject" means a human, mouse, or non-human primate. A human subject can be any age (e.g., an infant, child, young adult, or adult), and may suffer from a disease, or may be in need of alteration of a gene.
[0076] " Treat," "treating," and "treatment" as used herein mean the treatment of a disease in a subject (e.g., a human subject), including one or more of inhibiting the disease, i.e., arresting or preventing its development or progression; relieving the disease, i.e., causing regression of the disease state; relieving one or more symptoms of the disease; and curing the disease.
[0077] " Prevent," "preventing," and "prevention" as used herein means the prevention of a disease in a subject, e.g., in a human, including (a) avoiding or precluding the disease; (b) affecting the predisposition toward the disease; (c) preventing or delaying the onset of at least one symptom of the disease.
[0078] The terms "polynucleotide", "nucleotide sequence", "nucleic acid", "nucleic acid molecule", "nucleic acid sequence", and "oligonucleotide" refer to a series of nucleotide bases (also called "nucleotides") in DNA and RNA, and mean any chain of two or morenucleotides. The polynucleotides can be chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, its hybridization parameters, etc. A nucleotide sequence typically carries genetic information, including the information used by cellular machinery to make proteins and enzymes. These terms include double- or single-stranded genomic DNA, RNA, any synthetic and genetically manipulated polynucleotide, and both sense and antisense polynucleotides. This also includes nucleic acids containing modified bases.
[0079] Conventional IUPAC notation is used in nucleotide sequences presented herein, as shown in Table 1, below (see also Cornish-Bowden 1985, incorporated by reference herein). It should be noted, however, that "T" denotes "Thymine or Uracil" insofar as a given sequence (such as a gRNA sequence) may be encoded by either DNA or RNA.Table 1: IUPAC nucleic acid notation
[0080] The terms "protein," "peptide" and "polypeptide" are used interchangeably to refer to a sequential chain of amino acids linked together via peptide bonds. The terms include individual proteins, groups or complexes of proteins that associate together, as well as fragments, variants, derivatives and analogs of such proteins. Peptide sequences are presented using conventional notation, beginning with the amino or N-terminus on the left, and proceeding to the carboxyl or C-terminus on the right. Standard one-letter or three-letter abbreviations may be used.Overview
[0081] In certain aspects, the present disclosure focuses on AAV vectors encoding CRISPR / Cas9 genome editing systems, and on the use of such vectors to treat CEP290 associated disease. Exemplary AAV vector genomes are schematized in FIGS. 1A through ID, which illustrates certain fixed and variable elements of these vectors: inverted terminal repeats (ITRs), one or two gRNA sequences and promoter sequences to drive their expression, a Cas9 coding sequence and another promoter to drive its expression. Each of these elements is discussed in detail below.
[0082] Turning first to the gRNA pairs utilized in the nucleic acids or AAV vectors of the present disclosure, one of three "left" or "upstream" guides may be used to cut upstream (between exon 26 and the IVS26 mutation), and one of three "right" or "downstream" guides is used to cut downstream (between the IVS26 mutation and exon 27). Targeting domain sequences of these guides are presented in Table 2, below:Table 2: Upstream (left) and Downstream (right) gRNA Targeting Domain Sequences
[0083] The left and right guides can be used in any combination, though certain combinations may be more suitable for certain applications. Table 3 sets forth several upstream + downstream guide pairs used in the embodiments of this disclosure. It should be noted, notwithstanding the use of "left" and "right" as nomenclature for gRNAs, that any guide in a pair, upstream or downstream, may be placed in either one of the gRNA coding sequence positions illustrated in FIG. 1.Table 3: Upstream (Left) + Downstream (Right) Guide Pairs
[0084] In some embodiments, the gRNAs used in the present disclosure are derived from S. aureus gRNAs and can be unimolecular or modular, as described below. An exemplary unimolecular 5. aureus gRNA is shown in FIG. 3, and exemplary DNA and RNA sequences corresponding to unimolecular .S'. aureus gRNAs are shown below:DNA: [Nl 16- Z4 - GTTTTAGTACTCTGGAAA -CAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGATTTTTT (SEQ ID NO: 7) andRNA: INI 16-24GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGU UUAUCUCGUCAACUUGUUGGCGAGAUUUUUU (SEQ ID NO: 24).DNA: -* [ -N]L„lo-24GTTATAGTACTCTGGAAACAGAATCTACTATAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGATTTTTT (SEQ ID NO: 8) andRNA: IN 116-24GUUAUAGUACUCUGGAAACAGAAUCUACUAUAACAAGGCAAAAUGCCGUGU UUAUCUCGUCAACUUGUUGGCGAGAUUUUUU (SEQ ID NO: 25).It should be noted that, while the figure depicts a targeting domain of 20 nucleotides, the targeting domain can have any suitable length. gRNAs used in the various embodiments of this disclosure preferably include targeting domains of between 16 and 24 (inclusive) bases in length at their 5’ ends, and optionally include a 3’ U6 termination sequence as illustrated.
[0085] The gRNA in FIG. 3 is depicted as unimolecular, but in some instances modular guides can be used. In the exemplary unimolecular gRNA sequences above, a 5 ’ portion corresponding to a crRNA (underlined) is connected by a GAAA linker to a 3’ portion corresponding to a tracrRNA (double underlined). Skilled artisans will appreciate that two-part modular gRNAs can be used that correspond to the underlined and double underlined sections.
[0086] Either one of the gRNAs presented above can be used with any of targeting sequences 1-6, and two gRNAs in a pair do not necessarily include the same backbone sequence. Additionally, skilled artisans will appreciate that the exemplary gRNA designs set forth herein can be modified in a variety of ways, which are described below or are known in the art; the incorporation of such modifications is within the scope of this disclosure.
[0087] Expression of each of the gRNAs in the AAV vector is driven by a pair of U6 promoters, such as a human U6 promoter. An exemplary U6 promoter sequence, as set forth in Maeder, is presented below:AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATAC GATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGA TATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGT TTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATT TCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC (SEQ ID NO: 9).
[0088] Turning next to Cas9, in some embodiments the Cas9 protein is 5. aureus Cas9. In further embodiments of this disclosure an .S', aureus Cas9 sequence is modified to include two nuclear localization sequences (NLSs) at the C- and N-termini of the Cas9 protein, and a mini-polyadenylation signal (or Poly-A sequence). Exemplary 5. aureus Cas9 sequences (both nucleotide and peptide) are shown below.Table 4: s«Cas9 SequencesThese sequences are exemplary in nature, and are not intended to be limiting. The skilled artisan will appreciate that modifications of these sequences may be possible or desirable in certain applications; such modifications are described below, or are known in the art, and are within the scope of this disclosure.
[0089] Skilled artisans will also appreciate that polyadenylation signals are widely used and known in the art, and that any suitable polyadenylation signal can be used in the embodiments of this disclosure. One exemplary polyadenylation signal is set forth below: TAGCAATAAAGGATCGTTTATTTTCATTGGAAGCGTGTGTTGGTTTTTTGATCAGG CGCG (SEQ ID NO: 12).
[0090] Cas9 expression is driven, in certain vectors of this disclosure, by one of three promoters: cytomegalovirus (CMV), elongation factor- 1 (EFS), or human g-protein receptor coupled kinase-1 (hGRKl), which is specifically expressed in retinal photoreceptor cells. Nucleotide sequences for each of these promoters are provided in Table 5. Modifications of these sequences may be possible or desirable in certain applications, and such modifications are within the scope of this disclosure.Table 5: Cas9 Promoter SequencesAAV genomes according to the present disclosure generally incorporate inverted terminal repeats (ITRs) derived from the AAV2 serotype. Exemplary left and right ITRs are presented in Table 6. It should be noted, however, that numerous modified versions of the AAV2 ITRs are used in the field, and the ITR sequences shown below are exemplary and are not intended to be limiting. Modifications of these sequences are known in the art, or will be evident to skilled artisans, and are thus included in the scope of this disclosure.Table 6: AAV2 ITR Sequences
[0091] As FIG. 1 illustrates, the gRNA pairs and the Cas9 promoter are variable and can be selected from the lists presented above. For clarity, this disclosure encompasses nucleic acids and / or AAV vectors comprising any combination of these elements, though certain combinations may be preferred for certain applications. Accordingly, in various embodiments of this disclosure, a nucleic acid or AAV vector encodes a CMV promoter for the Cas9, and gRNAs comprising targeting domains according to SEQ ID NOS: 1 and 4; a CMV promoter and gRNAs comprising targeting domains according to SEQ ID NOS : 1 and 5; a CMV promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 1 and 6; a CMV promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 2 and 4; a CMV promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 2 and 5; a CMV promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 2 and 6; a CMV promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 3 and 4; a CMV promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 3 and 5; a CMV promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 3 and 6; an EFS promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 1 and 4; an EFS promoter andgRNAs comprising targeting domains according to SEQ ID NOS: 1 and 5; an EFS promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 1 and 6; an EFS promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 2 and 4; an EFS promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 2 and 5; an EFS promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 2 and 6; an EFS promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 3 and 4; an EFS promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 3 and 5; an EFS promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 3 and 6; an hGRKl promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 1 and 4; an hGRKl promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 1 and 5; an hGRKl promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 1 and 6; an hGRKl promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 2 and 4; an hGRKl promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 2 and 5; an hGRKl promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 2 and 6; an hGRKl promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 3 and 4; an hGRKl promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 3 and 5; or an hGRKl promoter and gRNAs comprising targeting domains according to SEQ ID NOS: 3 and 6.
[0092] In various embodiments, the nucleic acid or AAV vector encodes the following: left and right AAV2 ITR sequences, a first U6 promoter to drive expression of a first guide RNA having a sequence selected from SEQ ID NOS: 7 and 8 (corresponding RNA sequences in SEQ ID NOs: 24, and 25, respectively) and / or comprising a targeting domain sequence according to one of SEQ ID NOS: 1-3 (corresponding RNA sequences in SEQ ID NOs: 18- 20, respectively), a second U6 promoter to drive expression of a second guide RNA comprising a sequence selected from SEQ ID NOS: 7 and 8 and / or comprising a targeting domain sequence according to one of SEQ ID NOS: 4-6 (corresponding RNA sequences in SEQ ID NOs: 21-23, respectively), and a CMV promoter to drive expression of an 5. aureus Cas9 encoded by SEQ ID NO: 10; or left and right AAV2 ITR sequences, a first U6 promoter to drive expression of a first guide RNA having a sequence selected from SEQ ID NOS: 7 and 8 and / or comprising a targeting domain sequence according to one of SEQ ID NOS: 1-3, a second U6 promoter to drive expression of a second guide RNA comprising a sequence selected from SEQ ID NOS: 7 and 8 and / or comprising a targeting domain sequence according to one of SEQ ID NOS: 4-6, and an hGRK promoter to drive expression of an .S'.aureus Cas9 encoded by SEQ ID NO: 10; or left and right AAV2 ITR sequences, a first U6 promoter to drive expression of a first guide RNA having a sequence selected from SEQ ID NOS: 7 and 8 and / or comprising a targeting domain sequence according to one of SEQ ID NOS: 1-3, a second U6 promoter to drive expression of a second guide RNA comprising a sequence selected from SEQ ID NOS: 7 and 8 and / or comprising a targeting domain sequence according to one of SEQ ID NOS: 4-6, and an EFS promoter to drive expression of an .S'. aureus Cas9 encoded by SEQ ID NO: 10.
[0093] In some embodiments, the nucleic acid or AAV vector shares at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater sequence identity with one of the nucleic acids or AAV vectors recited above.
[0094] It should be noted that these sequences described above are exemplary, and can be modified in ways that do not disrupt the operating principles of elements they encode. Such modifications, some of which are discussed below, are within the scope of this disclosure. Without limiting the foregoing, skilled artisans will appreciate that the DNA, RNA or protein sequences of the elements of this disclosure may be varied in ways that do not interrupt their function, and that a variety of similar sequences that are substantially similar (e.g., greater than 90%, 95%, 96%, 97%, 98% or 99% sequence similarity, or in the case of short sequences such as gRNA targeting domains, sequences that differ by no more than 1, 2 or 3 nucleotides) can be utilized in the various systems, methods and AAV vectors described herein. Such modified sequences are within the scope of this disclosure.
[0095] The AAV genomes described above can be packaged into AAV capsids (for example, AAV5 capsids), which capsids can be included in compositions (such as pharmaceutical compositions) and / or administered to subjects. An exemplary pharmaceutical composition comprising an AAV capsid according to this disclosure can include a pharmaceutically acceptable carrier such as balanced saline solution (BSS) and one or more surfactants (e.g., Tween 20) and / or a thermosensitive or reverse-thermosensitive polymer (e.g., pluronic). Other pharmaceutical formulation elements known in the art may also be suitable for use in the compositions described here.
[0096] Compositions comprising AAV vectors according to this disclosure can be administered to subjects by any suitable means, including without limitation injection, for example, subretinal injection. The concentration of AAV vector within the composition is selected to ensure, among other things, that a sufficient AAV dose is administered to the retina of the subject, taking account of dead volume within the injection apparatus and the relatively limited volume that can be safely administered to the retina. Suitable doses mayinclude, for example, 1x1011viral genomes (vg) / mL, 2x1011vg / mL, 3x1011vg / mL, 4x1011vg / mL, 5x1011vg / mL, 6x1011vg / mL, 7x1011vg / mL, 8x1011vg / mL, 9x1011vg / mL, Ix1012vg / mL, 2x1012vg / mL, 3x1012vg / mL, 4x1012vg / mL, 5x1012vg / mL, 6x1012vg / mL, 7x1012vg / mL, 8x1012vg / mL, 9x1012vg / mL, 1x1013vg / mL, 2x1013vg / mL, 3x1013vg / mL, 4x1013vg / mL, 5x1013vg / mL, 6x1013vg / mL, 7x1013vg / mL, 8x1013vg / mL, or 9x1013vg / mL. For example, in certain of these embodiments, suitable doses may include, without limitation, 9-Ox1011vg / mL, 9.1x1011vg / mL, 9.2x1011vg / mL, 9.3x1011vg / mL, 9.4x1011vg / mL, 9.5x1011vg / mL, 9.6x1011vg / mL, 9.7x1011vg / mL, 9.8x1011vg / mL, 9.9x 1011vg / mL, LOx1012vg / mL, 1.1x1012vg / mL, L2x1012vg / mL, L3x1012vg / mL, L4x1012vg / mL, L5x1012vg / mL, L6x1012vg / mL, 1.7x1012vg / mL, L8x1012vg / mL, L9x1012vg / mL, 2.0x1012vg / mL, 2. Ix1012vg / mL, 2.2x1012vg / mL, 2.3x1012vg / mL, 2.4x1012vg / mL, 2.5x1012vg / mL, 2.6x1012vg / mL, 2.7x1012vg / mL, 2.8x1012vg / mL, 2.9x1012vg / mL, 3.0x1012vg / mL, etc. In another example, in certain of these embodiments, suitable doses may include Ix1011vg / mL to 2x1011vg / mL, 2x1011vg / mL to 3x1011vg / mL, 3x1011vg / mL to 4x1011vg / mL, 4x1011vg / mL to 5x1011vg / mL, 5x1011vg / mL to 6x1011vg / mL, bx1011vg / mL to 7x1011vg / mL, 7x1011vg / mL to 8x1011vg / mL, 8x1011vg / mL to 9x1011vg / mL, 9x1011vg / mL to 1x1012vg / mL, Ix1012vg / mL to 2x1012vg / mL, 2x1012vg / mL to 3x1012vg / mL, 3x1012vg / mL to 4x1012vg / mL, 4x1012vg / mL to 5x1012vg / mL, 5x1012vg / mL to 6x1012vg / mL, 6x1012vg / mL to 7x1012vg / mL, 7x1012vg / mL to 8x1012vg / mL, 8x1012vg / mL to 9x1012vg / mL, 9x1012vg / mL to 1x1013vg / mL, IxlO13vg / mL to 2x1013vg / mL, 2x1013vg / mL to 3x1013vg / mL, 3x1013vg / mL to 4x1013vg / mL, 4x1013vg / mL to 5x1013vg / mL, 5x1013vg / mL to 6x1013vg / mL, 6x1013vg / mL to 7x1013vg / mL, 7x1013vg / mL to 8x1013vg / mL, or 8x1013vg / mL to 9x1013vg / mL. In certain embodiments, the total amount of AAV vector received by the subject may include between about 9.0x1010vg to about 10x1012vg AAV vector. For example, in certain embodiments, the total amount of AAV vector received by the subject may include 9x1010vg, 1x1011vg, 2x1011vg, 3x1011vg, 4x1011vg, 5x1011vg, 6x1011vg, 7x1011vg, 8x1011vg, 9x1011vg, Ix1012vg. In another example, in certain embodiments, the total amount of AAV vector received by the subject may include 9.0x1010vg, 9.1x1010vg, 9.2x1010vg, 9.3x1010vg, 9.4x1010vg, 9.5x1010vg, 9.6x1010vg, 9.7x1010vg, 9.8x1010vg, 9.9x1010vg, LOx1011vg, 1.1x1011vg, 1.2x1011vg, 1.3x1011vg, 1.4x1011vg, 1.5x1011vg, 1.6x1011vg, 1.7x1011vg,1.8x1011vg, 1.9x1011vg, 2.0x1011vg, 2.1x1011vg, 2.2x1011vg, 2.3x1011vg, 2.4x1011vg,2.5x1011vg, 2.6x1011vg, 2.7x1011vg, 2.8x1011vg, 2.9x1011vg, 3.0x1011vg, etc. In another example, in certain of these embodiments, the total amount of AAV vector received by the subject may include to 9x1010vg to Ix1011vg, Ix1011vg to 2x1011vg, 2x1011vg to 3x1011vg, 3x1011vg to 4x1011vg, 4x1011vg to 5x1011vg, 5x1011vg to 6x1011vg, 6x1011vg to 7x1011vg, 7x1011vg to 8x1011vg, 8x1011vg to 9x1011vg, 9x1011vg to Ix1012vg AAV vector. Any suitable volume of the composition may be delivered to the subretinal space. In some instances, the volume is selected to form a bleb in the subretinal space, for example 1 microliter, 10 microliters, 50 microliters, 100 microliters, 150 microliters, 200 microliters, 250 microliters, 300 microliters, etc. The subject may be administered the AAV vector as a single dose or multiple doses. For example, the subject may be administered one, two, three, four, five, six, seven, eight, nine, ten, etc. doses.
[0097] Any region of the retina may be targeted, though the fovea (which extends approximately 1 degree out from the center of the eye) may be preferred in certain instances due to its role in central visual acuity and the relatively high concentration of cone photoreceptors there relative to peripheral regions of the retina. Alternatively or additionally, injections may be targeted to parafoveal regions (extending between approximately 2 and 10 degrees off center), which are characterized by the presence of all three types of retinal photoreceptor cells. In addition, injections into the parafoveal region may be made at comparatively acute angles using needle paths that cross the midline of the retina. For instance, injection paths may extend from the nasal aspect of the sclera near the limbus through the vitreal chamber and into the parafoveal retina on the temporal side, from the temporal aspect of the sclera to the parafoveal retina on the nasal side, from a portion of the sclera located superior to the cornea to an inferior parafoveal position, and / or from an inferior portion of the sclera to a superior parafoveal position. The use of relatively small angles of injection relative to the retinal surface may advantageously reduce or limit the potential for spillover of vector from the bleb into the vitreous body and, consequently, reduce the loss of the vector during delivery. In other cases, the macula (inclusive of the fovea) can be targeted, and in other cases, additional retinal regions can be targeted, or can receive spillover doses.
[0098] For pre-clinical development purposes, systems, compositions, nucleotides and vectors according to this disclosure can be evaluated ex vivo using a retinal explant system, or in vivo using an animal model such as a mouse, rabbit, pig, nonhuman primate, etc. Retinal explants are optionally maintained on a support matrix, and AAV vectors can be delivered by injection into the space between the photoreceptor layer and the support matrix, to mimic subretinal injection. Tissue for retinal explantation can be obtained from human or animal subjects, for example mouse.
[0099] Explants are particularly useful for studying the expression of gRNAs and / or Cas9 following viral transduction, and for studying genome editing over comparatively shortintervals. These models also permit higher throughput than may be possible in animal models, and can be predictive of expression and genome editing in animal models and subjects. Small (mouse, rat) and large animal models (such as rabbit, pig, dog, cat, nonhuman primate) can be used for pharmacological and / or toxicological studies and for testing the systems, nucleotides, vectors and compositions of this disclosure under conditions and at volumes that approximate those that will be used in clinic. Because model systems are selected to recapitulate relevant aspects of human anatomy and / or physiology, the data obtained in these systems will generally (though not necessarily) be predictive of the behavior of AAV vectors and compositions according to this disclosure in human and animal subjects.
[0100] While the foregoing exemplary embodiments have focused on guide RNAs, nucleic acids and AAV vectors targeted to the CEP290 gene, it will be appreciated by those of skill in the art that the nucleic acids and vectors of this disclosure may be used in the editing of other gene targets and the treatment of other diseases such as hereditary retinopathies that may be treated by editing of genes other than CEP290. FIGS. IB, 1C, and ID illustrate three exemplary AAV vectors that may be used to transduce retinal cells, including without limitation retinal photoreceptor cells such as rod photoreceptors and / or cone photoreceptors, and / or other retinal cell types. The AAV genome of FIG. IB comprises two guide RNAs according to SEQ ID NOS: 7 and / or 8, and a promoter sequence according to one of SEQ ID NOS: 13-15 driving expression of an 5. aureus Cas9 comprising one or two nuclear localization signals and, optionally, a polyadenylation signal. The vector may additionally include ITRs such as AAV2 ITRs, or other sequences that may be selected for the specific application to which the vector will be employed. As is shown in FIG. 1C, other vectors within the scope of this disclosure may include only 1 guide RNA. Thus, in specific embodiments, an AAV genome of this disclosure may encode a CMV promoter for the Cas9 and one guide RNA having a sequence comprising, or sharing at least 90% sequence identity with, a sequence selected from SEQ ID NOS: 7 and 8; a CMV promoter for the Cas9 and two guide RNAs, each having a sequence comprising, or sharing at least 90% sequence identity with, a sequence selected from SEQ ID NOS: 7 and 8; an hGRK promoter for the Cas9 and one guide RNA having a sequence comprising, or sharing at least 90% sequence identity with, a sequence selected from SEQ ID NOS: 7 and 8; an hGRK promoter for the Cas9 and two guide RNAs, each having a sequence comprising, or sharing at least 90% sequence identity with, a sequence selected from SEQ ID NOS: 7 and 8; an EFS promoter for the Cas9 and one guide RNA having a sequence comprising, or sharing at least 90% sequence identitywith, a sequence selected from SEQ ID NOS: 7 and 8; an EFS promoter for the Cas9 and two guide RNAs, each having a sequence comprising, or sharing at least 90% sequence identity with, a sequence selected from SEQ ID NOS: 7 and 8. As is shown in Fig. ID, vectors within the scope of this disclosure may comprise two guide RNAs comprising SEQ ID NOS: 1 and 4 (DNA sequences), and a hGRKl promoter sequence (e.g., according to SEQ ID NO: 15) driving expression of an S', aureus Cas9 comprising one or two nuclear localization signals and, optionally, a polyadenylation signal. The AAV genome may comprise SEQ ID NO:26 or SEQ ID NO:27.
[0101] The sequence of SEQ ID NO:26 is set forth below: gcggccgcgg ttcctcagat ctgaattcgg taccaaggtc gggcaggaag agggcctact 60 tcccatgatt ccttcatatt tgcatatacg atacaaggct gttagagaga taattagaat 120 taatttgact gtaaacacaa agatattagt acaaaatacg tgacgtagaa agtaataact 180 tcttgggtag tttgcagctt taaaattatg ttttaaaatg gactatcata tgcttaccgt 240 aacttgaaag tatttcgatt tcttggcttt atatatcttg tggaaaggac gaaacaccgt 300 tctgtcctca gtaaaaggta gttatagtac tctggaaaca gaatctacta taacaaggca 360 aaatgccgtg tttatctcgt caacttgttg gcgagatttt ttcgacttag ttcgatcgaa 420 ggaaggtcgg gcaggaagag ggcctatttc ccatgattcc ttcatatttg catatacgat 480 acaaggctgt tagagagata attagaatta atttgactgt aaacacaaag atattagtac 540 aaaatacgtg acgtagaaag taataatttc ttgggtagtt tgcagtttta aaattatgct 600 tcaaaatgga ctatcatatg cttaccgtaa cttgaaagta tttcgatttc ttggctttat 660 acatcttgtg gaaaggacga aacaccgtca aaagctaccg gttacctggt tatagtaccc 720 tggaaacaga atctactata acaaggcaaa atgccgtgtt tatctcgtca acttgttggc 780 gagatttttt ggtaccgcta gcgcttaagt cgcgaagggc cccagaagcc tggtggttgt 840 tcgtccttct caggggaaaa gtgaggcggc cccttggagg aaggggccgg gcagaatgat 900 ccaatcggat tccaagcagc tcaggggatt gtctttttct agcaccttct tgccactcct 960 aagcgLccLc cglgaccccg gcLgggaLLL agccL.ggL.gc Lg Lg Lcagcc ccggLclccc 1020 aggggcttcc cagtggtccc caggaaccct cgacagggcc cggtctctct cgtccagcaa 1080 gggcagggac gggccacagg ccaagggctc tagaggatcc ggtactcgag gaactgaaaa 1140 accagaaagt taactggcaa gtttagtctt tttgtctttt atttcaggtc ccggatccgg 1200 tggtggtgca aatcaaagaa ctgctcctca gtggatgttg cctttacttc taggcctgca 1260 cggaagtgtt acgcggccgc caccatggga ccgaagaaaa agcgcaaggt cgaagcgtcc 1320 acgaaaagga actacatcct ggggctggac atcgggatta caagcgtggg gtatgggact 1380 actgactatg aaacaaggga cgtgatcgac gcaggcgtca gactgttcaa ggaggccaac 1440 gcggaaaaca atgagggacg gagaagcaag aggggagcca ggcgcctgaa acgacggaga 1500 aggcacagaa tccagagggt gaagaaactg ctgttcgatt acaacctgct gaccgaccat 1560 tctgagctga gtggaatcaa tccttatgaa gccagggtga aaggcctgag tcagaagccg 1620 tcagaggaag agttttccgc agctctgctg cacctggcta agcgccgagg agtgcataac 1680 gccaatgagg tggaagagga caccggcaac gagctgtcta caaaggaaca gatctcacgc 1740 aatagcaaag ctctggaaga gaagtatgtc gcagagctgc agctggaacg gctgaagaaa 1800gatggcgagg tgagagggtc aattaatagg ttcaagacaa gcgactacgt caaagaagcc 1860 aagcagctgc tgaaagtgca gaaggcttac caccagctgg atcagagctt catcgatact 1920 tatatcgacc tgctggagac tcggagaacc tactatgagg gaccaggaga agggagcccc 1980 tacggatgga aagacatcaa ggaatggtac gagatgctga tgggacattg cacctattat 2040 ccagaagagc tgagaagcgt caagtacgct tataacgcag atctgtacaa cgccctgaat 2100 gacctgaaca acctggtcat caccagggat gaaaacgaga aactggaata ctatgagaag 2160 taccagatca tcgaaaacgt gtttaagcag aagaaaaagc ctacactgaa acagattgct 2220 aaggagatcc tggtcaacga agaggacatc aagggctacc gggtgacaag cactggaaaa 2280 ccagagttca ccaatctgaa agtgtatcac gatattaagg acatcacagc acggaaagaa 2340 aacattgaga acgccgaact gctggatcag attgctaaga tcctgactat ctaccagagc 2400 Lccgaggaca Lccaggaaga gclgacLaac c Lgaacagcg agcLgaccca ggaagagaac 2460 gaacagatta gtaatctgaa ggggtacacc ggaacacaca acctgtccct gaaagctaac 2520 aatctgattc tggatgagct gtggcataca aacgacaatc agattgcaat ctttaaccgg 2580 cagaagctgg tcccaaaaaa ggtggacctg agtcagcaga aagagatccc aaccacacag 2640 gaggacgatt tcattctgtc acccgtggtc aagcggagct tcatccagag catcaaagag 2700 aacaacgcca tcatcaagaa gtacggcctg cccaatgata tcattatcga gctggctagg 2760 gagaagaaca gcaaggacgc acagaagatg atcaatgaga tgcagaaacg aaaccggcag 2820 accaatgaac gcattgaaga gattatccga actaccggga aagagaacgc aaagtaccag 2880 aatgaaaaaa tcaagctgca cgatatgcag gagggaaagt gtctgtattc tctggaggcc 2940 aaccccctgg aggacctgct gaacaatcca ttcaactacg aggtcgatca tattatcccc 3000 agaagcgtgt ccttcgacaa ttcctttaac aacaaggtgc tggtcaagca ggaagagaac 3060 tctaaaaagg gcaataggac tcctttccag tacctgtcta gttcagattc caagatctct 3120 tacgaaacct ttaaaaagca cattctgaat ctggccaaag gaaagggccg catcagcaag 3180 accaaaaagg agtacctgct ggaagagcgg gacatcaaca gattctccgt ccagaaggat 3240 tatattaacc ggaatctggt ggacacaaga tacgctactc gcggcctgat gaatctgcag 3300 cgatcctatt tccgggtgaa caatctggat gtgaaagtca agtccatcaa cggcgggtac 3360 acatcttttc tgaggcgcaa atggaagttt aaaaaggagc gcaacaaagg gtacaagcac 3420 catgccgaag atgctctgat tatcgcaaat gccgacttca tctttaagga gtggaaaaag 3480 caggacaaag ccaagaaagt gatggagaac cagatgttcg aagagaagca ggccgaatct 3540 aagcccgaaa tcgagacaga acaggagtac aaggagattt tcatcactcc tcaccagaac 3600 aagcatatca aggatttcaa ggactacaag tactctcacc gggtggataa aaagcccaac 3660 agagagctga tcaatgacac cctgtatagt acaagaaaag acgataaggg gaatacccag 3720 aatgtgaaca atctgaacgg actgtacgac aaagataatg acaagctgaa aaagctgaac 3780 aacaaaag Lc ccgagaagc L gclgalgLac caccaLgaLc cLcagacaLa Lcagaaacag 3840 aagctgatta tggagcagta cggcgacgag aagaacccac tgtataagta ctatgaagag 3900 actgggaact acctgaccaa gtatagcaaa aaggataatg gccccgtgat caagaagaac 3960 aagtactatg ggaacaagct gaatgcccat ctggacatca cagacgatta ccctaacagt 4020 cgcaacaagg tggtcaagct gtcactgaag ccatacagat tcgatgtcta tctggacaac 4080 ggcgtgtata aatttgtgac tgtcaagaat ctggatgtca tcaaaaagga gaactactat 4140 gaagtgaata gcaagtgcta cgaagaggct aaaaagctga aaaagattag caaccaggca 4200 gagttcatcg cctccttata caacaacgac ctgattaaga tcaatggcga actgtatagg 4260gccatcgggg tgaacaacga tctgctgaac cgcattgaag tgaatatgat tgacatcact 4320 taccgagagt atctggaaaa catgaatgat aagcgccccc ctcgaattat caaaacaart 4380 gcctctaaga ctcagagcat caaaaagtac tcaaccgaca ttctgggaaa cctgtatgag 4440 gcgaagagca aaaagcaccc tcagattatc aaaaagggcg gatcccccaa gaagaagagg 4500 aaagtctcga gctagcaata aaggatcgtt tattttcatt ggaagcgtgt gttggtttct 4560 tgatcaggcg cgtccaagct tgcatgctgg ggagagatct gcggccgc(SEQ ID NO:26)
[0102] The features of SEQ ID NO:26 include the following: spacer (nucleotides 16 to 34); U6 promoter (SEQ ID NO:9) (nucleotides 35 to 298); -S'. aureus gRNA w / targeting domain of CEP290-323 (nucleotides 299 to 402); U6 promoter (SEQ ID NO:9) (nucleotides 423 to 686); S', aureus gRNA w / targeting domain of CEP290-64 (nucleotides 687 to 790); hGRKl promoter (SEQ ID NO: 15) (nucleotides 817 to 1108); SV40 splice donor (SD) / splice acceptor (SA) site (nucleotides 1109 to 1272); consensus Kozak sequence (nucleotides 1276 to 1288); SV40 nuclear localization signal (NLS) (nucleotides 1291 to 1311); codon- optimized S. aureus Cas9 (SEQ ID NO: 10) (nucleotides 1321 to 4479); SV40 nuclear localization signal (NLS) (nucleotides 4486 to 4506); mini polyA (SEQ ID NO: 12)(nucleotides 4513 to 4572).
[0103] The sequence of SEQ ID NO:27 is set forth below: cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgcc 60 gggcgacctt Lggtcgcccg gccL.cagL.ga gcgagcgagc gcgcagagag ggagtggcca 120 actccatcac taggggtccc tgcggccgcg gttcctcaga tctgaattcg gtaccaaggt 180 cgggcaggaa gagggcccat ttcccatgat tccttcatat ttgcatatac gatacaaggc 240 tgttagagag ataattagaa ttaatttgac tgtaaacaca aagatattag tacaaaatac 300 gcgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 360 ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatcct 420 gcggaaagga cgaaacaccg ttctgtcctc agtaaaaggt agttatagta ctctggaaac 480 agaatctact ataacaaggc aaaatgccgt gtttatctcg tcaacttgtt ggcgagatct 540 tctcgactta gttcgatcga aggaaggtcg ggcaggaaga gggcctattt cccatgatcc 600 cctcatattt gcatatacga tacaaggctg ttagagagat aattagaatt aatttgaccg 660 taaacacaaa gatattagta caaaatacgt gacgtagaaa gtaataattt cttgggtagt 720 tcgcagtttt aaaattacgt tttaaaatgg actatcatat gcttaccgta acttgaaagt 780 acttcgattt cttggctcta tatatcttgt ggaaaggacg aaacaccgtc aaaagctacc 840 ggttacctgg ttatagtact ctggaaacag aatctactat aacaaggcaa aatgccgtgt 900 tratct.cgtc aacttgtcgg cgagattttt tggtaccgct agcgcttaag tcgcgaaggg 960 ccccagaagc ctggtggctg tttgtccttc tcaggggaaa agtgaggcgg ccccttggag 1020 gaaggggccg ggcagaacga tctaatcgga ttccaagcag ctcaggggat tgtcttttcc 1080 tagcaccttc ttgccacccc taagcgtcct ccgtgacccc ggctgggatt tagcctggcg 1140 ccgtgtcagc cccggtcccc caggggcttc ccagtggtcc ccaggaaccc tcgacagggc 1200 ccggtctctc tcgtccagca agggcaggga cgggccacag gccaagggct ctagaggacc 1260 cggtactcga ggaactgaaa aaccagaaag ttaactggta agtttagtct ttttgtcttt 1320tatttcaggt cccggatccg gtggtggtgc aaatcaaaga actgctcctc agtggatgat 1380 gcctttactt ctaggccagt acggaagtgt tacgcggccg ccaccatggg accgaagaaa 1440 aagcgcaagg tcgaagcgtc catgaaaagg aactacattc tggggctgga catcgggaat 1500 acaagcgtgg ggtatgggat tattgactat gaaacaaggg acgtgatcga cgcaggcgac 1560 agactgttca aggaggccaa cgtggaaaac aatgagggac ggagaagcaa gaggggagcc 1620 aggcgcctga aacgacggag aaggcacaga atccagaggg tgaagaaact gctgttcgat 1680 tacaacctgc tgaccgacca ttctgagctg agtggaatta atccttatga agccagggag 1740 aaaggcctga gtcagaagct gtcagaggaa gagttttccg cagctctgct gcacctggct 1800 aagcgccgag gagtgcaaaa cgtcaatgag gtggaagagg acaccggcaa cgagctgtct 1860 acaaaggaac agatctcacg caatagcaaa gctctggaag agaagtatgt cgcagagcag 1920 cagcLggaac ggc Lgaagaa agaLggcgag g Lgagaggg L caal LaaLag g L Lcaagaca 1980 agcgactacg tcaaagaagc caagcagctg ctgaaagtgc agaaggctta ccaccagcag 2040 gatcagagct tcatcgaaac ttatatcgac ctgctggaga ctcggagaac ctactatgag 2100 ggaccaggag aagggagccc cttcggatgg aaagacatca aggaatggta cgagatgcag 2160 aagggacatt gcacctaatt tccagaagag ctgagaagcg tcaagtacgc ttataacgca 2220 gatctgtaca acgccctgaa tgacctgaac aacctggtca tcaccaggga tgaaaacgag 2280 aaactggaat actatgagaa gttccagatc atcgaaaacg tgtttaagca gaagaaaaag 2340 cctacactga aacagatagc taaggagatc ctggtcaacg aagaggacat caagggctac 2400 cgggtgacaa gcactggaaa accagagttc accaatctga aagtgtatca cgatattaag 2460 gacatcacag cacggaaaga aatcattgag aacgccgaac tgctggatca gattgctaag 2520 aacctgacta tctaccagag ctccgaggac atccaggaag agctgactaa cctgaacagc 2580 gagctgaccc aggaagagat cgaacagatt agtaatctga aggggtacac cggaacacac 2640 aacctgtccc tgaaagcaat caatctgatt ctggatgagc tgtggcatac aaacgacaat 2700 cagattgcaa tctttaaccg gctgaagctg gtcccaaaaa aggtggacct gagtcagcag 2760 aaagagatcc caaccacact ggtggacgat ttcattctgt cacccgtggt caagcggagc 2820 tacatccaga gcatcaaagt gatcaacgcc atcatcaaga agtacggcct gcccaatgat 2880 aacattatcg agctggcaag ggagaagaac agcaaggacg cacagaagat gatcaatgag 2940 aagcagaaac gaaaccggca gaccaatgaa cgcattgaag agattatccg aactaccggg 3000 aaagagaacg caaagtacct gattgaaaaa atcaagctgc acgatatgca ggagggaaag 3060 tgtctgtatt ctctggaggc catccccctg gaggacctgc tgaacaatcc attcaactac 3120 gaggtcgatc atattatccc cagaagcgtg tccttcgaca attcctttaa caacaaggag 3180 caggtcaagc aggaagagaa ctctaaaaag ggcaatagga ctcctttcca gtacctgtct 3240 agttcagatt ccaagatctc ttacgaaacc tttaaaaagc acattctgaa tctggccaaa 3300 ggaaagggcc gcaLcagcaa gaccaaaaag gag Lacc Lgc Lggaagagcg ggacalcaac 3360 agattctccg tccagaagga ttttattaac cggaatctgg tggacacaag atacgctact 3420 cgcggcctga tgaatctgct gcgatcctat ttccgggtga acaatctgga tgtgaaagac 3480 aagtccatca acggcgggtt cacatctttt ctgaggcgca aatggaagtt taaaaaggag 3540 cgcaacaaag ggtacaagca ccatgccgaa gatgctctga ttatcgcaaa tgccgactac 3600 aactttaagg agtggaaaaa gctggacaaa gccaagaaag tgatggagaa ccagatgtac 3660 gaagagaagc aggccgaatc tatgcccgaa atcgagacag aacaggagta caaggagaat 3720 tacatcactc ctcaccagat caagcatatc aaggatttca aggactacaa gtactctcac 3780cgggtggata aaaagcccaa cagagagctg atcaatgaca ccctgtatag tacaagaaaa 3840 gacgataagg ggaataccct gattgtgaac aatctgaacg gactgtacga caaagataat 3900 gacaagctga aaaagctgat caacaaaagt cccgagaagc tgctgatgta ccaccatgat 3960 cctcagacat atcagaaact gaagctgatt atggagcagt acggcgacga gaagaaccca 4020 cagtataagt actatgaaga gactgggaac tacctgacca agtatagcaa aaaggataat 4080 ggccccgtga tcaagaagat caagtactat gggaacaagc tgaatgccca tctggacaac 4140 acagacgatt accctaacag tcgcaacaag gtggtcaagc tgtcactgaa gccatacaga 4200 tacgatgtct atctggacaa cggcgtgtat aaatttgtga ctgtcaagaa tctggatgac 4260 aacaaaaagg agaactacta tgaagtgaat agcaagtgct acgaagaggc taaaaagcag 4320 aaaaagatta gcaaccaggc agagttcatc gcctcctttt acaacaacga cctgattaag 4380 aacaaLggcg aacLgLaaag ggLcaLcggg gLgaacaaLg aLcLgcLgaa ccgcaLLgaa 4440 gagaatatga ttgacatcac ttaccgagag tatctggaaa acatgaatga taagcgcccc 4500 cctcgaatta tcaaaacaat tgcctctaag actcagagta tcaaaaagta ctcaaccgac 4560 aatctgggaa acctgtaaga ggtgaagagc aaaaagcacc ctcagattat caaaaagggc 4620 ggatccccca agaagaagag gaaagtctcg agctagcaat aaaggatcgt ttattttcat 4680 tggaagcgtg tgttggtatt ttgatcaggc gcgtccaagc ttgcatgctg gggagagaac 4740 tgcggccgca ggaaccccta gtgatggagt tggccactcc ctctctgcgc gctcgctcgc 4800 tcactgaggc cgggcgacca aaggtcgccc gacgcccggg ctttgcccgg gcggcctcag 4860 tgagcgagcg agcgcgcagc tgcctgcagg (SEQ ID NO: 27)
[0104] The features of SEQ ID NO:27 include the following: AAV2 inverted terminal repeat (ITR) (nucleotides 1 to 141); spacer (nucleotides 157 to 175); U6 promoter (SEQ ID NO:9) (nucleotides 176 to 439); -S', aureus gRNA w / targeting domain of CEP290-323 (nucleotides 440 to 543); U6 promoter (SEQ ID NO:9) (nucleotides 564 to 827); 5. aureus gRNA w / targeting domain of CEP290-64 (nucleotides 828 to 931); hGRKl promoter (SEQ ID NO: 15) (nucleotides 958 to 1249); SV40 splice donor (SD) / splice acceptor (SA) site (nucleotides 1250 to 1413); consensus Kozak sequence (nucleotides 1417 to 1429); SV40 nuclear localization signal (NLS) (nucleotides 1432 to 1452); codon-optimized 5. aureus Cas9 (SEQ ID NO: 10) (nucleotides 1462 to 4620); SV40 nuclear localization signal(NLS) (nucleotides 4627 to 4647); mini polyA (SEQ ID NO: 12) (nucleotides 4654 to 4713); and AAV2 inverted terminal repeat (ITR) (nucleotides 4750 to 4890).Methods of treating
[0105] In certain aspects, this disclosure relates to methods of treating a subject having LCA10 comprising administering to the subject a nucleic acid encoding a Cas9, a first gRNA and a second gRNA, each gRNA targeted to a CEP290 gene of the subject to treat the subject. In certain embodiments, the subject may be an adult subject. In certain embodiments, the subject may be a pediatric subject (i.e., 3-17 years old). In certain embodiments, the subject may be homozygous for the C.2991+1655A to G mutation in theCEP290 gene. In certain embodiments, the nucleic acid may be an AAV vector. In certain embodiments, the AAV vector may be administered to the subject at a concentration of about 6.0x1011vg / ml, about l.lx1012vg / ml, or about 3.0 x1012. In certain embodiments, the subject may receive from about 9.Ox1010vg to about l.Ox1012vg of the AAV vector. In certain embodiments, the subject may be administered a single dose of the nucleic acid. In certain embodiments, treating may comprise increasing the subject’s visual navigation after administration of the nucleic acid to the subject. In certain embodiments, the subject’s visual navigation may be measured using visual navigation courses. In certain embodiments, increasing the subject’s visual navigation may comprise an increase of one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or twenty one levels of the subject’s visual function navigation course level score after administration of the nucleic acid to the subject compared to the subject’s visual function navigation course level score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s visual navigation may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0106] In certain embodiments, treating may comprise reducing the subject’s Logarithm of the Minimum Angle of Resolution (LogMAR) measurement of best corrected visual acuity (BCVA) after administration of the nucleic acid to the subject. In certain embodiments, reducing the subject’s LogMAR measurement of BCVA may comprise a reduction of about 1% to about 100% (e.g., about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s LogMAR measurement of BCVA prior to administration of the nucleic acid to the subject. In certain embodiments, reducing the subject’s LogMAR measurement of BCVA may comprise a reduction of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4,1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2., 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5,3.6, 3.7, 3.8, 3.9, or 4.0 of the subject’s LogMAR measurement of BCVA prior toadministration of the nucleic acid to the subject. In certain embodiments, reducing the subject’s LogMAR measurement of BCVA may occur and / or be assayed about I week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0107] In certain embodiments, treating may comprise increasing the subject’s dark-adapted visual sensitivity after administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s dark-adapted visual sensitivity may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s dark-adapted visual sensitivity after administration of the nucleic acid to the subject compared to the subject’s dark-adapted visual sensitivity prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s dark-adapted visual sensitivity after administration of the nucleic acid to the subject may comprise reducing the subject’s full field light sensitivity threshold (FST) (Log cd / m2). In certain embodiments, the subject’s FST (Log cd / m2) may be reduced by 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2., 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, or 4.0 of the subject’s Log cd / m2 measurement of FST prior to administration of the nucleic acid to the subject. In certain embodiments, the subject’s dark-adapted visual sensitivity is measured using one or more of the group selected from blue light, white light, and red light. In certain embodiments, increasing the subject’s dark-adapted visual sensitivity may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0108] In certain embodiments, treating may comprise increasing the subject’s pupillary response after administration of the nucleic acid to the subject. In certain embodiments, the increase in the subject’s pupillary response may be measured by the change in pupil diameter in response to a light stimulus. In certain embodiments, increasing the subject’s pupillary response may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s pupillary response after administration of the nucleic acid to the subject compared to the subject’s pupillary response prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s pupillary response may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0109] In certain embodiments, treating may comprise increasing the subject’s macula thickness after administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s macula thickness may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s macula thickness after administration of the nucleic acid to the subject compared to the subject’s macula thickness prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s macula thickness may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0110] In certain embodiments, treating may comprise increasing the subject’s contrast sensitivity after administration of the nucleic acid to the subject. In certain embodiments, the increase in the subject’s contrast sensitivity may be measured using a Pelli-Robson chart. In certain embodiments, increasing the subject’s contrast sensitivity may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s contrast sensitivity after administration of the nucleic acid to the subject compared to the subject’s contrast sensitivity prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s contrast sensitivity may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0111] In certain embodiments, treating may comprise increasing the subject’s macular sensitivity after administration of the nucleic acid to the subject. In certain embodiments, the increase in the subject’s macular sensitivity may be measured using microperimetry. In certain embodiments, the increase in the subject’s macular sensitivity may be measured using a visual field test measuring the amount of light perceived in specific parts of the macula. In certain embodiments, increasing the subject’s macular sensitivity comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s macular sensitivity after administration of the nucleic acid to the subject compared to the subject’s macular sensitivity prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s macular sensitivity may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months,about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0112] In certain embodiments, treating may comprise increasing the subject’s color vision score after administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s color vision score may be measured using a Farnsworth 15 score. In certain embodiments, increasing the subject’s color vision score comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s color vision score after administration of the nucleic acid to the subject compared to the subject’s color vision score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s color vision score may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0113] In certain embodiments, treating may comprise increasing the subject’s Quality of Life (QOL) score after administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s QOL score may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s QOL score after administration of the nucleic acid to the subject compared to the subject’s QOL score prior to administration of the nucleic acid to the subject. In certain embodiments, the subject’s BCVA may be worse than 1.0 LogMAR in both eyes. In certain embodiments, the QOL score may be measured using the Impact of Vision Impairment for Very Low Vision. In certain embodiments, the subject’s BCVA may be 1.0 LogMAR or better in both eyes. In certain embodiments, the QOL score may be measured using the Impact of Vision Impairment. In certain embodiments, increasing the subject’s QOL score may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months,about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0114] In certain embodiments, treating may comprise increasing the subject’s National Eye Institute 25-Item Visual Function Questionnaire (VFQ-25) score. In certain embodiments, the VFQ-25 score is an all domains composite score. In certain embodiments, the VFQ-25 score is a selected domains (e.g., general vision, color vision, near vision, and / or distance vision domains) score. In certain embodiments, increasing the subject’s VFQ-25 score may comprise an increase of about 1 point, about 2 points, about 3 points, about 4 points, about 5 points, about 6 points, about 7 points, about 8 points, about 9 points, about 10 points, about 11 points, about 12 points, about 13 points, about 14 points, or about 15 points of the subject’s VFQ-25 score after administration of the nucleic acid to the subject compared to the subject’s VFQ-25 score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s VFQ-25 score may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0115] In certain embodiments, treating may comprise increasing the subject’s visual field after administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s visual field may be measured using kinetic perimetry. In certain embodiments, increasing the subject’s visual field may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s visual field after administration of the nucleic acid to the subject compared to the subject’s visual field prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s visual field may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months,about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0116] In certain embodiments, treating may comprise increasing the subject’s Patient Global Impressions of Change score after administration of the nucleic acid to the subject. In certain embodiments, the Patient Global Impressions of Change score may be for severity (e.g., PGIC-S). In certain embodiments, the Patient Global Impressions of Change score may be for function (e.g., PGIC-F). In certain embodiments, increasing the subject’s Patient Global Impressions of Change score may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s Patient Global Impressions of Change score after administration of the nucleic acid to the subject compared to the subject’s Patient Global Impressions of Change score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s Patient Global Impressions of Change score may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0117] In certain embodiments, treating may comprise increasing the subject’s gaze tracking after administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s gaze tracking may comprise an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100%) of the subject’s gaze tracking after administration of the nucleic acid to the subject compared to the subject’s gaze tracking prior to administration of the nucleic acid to the subject. In certainembodiments, increasing the subject’s gaze tracking may occur and / or be assayed about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0118] In certain embodiments, treating may comprise increasing the subject’s vision related quality of life (PRO) as measured by Visual Function Navigation (VFQ)ZChildren’ s Visual Function Questionnaire (CVFQ) score after administration of the nucleic acid to the subject compared to the subject’s VFQ / CVFQ score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s PRO may comprise an increase of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 points of the subject’s VFQ / CVFQ score after administration of the nucleic acid to the subject compared to the subject’s VFQ / CVFQ score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s PRO may comprise an increase of > 4, > 5, > 10, > 15, > 20, > 25, > 30, > 35, > 40 points of the subject’s VFQ / CVFQ score after administration of the nucleic acid to the subject compared to the subject’s VFQ / CVFQ score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s PRO may comprise an increase of 4 to 10, 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40 points of the subject’s VFQ / CVFQ score after administration of the nucleic acid to the subject compared to the subject’s VFQ / CVFQ score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s PRO may occur about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
[0119] In certain embodiments, treating may comprise increasing the subject’s visual function navigation (VFN) composite score compared to the subject’s VFN composite scoreprior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s VFN composite score may comprise an increase of 1, 2, 3, 4, 5, 6, 7, or 8 compared to the subject’s VFN composite score prior to administration of the nucleic acid to the subject. In certain embodiments, wherein increasing the subject’s VFN composite score comprises an increase of 1 to 4, 2 to 5, 3 to 6, 4 to 7, or 5 to 8, compared to the subject’s VFN composite score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s VFN composite score may comprise an increase of > 3, > 4, > 5, > 6, > 7, or > 8 compared to the subject’s VFN composite score prior to administration of the nucleic acid to the subject. In certain embodiments, increasing the subject’s VFN composite score may occur about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.Genome editing systems
[0120] The term "genome editing system" refers to any system having RNA-guided DNA editing activity. Genome editing systems of the present disclosure include at least two components adapted from naturally occurring CRISPR systems: a gRNA and an RNA-guided nuclease. These two components form a complex that is capable of associating with a specific nucleic acid sequence in a cell and editing the DNA in or around that nucleic acid sequence, for example by making one or more of a single-strand break (an SSB or nick), a double-strand break (a DSB) and / or a base substitution.
[0121] Naturally occurring CRISPR systems are organized evolutionarily into two classes and five types (Makarova 2011, incorporated by reference herein), and while genome editing systems of the present disclosure may adapt components of any type or class of naturally occurring CRISPR system, the embodiments presented herein are generally adapted from Class 2, and type II or V CRISPR systems. Class 2 systems, which encompass types II and V, are characterized by relatively large, multidomain RNA-guided nuclease proteins (e.g., Cas9 or Cpfl) that form ribonucleoprotein (RNP) complexes with gRNAs. gRNAs, which are discussed in greater detail below, can include single crRNAs in the case of Cpfl or duplexed crRNAs and tracrRNAs in the case of Cas9. RNP complexes, in turn, associate with (i.e., target) and cleave specific loci complementary to a targeting (or spacer) sequence of thecrRNA. Genome editing systems according to the present disclosure similarly target and edit cellular DNA sequences, but differ significantly from CRISPR systems occurring in nature. For example, the unimolecular gRNAs described herein do not occur in nature, and both gRNAs and RNA-guided nucleases according to this disclosure can incorporate any number of non-naturally occurring modifications.
[0122] Genome editing systems can be implemented in a variety of ways, and different implementations may be suitable for any particular application. For example, a genome editing system is implemented, in certain embodiments, as a protein / RNA complex (a ribonucleoprotein, or RNP), which can be included in a pharmaceutical composition that optionally includes a pharmaceutically acceptable carrier and / or an encapsulating agent, such as a lipid or polymer micro- or nano-particle, micelle, liposome, etc. In other embodiments, a genome editing system is implemented as one or more nucleic acids encoding the RNA- guided nuclease and gRNA components described above (optionally with one or more additional components); in still other embodiments, the genome editing system is implemented as one or more vectors comprising such nucleic acids, for example a viral vector such as an AAV; and in still other embodiments, the genome editing system is implemented as a combination of any of the foregoing. Additional or modified implementations that operate according to the principles set forth herein will be apparent to the skilled artisan and are within the scope of this disclosure.
[0123] It should be noted that the genome editing systems of the present invention can be targeted to a single specific nucleotide sequence, or can be targeted to — and capable of editing in parallel — two or more specific nucleotide sequences through the use of two or more gRNAs. The use of two or more gRNAs targeted to different sites is referred to as "multiplexing" throughout this disclosure, and can be employed to target multiple, unrelated target sequences of interest, or to form multiple SSBs and / or DSBs within a single target domain and, in some cases, to generate specific edits within such target domain. For example, this disclosure and Maeder both describe a genome editing system for correcting a point mutation (C.2991+1655A to G) in the human CEP290 gene that results in the creation of a cryptic splice site, which in turn reduces or eliminates the function of the gene. The genome editing system of Maeder utilizes two gRNAs targeted to sequences on either side of (i.e., flanking) the point mutation, and forms DSBs that flank the mutation. This, in turn, promotes deletion of the intervening sequence, including the mutation, thereby eliminating the cryptic splice site and restoring normal gene function.
[0124] As another example, International Patent Publication No. W02016 / 073990 by Cotta-Ramusino et al. ("Cotta-Ramusino"), incorporated by reference herein, describes a genome editing system that utilizes two gRNAs in combination with a Cas9 nickase (a Cas9 that makes a single strand nick such as S. pyogenes D10A), an arrangement termed a "dualnickase system." The dual-nickase system of Cotta-Ramusino is configured to make two nicks on opposite strands of a sequence of interest that are offset by one or more nucleotides, which nicks combine to create a double strand break having an overhang (5 ’ in the case of Cotta-Ramusino, though 3’ overhangs are also possible). The overhang, in turn, can facilitate homology directed repair events in some circumstances. And, as another example, International Patent Publication No. W02015 / 070083 by Zhang et al., incorporated by reference herein, describes a gRNA targeted to a nucleotide sequence encoding Cas9 (referred to as a "governing" gRNA), which can be included in a genome editing system comprising one or more additional gRNAs to permit transient expression of a Cas9 that might otherwise be constitutively expressed, for example in some virally transduced cells. These multiplexing applications are intended to be exemplary, rather than limiting, and the skilled artisan will appreciate that other applications of multiplexing are generally compatible with the genome editing systems described here.
[0125] Genome editing systems can, in some instances, form double strand breaks that are repaired by cellular DNA double-strand break mechanisms such as non-homologous end joining (NHEJ), or homology directed repair (HDR). These mechanisms are described throughout the literature (see, e.g., Davis 2014 (describing Alt- HDR), Frit 2014 (describing Alt-NHEJ), and lyama 2013 (describing canonical HDR and NHEJ pathways generally), all of which are incorporated by reference herein).
[0126] Where genome editing systems operate by forming DSBs, such systems optionally include one or more components that promote or facilitate a particular mode of double-strand break repair or a particular repair outcome. For example, Cotta-Ramusino also describes genome editing systems in which a single stranded oligonucleotide "donor template" is added; the donor template is incorporated into a target region of cellular DNA that is cleaved by the genome editing system, and can result in a change in the target sequence.
[0127] In other cases, genome editing systems modify a target sequence, or modify expression of a gene in or near the target sequence, without causing single- or double-strand breaks. For example, a genome editing system can include an RNA-guided nuclease / cytidine deaminase fusion protein, and can operate by generating targeted C-to-A substitutions. Suitable nuclease / deaminase fusions are described in Komor 2016, which is incorporated byreference. Alternatively, a genome editing system can utilize a cleavage-inactivated (i.e., a "dead") nuclease, such as a dead Cas9, and can operate by forming stable complexes on one or more targeted regions of cellular DNA, thereby interfering with functions involving the targeted region(s) such as mRNA transcription and chromatin remodeling.Guide RNA (gRNA)
[0128] The terms guide RNA and gRNA refer to any nucleic acid that promotes the specific association (or "targeting") of an RNA-guided nuclease such as a Cas9 or a Cpfl to a target sequence such as a genomic or episomal sequence in a cell. gRNAs can be unimolecular (comprising a single RNA molecule, and referred to alternatively as chimeric), or modular (comprising more than one, and typically two, separate RNA molecules, such as a crRNA and a tracrRNA, which are usually associated with one another, for example by duplexing). gRNAs and their component parts are described throughout the literature (see, e.g., Briner 2014, which is incorporated by reference; see also Cotta-Ramusino).
[0129] In bacteria and archea, type II CRISPR systems generally comprise an RNA-guided nuclease protein such as Cas9, a CRISPR RNA (crRNA) that includes a 5’ region that is complementary to a foreign sequence, and a trans-activating crRNA (tracrRNA) that includes a 5’ region that is complementary to, and forms a duplex with, a 3’ region of the crRNA. While not intending to be bound by any theory, it is thought that this duplex facilitates the formation of — and is necessary for the activity of — the Cas9 / gRNA complex. As type II CRISPR systems were adapted for use in gene editing, it was discovered that the crRNA and tracrRNA could be joined into a single unimolecular or chimeric gRNA, for example by means of a four nucleotide (e.g., GAAA) "tetraloop" or "linker" sequence bridging complementary regions of the crRNA (at its 3’ end) and the tracrRNA (at its 5’ end) (Mali 2013; Jiang 2013; Jinek 2012; all incorporated by reference herein).
[0130] gRNAs, whether unimolecular or modular, include a targeting domain that is fully or partially complementary to a target domain within a target sequence, such as a DNA sequence in the genome of a cell where editing is desired. In certain embodiments, this target sequence encompasses or is proximal to a CEP290 target position. Targeting domains are referred to by various names in the literature, including without limitation "guide sequences" (Hsu 2013, incorporated by reference herein), "complementarity regions" (Cotta-Ramusino), "spacers" (Briner 2014), and generically as "crRNAs" (Jiang 2013). Irrespective of the names they are given, targeting domains are typically 10-30 nucleotides in length, preferably 16-24 nucleotides in length (for example, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides inlength), and are at or near the 5’ terminus of in the case of a Cas9 gRNA, and at or near the 3’ terminus in the case of a Cpfl gRNA.
[0131] In addition to the targeting domains, gRNAs typically (but not necessarily, as discussed below) include a plurality of domains that influence the formation or activity of gRNA / Cas9 complexes. For example, as mentioned above, the duplexed structure formed by first and secondary complementarity domains of a gRNA (also referred to as a repeat: antirepeat duplex) interacts with the recognition (REC) lobe of Cas9 and may mediate the formation of Cas9 / gRNA complexes (Nishimasu 2014; Nishimasu 2015; both incorporated by reference herein). It should be noted that the first and / or second complementarity domains can contain one or more poly- A tracts, which can be recognized by RNA polymerases as a termination signal. The sequence of the first and second complementarity domains are, therefore, optionally modified to eliminate these tracts and promote the complete in vitro transcription of gRNAs, for example through the use of A-G swaps as described in Briner 2014, or A-U swaps. These and other similar modifications to the first and second complementarity domains are within the scope of the present disclosure.
[0132] Along with the first and second complementarity domains, Cas9 gRNAs typically include two or more additional duplexed regions that are necessary for nuclease activity in vivo but not necessarily in vitro (Nishimasu 2015). A first stem-loop near the 3’ portion of the second complementarity domain is referred to variously as the "proximal domain," (Cotta-Ramusino) "stem loop 1" (Nishimasu 2014; Nishimasu 2015) and the "nexus" (Briner 2014). One or more additional stem loop structures are generally present near the 3’ end of the gRNA, with the number varying by species: .S', pyogenes gRNAs typically include two 3’ stem loops (for a total of four stem loop structures including the repeat:anti-repeat duplex), while s. aureus and other species have only one (for a total of three). A description of conserved stem loop structures (and gRNA structures more generally) organized by species is provided in Briner 2014.
[0133] Skilled artisans will appreciate that gRNAs can be modified in a number of ways, some of which are described below, and these modifications are within the scope of disclosure. For economy of presentation in this disclosure, gRNAs may be presented by reference solely to their targeting domain sequences. gRNA modifications
[0134] The activity, stability, or other characteristics of gRNAs can be altered through the incorporation of chemical and / or sequential modifications. As one example, transiently expressed or delivered nucleic acids can be prone to degradation by, e.g., cellular nucleases.Accordingly, the gRNAs described herein can contain one or more modified nucleosides or nucleotides which introduce stability toward nucleases. While not wishing to be bound by theory it is also believed that certain modified gRNAs described herein can exhibit a reduced innate immune response when introduced into a population of cells, particularly the cells of the present invention. As noted above, the term "innate immune response" includes a cellular response to exogenous nucleic acids, including single stranded nucleic acids, generally of viral or bacterial origin, which involves the induction of cytokine expression and release, particularly the interferons, and cell death.
[0135] One common 3’ end modification is the addition of a poly A tract comprising one or more (and typically 5-200) adenine (A) residues. The poly A tract can be contained in the nucleic acid sequence encoding the gRNA, or can be added to the gRNA during chemical synthesis, or following in vitro transcription using a polyadenosine polymerase (e.g., E. coli Poly(A)Polymerase). In vivo, poly-A tracts can be added to sequences transcribed from DNA vectors through the use of polyadenylation signals. Examples of such signals are provided in Maeder.RNA-guided nucleases
[0136] RNA-guided nucleases according to the present disclosure include, without limitation, naturally-occurring Class 2 CRISPR nucleases such as Cas9, and Cpf 1 , as well as other nucleases derived or obtained therefrom. In functional terms, RNA-guided nucleases are defined as those nucleases that: (a) interact with (e.g., complex with) a gRNA; and (b) together with the gRNA, associate with, and optionally cleave or modify, a target region of a DNA that includes (i) a sequence complementary to the targeting domain of the gRNA and, optionally, (ii) an additional sequence referred to as a "protospacer adjacent motif," or "PAM," which is described in greater detail below. As the following examples will illustrate, RNA-guided nucleases can be defined, in broad terms, by their PAM specificity and cleavage activity, even though variations may exist between individual RNA-guided nucleases that share the same PAM specificity or cleavage activity. Skilled artisans will appreciate that some aspects of the present disclosure relate to systems, methods and compositions that can be implemented using any suitable RNA-guided nuclease having a certain PAM specificity and / or cleavage activity. For this reason, unless otherwise specified, the term RNA-guided nuclease should be understood as a generic term, and not limited to any particular type (e.g., Cas9 vs. Cpfl), species (e.g., 5. pyogenes vs. 5. aureus) or variation (e.g., full-length vs. truncated or split; naturally-occurring PAM specificity vs. engineered PAM specificity).
[0137] Turning to the PAM sequence, this structure takes its name from its sequential relationship to the "protospacer" sequence that is complementary to gRNA targeting domains (or "spacers"). Together with protospacer sequences, PAM sequences define target regions or sequences for specific RNA-guided nuclease / gRNA combinations.
[0138] Various RNA-guided nucleases may require different sequential relationships between PAMs and protospacers. In general, Cas9s recognize PAM sequences that are 5’ of the protospacer as visualized relative to the top or complementary strand.
[0139] In addition to recognizing specific sequential orientations of PAMs and protospacers, RNA-guided nucleases generally recognize specific PAM sequences. 5. aureus Cas9, for example, recognizes a PAM sequence of NNGRRT, wherein the N sequences are immediately 3’ of the region recognized by the gRNA targeting domain. 5. pyogenes Cas9 recognizes NGG PAM sequences. It should also be noted that engineered RNA-guided nucleases can have PAM specificities that differ from the PAM specificities of similar nucleases (such as the naturally occurring variant from which an RNA-guided nuclease is derived, or the naturally occurring variant having the greatest amino acid sequence homology to an engineered RNA-guided nuclease). Modified Cas9s that recognize alternate PAM sequences are described below.
[0140] RNA-guided nucleases are also characterized by their DNA cleavage activity: naturally -occurring RNA-guided nucleases typically form DSBs in target nucleic acids, but engineered variants have been produced that generate only SSBs (discussed above; see also Ran 2013, incorporated by reference herein), or that do not cut at all.Cas9
[0141] Crystal structures have been determined for 5. pyogenes Cas9 (Jinek 2014), and for 5. aureus Cas9 in complex with a unimolecular gRNA and a target DNA (Nishimasu 2014; Anders 2014; and Nishimasu 2015).
[0142] A naturally occurring Cas9 protein comprises two lobes: a recognition (REC) lobe and a nuclease (NUC) lobe; each of which comprise particular structural and / or functional domains. The REC lobe comprises an arginine-rich bridge helix (BH) domain, and at least one REC domain (e.g., a RECI domain and, optionally, a REC2 domain). The REC lobe does not share structural similarity with other known proteins, indicating that it is a unique functional domain. While not wishing to be bound by any theory, mutational analyses suggest specific functional roles for the BH and REC domains: the BH domain appears to play a role in gRNA: DNA recognition, while the REC domain is thought to interact with therepeat: anti -repeat duplex of the gRNA and to mediate the formation of the Cas9 / gRNA complex.
[0143] The NUC lobe comprises a RuvC domain, an HNH domain, and a PAM-interacting (PI) domain. The RuvC domain shares structural similarity to retroviral integrase superfamily members and cleaves the non-complementary (i.e., bottom) strand of the target nucleic acid. It may be formed from two or more split RuvC motifs (such as RuvC I, RuvCII, and RuvCIII in v pyogenes and s. aureus). The HNH domain, meanwhile, is structurally similar to HNH endonuclease motifs, and cleaves the complementary (i.e., top) strand of the target nucleic acid. The PI domain contributes to PAM specificity.Modifications of RNA-guided nucleases
[0144] The RNA-guided nucleases described above have activities and properties that are useful in a variety of applications, but the skilled artisan will appreciate that RNA-guided nucleases may also be modified in certain instances, to alter cleavage activity, PAM specificity, or other structural or functional features.
[0145] Turning first to modifications that alter cleavage activity, mutations that reduce or eliminate the activity of domains within the NUC lobe have been described above.Exemplary mutations that may be made in the RuvC domains, in the Cas9 HNH domain, or in the Cpfl Nuc domain are described in Ran and Yamano, as well as in Cotta-Ramusino. In general, mutations that reduce or eliminate activity in one of the two nuclease domains result in RNA-guided nucleases with nickase activity, but it should be noted that the type of nickase activity varies depending on which domain is inactivated. As one example, inactivation of a RuvC domain of a Cas9 will result in a nickase that cleaves the complementary strand, while inactivation of a Cas9 HNH domain results in a nickase that cleaves the non-complementary strand.
[0146] Modifications of PAM specificity relative to naturally occurring Cas9 reference molecules has been described for both .S'. pyogenes (Kleinstiver 2015 a) and .S', aureus (Kleinstiver 2015b). Modifications that improve the targeting fidelity of Cas9 have also been described (Kleinstiver 2016). Each of these references is incorporated by reference herein.
[0147] RNA-guided nucleases have been split into two or more parts (see, e.g., Zetsche 2015; Fine 2015; both incorporated by reference).
[0148] RNA-guided nucleases are, in some cases, size-optimized or truncated, for example via one or more deletions that reduce the size of the nuclease while still retaining gRNA association, target and PAM recognition, and cleavage activities. In certain embodiments, RNA guided nucleases are bound, covalently or non-covalently, to another polypeptide,nucleotide, or other structure, optionally by means of a linker. RNA-guided nucleases also optionally include a tag, such as a nuclear localization signal to facilitate movement of RNA- guided nuclease protein into the nucleus.
[0149] The foregoing list of modifications is intended to be exemplary in nature, and the skilled artisan will appreciate that other modifications may be possible or desirable in certain applications. For brevity, therefore, certain systems, methods and compositions of the present disclosure are exemplified by reference to particular RNA-guided nucleases, but it should be understood that the RNA-guided nucleases used may be modified in ways that do not alter the exemplified operating principles. Such modifications are within the scope of the present disclosure.EXAMPLES
[0150] The following Examples are illustrative and are not intended to limit the scope or content of the invention in any way.Example 1: Open-Label, Single Ascending Dose Phase 1 / 2 Study to Evaluate the Safety, Tolerability, and Efficacy of Administering a CRISPR / Cas AAV Vector to Patients with LCA10
[0151] Mutations in the centrosomal protein 290 gene (CEP290) cause severe early-onset retinal degeneration, a rare autosomal recessive inherited disease that causes visual impairment from infancy. The most frequent mutation associated with CEP290-related retinal degeneration is in intron 26 (IVS26). This mutation results in the loss of CEP290 function, leading to photoreceptor dysfunction and degeneration. Disease symptoms caused by CEP290-related degeneration include blindness, usually diagnosed in infancy or early childhood; severely impaired visual acuity; loss of peripheral vision; night blindness; and rapid, involuntary eye movements (nystagmus). CEP290-related degeneration may result in the inability to adequately navigate enclosed spaces; risk of falls and injury; inability to be mobile or independently use public transportation; constrained social function; impaired academic performance; and challenges with employment.
[0152] An open-label phase 1 / 2 study was conducted to evaluate the safety, tolerability, and efficacy of single ascending doses of an adeno-associated virus vector 5 (AAV5) viral vector administered via subretinal injection to adults (>18 years) with LCA10 caused by a homozygous or compound heterozygous mutation involving c.2991+1655A>G in intron 26 of the CEP290 gene (“LCA10-IVS26”).
[0153] The AAV5 viral vector (AAV5 comprising SEQ ID NO:27 or “AAV5-SEQ ID NO:27”) administered to the patients comprises the AAV viral genome set forth in SEQ ID NO:27. AAV5-SEQ ID NO:27 comprises DNA encoding Cas9, expressed under the photoreceptor-specific GRK1 promoter, and two specific guide RNAs. Specifically, AAV5- SEQ ID NO:27 is an AAV5 viral vector comprising an AAV genome encoding (i) S', aureus Cas9 operably linked to the photoreceptor-specific hGRKl promoter sequence, and (ii) first and second gRNAs comprising gRNA targeting domain sequences according to SEQ ID NOS: 1 and 4 (corresponding RNA gRNA targeting sequences are SEQ ID NOS:18 and 21 , respectively), and having gRNA backbone sequences according to SEQ ID NO: 8.
[0154] Participants in the phase 1 / 2 study were enrolled in cohorts to evaluate three dose levels of AAV5-SEQ ID NO:27 (6.0x1011vg / ml (low dose), l.lx1012vg / ml (middle (mid) dose), and 3.0 x1012vg / ml (high dose)). Inclusion criteria for the study included: (1) male or female; (2) adults aged 18 years or older, (3) CEP290-related retinal degeneration caused by a homozygous or compound heterozygous mutation involving c.2991+1655A>G in IVS26 of the CEP290 gene, and (4) presence of outer nuclear layer by ocular coherence tomography. The best corrected visual acuity (BCVA) eligibility criteria for the low-dose Cohort 1 (n=2) were light perception (LP), black-white discrimination, and white field projection. For the mid-dose and all other cohorts, the first subject was required to have light perception to BCVA of 1.6 LogMAR (20 / 800 Snellen). BCVA criteria for all subsequent subjects was LP to 0.4 LogMAR (20 / 50 Snellen).
[0155] Exclusion criteria for the study included: (1) other known disease-causing mutations detected in other retinal degeneration disease genes; (2) achieves a passing score for the mobility course (i.e., Visual Navigation Course) at the most difficult level; (3) in either eye, active systemic or ocular / intraocular infection or inflammation; (4) in either eye, history of steroid-responsive intraocular pressure with increases > 25 mm Hg following corticosteroid exposure; (5) spherical equivalent of refractive error more than -8 Diopters or more than +6 Diopters in study eye; (6) inability or unwillingness to take oral prednisone; and (7) prior gene therapy or oligonucleotide treatment.
[0156] For each patient, AAV5-SEQ ID NO:27 was administered via subretinal injection to the para-fovea region of the eye with the worst visual acuity at screening. Participants underwent a standard pars plana vitrectomy and received a single subretinal injection of up to 300 pL of AAV5-SEQ ID NO:27 in the worse seeing eye (study eye). Three AAV5-SEQ ID NO:27 doses, 6.0x1011vg / ml (low dose), l.lx1012vg / ml (middle dose), and 3.0 x1012vg / ml (high dose), were assessed in three cohorts. AAV5-SEQ ID NO:27 doses and targetedenrollment for each cohort were as follows: Cohort 1 (low dose, n=2 adults); Cohort 2 (middle (mid) dose, n=4 adults); and Cohort 3 (high dose, n=4 adults). Intra-operative optical coherence tomography (OCT) was used to guide delivery of AAV5-SEQ ID NO:27 to the subretinal space between the retinal pigment epithelium (RPE) and the photoreceptor layer. Subretinal injections covered the posterior pole of the retina and extended to the vascular arcades.
[0157] All patients were placed on a low-dose prophylactic oral prednisone regimen for approximately 6 weeks following surgery. Beginning 3 days before study intervention, participants began a course of oral prednisone for immune suppression. The proposed course was 0.5 mg / kg / day for 4 weeks, followed by a 15-day taper (0.4 mg / kg / day for 5 days, and then 0.2 mg / kg / day for 5 days, and then 0.1 mg / kg / day for 5 days). If there was an increase in vitreous inflammation by 1+ on the grading scale while the participant was receiving the 0.5 mg / kg / day dose (i.e., within 4 weeks after surgery), the investigator may have increased the dose to 1 mg / kg / day. If any inflammation was present within 4 weeks after surgery, the taper may have been delayed at the discretion of the investigator.
[0158] Patients were screened at baseline for certain characteristics (e.g., best corrected visual acuity (BCVA) measured by LogMAR) and followed for 12 months after treatment. The baseline BCVA for the subjects in Cohorts 1 and 2 were as follows:• Subject 1 of Cohort 1 (low dose): BCVA for study eye was 3.5 LogMAR and BCVA for untreated eye was 3.5 LogMAR;• Subject 2 of Cohort 1 (low dose): BCVA for study eye was 3.9 LogMAR and BCVA for untreated eye was 3.9 LogMAR;• Subject 1 of Cohort 2 (mid dose): BCVA for study eye was 2.7 LogMAR and BCVA for untreated eye was 2.3 LogMAR;• Subject 2 of Cohort 2 (mid dose): BCVA for study eye was 1.4 LogMAR and BCVA for untreated eye was 1.4 LogMAR;• Subject 3 of Cohort 2 (mid dose): BCVA for study eye was 0.6 LogMAR and BCVA for untreated eye was 0.5 LogMAR; and• Subject 4 of Cohort 2 (mid dose): BCVA for study eye was 0.9 LogMAR and BCVA for untreated eye was 0.6 LogMAR.
[0159] The primary outcome measures of the study assessed safety and included frequency of adverse events (AEs) related to AAV5-SEQ ID NO:27, number of participants experiencing procedural related adverse events, and incidence of dose limiting toxicides (DLTs). DLTswere defined as a vision threatening toxicity or severe non-ocular AE that occurs before or at the Week 4 visit and was assessed by the investigator as being related to AAV5-SEQ ID NO:27 and not the administration procedure. Vision threatening toxicity was defined as a sustained decline in BCVA from baseline by > 0.6 LogMAR or loss of light perception over 2 consecutive visits on or after Day 7 that is unresponsive to therapy, and severe ocular inflammation that does not improve with corticosteroid dose adjustment (increase) and continues > 4 weeks. Any non-ocular AEs must be severe in intensity in the investigator’s opinion, and not due to the administration procedure, co-existing medical conditions, or disease-related.
[0160] The secondary outcome measures assessed tolerability and efficacy endpoints:• Maximum tolerated dose as determined by occurrence of dose limiting toxicities.• Change from baseline in the LogMAR measurement of best corrected visual acuity (BCVA). The test evaluated visual acuity in ranges from light perception to normal vision using the Early Treatment Diabetic Retinopathy Study (ETDRS) / LogMAR Visual Acuity Test (FIG. 4A), the Lea Symbols 15-line Pediatric Eye Chart (FIG. 4B), or the Berkeley Rudimentary Visual Test (BRVT) (FIG. 4C).• An assessment of visual navigation using Ora Visual Navigation Courses (FIG. 5). Ora developed four separate mobility courses consisting of 19 different course / light level combinations for patients with LCA10-TVS26 to assess differing levels of visual function. The design of mobility courses can take into account multiple “real-life” scenarios to adapt to patients with specific visual defects (e.g., in visual acuity, visual function, contrast sensitivity, low-light conditions). The ability to improve or preserve mobility at a given ambient light level has important clinical and quality of life implications. Testing the subject’s visual function includes having the subject walk-through obstacle courses with different levels of difficulty depending upon the light levels of the room and the contrast of the objects in the room.• Change from baseline in dark-adapted visual sensitivity using the Full Field Light sensitivity threshold test (FST). The FST test is a well-established tool for testing retinal sensitivity in low vision patients (FIG. 4D). The test measures the point of greatest sensitivity across the entire visual field by testing for lowest luminance flash which elicits visual sensation (i.e., flashes of light of varying luminancewere presented to the eye and the subject reported if the flash was seen). This is a fast test (only takes 1-2 minutes / test), does not require fixation, and enables the best chance for patients to see light. Patients were presented with blue, red, and white stimuli to assess rod / cone / mixed sensitivity. Based on the blue-red difference, the experimenter can determine the sensitivity of rod-mediated and cone-mediated perceptions.• Change from baseline in pupillary response (i.e., measuring the change in pupil diameter in response to a light stimulus).• Change from baseline in macula thickness.• Change from baseline in contrast sensitivity (i.e., the Lea symbols chart was used for subjects under age 6 and the Pelli-Robson chart was used for all other subjects (the images or letters on the chart were in decreasing contrast)).• Change from baseline in macular sensitivity as measured by microperimetry (i.e., visual field test measuring the amount of light perceived in specific parts of the macula).• Change from baseline in color vision score using the Farnsworth 15 score. The Farnsworth D15 tests for congenital and acquired color vision defects. Fifteen color discs were arranged by the subject. Scoring was accomplished by recording the sequence selected by the patient on a copy of the score sheet. A patient with a color vision deficiency arranged the color discs in a different order than a person with normal color vision.• Change from baseline in QOL score for Age >18 years if BCVA is worse than 1.0 LogMAR in both eyes using the Impact of Vision Impairment for Very Low Vision.• Change from baseline in QOL score for Age >18 years if BCVA is 1.0 LogMAR or better in both eyes using the Impact of Vision Impairment.• Change from baseline in visual field using kinetic perimetry (i.e., kinetic perimetry looks at the visual field to identify regions of normal and abnormal sensitivity to light).• Change from baseline in Patient Global Impressions of Change score (this QOL had five non-numeric choices for the subject to select how they believe their condition has changed).• Change from baseline in gaze tracking (i.e., video clips of the eyes were used to measure eye position and stability over time).
[0161] Safety-related results of the study from six patients from Cohort 1 (n=2) and Cohort 2 (n=4) showed that there were no reports of DLTs nor serious AEs in the cohorts (Table 7). No treatment-related cataracts, edema, or retinal thinning were observed. The most frequently reported AE was eye pain in four subjects (1 low dose and 3 middle dose) and was related to the surgical procedure.Table 7: Safety Data
[0162] AAV5 viral copy numbers in tears of subjects were quantified by qPCR. AAV5 neutralizing antibodies were assessed in the plasma of subjects. Transient viral shedding was detected in tears and blood, approaching clearance around Day 7. AAV5-specific antibody was detected in 3 of 5 subjects but was not correlated with inflammation. No Cas9-specific antibody or T-cell response was detected.
[0163] The efficacy assessments of visual acuity (i.e., endpoint of LogMAR measurement BCVA); full field light sensitivity threshold (FST) (i.e., endpoint of dark-adapted visual sensitivity to white, red, and blue light); and Visual Function Navigation (ORA VNC™) (i.e., Visual Function Navigation course score) confirmed the efficacy measures that are clinically relevant to CEP290 retinal degeneration.
[0164] Efficacy results for Subject 1 of Cohort 1 (low dose) were assessed for up to 6 months and showed indeterminant changes in BCVA (FIG. 6A), FST (FIG 6B), or Visual Navigation (FIG. 6C).
[0165] For Subject 2 of Cohort 1 (low dose), variable data outcomes were shown for BCVA (FIG. 7A) and Visual Navigation (FIG. 7B) (FST Thresholds were unable to be detected).
[0166] Subject 1 of Cohort 2 (mid dose), the only patient homozygous for c.2991+1655A>G, showed early signals of productive gene editing and clinical efficacy.Early changes by month 3 with sustained or further improvements in BCVA, FST, and Visual Navigation Course (VNCs) by month 6 (see FIG. 8A (BCVA), FIG. 8B (FST), and 8C(Visual Navigation) were seen. Subject 1 of Cohort 2 (mid dose) showed improved ability to navigate the visual navigation course over time in the study eye. At baseline, Subject 1 of Cohort 2 (mid dose) failed the High Contrast Visual Navigations Challenge (HCVNC) Course at 500 lux but at month 6, the subject passed the HCVNC course at 63 lux.
[0167] Subject 2 of Cohort 2 (mid dose) was tested for BCVA (FIG. 9A), FST (FIG 9B), and Visual Navigation (FIG. 9C) and showed early signals of efficacy based on FST assessment as shown by early changes by month 3 with more pronounced improvements observed in FST (FIG. 9B).
[0168] Subject 3 of Cohort 2 (mid dose) was tested for BCVA (FIG. 10A), FST (FIG 10B), and Visual Navigation (FIG. 10C) and showed indeterminant clinical improvements up to 3 months.
[0169] In sum, AAV5-SEQ ID NO:27 for the treatment of CEP290-related retinal degeneration is the first clinically investigated in vivo CRISPR gene editing therapy. Safety data was reported with respect to all six subjects treated in the low dose (n=2) and mid-dose (n=4) cohorts. Most adverse effects were mild and primarily resulting from the surgical procedure and subretinal injection. There were no dose limiting toxicities defined as a vision-threatening toxicity or severe non-ocular AE that occurred before or at the Week 4 visit and was assessed by the investigator as being related to AAV5-SEQ ID NO:27 and not the administration procedure. Mild anterior chamber inflammation was observed, and adequately controlled with oral steroids. No Cas9-specific antibody or T-cell response was detected. No treatment-related cataracts, edema, or retinal thinning have been observed.
[0170] Efficacy was assessed based on available data from five subjects treated in the adult low-dose Cohort 1 (n=2) and the adult mid-dose Cohort 2 (n=3), who had at least three months of post treatment follow-up, focusing on those measures demonstrated to be consistent and reproducible in subjects with CEP290 retinal degeneration, including: BCVA, FST, and Visual Function Navigation (VNC™, developed by Ora, Inc.).
[0171] Two of three subjects in the mid-dose Cohort 2 followed for up to six months showed efficacy signals suggesting productive editing and providing initial support for clinical benefits, including improvements in BCVA, FST, and / or mobility navigation. Subject 1 from mid-dose Cohort 2 showed improvement in BCVA of approximately 0.7 LogMAR at Month 1.5 which was sustained at Month 6 follow-up. In addition, there was a positive trend toward improved retinal sensitivity by FST in the study eye relative to the untreated eye. The subject also demonstrated a 5 -level improvement in mobility at Month 6, as assessed with the VNC. Subject 2 from mid-dose Cohort 2 showed improvement byMonth 3 with a stable BCVA and a notable improvement in retinal sensitivity in the study eye relative to the untreated eye by FST, detectable at Month 1.5 that continued to improve through Month 3.Example 2: Open-Label, Single Ascending Dose Phase 1 / 2 Study to Evaluate the Safety, Tolerability, and Efficacy of Administering a CRISPR / Cas AAV Vector to Patients with LCA10
[0172] Provided below in Example 2 are data for additional subjects enrolled in the openlabel phase 1 / 2 study described in Example 1 and data for longer timepoints.
[0173] As described in Example 1, adult participants in the phase 1 / 2 study were enrolled in three cohorts to evaluate three dose levels of AAV5-SEQ ID NO:27 (6.0x1011vg / ml (low dose), l. lx1012vg / ml (middle (mid) dose), and 3.0 x1012vg / ml (high dose)). This Example additionally describes results from a fourth cohort including pediatric participants administered a 1 .1x1012vg / ml (middle (mid)) dose of AAV5-SEQ ID NO:27.
[0174] For each patient, AAV5-SEQ ID NO:27 was administered via subretinal injection to the para-fovea region of the eye with the worst visual acuity at screening. Three AAV5-SEQ ID NO:27 doses, 6.0x1011vg / ml (low dose), l.lx1012vg / ml (middle dose), and 3.0 x1012vg / ml (high dose), were assessed in four cohorts. AAV5-SEQ ID NO:27 doses and enrollment for each cohort were as follows: Cohort 1 (low dose, n=2 adults, 6 x 1011vg / mL); Cohort 2 (middle (mid) dose, n=5 adults, 1.1 x 1012vg / mL); Cohort 3 (high dose, n=5 adults, 3 x 1012vg / mL); Cohort 4 (middle (mid) dose, n=2 (pediatrics, 1.1 x 1012vg / mL). Table 8 below provides the patient characteristics for the study. There was a broad range in baseline BCVA (LP-0.6 logMAR) and red light FST (-0.62 to -3.94 log cd.s / m2) in the study eye.Ellipsoid zone length from horizontal optical coherence tomography (OCT) scans through the fovea ranged from 0.0 mm to 4.1 mm in the study eye. Patients were screened at baseline for certain characteristics and are followed for up to 36 months post treatment. Patients will also be part of a 12-year long-term extension study.Table 8. Patient Characteristics
[0175] Efficacy results for the subjects from Cohorts 1-4 (see Table 8) were assessed for up to 18 months for FST (FIGs. 11A-11N, 12A-12C), BCVA (FIGs. 13A-13N, 14A-14C), and Visual Navigation (FIGs. 15A-15N, 16A-16C).
[0176] Patients were also assessed for quality of life based on The National Eye Institute 25-Item Visual Function Questionnaire (VFQ-25) (Aleman 2018; Mangione 2001;Aflibercept 2015). The scoring process for VFQ-25 is a two-step process: step 1 in which the original numeric values from the survey were recorded following a set of Scoring Rules, and step 2 in which items within each subscale were averaged together to create the 12 subscale scores (Table 9). The composite score is the average of the subscale scores, excluding the general health rating question. Some sub-scales (e.g., general vision, near activity,distance activity, color vison) are more relevant to this disease whereas some sub-scales (e.g., driving) are less or not relevant to this disease. The composite score weighs all sub-scales equally and may not be representative. Analysis in an alternative manner (e.g., selected domains, balanced weight) may improve the value of the composite score.Table 9. Step 2 of VFQ-25
[0177] Results in FIGS. 17A-17N show the composite score change from baseline over time for the subjects in various cohorts (Table 8). FIGS. 18A-18C show the composite score change from baseline over time for the different cohorts.
[0178] Efficacy results for the subjects from Cohorts 1-4 (see Table 8) were assessed for up to 24 months for FST (FIGs. 19A-19N), BCVA (FIGs. 20A-20N), Visual Navigation (FIGs. 21A-21N), and Vision-related quality of life (FIGs. 22A-22N).
[0179] A summary of the efficacy for patients with 3 months or more follow-up is shown in Table 10 below. As shown in Table 10, multiple patients showed improvement in one or more of the four endpoints (BCVA, FST, VFN, and VFQ / CVFQ). A positive response is defined as a clinically meaningful improvement in BCVA and improvement in two other endpoints. Three patients demonstrated clinically meaningful improvement in BCVA and consistent positive responses in two other endpoints (patients C2, SI; C3, S5; and C4, SI).The two homozygous patients (C2, SI; C4, SI) were both responders and one heterozygous patient (C3, S5) out of the twelve patients, (1 / 12) was also a responder (Table 10).Table 10. Efficacy Summary for Patients with > Month 3 Follow-Up
[0180] A summary of the efficacy for patients with 6 months or more follow-up is shown in Table 11 below. As shown in Table 11, multiple patients showed improvement in one or more of the four endpoints (BCVA, FST, VFN, and PRO: VFQ / CVFQ). 12 / 14 (86%) subjects demonstrated improvement in at least one of the four efficacy outcomes. 7 / 14 subjects (50%) demonstrated improvement in two or more efficacy outcomes including 2 of 2 (100%) homozygous patients. Four participants demonstrated improvement in BCVA > 0.3 logMAR (gain of at least 15 letters on the ETDRS chart), suggesting therapeutic levels of CEP290 expression and improved photoreceptor function. Improvements in FST sensitivity were also observed in six participants, and were mostly observed for red stimuli, suggestingthat this response was mediated by enhanced cone photoreceptor function. Five subjects had improved VFN, and six subjects had better PRO. Overall, improvements in vision occurred as early as month 3 and were sustained in subsequent visits including up to year 2 in one participant, suggesting a potentially durable treatment effect. These findings provide evidence of productive in vivo gene editing at doses that do not cause uncontrollable inflammation and to the best of our knowledge, represent the first in vivo application of CRISPR / Cas technology to restore vision.Table 11. Efficacy Summary for Patients with > Month 6 Follow-Up
[0181] Results also showed that administration of AAV5-SEQ ID NO:27 demonstrates a favorable safety profile. AAV5-SEQ ID NO:27 was generally well tolerated across all cohorts during the follow up period. There were no dose-limiting toxicities, no drug-related serious adverse event (SAEs), and no ocular SAEs or dose-limiting toxicities (DLTs). The majority of adverse events (AEs) were mild (76%) or moderate (22%). 47% of AEs were related to surgical procedure. There were 21 ocular treatment-related AEs associated with AAV5-SEQ ID NO:27 (Table 12). 7 / 14 patients (50%) reported no ocular AEs related to AAV5-SEQ ID NO:27. One patient [7% (1 / 14)] reported a severe ocular AE at 6 months (non-serious visual impairment) which is improving. The participant was also enrolled in aNatural History Study, during which the same eye experienced similar vision fluctuation.Table 12. Ocular Treatment-related Adverse Events Related to AAV5-SEQ ID NO:27
[0182] Viral genomes were detected in tears, nasal mucosa, and blood in 93%, 29%, and 36% of participants, respectively. No viral genomes were detected in semen. Viral shedding across all matrices was transient, with vector clearance observed within seven days posttreatment for most participants and undetectable levels noted in all participants at month 3 (FIGs. 23A-23B). No SaCas9 BABs were detected pre- or post-treatment. AAV5 BAB and nAB titers showed small increases post-treatment (not exceeding 105). Pre-existing cell- mediated responses to AAV5 or SaCas9 were detected in 64% and 36% of participants, respectively. Most participants with pre-existing immunity had a post-treatment cell- mediated immune response (FIGs. 24A-24C). The immunogenicity findings suggest a clinically insignificant response to AAV5 and SaCas9.
[0183] Further analyses were performed in two subjects who showed correspondence between two or more efficacy outcomes (pediatric mid-dose (Cohort 4, Subjects 1 and 2). While retinal imaging in patients with CEP290-associated inherited retinal degeneration (IRD) can be challenging due to nystagmus and / or unstable fixation, spectral domain optical coherence tomography (OCT) cross sections in both participants demonstrated a normal foveal depression and normal retinal lamination with clear retention of macular photoreceptor cells, typical of C£P290-associated IRD (FIG. 25A) (Cideciyan 2011). Per eligibility criteria, all subjects showed similarly detectable patterns of central photoreceptors. Images acquired 6 months post-treatment were nearly identical to images acquired at baseline, supporting the safety of subfoveal injections. The foveal outer nuclear layer thickness (ONL) at baseline was near the lower limit of normal (mean = -2 pm, SD = 72 pm) or within normal limits. Foveal ONL thickness in the treated eyes remained stable (Cideciyan 2007, Ctori 2015, Menke 2009).
[0184] Retinal sensitivity as measured by full-field stimulus testing (FST) is expected to originate from the most sensitive, preserved retina, near the foveal center in most patients (Cideciyan 2007, Jacobson 2017, Cideicyan 2011). Photoreceptor mediation was determined by calculating spectral sensitivity differences between red and blue stimuli, and showed cone- mediated sensitivities in all but one patient (Cohort 4, Subject 2), who showed mixedphotoreceptor mediation (blue light perceived by rods, red light perceived by cones) (FIG. 25B) (Roman 2022). The sensitivity losses determined with the blue stimulus were thus driven by the total or near-total loss of rod function in all patients. Cone-mediated sensitivities estimated with the red stimulus were severely reduced in Cohort 4, Subject 1, who was homozygous for the IVS26 mutation. Cohort 4, Subject 2 — a compound heterozygote, showed moderately reduced cone sensitivities.
[0185] Treatment led to significant improvements in cone-mediated sensitivities in both subjects, which fell within 0.5 log units of the normal limit at 6 months post-treatment (FIG. 25B) Sensitivities in the untreated eyes were comparable to baseline. When extended to all participants, the analysis revealed significant improvements in cone- mediated sensitivities in the treated eye in six participants (FIG. 25C). The magnitude of recovery related to baseline cone-mediated sensitivity, with a greater change in sensitivity observed in participants with worse baseline sensitivities, and thus greater structural-functional dissociation (i.e., participants with preserved but highly dysfunctional cone photoreceptors). There was virtually no change in participants with better baseline cone sensitivities, who were close to normal.INCORPORATION BY REFERENCE
[0186] All references mentioned herein are hereby incorporated by reference in their entirety as if each individual reference was specifically and individually indicated to be incorporated by reference.EQUIVALENTS
[0187] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.REFERENCESAflibercept (Eylea): Treatment of Neovascular (Wet) Age-Related Macular Degeneration (wAMD). Ottawa (ON): Canadian Agency for Drugs and Technologies in Health (2015).Aleman et al, Invest Ophthalmol Vis Sci 59( 12) :5225-36 (2018) Anders et al. Nature 513(7519) :569-573 (2014) Briner et al. Mol Cell 56(2) :333-339 (2014)Cideciyan et al. Hum Mutat 28(11): 1074-83 (2007)Cideciyan et al. Hum Mol Genet. 20(7): 1411-23 (2011)Comish-Bowden Nucleic Acids Res 13(9):3021 -3030 (1985)Ctori PLoS One 10(6):e0129005 (2015)Davis & Maizels Proc Natl Acad Sci USA ll l(10):E924-E932 (2014)Fine et al. Sci Rep 5: 10777 (2015)Frit et al. DNA Repair (Amst.) 17:81-97 (2014)Hsu et al. Nat Biotechnol 31 (9): 827-832 (2013) lyama & Wilson DNA Repair (Amst.) 12(8):620-636 (2013)Jacobson et al. Invest Ophthalmol Vis Sci 58(5):2609-2622 (2017)Jiang et al. Nat Biotechnol 31(3):233-239 (2013)Jinek et al. Science 337(6096):816-821 (2012)Jinek et al. Science 343(6176):1247997 (2014)Kleinstiver et al. Nature 523(7561):481-485 (2015a)Kleinstiver et al. Nat Biotechnol 33(12):1293-1298 (2015b)Kleinstiver et al. Nature 529(7587):490-495 (2016)Komor et al. Nature 533(7603):420-424 (2016)Makarova et al. Nat Rev Microbiol 9(6):467-477 (2011)Mali et al. Science 339(6121):823-826 (2013)Mangione et al. Arch Opthalmol 119(7): 1050-8 (2001)Menke et al. Am J Ophthalmol 147(3):467-72 (2009)Nishimasu et al. Cell 156(5):935-949 (2014)Nishimasu et al. Cell 162(5):1113-1126 (2015)Ran et al. Cell 154(6): 1380-1389 (2013)Roman et al. Prog Retin Eye Res 87: 101000 (2022)Tsai et al. Nat Biotechnol 34(5) :483 (2016)Zetsche et al. Nat Biotechnol 33(2): 139-142 (2015)
Claims
CLAIMS1. A method of treating a subject having LCA10 comprising administering to the subject a nucleic acid encoding a Cas9, a first gRNA and a second gRNA, each gRNA targeted to a CEP290 gene of the subject to treat the subject.
2. The method of claim 1 , wherein treating comprises increasing the subject’s visual navigation after administration of the nucleic acid to the subject.
3. The method of claim 2, wherein the subject’s visual navigation is measured using visual navigation courses.
4. The method of claim 3, wherein increasing the subject’s visual navigation comprises an increase of one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or twenty one levels of the subject’s visual function navigation course level score after administration of the nucleic acid to the subject compared to the subject’s visual function navigation course level score prior to administration of the nucleic acid to the subject.
5. The method of any one of claims 2-4, wherein increasing the subject’s visual navigation occurs about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
6. The method of any one of claims 1-5, wherein treating comprises reducing the subject’s Logarithm of the Minimum Angle of Resolution (LogMAR) measurement of best corrected visual acuity (BCVA) after administration of the nucleic acid to the subject.
7. The method of claim 6, wherein reducing the subject’s LogMAR measurement of BCVA comprises a reduction of about 1% to about 100% (e.g., about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%) of the subject’s LogMAR measurement of BCVA prior to administration of the nucleic acid to the subject.
8. The method of claim 6, wherein reducing the subject’s LogMAR measurement of BCVA comprises a reduction of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3,1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2., 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4,3.5, 3.6, 3.7, 3.8, 3.9, 4.0 of the subject’s LogMAR measurement of BCVA prior to administration of the nucleic acid to the subject.
9. The method of any one of claims 6-8, wherein reducing the subject’sLogMAR measurement of BCVA occurs about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
10. The method of any one of claims 1-9, wherein treating comprises increasing the subject’s dark-adapted visual sensitivity after administration of the nucleic acid to the subject.
11. The method of claim 10, wherein increasing the subject’s dark-adapted visual sensitivity comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%) of the subject’s dark-adapted visual sensitivity after administration of the nucleic acid to the subject compared to the subject’s dark-adapted visual sensitivity prior to administration of the nucleic acid to the subject.
12. The method of any one of claims 1-11, wherein treating comprises increasing the subject’s pupillary response after administration of the nucleic acid to the subject.
13. The method of claim 12, wherein increasing the subject’s pupillary response comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%) of the subject’s pupillary response after administration of the nucleic acid to the subject compared to the subject’s pupillary response prior to administration of the nucleic acid to the subject.
14. The method of any one of claims 1-13, wherein treating comprises increasing the subject’s macula thickness after administration of the nucleic acid to the subject.
15. The method of claim 14, wherein increasing the subject’s macula thickness comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%) of the subject’s macula thickness after administration of the nucleic acid to the subject compared to the subject’s macula thickness prior to administration of the nucleic acid to the subject.
16. The method of any one of claims 1 -15, wherein treating comprises increasing the subject’s contrast sensitivity after administration of the nucleic acid to the subject.
17. The method of claim 16, wherein increasing the subject’s contrast sensitivity comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%) of the subject’s contrast sensitivity after administration of the nucleic acid to the subject compared to the subject’s contrast sensitivity prior to administration of the nucleic acid to the subject.
18. The method of any one of claims 1-17, wherein treating comprises increasing the subject’s macular sensitivity after administration of the nucleic acid to the subject.
19. The method of claim 18, wherein increasing the subject’s macular sensitivity comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%) of the subject’s macular sensitivity after administration of the nucleic acid to the subject compared to the subject’s macular sensitivity prior to administration of the nucleic acid to the subject.
20. The method of any one of claims 1-19, wherein treating comprises increasing the subject’s color vision score after administration of the nucleic acid to the subject.
21. The method of claim 20, wherein increasing the subject’s color vision score comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%) of the subject’s color vision score after administration of the nucleic acid to the subject compared to the subject’s color vision score prior to administration of the nucleic acid to the subject.
22. The method of any one of claims 1-21, wherein treating comprises increasing the subject’s Quality of Life (QOL) score after administration of the nucleic acid to the subject.
23. The method of claim 22, wherein increasing the subject’s QOL score comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%) of the subject’s QOL score after administration of the nucleic acid to the subject compared to the subject’s QOL score prior to administration of the nucleic acid to the subject.
24. The method of claim 22 or 23, wherein if the subject’s BCVA is worse than 1.0 LogMAR in both eyes, then the QOL score is measured using the Impact of Vision Impairment for Very Low Vision.
25. The method of claim 22 or 23, wherein if the subject’s BCVA is 1.0 LogMAR or better in both eyes, then the QOL score is measured using the Impact of Vision Impairment.
26. The method of any one of claims 1-25, wherein treating comprises increasing the subject’s visual field using kinetic perimetry after administration of the nucleic acid to the subject.
27. The method of claim 26, wherein increasing the subject’s visual field using kinetic perimetry comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%) of the subject’s visual field using kinetic perimetry after administration of the nucleic acid to the subject compared to the subject’s visual field prior to administration of the nucleic acid to the subject.
28. The method of any one of claims 1-27, wherein treating comprises increasing the subject’s Patient Global Impressions of Change score after administration of the nucleic acid to the subject.
29. The method of claim 28, wherein increasing the subject’s Patient Global Impressions of Change score comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%) of the subject’s Patient GlobalImpressions of Change score after administration of the nucleic acid to the subject compared to the subject’s Patient Global Impressions of Change score prior to administration of the nucleic acid to the subject.
30. The method of any one of claims 1-29, wherein treating comprises increasing the subject’s gaze tracking after administration of the nucleic acid to the subject.
31. The method of claim 30, wherein increasing the subject’s gaze tracking comprises an increase of about 1% to about 100% (e.g., about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%) of the subject’s gaze tracking after administration of the nucleic acid to the subject compared to the subject’s gaze tracking prior to administration of the nucleic acid to the subject.
32. The method of any one of claims 1-31, wherein treating comprises increasing the subject’s vision related quality of life (PRO) as measured by Visual Function Navigation (VFQj / Children’ s Visual Function Questionnaire (CVFQ) score after administration of the nucleic acid to the subject compared to the subject’s VFQ / CVFQ score prior to administration of the nucleic acid to the subject.
33. The method of claim 32, wherein increasing the subject’s PRO comprises an increase of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 points of the subject’s VFQ / CVFQ score after administration of the nucleic acid to the subject compared to the subject’s VFQ / CVFQ score prior to administration of the nucleic acid to the subject.
34. The method of claim 32 or 33, wherein increasing the subject’s PRO comprises an increase of > 4, > 5, > 10, > 15, > 20, > 25, > 30, > 35, > 40 points of the subject’s VFQ / CVFQ score after administration of the nucleic acid to the subject compared to the subject’s VFQ / CVFQ score prior to administration of the nucleic acid to the subject.
35. The method of any one of claims 32-34, wherein increasing the subject’s PRO comprises an increase of 4 to 10, 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40 points of the subject’s VFQ / CVFQ score after administration of the nucleic acid to the subject compared to the subject’s VFQ / CVFQ score prior to administration of the nucleic acid to the subject.
36. The method of any one of claims 32-35, wherein increasing the subject’s PRO occurs about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
37. The method of any one of claims 1-36, wherein treating comprises increasing the subject’s visual function navigation (VFN) composite score compared to the subject’s VFN composite score prior to administration of the nucleic acid to the subject.
38. The method of claim 37, wherein increasing the subject’s VFN composite score comprises an increase of 1, 2, 3, 4, 5, 6, 7, or 8 compared to the subject’s VFN composite score prior to administration of the nucleic acid to the subject.
39. The method of claims 37 or 38, wherein increasing the subject’s VFN composite score comprises an increase of 1 to 4, 2 to 5, 3 to 6, 4 to 7, or 5 to 8 compared to the subject’s VFN composite score prior to administration of the nucleic acid to the subject.
40. The method of any one of claims 37-39, wherein increasing the subject’s VFN composite score comprises an increase of > 3, > 4, > 5, > 6, > 7, or > 8 compared to the subject’s VFN composite score prior to administration of the nucleic acid to the subject.
41. The method of any one of claims 37-40, wherein increasing the subject’s VFN composite score occurs about 1 week, about 2 weeks, about 3 weeks, about 1 month, about 2 months, about 2.5 months, about 3 months, about 3.5 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 13 months, about 14 months, about 15 months, about 16 months, about 17 months, about 18 months, about 19 months, about 20 months, about 21 months, about 22 months, about 23 months, or about 24 months after administration of the nucleic acid to the subject.
42. The method of any one of claims 1-41, wherein the first gRNA comprises a targeting domain selected from the group consisting of SEQ ID NOS: 1-3.
43. The method of any one of claims 1-42, wherein the second gRNA comprises a targeting domain selected from the group consisting of SEQ ID NOS: 4-6.
44. The method of any one of claims 1-43, wherein the nucleic acid encoding the Cas9, the first gRNA and second gRNA is characterized in that it comprises the following targeting domain sequences a) SEQ ID NO:1 and SEQ ID NO:4; or b) SEQ ID NO: 1 and SEQ ID NO:5; orc) SEQ ID NO:1 and SEQ ID N0:6; or d) SEQ ID NO:2 and SEQ ID NO:4; or e) SEQ ID NO:3 and SEQ ID NO:4; or f) SEQ ID NO:3 and SEQ ID NO:5.
45. The method of any one of claims 1-44, wherein the nucleic acid encodes .S'. aureus Cas9.
46. The method of any one of claims 1-45, wherein the nucleic acid comprises a Cas9 coding sequence according to SEQ ID NO: 10 or encodes a Cas9 comprising the sequence of SEQ ID NO: 11.
47. The method of claim 46, wherein the Cas9 is a modified Cas9.
48. The method of any one of claims 1-47, wherein the nucleic acid comprises SEQ ID NOS: 26 or 27.
49. The method of any one of claims 1-48, wherein the nucleic acid is an AAV vector.
50. The method of any one of claims 1-49, wherein the subject is a pediatric subject.
51. The method of any one of claims 1-50, wherein the subject is homozygous for the C.2991+1655A to G mutation in the CEP290 gene.
52. The method of any one of claims 49-51, wherein the AAV vector is administered to the subject at a concentration of about 6.0x1011vg / ml, about l.lx1012vg / ml, or about 3.0 x1012.
53. The method of any one of claims 49-52, wherein the subject receives from about 9.Ox1010vg to about l.Ox1012vg of the AAV vector.
54. The method of any one of claims 1-53, wherein the subject is administered a single dose of the nucleic acid.