Compositions and methods for modulating grin2a

Abstract

Aspects of the disclosure relate to compositions and methods for modulating levels, transcription, splicing, and / or translation of one or more RNA transcripts (e.g., mRNA transcripts) in a cell or subject. The disclosure is based, in part, on isolated nucleic acids that bind to mRNA transcripts of genes involved in psychiatric diseases and disorders, for example Glutamate [NMD A] receptor subunit epsilon- 1 (GRIN2A), which is a subunit of some N-methyl- D-aspartate (NMD A) receptors. In some embodiments, compositions of the disclosure are useful for treating psychiatric diseases or disorders, such as schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer's disease (AD), Parkinson's disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett's syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).

Description

[0001] COMPOSITIONS AND METHODS FOR MODULATING GRIN2A

[0002] RELATED APPLICATIONS

[0003] The application claims the benefit under 35 U.S.C. 119(e) of U.S. Provisional Application number 63 / 489,234 filed on March 9, 2023, U.S. Provisional Application number 63 / 492,600 filed on March 28, 2023, U.S. Provisional Application number 63 / 500,071 filed on May 4, 2023, U.S. Provisional Application number 63 / 512,295 filed on July 7, 2023, U.S. Provisional Application number 63 / 519,212 filed on August 11, 2023, U.S. Provisional Application number 63 / 580,796 filed on September 6, 2023, U.S. Provisional Application number 63 / 588,143 filed on October 5, 2023, U.S. Provisional Application number 63 / 550,523 filed on February 6, 2024, and U.S. Provisional Application number 63 / 556,385 filed on February 21, 2024, each of which is herein incorporated by reference in its entirety.

[0004] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0005] The contents of the electronic sequence listing (L090770038WO00-SEQ-KZM.xml; Size: 284,981 bytes; and Date of Creation: March 7, 2024) is herein incorporated by reference in its entirety.

[0006] BACKGROUND

[0007] Glutamate is the anion of glutamic acid and acts as an excitatory neurotransmitter that is involved in modulating a variety of biological processes. Glutamate signals through three different receptor types: AMP A receptors, NMD A receptors, and metabotropic glutamate receptors. Glutamate signaling through NMDA receptors is important for controlling synaptic plasticity and mediating learning and memory functions.

[0008] SUMMARY

[0009] Aspects of the disclosure relate to isolated nucleic acids that bind to mRNA transcripts of genes involved in certain psychiatric diseases and disorders, for example genes encoding subunits of N-methyl-D-aspartate (NMDA) receptors. In some embodiments, the subunit is a Glutamate [NMDA] receptor subunit epsilon- 1 (GRIN2A) subunit. In some embodiments, compositions of the disclosure are useful for treating diseases or disorders associated with psychiatric diseases and disorders, such as schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression and major depressive disorder), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drugresistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.). The disclosure is based, in part, on compositions and methods for modulating a level, transcription, splicing, and / or translation of one or more RNA transcripts (e.g., mRNA transcripts) in a cell or subject.

[0010] Accordingly, in some aspects, the disclosure provides an isolated nucleic acid that comprises a region of complementarity with a human GRIN2A mRNA transcript, has at least 60% identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, 95-99%, or 100% identity) to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-269 (e.g., as listed in Column A of Table 1), and upon binding to the mRNA transcript decreases a level, transcription, splicing, and / or translation of functional GRIN2A protein from the mRNA transcript.

[0011] In some embodiments, the isolated nucleic acid comprises RNA. In some embodiments, the isolated nucleic acid is an antisense oligonucleotide (ASO).

[0012] In some embodiments, the isolated nucleic acid comprises or consists of between 10 and 40 nucleotides. In some embodiments, the isolated nucleic acid comprises or consists of between 18 and 25 nucleotides.

[0013] In some embodiments, the isolated nucleic acid comprises one or more chemical modifications, for example as listed in Column B of Table 1. In some embodiments, the one or more chemical modifications comprise one or more nucleoside modifications and / or one or more sugar-phosphate backbone modifications. In some embodiments, the one or more nucleoside modifications comprises a 2'-O-methyl (2'-OMe) modification, 2'-0-M0E modification, 2’-fluoro modification, or a locked nucleic acid (LNA) modification. In some embodiments, the one or more sugar-phosphate backbone modifications comprises a phosphorothioate backbone modification. In some embodiments, the isolated nucleic acid is fully chemically modified (e.g., contains a fully modified sugar-phosphate backbone, and all nucleotides of the isolated nucleic acid are chemically modified).

[0014] In some embodiments, the isolated nucleic acid comprises one or more deoxyribonucleotides. In some embodiments, the isolated nucleic acid is a gapmer. In some embodiments, the region of complementarity is located in an untranslated region of the GRIN2A mRNA transcript. In some embodiments, the untranslated region comprises a 5' UTR, intron, or a 3' UTR of the GRIN2A mRNA transcript.

[0015] In some embodiments, the region of complementarity is located in a protein coding region of the GRIN2A mRNA transcript.

[0016] In some embodiments, the region of complementarity is located on an intron-exon boundary (e.g., the region of complementarity spans an intron exon boundary, such that the isolated nucleic acid hybridizes binds to both an intron and an exon at the same time) of the GRIN2A mRNA transcript.

[0017] In some embodiments, the region of complementarity comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 continuous nucleotides of the sequence set forth in any one of SEQ ID NOs: 270-272.

[0018] In some embodiments, the nucleotide sequence comprises the nucleic acid sequence set forth in any one of the nucleotide sequences set forth in Column A of Table 1. In some embodiments, the nucleotide sequence comprises one or more chemical modifications (or combinations of chemical modifications) set forth in Column B of Table 1. In some embodiments, the nucleotide sequence comprises a nucleic acid sequence set forth in any one of the nucleotide sequences set forth in Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications) set forth in Column B of Table 1. In some embodiments, the nucleic acid sequence from Column A and the one or more chemical modifications (or combinations of chemical modifications) in Column B are taken from the same row of Table 1.

[0019] In some aspects, the disclosure provides a method for decreasing glutamate signaling in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof.

[0020] In some embodiments, the cell is a neuronal cell. In some embodiments, the neuronal cell is a postsynaptic neuronal cell.

[0021] In some embodiments, the subject comprises one or more mutations in a gene that is associated with glutamate signaling. In some embodiments, the gene is GRIN2A.

[0022] In some embodiments, the cell or subject is a human cell or subject.

[0023] In some embodiments, the subject has or is suspected of having a psychiatric disease or disorder. In some embodiments, the disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drugresistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).

[0024] In some embodiments, the administration is systemic administration. In some embodiments, the systemic administration comprises intravenous injection.

[0025] In some embodiments, the administration comprises direct administration to a target tissue of the subject. In some embodiments, the direct administration comprises direct injection to the central nervous system (CNS) of the subject. In some embodiments, the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject.

[0026] In some embodiments, the administration comprises placing the subject in a Trendelenburg position during the administration.

[0027] In some aspects, the disclosure provides a method for reducing NMDA receptor- mediated exci totoxi city in a subject, the method comprising administering an isolated nucleic acid as described herein, to a subject in need thereof.

[0028] In some embodiments, the subject does not comprise one or more mutations in a gene associated with glutamate signaling. In some embodiments, a subject does not have a mutation in a GRIN2A gene.

[0029] In some embodiments, the subject comprises one or more mutations in a gene that is associated with glutamate signaling. In some embodiments, the gene is GRIN2A.

[0030] In some embodiments, the subject is a human subject.

[0031] In some embodiments, the subject has or is suspected of having a psychiatric disease or disorder. In some embodiments, the psychiatric disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).

[0032] In some embodiments, the administration is systemic administration. In some embodiments, the systemic administration comprises intravenous injection.

[0033] In some embodiments, the administration comprises direct administration to a target tissue of the subject. In some embodiments, the direct administration comprises direct injection to the central nervous system (CNS) of the subject. In some embodiments, the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject.

[0034] In some embodiments, the administration comprises placing the subject in a Trendelenburg position during the administration.

[0035] In some aspects, the disclosure provides a method for preventing or treating a psychiatric disease or disorder in a subject in need thereof, the method comprising administering to the subject an isolated nucleic acid as described herein.

[0036] In some embodiments, the subject is a human.

[0037] In some embodiments, the psychiatric disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).

[0038] In some embodiments, the administration comprises direct administration to a target tissue of the subject. In some embodiments, the direct administration comprises direct injection to the central nervous system (CNS) of the subject. In some embodiments, the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject.

[0039] BRIEF DESCRIPTION OF DRAWINGS

[0040] FIG. 1 shows a schematic depicting modulation of RNA (e.g., mRNA, such as mature mRNA or pre-mRNA) levels, transcription, splicing, and / or translation by antisense oligonucleotides (ASOs). Composition “A” represents an ASO that binds to the 5' untranslated region (5' UTR) of an RNA. Composition “B” represents an ASO that binds to an intron of an RNA. Composition “C” represents an ASO that binds to a splice boundary (e.g., a splice junction) between an exon and intron of an RNA. Composition “D” represents an ASO that binds to an exon (e.g., protein coding region) of an RNA. Composition “E” represents a combination of an ASO binding to a 3' UTR of an RNA, alone or with a trans-regulator. Composition “F” represents a “gapmer” ASO that binds to an exon (e.g., protein coding region) of an RNA and mediates RNaseH decay. Composition “G” represents a “gapmer” ASO that binds to a 3' UTR of an RNA, alone or with a trans-regulator, and mediates RNaseH decay. In some embodiments, ASOs binding to an RNA result in translation of a truncated protein that has a dominant negative effect on the wild-type, full-length protein.

[0041] FIGs. 2A-2C show representative data regarding expression profiling of human Glutamate ionotropic receptor NMDA type subunit 2A (GRIN2A). FIG. 2A shows bulk tissue gene expression of human GPJN2A\ data indicate GRIN2A mRNA is expressed in various tissues. FIG. 2B shows a schematic depicting exons and introns present in the GRIN2A gene. FIG. 2C shows representative data for exon expression analysis of human GRIN2A splice variants in tissue.

[0042] FIG. 3 is a schematic depicting the primary AUG, and upstream regions of GRIN2A mRNA transcript.

[0043] FIGs. 4A-4C show representative in vitro data for ASOs targeting GRIN2A RNA. FIG. 4A shows a diagram of GRIN2A RNA within which exons are indicated as boxes and introns are indicated as dashed lines. The 181 designed ASOs (rectangles; Table 1) are shown based on the location of their target region on GRIN2A RNA. Ten of the most potent ASOs of each chemistry are shaded. FIG. 4B shows GRIN2A RNA levels after ASO treatment. Normalized levels of GRIN2A RNA in U-138 MG cells as measured by branched DNA (bDNA) in a bDNA signal amplification assay 48 hours after transfection with mock and non-targeting control ASOs (shaded), an siRNA targeting GRIN2A (shaded), or ASOs targeting GRIN2A at both 5 nM and 20 nM doses are presented. GRIN2A expression was normalized to GAPDH expression and presented as a percentage of the negative mock and non-targeting controls. Means across biological replicates (N=4) are presented; error bars are standard error of the mean. FIG. 4C shows GRIN2A RNA down-regulation by select ASOs. Normalized levels of GRIN2A RNA in U-138 MG cells, as measured by bDNA 48 hours after transfection with mock and non-targeting control ASOs (grey) or 10 of the most potent GRIN2A ASOs of each chemistry at both 5 nM and 20 nM doses are presented. GRIN2A expression was normalized to GAPDH expression and presented as a percentage of the negative mock and non-targeting mock controls. Means across biological replicates (N=4) are presented; error bars are standard error of the mean.

[0044] FIG. 5 shows high concordance of GRIN2A knockdown in cells treated during separate two-dose and ten-dose series. 22 ASOs targeting GRIN2A were tested in U138-MG cells as part of a ten-dose series and knockdown was compared with that observed previously in U138-MG cells treated in a two-dose series. U138-MG cells were forward transfected with ASOs at either a 5 nM dose or a 20 nM dose (chemistry 1 (skipmer); chemistry 2 (gapmer)) and GRIN2A expression was measured after 48 hours by bDNA assay. The effect of tested ASOs on cells treated as part of either series was determined to be correlated (R = 0.53).

[0045] FIGs. 6A and 6B show dose response of GRIN2A -targeting ASOs in U138-MG cells. 7 distinct ASOs were assayed in U138-MG cells in vitro at 10 doses: 40 nM, 20 nM, 10 nM, 5 nM, 2.5 nM, 1.25 nM, 0.625 nM, 0.3125 nM, 0.15625 nM, and 0.078125 nM. U-138 MG cells were treated in 96 well plate format by forward transfection and GRIN2A expression (FIG. 6A) and GAPDH expression (FIG. 6B) was assayed after 48 hours by bDNA assay. ASO treatments were normalized to control transfected cells. 0% knockdown and 50% knockdown are indicated by dashed lines (black and grey, respectively). Means across biological replicates (N=4) are presented; error bars are standard deviation. The ASOs shown in the data include: an ASO comprising the nucleotide sequence of SEQ ID NO: 1, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 2 of Table 1; an ASO comprising the nucleotide sequence of SEQ ID NO: 106, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 107 of Table 1; an ASO comprising the nucleotide sequence of SEQ ID NO: 136, a gapmer structure , and the chemical modifications as set forth in Columns A and B of row 137 of Table 1; and an ASO comprising the nucleotide sequence of SEQ ID NO: 230, a skipmer structure, and the chemical modifications as set forth in Columns A and B of row 231 of Table 1.

[0046] FIGs. 7A-7G show representative data for in vitro dose-dependent reduction of GRIN2A mRNA in IPS-derived glutaminergic neurons. FIG. 7A shows RT-qPCR results from screening of GRIN2A ASOs comprising skipper or gapmer chemistries. FIG. 7B shows RT-qPCR analyses of GRIN2A dose-dependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 237, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 238 of Table 1. FIG. 7C shows RT-qPCR analyses of GRIN2A dosedependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 251 a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 252 of Table 1. FIG. 7D shows RT-qPCR analyses of GRIN2A dose-dependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 252, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 253 of Table 1. FIG. 7E shows RT-qPCR analyses of GRIN2A dose-dependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 254, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 255 of Table 1. FIG. 7F shows RT-qPCR analyses of GRIN2A dose-dependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1 (also referred to as “ASO 2” herein) . FIG. 7G shows RT-qPCR analyses of GRIN2A dose-dependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 269, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 270 of Table 1.

[0047] FIGs. 8A-8B show in vivo Grin2a expression data from mouse subjects administered ASOs targeting Grin2a mRNA. In this figure, “ASO” refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein). FIG. 8A shows Grin2a mRNA expression in cortex and hippocampus tissue of mouse subjects who received a single intracerebroventricular injection of 100 pg of ASOs. FIG. 8B shows Grin2a mRNA expression in cortex and hippocampus tissue of mouse subjects after the last of two intracerebroventricular injections of 50 pg or 100 pg of ASOs. Expression analysis data was averaged across 3 technical replicates and shown as a percentage of the vehicle-control group. Each dot represents an animal; bars show mean + / - standard deviation. N (# of subjects treated with vehicle / # of subjects treated with ASO) = 12 / 12; 12 / 12 and 5,5,5 / 4,5,5 for cortex / hippocampus in FIG. 8A and FIG. 8B, respectively. Statistical analysis was performed using a linear model comparing treatment groups to the vehicle group and adjusting for RNA isolation batch (*:p<0.05, **:p<0.01, ***:p<0.001).

[0048] FIGs. 9A-9B show ASO levels in tissue samples from mouse subjects administered ASOs targeting Grin2a mRNA. In this figure, “ASO” refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein). FIG. 9A shows ASO levels in frontal cortex and hippocampus tissue samples of mouse subjects who received a single intracerebroventricular injection of 100 pg of ASOs, FIG. 9B shows ASO levels in frontal cortex and hippocampus tissues of mouse subjects after the last of two intracerebroventricular injections of 50pg or lOOpg of ASO. Expression analyses data was averaged across 3 technical replicates and shown as a percentage of the vehicle-control group. Each dot represents an animal; bars show mean + / - standard deviation. N (# of subjects treated with vehicle / # of subjects treated with ASO) = 12 / 12; 12 / 12 and 5,5,5 / 4,5,5 for frontal cortex / hippocampus in FIG. 9A and FIG. 9B, respectively.

[0049] FIGs. 10A-10D show the representative data for silencing of Grin2a in mouse subjects following intracerebroventricular injection of three doses of GRIN2A ASOs. In this figure, “ASO” refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein). FIG. 10A shows a schematic depicting a study design wherein mouse subjects received either vehicle or 100 pg of ASOs via intracerebroventricular injection which was performed at weeks three, four, and five after cannulation. Following the third injection, behavioral analyses, and Grin2a expression assays on harvested tissues (e.g., hippocampus, cortex, striatum, cerebellum, and CSF) were performed at the indicated time points. FIG. 10B shows RT-qPCR analysis of Grin2a mRNA expression in frontal cortex and hippocampus tissue of mouse subjects harvested after the last of three intracerebroventricular injections of 100 pg of ASOs. Expression analysis shown as the mean percentage of the vehicle-control group. Dark / light shades represent two different qPCR probe sets. Each dot represents an animal. Errors bars show standard error of the mean (*:p<0.001 by linear regression). N (# of subjects treated with vehicle / # of subjects treated with ASO) = 10-12. FIG. 10C shows the composite data derived from the RT-qPCR analyses of Grin2a mRNA expression in frontal cortex tissue as shown in FIG. 10B (***:p<0.001 by linear regression). FIG. 10D shows representative data from an open field behavioral assay. For each subject, median values were calculated across six time bins (0-5 min, 5-10 min, 10-15 min, 15-20 min, 20-25 min, and 25-30 min post-administration). Histograms represent mean values across mouse subjects. Error bars indicate standard error of the mean (*:p<0.05 by linear regression). N (# of subjects treated with vehicle / # of subjects treated with ASO) = 10-12 per treatment group.

[0050] FIGs. 11A-11B show representative data of GRIN2A ASO pharmacokinetics (ASO levels) and pharmacodynamics (Grin2a mRNA expression) in brain tissue samples obtained from mouse subjects. In this figure, “ASO” refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein), “pg / g” refers to micrograms of ASO per gram of tissue sample. FIG. 11A is a table showing ASO levels and Grin2a mRNA levels as a result of unilateral intracerebroventricular (“ICV”) injection of ASO into the frontal cortex and hippocampus of mouse subjects. mRNA knockdown is shown as a negative range indicating the percent reduction of Grin2a mRNA levels relative to subjects that underwent ICV injection with vehicle (artificial CSF). *:p<0.05, **:p<0.01, ***:p<0.001. “NS” indicates not statistically significant. FIG. 11B shows the correlation (“PK / PD Correlation”) between ASO pharmacokinetics (x-axis; ASO levels) and ASO pharmacodynamics (y-axis; Grin2a mRNA knockdown) in hippocampus tissue samples obtained from injected mouse subjects. “P” value indicates statistical significance of “R” correlation coefficient which were determined from the statistical analysis of the data shown in FIG. 11 A.

[0051] FIG. 12 shows a non-limiting example of a study design wherein non-human primate subjects were administered a series of two intrathecal injections of either vehicle (artificial CSF), ASO at a dose of 20 mg (10 mg+10 mg), or ASO at a dose of 40 mg (20 mg+20mg). Each intrathecal injection was performed two weeks apart (days 1 and 14).

[0052] FIGs. 13A-13G show representative ASO pharmacokinetics data (ASO levels) and pharmacodynamics (GRIN2A mRNA expression) in central nervous system tissue samples obtained from non-human primate and mouse subjects injected with ASOs. Non-human primate (“NHP”) subjects were administered a series of two intrathecal injections performed two weeks apart, wherein subjects underwent intrathecal injection with either vehicle (artificial CSF), ASO at a “low dose” of 20 mg (10 mg+10 mg), or ASO at a “high dose” of 40 mg (20 mg+20mg). Mouse subjects were administered a single intracerebroventricular injection or a series of two intracerebroventricular injections performed one week apart, wherein mouse subjects underwent intracerebroventricular injection with either vehicle (artificial CSF), ASO at a “low dose” of 100 pg (50 pg+50 pg), or ASO at a “high dose” of 200 pg (100 pg+100 pg). N=2-3 for non-human primate subjects and N=4-5 for mouse subjects. Each dot on the graph represents a respective subject. In this figure, “ASO” refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein), “pg / g” refers to micrograms of ASO per gram of tissue sample. FIG. 13A shows ASO levels in frontal cortex samples obtained from injected non-human primate subjects (left panel) and injected mouse subjects (right panel). Bars indicate mean + / - standard deviation. FIG. 13B shows ASO levels in frontal cortex samples obtained from injected non-human primate subjects (left panel) and injected mouse subjects (right panel). Bars indicate mean + / - standard error of the mean. FIG. 13C shows ASO levels in hippocampus samples obtained from injected non-human primate subjects (left panel) and mouse subjected (right panel). Bars indicate mean + / - standard error of the mean. FIG. 13D shows ASO levels in frontal cortex (“Cortex”), hippocampus, and lumbar spinal cord (“Lumbar SC”) samples obtained from injected non-human primate subjects that received either a low dose (left panel) or a high dose (right panel) of ASO. Bars indicate mean + / - standard deviation. FIG. 13E shows RT-qPCR analysis data for GRIN2A mRNA expression in frontal cortex tissue samples obtained from injected non-human primate subjects that that received a high dose of ASO. Bars indicate mean + / - standard deviation. FIG. 13F shows RT- qPCR analysis data which was obtained using two different GRIN2A probes (dark and light shaded bars) measuring GRIN2A mRNA expression in frontal cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF), a low dose of ASO or a non-specific ASO, or a high dose of ASO or a non-specific ASO. GRIN2A mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean + / - standard deviation. FIG. 13G shows a comparison of the data in FIG. 13F obtained by RT-qPCR analysis of GRIN2A mRNA expression in frontal cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle, a low dose of ASO, or a high dose of ASO. GRIN2A mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean + / - standard deviation. (*): p<0.1 by ANOVA. FIG. 13H shows RT-qPCR analysis data for GPJN2A mRNA expression in frontal cortex tissue samples obtained from injected non-human primate subjects that that received either a low dose or a high dose of ASO. Bars indicate mean + / - standard error of the mean. *: p<0.1 by ANOVA. FIG. 131 shows RT-qPCR analysis data which was obtained using two different GPJN2A probes (dark and light shaded bars) measuring GPJN2A mRNA expression in sensory cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF), a low dose of ASO or a non-specific ASO, or a high dose of ASO or a non-specific ASO. GPIN2A mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean + / - standard deviation. FIG. 13J shows RT-qPCR analysis data which was obtained using two different GRIN2A probes (left and right panels) for measuring GRIN2A mRNA expression in sensory cortex tissue samples obtained from injected non-human primate subjects that that received either a low dose or a high dose of ASO. Bars indicate mean + / - standard deviation. FIG. 13K shows RT-qPCR analysis data which was obtained using two different GRIN2A probes (left and right panels) measuring GRIN2A mRNA expression in sensory cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF), a low dose of ASO or a high dose of ASO. GRIN2A mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean + / - standard deviation. P-values were determined by linear regression. FIG. 13L shows RT-qPCR analysis data which was obtained using two different GRIN2A probes (left and right panels) measuring GRIN2A mRNA expression in sensory cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF) or a high dose of ASO. GRIN2A mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean + / - standard deviation. P-values were determined by unpaired T-test. FIG. 13M shows RT-qPCR analysis data which was obtained using two different GPIN2A probes (left and right panels) measuring GPIN2A mRNA expression in sensory cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF), a low dose of ASO or a high dose of ASO. GPJN2A mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean + / - standard error of the mean. P-values were determined by linear regression. P=values were determined by ANOVA. FIG. 13N shows a comparison of pharmacodynamics in frontal cortex (left panel) and sensory cortex (right panel) tissue samples as a result of intrathecal administration of ASO at low and high doses. *:p<0.05 and (*):p<0.1 for treatment vs. vehicle by unpaired T-test. Bars indicate mean + / - standard error of the mean. FIG. 130 shows a table representation of the data shown in FIGs. 13F-13M. Mean knockdown levels are shown as the percent difference from the vehicle group. Mean knockdown levels were analyzed over a 95% confidence interval (“CI”) (lower and upper limits shown in brackets). P-values associated with the mean knockdown levels as determined from confidence interval analysis are shown in scientific notation. The “IDT” probe and the “Thermo” probe corresponds to the dark and light shaded bars, respectively, in FIGs. 13F, 13G, and 131.

[0053] FIGs. 14A-14G show the representative data for the effect of GPIN2A ASOs in mouse seizure models. Each dot represents an animal. Bars indicate mean. Error bars indicate standard error of the mean ((*):p<0.1, *:p<0.05, **:p<0.01, ***:p<0.001 for Treatment vs. Vehicle by ANOVA followed by Dunnett’s test for all plots except % Survival). Statistics for % Survival reflected for Treatment vs. Vehicle compared by chi-square, no multiple testing correction). N (# of subjects treated with vehicle / # of subjects treated with ASO) = 9-12. In this figure, “ASO 1” refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 . In this figure, “ASO 2” refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1. FIG. 14A shows a schematic depicting a study design wherein mouse subjects received either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2 via intracerebroventricular injection which was performed at weeks three, four, and five after cannulation. Prior to observations, all mouse subjects received 85 mg / kg pentylenetetrazol. A positive control group was also used wherein mouse subjects received 400 mg / kg of Valproate via intraperitoneal injection. In parallel, Grin2a expression assays were performed on tissue samples (e.g., hippocampus, cortex, striatum, cerebellum, and CSF) harvested from mouse subjects following the third injection with vehicle (artificial CSF) or ASO 1 or ASO 2. FIG. 14B shows latency to death analyses of mouse subjects after intraperitoneal injection of 400 mg / kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. FIG. 14C shows survival analyses of mouse subjects after intraperitoneal injection of 400 mg / kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. FIG. 14D shows latency to first tonic seizure analyses of mouse subjects after intraperitoneal injection of 400 mg / kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. FIG. 14E shows latency to first twitch analyses of mouse subjects after intraperitoneal injection of 400 mg / kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. FIG. 14F shows latency to first clonic seizure / tonic seizure analyses of mouse subjects after intraperitoneal injection of 400 mg / kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. FIG. 14G shows a line plot of seizure scoring data from analyses of mouse subjects after intraperitoneal injection of 400 mg / kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2.

[0054] FIGs. 15A-15D show representative pharmacodynamics data for silencing of Grin2a in brain tissue samples harvested from mouse seizure models following intracerebroventricular injection of three doses of vehicle (artificial CSF) or GRIN2A ASOs. Expression analysis data was averaged across 3 technical replicates and shown as a percentage of the vehicle-control group. Each dot represents an animal. Bars indicate mean. Error bars indicate standard error of the mean ((*):p<0.1, *:p<0.05, **:p<0.01, ***:p<0.001 by linear regression). N (# of subjects treated with vehicle / # of subjects treated with ASO) = 9-12. In this figure, “ASO 1” refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1; “ASO 2” refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1. FIG. 15A shows RT-qPCR analysis data for Grin2a mRNA expression in cortex tissue of mouse subjects harvested after intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. Expression analysis data was obtained using a single qPCR probe. FIG. 15B shows RT-qPCR analysis of Grin2a mRNA expression in cortex tissue of mouse subjects harvested after intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. Expression analysis data was obtained using two different qPCR probe sets represented by dark / light shades. FIG. 15C shows RT-qPCR analysis of Grin2a mRNA expression in hippocampus tissue of mouse subjects harvested after intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. Expression analysis data was obtained using a single qPCR probe. FIG. 15D shows RT-qPCR analysis of Grin2a mRNA expression in hippocampus tissue of mouse subjects after intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. Expression analysis data was obtained using two different qPCR probe sets represented by dark / light shades.

[0055] FIGs. 16A-16B show statistical analyses of representative pharmacodynamics data for silencing of Grin2a in brain tissue samples from mouse seizure model subjects. Samples were harvested from mouse subjects after intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) with an ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to herein as “ASO 1”) or an ASO comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1 (also referred to herein as “ASO 2”). Expression data was obtained by performing RT-qPCR with two different probes and averaged across 3 technical replicates. Mean knockdown levels are shown as the percent difference from the vehicle-control group. Mean knockdown levels were also analyzed over a 95% confidence interval (“CI”) (lower and upper limits shown in brackets). P-values associated with the mean knockdown levels as determined from confidence interval analysis are shown in scientific notation. N (# of subjects treated with vehicle / # of subjects treated with ASO) = 9-12. FIG. 16A shows RT-qPCR analysis data for Grin2a mRNA expression in cortex tissue samples from mouse seizure models. FIG. 16B shows RT-qPCR analysis data for Grin2a mRNA expression in hippocampus tissue samples from mouse seizure models.

[0056] FIGs. 17A-17J show representative immunostimulatory effects of GRIN2A ASO on human peripheral blood mononuclear cells (huPBMCs) that were harvested from healthy donors. huPBMCs were either untreated (“mock” and “media”), treated with a cytokine / chemokine response control agent (CL097, TL8-506, R837, XD-01024, poly(l:c), ODN2006, or ODN2006 negative control), or treated with ASO at a concentration of 1 pM, 3pM, or lOpM for 24 hours (indicated on x-axes). Cytokine / chemokine levels were then analyzed using the MSD-U-Plex platform (indicated by y-axes). In this figure, “ASO” refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1. Plots show mean + / - standard error. Each dot represents an individual donor. N=4 donors (2 male and 2 female). FIG. 17A shows analyses of IFN-a2a levels. FIG. 17B shows analyses of IFN-b levels. FIG. 17C shows analyses of IL- IB levels. FIG. 17D shows analyses of IL-6 levels. FIG. 17E shows analyses of IL-10 levels. FIG. 17F shows analyses of IP-10 levels. FIG. 17G shows analyses of MCP-1 levels. FIG. 17H shows analyses of MIP-la levels. FIG. 171 shows analyses of MIP-lb levels. FIG. 17J shows analyses of TNF-a levels.

[0057] FIG. 18 shows a non-limiting example of a study design wherein non-human primate subjects were administered a series of four intrathecal injections of either vehicle (artificial CSF) or ASO at a dose of 100 mg (30 mg + 30 mg + 20 mg + 20 mg). Each intrathecal injection was performed two weeks apart (days 0, 14, 28 and 42). FIG. 19 shows ASO levels in dorsal root ganglion (DRG), hippocampus, lumbar spinal cord, motor cortex, prefrontal cortex, and temporal cortex samples obtained from injected nonhuman primate subjects and assessed by liquid chromatography -tandem mass spectrometry (LC- MS / MS). Non-human primate subjects received ASO at a dose of 100 mg (30 mg + 30 mg + 20 mg + 20 mg) by intrathecal injection as illustrated in FIG. 18. The indicated samples were obtained at two weeks post-final injection of ASO (day 56). Each dot represents a sample from obtained from a different non-human primate subject. N = 2-3 for each of the indicated groups of samples. Bars show mean + / - standard error of the mean. In this figure, “ASO 1” refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1.

[0058] DETAILED DESCRIPTION

[0059] Aspects of the disclosure relate to compositions and methods for modulating a level, transcription, splicing, and / or translation of one or more RNA transcripts (e.g., mRNA transcripts) in a cell or subject. The disclosure is based, in part, on isolated nucleic acids that bind to mRNA transcripts of genes involved in glutamate signaling, for example genes encoding subunits of NMD A receptors, for example GRIN2A. In some embodiments, compositions of the disclosure are useful for treating diseases or disorders associated with dysregulation of glutamate signaling, such as schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.). In some embodiments, compositions of the disclosure are useful for treating (e.g., reducing) NMDA receptor-mediated excitotoxicity in a subject in need thereof.

[0060] Glutamate Signaling Glutamate is the anion of glutamic acid and acts as an excitatory neurotransmitter that is involved in modulating a variety of biological processes. Glutamate signals through three different receptor types: AMP A receptors, NMD A receptors, and metabotropic glutamate receptors. Glutamate signaling through NMDA receptors is important for controlling synaptic plasticity and mediating learning and memory functions.

[0061] Glutamate signaling also plays a major role in psychiatric diseases and disorders, and genes associated with glutamate signaling have traditionally served as an important therapeutic target for managing these indications. Accordingly, aspects of the disclosure relate to compositions for altering a level, transcription, splicing, and / or translation of genes associated with glutamate signaling.

[0062] A “gene associated with glutamate signaling” refers to a gene encoding a gene product (e.g., an mRNA, protein, etc.) that is genetically, biochemically, or functionally associated with the release, reuptake, and or interaction between glutamate and a glutamate receptor (e.g., an NMDA receptor, for example an NMDA receptor comprising at least one GRIN2A subunit) in a cell or subject. In some embodiments, a gene associated with glutamate signaling is a gene comprising a gain-of-function mutation in an NMDA subunit encoding sequence. In some embodiments, a gene associated with glutamate signaling is GRIN2A. In some embodiments, a gene associated with glutamate signaling is a GRIN2A gene comprising a gain-of-function mutation.

[0063] In some embodiments, a gene associated with glutamate signaling encodes an mRNA encoding a GRIN2A protein. In humans, GRIN2A is encoded by the GRIN2A gene, located on chromosome 16 (e.g., encoded by Ensembl ID NO: ENSG00000183454, Chromosome 16: 9,753,404-10,182,928 reverse strand). GRIN2A encodes the GluN2A component of the NMDA receptor. In some embodiments, GRIN2A encodes a peptide that is represented by NCBI Reference Sequence NP_000824.1, NP_001127879.1, or NP_001127880.1. In some embodiments, a GRIN2A gene encodes an mRNA comprising the sequence set forth in NCBI Reference Sequence NM_000833.5, NM_001134407.3, or NM_001134408.2. In some embodiments, an mRNA is encoded by a GRIN2A gene and comprises one of the sequences set forth below: TCACTGGGAAGGGATGCTAATTGCCTACTTAAGATATAAGTTCAAGAATAACATTTTCATAGAAAATTCAGAAAACT GCTTGACACAGCAGTGACATAGTTAGATGTGGCTCAGATGCCTTCCAAACCTGAGGGTCCCCAAAGATTTCTTTACC AGTTGTTTTTAACTATGAATCTTAATCTTGTTCATTCCCCTGCCAAAACAAATTTAAAAGCATAAACCTGCTGAATT AAT T GGCAGAAT T GAG CAT AGT T TAT AT CAC C C CAGAAT GT T TAT GT GT AT AT GT T TAT GT AT AGT AT AT AT AT T T C AAGCTGAATGTTCAGAAAGAATAAGGTGAGTTTCTTGGTAGCTTGAATAAGAATTAGATCATAAAAATTATAAATAA TGGCCTTCTCAAAGAGGATAAATGATTCATTTTTCACTCACGTATTAATAATATGACTTGTTGCATAATACACAAGC TGGTCATTGCCTGCAAGAAAGTTATTGAATTAAGCAGCTATCCAGGTTTATGTCTGAGTCCATTTTTAACCCAACAA GGCTAGGATTGAACTCCATATGCAGAGGGTTTCTATTCACAGCTACATTCAAACAGAATCCAAAACCCACATCAGAA CTGACTTGATGTCTTGTATGGTGGAGCTGAAAGCAAGCTGTCTGCTCTAAGCAATGGTCTTCATTTGGGAATTAATG TTCACTGATCAACTGCAGCAGTTTATATCTGTCATGTTTTAATCCACTGCATGAGGAAGTGCTAATAAGTGTATTAA ATATTTCCAAGCATAGCTACAAAATTATATGTTTGCTTAACACCTTTCTATGATAGAGGAAGTATATACTATGGTTG TCTTCTTGTAGTATGTCTTTTAATTTTGTTCAATGTGTTATCAACTGTTTTAAGGAATGGGGATTGAAATTCGTGTG CAAACT GATAT GTATATAACT CCT GAGGCAACAGAAGT GCCCGGT CATAT GGT GTAAAAAT GTAAATACAGGAAAAT TTCATTTTTCTAATAAAGATAATTTCTGCCAATTGATATGAAAATGA ( SEQ ID NO : 270 )

[0064] NM_001134407,3

[0065] CTCTTTCTCTCCCTACCTCCCTCGCTCAGCAGCTCCCGGTCGCACAACTCCCAGCAGCCGGCGCTGGGGAGGTGGTA GGGGGTGCGGGTGGAGGTGCCCAGTTAGCTTCTCGTGGGTGGCCAACCTGGGGCTCCCATTCTCCTGTGCACCCTGG AGTGGAGCTCCCGCTATCAGCCACAGGGGCTGAGGATCCGCACTGGGGGCGTCGTGGGCATCGGGCTTCAGCTTCCC CCCTCTTGTCTAGCCCCCCTGGGCGCATAGGGGGGCTTGTGAGCACTGCAGACTGCAGCCTTCCCCTCAACCCTCCC TCCCCTCGTTGGTGGGCTGACCCTGCCTCTCCTTCTCTCCTCCGCCCCGTTAGAGCCCTGCTGCAGAGCCTCCGGCT GGGATAGCCGCCCCCCGTGGGGGCGATGCGGACAGCGCGGGACAGCCAGGGGAGCGCGCTGGGGCCGCAGCATGCGG GAACCCGCTAAACCCGGTGGCTGCTGAGGCGGCCGAGATGCTCGTGCGCGCAGCGCGCCCCACTGCATCCTCGACCT TCTCGGGCTACAGGGACCGTCAGTGGCGACTATGGGCAGAGTGGGCTATTGGACCCTGCTGGTGCTGCCGGCCCTTC TGGTCTGGCGCGGTCCGGCGCCGAGCGCGGCGGCGGAGAAGGGTCCCCCCGCGCTAAATATTGCGGTGATGCTGGGT CACAGCCACGACGTGACAGAGCGCGAACTTCGAACACTGTGGGGCCCCGAGCAGGCGGCGGGGCTGCCCCTGGACGT GAACGTGGTAGCTCTGCTGATGAACCGCACCGACCCCAAGAGCCTCATCACGCACGTGTGCGACCTCATGTCCGGGG CACGCATCCACGGCCTCGTGTTTGGGGACGACACGGACCAGGAGGCCGTAGCCCAGATGCTGGATTTTATCTCCTCC CACACCTTCGTCCCCATCTTGGGCATTCATGGGGGCGCATCTATGATCATGGCTGACAAGGATCCGACGTCTACCTT CTTCCAGTTTGGAGCGTCCATCCAGCAGCAAGCCACGGTCATGCTGAAGATCATGCAGGATTATGACTGGCATGTCT TCTCCCTGGTGACCACTATCTTCCCTGGCTACAGGGAATTCATCAGCTTCGTCAAGACCACAGTGGACAACAGCTTT GTGGGCTGGGACATGCAGAATGTGATCACACTGGACACTTCCTTTGAGGATGCAAAGACACAAGTCCAGCTGAAGAA GATCCACTCTTCTGTCATCTTGCTCTACTGTTCCAAAGACGAGGCTGTTCTCATTCTGAGTGAGGCCCGCTCCCTTG GCCTCACCGGGTATGATTTCTTCTGGATTGTCCCCAGCTTGGTCTCTGGGAACACGGAGCTCATCCCAAAAGAGTTT CCATCGGGACTCATTTCTGTCTCCTACGATGACTGGGACTACAGCCTGGAGGCGAGAGTGAGGGACGGCATTGGCAT CCTAACCACCGCTGCATCTTCTATGCTGGAGAAGTTCTCCTACATCCCCGAGGCCAAGGCCAGCTGCTACGGGCAGA TGGAGAGGCCAGAGGTCCCGATGCACACCTTGCACCCATTTATGGTCAATGTTACATGGGATGGCAAAGACTTATCC TTCACTGAGGAAGGCTACCAGGTGCACCCCAGGCTGGTGGTGATTGTGCTGAACAAAGACCGGGAATGGGAAAAGGT GGGCAAGTGGGAGAACCATACGCTGAGCCTGAGGCACGCCGTGTGGCCCAGGTACAAGTCCTTCTCCGACTGTGAGC CGGATGACAACCATCTCAGCATCGTCACCCTGGAGGAGGCCCCATTCGTCATCGTGGAAGACATAGACCCCCTGACC GAGACGTGTGTGAGGAACACCGTGCCATGTCGGAAGTTCGTCAAAATCAACAATTCAACCAATGAGGGGATGAATGT GAAGAAATGCTGCAAGGGGTTCTGCATTGATATTCTGAAGAAGCTTTCCAGAACTGTGAAGTTTACTTACGACCTCT AT CT GGT GACCAAT GGGAAGCAT GGCAAGAAAGTTAACAAT GT GT GGAAT GGAAT GAT CGGT GAAGT GGT CTAT CAA CGGGCAGTCATGGCAGTTGGCTCGCTCACCATCAATGAGGAACGTTCTGAAGTGGTGGACTTCTCTGTGCCCTTTGT GGAAACGGGAATCAGTGTCATGGTTTCAAGAAGTAATGGCACCGTCTCACCTTCTGCTTTTCTAGAACCATTCAGCG CCTCTGTCTGGGTGATGATGTTTGTGATGCTGCTCATTGTTTCTGCCATAGCTGTTTTTGTCTTTGAATACTTCAGC CCTGTTGGATACAACAGAAACTTAGCCAAAGGGAAAGCACCCCATGGGCCTTCTTTTACAATTGGAAAAGCTATATG GCTTCTTTGGGGCCTGGTGTTCAATAACTCCGTGCCTGTCCAGAATCCTAAAGGGACCACCAGCAAGATCATGGTAT CTGTATGGGCCTTCTTCGCTGTCATATTCCTGGCTAGCTACACAGCCAATCTGGCTGCCTTCATGATCCAAGAGGAA TTTGTGGACCAAGTGACCGGCCTCAGTGACAAAAAGTTTCAGAGACCTCATGACTATTCCCCACCTTTTCGATTTGG GACAGTGCCTAATGGAAGCACGGAGAGAAACATTCGGAATAACTATCCCTACATGCATCAGTACATGACCAAATTTA ATCAGAAAGGAGTAGAGGACGCCTTGGTCAGCCTGAAAACGGGGAAGCTGGACGCTTTCATCTACGATGCCGCAGTC TTGAATTACAAGGCTGGGAGGGATGAAGGCTGCAAGCTGGTGACCATCGGGAGTGGGTACATCTTTGCCACCACCGG TTATGGAATTGCCCTTCAGAAAGGCTCTCCTTGGAAGAGGCAGATCGACCTGGCCTTGCTTCAGTTTGTGGGTGATG GTGAGATGGAGGAGCTGGAGACCCTGTGGCTCACTGGGATCTGCCACAACGAGAAGAACGAGGTGATGAGCAGCCAG CTGGACATTGACAACATGGCGGGCGTATTCTACATGCTGGCTGCCGCCATGGCCCTTAGCCTCATCACCTTCATCTG GGAGCACCTCTTCTACTGGAAGCTGCGCTTCTGTTTCACGGGCGTGTGCTCCGACCGGCCTGGGTTGCTCTTCTCCA TCAGCAGGGGCATCTACAGCTGCATTCATGGAGTGCACATTGAAGAAAAGAAGAAGTCTCCAGACTTCAATCTGACG

[0066] The skilled artisan recognizes that when referring to a gene sequence encoding an mRNA, the sequence of the mRNA is identical to the recited gene sequence, except that each instance of “T” is replaced with “U”.

[0067] Aspects of the disclosure relate to methods for reducing glutamate signaling in subjects having certain psychiatric diseases and disorders. In some embodiments, the subjects do not have any mutations in either allele of their GRIN2A gene (e.g., the subjects have wild type GRIN2A protein).

[0068] However, in some embodiments, a GRIN2A gene (or an mRNA encoded by a GRIN2A gene) comprises one or more nucleotide substitutions, the one or more nucleotide insertions, and / or the one or more nucleotide deletions relative to a wild type GRIN2A gene (or mRNA encoded by a wild type GRIN2A gene), and may be referred to as a “mutant” GRIN2A gene or a GRIN2A variant. The number of nucleotide substitutions, nucleotide insertions, and / or nucleotide deletions in a GRIN2A variant may vary. In some embodiments, a GRIN2A variant comprises between 1 and 20, 5 and 10, 2 and 15, 10 and 30, or 20 and 100 nucleotide substitutions, nucleotide insertions, and / or nucleotide deletions relative to a wild type GRIN2A gene (or mRNA encoded by a wild type GRIN2A gene). In some embodiments, the one or more nucleotide substitutions, the one or more nucleotide insertions, and / or the one or more nucleotide deletions results in an amino acid substitution in the protein encoded by the GRIN2A variant. In some embodiments, the one or more nucleotide substitutions, the one or more nucleotide insertions, and / or the one or more nucleotide deletions results in a nonsense mutation (e.g., insertion of a premature stop codon) in an mRNA encoded by the GRIN2A variant.

[0069] In some embodiments, the one or more nucleotide substitutions, the one or more insertions, and / or the one or more deletions results in a frameshift mutation of the GRIN2A variant relative to a wild type GRIN2A gene. In some embodiments, a mutation or mutations present in a GRIN2A variant result in the production of one or more splice variants of GRIN2A mRNA. A “splice variant” may refer to a mRNA resulting from one or more mutations in a DNA sequence that occur at the boundary of an exon and an intron (splice site) of a gene. Splice site mutations generally disrupt RNA splicing and result in the loss of exons or the inclusion of introns and an altered protein-coding sequence (e.g., a “splice variant”).

[0070] Aspects of the disclosure relate to isolated nucleic acids, for example RNA processing modulators (e.g., ASOs) that bind to one or more target regions of an mRNA encoded by a gene associated with glutamate signaling. In some embodiments, the isolated nucleic acids bind to more or more splice variants of a GRIN2A gene (e.g., a human GRIN2A splice variant). In some embodiments, an isolated nucleic acid described by the disclosure binds to a region of a GRIN2A splice variant (e.g., mRNA encoded by a GRIN2A variant) selected from an untranslated region (UTR). In some embodiments, the UTR is a 5' UTR. In some embodiments, the UTR is a 3' UTR. In some embodiments, the UTR is an intron. In some embodiments, an isolated nucleic acid described by the disclosure binds to an intron-exon boundary of a GRIN2A splice variant (e.g., mRNA encoded by a GRIN2A variant). An intron-exon boundary refers to a contiguous nucleotide sequence that includes portions of an intron and exon that are adjacent to one another in the mRNA transcript. In some embodiments, an isolated nucleic acid (e.g., antisense oligonucleotide) binds to an mRNA expressed from a particular allele of GRIN2A (e.g., binds to a target mRNA in an allele-specific manner).

[0071] Isolated nucleic acids

[0072] In some embodiments of the present disclosure, a nucleic acid is an isolated nucleic acid. In some cases, nucleic acids are alternatively referred to as oligonucleotides. In some embodiments, an isolated nucleic acid comprises DNA (e.g., deoxyribonucleotides). In some embodiments, an isolated nucleic acid comprises RNA (e.g., ribonucleotides). In some embodiments, an isolated nucleic acid comprises both DNA (e.g., deoxyribonucleotides) and RNA (e.g., ribonucleotides), such as an isolated nucleic acid comprising a gapmer structure that comprises a region of deoxyribonucleotides which are flanked by regions of ribonucleotides. An isolated nucleic acid may be single stranded or double stranded. In some embodiments, the isolated nucleic acid is an RNA oligonucleotide. In some embodiments, the isolated nucleic acid is a single stranded RNA oligonucleotide (which may also be referred to as a single stranded RNA polynucleotide).

[0073] As used herein, the term “isolated” means artificially produced. Artificial production of an isolated nucleic acid may be achieved, for example, through amplification in vitro through polymerase chain reaction (PCR), recombinant cloning, or chemical synthesis. Methods of synthesizing isolated nucleic acids, for example RNAs, are known in the art, for example as described by Soukchareun et al. Preparation and characterization of antisense oligonucleotidepeptide hybrids containing viral fusion peptides. Bioconjug Chem. 1995 Jan-Feb;6(l):43-53. doi: 10.1021 / bc00031a004. PMID: 7711103.

[0074] The length of an isolated nucleic acid may vary. In some embodiments, an isolated nucleic acid (e.g., a single stranded RNA) is 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or up to 100 nucleotides in length. In some embodiments, an isolated nucleic acid ranges from about 1 to 100, 2 to 30, 5 to 20, 10 to 40, or 20 to 80 nucleotides in length. In some embodiments, an isolated nucleic acid is between 10 and 50 nucleotides in length. In some embodiments, an isolated nucleic acid comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,

[0075] 48, 49, or 50 nucleotides in length. In some embodiments, an isolated nucleic acid is more than 50 nucleotides in length (e.g., 60, 70, 80, 90, 100, etc., nucleotides in length). In some embodiments, an isolated nucleic acid is no greater than 200 nucleotides in length. In some embodiments, an isolated nucleic acid comprises a nucleotide sequence that encodes a full length, wild type GRIN2A protein.

[0076] In some embodiments, an isolated nucleic acid of the disclosure comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-269 (provided in column A of Table 1). In some embodiments, an isolated nucleic acid of the disclosure comprises an antisense oligonucleotide comprising at least 15 nucleotides (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleotides) of the any one of the sequences set forth in SEQ ID NOs: 1-269 (provided in column A of Table 1).

[0077] In some embodiments of the present invention, an isolated nucleic acid is modified (e.g., comprises one or more modifications (or modification patterns), for example chemical modifications (or modification patterns), such as those in column B of Table 1). A modified nucleic acid may refer to an oligonucleotide that has been structurally altered in a non-natural manner (e.g., a manner that does not occur in nature). Nucleic acid modifications may be used to endow the nucleic acid with specific functional characteristics relative to unmodified nucleic acids. In some embodiments, modification of an isolated nucleic acid promotes binding of the isolated nucleic acid to a target molecule or increases stability of the isolated nucleic acid (e.g., makes the isolated nucleic acid resistant to enzymatic degradation).

[0078] In some embodiments, the one or more modifications is between 1 and 50 modifications, 2 and 20, 5 and 30, 10 and 40, or 15 and 50 modifications. In some embodiments, an isolated nucleic acid comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,

[0079] 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,

[0080] 49, or 50 modifications. In some embodiments, an isolated nucleic acid comprises more than 50 modifications (e.g., up to 60, 70, 80, 90, or 100, etc., modifications). In some embodiments, an isolated nucleic acid comprises chemical modifications on each nucleotide and each sugarphosphate backbone linkage. Such a modified isolated nucleic acid may be referred to as a “fully modified” isolated nucleic acid. In some embodiments, not all nucleotides of an isolated nucleic acid are modified. A chemical modification may comprise a modification of a nucleobase or a nucleotide, and / or a modification of a sugar-phosphate backbone (e.g., modification of one or more sugarphosphate backbone linkages).

[0081] In some embodiments, an isolated nucleic acid of the disclosure comprises one or more chemical modification(s) listed in Column B of Table 1. In some embodiments, an isolated nucleic acid of the disclosure comprises a modification pattern (e.g., all of the mutations) listed in a line of Column B of Table 1. In some embodiments, an isolated nucleic acid comprises one or more modifications to a 5' carbon atom (e.g., a 5'-carbon atom of a sugar) and / or one or more modifications to a 5-carbon of a nucleobase. Examples of modifications include, but are not limited to, 5-(2-amino)propyl uridine, 5-bromo uridine, 5-propyne uridine, 5-propenyl uridine, 5-carboxymethylaminomethyl-2 -thiouracil, and 5-carboxymethylaminomethyl uracil. In other embodiments, the nucleic acid modification is targeted to the 6-carbon atom of a nucleobase. In some embodiments, an isolated nucleic acid comprises one or more modifications to a 6-carbon atom (e.g., a 6-carbon atom of a nucleobase) for example a 6-(2-amino)propyl uridine. In some embodiments, an isolated nucleic acid comprises one or more modifications to an 8-carbon atom (e.g., an 8-carbon atom of a nucleobase). Examples of 8 modifications include, but are not limited to, 8-bromo guanosine, 8-chloro guanosine, and 8-fluoroguanosine.

[0082] In some embodiments, an isolated nucleic acid comprises one or more modifications to a 2' carbon of the sugar group. Examples of modified sugar groups include, but are not limited to, D-ribose, 2'-O-alkyl (including 2'-O-methyl and 2'-O-ethyl), i.e., 2'-alkoxy, 2'-amino, 2'-S-alkyl, 2'-halo (including 2’ -fluoro), 2'-2-O-methoxy ethoxy, 2'-allyloxy (-OCH2CH=CH2), 2'- propargyl, 2'-propyl, ethynyl, ethenyl, propenyl, and cyano and the like. In some embodiments, a modified sugar moiety comprises a hexose and incorporated into an oligonucleotide as described (Augustyns, K., et al., Nucl. Acids. Res. 18:4711 (1992)). Other examples of 2' modifications include, but are not limited to, substitutions of the bound OH group with H, OR, R, F, Cl, Br, I, SH, SR, NH, NHR, NR, COOR, or, wherein R is a substituted or unsubstituted aliphatic group. Other 2' modifications are found in the art. The term “aliphatic,” as used herein, includes both saturated and unsaturated, straight chain (i.e., unbranched), branched, acyclic, cyclic, or polycyclic aliphatic hydrocarbons, which are optionally substituted with one or more functional groups. As will be appreciated by one of ordinary skill in the art, “aliphatic” is intended herein to include, but is not limited to, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, and cycloalkynyl moieties. In some embodiments, an isolated nucleic acid modification a sugar-phosphate backbone modification. One example of a phosphate group modifications is substitution of an oxygen atom with a sulfur atom. In other embodiments, the backbone of the nucleic acid is modified. Examples of backbone modifications include, but are not limited to, phosphorothioate, borano- phosphate, alkyl phosphonate nucleic acid, peptide nucleic acid, and morpholino. Morpholino backbones are described, for example by Corey and Abrams Genome Biol. 2001; 2(5): reviews 1015.1-reviews 1015.3.

[0083] Other examples of modified bases include N4,N4-ethanocytosine, 7-deazaxanthosine, 7- deazaguanosine, 8-oxo-N6-methyladenine, 4-acetylcytosine, dihydrouracil, inosine, N6- isopentenyl-adenine, 1 -methyladenine, 1 -methylpseudouracil, 1-methylguanine, 1- methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3 -methylcytosine, 5- methylcytosine, N6 -methyladenine, 7-methylguanine, 2-methylthio-N6-isopentenyladenine, pseudouracil, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 2-thiocytosine, and 2,6- diaminopurine. Other examples of nucleic acid modifications are described for example by Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2): 117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5): 333-45, Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85, Duffy. BMC Bio. 2020 Sep. 2(8): 112, and US Patent No. US5684143.

[0084] Additional modifications of isolated nucleic acids (e.g., ASOs) are described by Duffy et al. BMC Biology volume 18, Article number: 112 (2020), the entire contents of which are incorporated herein by reference.

[0085] In some embodiments, an isolated nucleic acid of the disclosure comprises a nucleic acid sequence from Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications, such as a modification pattern) from Column B of Table 1, optionally where Columns A and B are from the same row of Table 1.

[0086] RNA processing modulators

[0087] Aspects of the disclosure relate to compositions (e.g., isolated nucleic acids, agents, etc.) that modulate mRNAs encoded by genes associated with glutamate signaling. In some embodiments, the gene associated with glutamate signaling is GRIN2A (e.g., a human GRJN2A gene). In some embodiments, a composition comprises an RNA processing modulator. As used herein, an “RNA processing modulator” or “RPM” refers to an agent that binds to, and up- regulates, down-regulates, or otherwise change function or activity, of a target mRNA (e.g., an mRNA encoded by a gene associated with glutamate signaling, such as GRIN2A, or a gene product, such as a protein encoded by the mRNA) by affecting transcription, levels, splicing, and / or translation of the mRNA. An RNA processing modulator may be an isolated nucleic acid or ASO as described herein. In some embodiments, an RNA processing modulator is an isolated nucleic acid that affects transcription, levels, splicing, and / or translation of a target mRNA (e.g., an mRNA encoded by a GRIN2A gene). In some embodiments, an RNA processing modulator is an ASO that affects transcription, levels, splicing, and / or translation of a target mRNA (e.g., an mRNA encoded by a GRIN2A gene). In some embodiments, an mRNA (e.g., a target mRNA, such as an mRNA encoded by a GRIN2A gene) is a pre-mRNA (e.g., an RNA that has been transcribed from a gene, such as a GRIN2A gene, but has not been processed to remove introns, for example by splicing). In some embodiments, an mRNA is a mature mRNA that has been processed (e.g., an mRNA transcribed from a GRIN2A gene and that has undergone processing).

[0088] In some embodiments, an RNA processing modulator upregulates transcription, levels, splicing, and / or translation of a target mRNA. Upregulation of transcription, levels, splicing, and / or translation may comprise binding to a regulatory region (e.g., an untranslated region, such as a 5' UTR or 3' UTR) of a target mRNA and reducing non-productive splicing or translation initiation from alternative start codons present in the target mRNA, for example through steric blocking of non-productive splice site(s) or alternative start codons (such as “upstream alternative start codons” located in the 5' UTR of the target mRNA), or causing a mRNA frameshift (e.g., a splice variant) resulting in translation of a protein variant from the target mRNA that lacks one or more inhibitory domains.

[0089] The amount of upregulation of transcription, levels, splicing, and / or translation mediated by an RNA processing modulator may vary. In some embodiments, an RNA processing modulator increases transcription, levels, splicing, and / or translation of a target mRNA transcript (e.g., increases relative to a cell or subject prior to the administration of the RPM, or increases relative to a control cell or subject) between 1-fold and 100-fold, 2-fold and 10-fold, 5- fold and 20-fold, 10-fold and 30-fold, 20-fold and 50-fold, or 25-fold and 100-fold, or any value therebetween. In some embodiments, an RNA processing modulator increases transcription, levels, splicing, and / or translation of a target mRNA transcript more than 100-fold, for example at least 200-fold, 400-fold, 500-fold, or 1000-fold. In some embodiments, an RNA processing modulator increases transcription, levels, splicing, and / or translation of a target mRNA transcript no more than 1000-fold. In some embodiments, upregulation of a level, transcription, splicing, and / or translation of a target mRNA is useful to increase expression of a desired (e.g., wild-type) allele encoding the target mRNA.

[0090] In some embodiments, an RNA processing modulator downregulates transcription, levels, splicing, and / or translation of a target mRNA. Downregulation of transcription, levels, splicing, and / or translation may comprise binding to a regulatory region (e.g., an untranslated region, such as a 5' UTR or 3' UTR) of a target mRNA and blocking transcription the target mRNA, for example through steric blocking of a transcription initiation site, binding to an mRNA and subsequently initiating RNAse H-mediated degradation (e.g., in the context of a ‘gapmer’ RNA processing modulator), or causing an mRNA frameshift (e.g., a splice variant) resulting in translation of a protein variant from the target mRNA that is inactive, or has reduced function or activity (e.g., enzymatic activity, the ability to interact with other proteins to form protein complexes, etc.). In some embodiments, the resulting protein variant is a dominant negative protein variant. In some embodiments, downregulation of a level, transcription, splicing, and / or translation of a target mRNA is useful to increase expression of an undesirable (e.g., mutant, or disease-associated) allele encoding a target mRNA.

[0091] The amount of downregulation of transcription, levels, splicing, and / or translation mediated by an RNA processing modulator may vary. In some embodiments, an RNA processing modulator decreases transcription, levels, splicing, and / or translation of a target mRNA transcript between 1-fold and 100-fold, 2-fold and 10-fold, 5-fold and 20-fold, 10-fold and 30-fold, 20-fold and 50-fold, or 25-fold and 100-fold, or any value therebetween. In some embodiments, an RNA processing modulator decreases transcription, levels, splicing, and / or translation of a target mRNA transcript more than 100-fold, for example at least 200-fold, 400- fold, 500-fold, or 1000-fold. In some embodiments, an RNA processing modulator decreases transcription, levels, splicing, and / or translation of a target mRNA transcript no more than 1000- fold.

[0092] An RNA processing modulator may alter the number and / or character of splice variants of a target mRNA. In some embodiments, an RNA processing modulator increases (relative to natural transcription or translation of a target mRNA) the number of different splice variants of an mRNA, or the ratio between different splice variants of an mRNA. In some embodiments, an RNA processing modulator decreases (relative to natural transcription or translation of a target mRNA) the number of different splice variants of an mRNA, or the ratio between different splice variants of an mRNA. In some embodiments, contacting a target mRNA with an RNA processing modulator results in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more splice variants of the target mRNA being transcribed and / or translated. In some embodiments, contacting a target mRNA with an RNA processing modulator results in a single splice variant of the target mRNA being transcribed and / or translated.

[0093] The binding location of an RNA processing modulator may vary. In some embodiments, an RNA processing modulator affects splicing of the target mRNA. For example, an RNA processing modulator may bind to the target mRNA at a splice junction (e.g., a location spanning an intron-exon boundary) and mediate skipping of one or more exons in the mRNA transcript. In some embodiments, skipping of one or more exons in the target mRNA results in production of a truncated protein variant of the protein encoded by the target mRNA. In another example, an RNA processing modulator may bind to the target mRNA at a splice junction and mediate alternative splicing in which an intron is translated, and a protein variant of the target gene is produced. In some embodiments, an RNA processing modulator binds a target mRNA at a location comprising a coding sequence (e.g., a protein coding sequence or an exon).

[0094] In some embodiments, an RNA processing modulator comprises an agent selected from the group consisting of nucleic acid, peptide (including polypeptide), and small molecule. Examples of small molecule RNA processing inhibitors include but are not limited to translational readthrough-inducing drugs (TRIDs), such as certain aminoglycosides, nonaminoglycoside antibiotics (e.g., negamycin), ataluren (PTC 124), and amlexanox). Examples of peptides include but are not limited to activator proteins (e.g., transcription factors), suppressor proteins (e.g., inducible cAMP early repressor (ICER), bZIP repressor, SP1 repressor, certain histone deacetylases, etc.), antibodies, etc. Examples of nucleic acids include but are not limited to suppressor tRNAs, dsRNA, siRNA, micro-RNA (miRNA), artificial miRNA (ami-RNA), aptamers, and antisense oligonucleotides. In some embodiments, an RNA processing modulator comprises an antisense oligonucleotide (ASO).

[0095] As used herein, the term, “antisense nucleic acid,” or “ASO” refers to a single stranded nucleic acid that has sequence complementarity to a target sequence and is specifically hybridizable, e.g., under stringent conditions, with a nucleic acid having the target sequence. An antisense nucleic acid is specifically hybridizable when binding of the antisense nucleic acid to the target nucleic acid is sufficient to produce complementary base pairing between the antisense nucleic acid and the target nucleic acid, and there is a sufficient degree of complementarity to reduce or avoid non-specific binding of the antisense nucleic acid to non-target nucleic acid under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed. In some embodiments, an ASO is chemically synthesized. An ASO may be a DNA polynucleotide, an RNA polynucleotide, or a DNA / RNA polynucleotide (e.g., an ASO comprising a gapmer structure that comprises a region of deoxyribonucleotides flanked by regions comprising ribonucleotides; for example, in some embodiments, a “5-10-5” gapmer comprises a region of 10 deoxyribonucleotides flanked by two ribonucleotide regions each being 5 nucleotides in length).

[0096] Complementary refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an antisense nucleic acid is capable of hydrogen bonding with a nucleotide at the corresponding position of a target nucleic acid (e.g., target RNA), then the antisense nucleic acid and target nucleic acid are considered to be complementary to each other at that position. The antisense nucleic acid and target nucleic acid are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other through their bases. Thus, “complementary” is a term that is used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the antisense nucleic acid and target nucleic acid. However, it should be appreciated that 100% complementarity is not required. For example, in some embodiments, an antisense nucleic acid (e.g., an oligonucleotide) may be at least 80% complementary to (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to) the consecutive nucleotides of a target nucleic acid (e.g., a target nucleic acid comprising an mRNA sequence encoded by any one of SEQ ID NOs: 270-272).

[0097] Sequence identity, including determination of sequence complementarity for nucleic acid sequences, may be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position. In some embodiments, the percent identity between the two sequences is a function of the number of identical positions shared by the sequences (e.g., % homology=# of identical positions / total # of positions* 100), optionally penalizing the score for the number of gaps introduced and / or length of gaps introduced.

[0098] In some embodiments, an antisense oligonucleotide has a length in a range of 5 to 40 nucleotides, 5 to 30 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, or 15 to 25 nucleotides. In some embodiments of the disclosure, an antisense oligonucleotide comprises a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides.

[0099] In some embodiments, an antisense nucleic acid comprises a region of complementarity that is perfectly complementary to a portion of a target nucleic acid (e.g., 100% of the nucleotides of the ASO hybridize to the nucleotides of the target RNA, such as a target mRNA (e.g., an mRNA sequence encoded by any one of SEQ ID NOs: 270-272)). However, it should be appreciated that in some embodiments, an antisense nucleic acid comprises less than 100% sequence complementarity with a target nucleic acid (e.g., 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the nucleotides of the ASO hybridize to the nucleotides of the target RNA, such as a target mRNA (e.g., an mRNA sequence encoded by any one of SEQ ID NOs: 270-272)). In addition, to minimize the likelihood of off-target effects, an antisense nucleic acid may be designed to ensure that it does not have a sequence (e.g., of 5 or more consecutive nucleotides) that is complementary with an off-target nucleic acid (e.g., an mRNA that is not transcribed from a GRIN2A gene).

[0100] In some embodiments, an antisense oligonucleotide comprises a region of complementarity with an mRNA encoded by (e.g., transcribed from) a GRIN2A gene. In some embodiments, an antisense oligonucleotide comprises a region of complementarity with an mRNA encoded by the sequence as set forth in any one of SEQ ID NOs: 270-272. In some embodiments, the region of complementarity of the antisense nucleic acid hybridizes with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of a target nucleic acid (e.g., an mRNA encoded by the sequence set forth in any one of SEQ ID NOs: 270-272). In some embodiments, an antisense oligonucleotide comprises a region of complementarity with a 5' UTR, 3' UTR, an exonic sequence, a splice donor sequence, a splice acceptor sequence, or a lariat branch point encoded by a human GRIN2A gene. In some embodiments, an oligonucleotide binds to an mRNA expressed from a particular allele of GRIN2A (e.g., binds to a target mRNA in an allele-specific manner). In some embodiments, an antisense oligonucleotide comprises a region of complementarity with an mRNA encoded by (e.g., transcribed from) a GRIN2A gene. In some embodiments, an antisense oligonucleotide comprises a region of complementarity with a pre- mRNA sequence encoded by a human GRIN2A gene, for example (e.g., Ensembl ID NO: ENSG00000183454, Chromosome 16: 9,753,404-10,182,928 reverse strand). In some embodiments, the region of complementarity of the antisense nucleic acid hybridizes with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of a target nucleic acid (e.g., a pre-mRNA encoded by Ensembl ID NO: ENSG00000183454, Chromosome 16: 9,753,404-10,182,928 reverse strand). In some embodiments, the antisense oligonucleotide comprises a region of complementarity with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of an intron encoded by Ensembl ID NO: ENSG00000183454, Chromosome 16: 9,753,404- 10,182,928 reverse strand. The skilled artisan recognizes that the forward strand of such a nucleic acid encoding a pre-mRNA transcript or mRNA transcript may also be targeted.

[0101] In some embodiments, an antisense oligonucleotide comprises a region of complementarity that is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 continuous nucleotides complementary with an mRNA encoded by the sequence as set forth in any one of SEQ ID NOs: 270-272. In some embodiments, an antisense oligonucleotide comprising a region of complementarity with an mRNA transcript encoded by any one of SEQ ID NOs: 270-272 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-269, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises a sequence of 10 or more contiguous nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, or more contiguous nucleotides) of any one of the sequences set forth in SEQ ID NOs: 1- 269. In some embodiments, an antisense oligonucleotide comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-269, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprises a nucleotide sequence having one or more mismatches (e.g., one or more bases that is not complementary to the nucleotide at a given position of the target mRNA) relative to an mRNA transcript encoded by the sequence set forth in any one of SEQ ID NOs: 270-272. In some embodiments, an antisense oligonucleotide comprises a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches relative to an mRNA transcript encoded by the sequence set forth in any one of SEQ ID NOs: 270-272. In some embodiments, an antisense oligonucleotide comprising one or more mismatches relative to an mRNA transcript encoded by any one of SEQ ID NOs: 270-272 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a sequence of 10 or more contiguous nucleotides of any one of the sequences set forth in SEQ ID NOs: 1-269, as recited in Column A of Table 1. In some embodiments, an antisense oligonucleotide comprising at least 60% sequence identity to a sequence of 10 or more contiguous nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, or more contiguous nucleotides) of any one of one of the sequences set forth in SEQ ID Nos: 1-269 differs at one or more nucleotide positions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide positions comprising a substitution, an insertion, or a deletion) relative to the sequence of 10 or more contiguous nucleotides of any one of the sequences set forth in SEQ ID Nos: 1-269. In some embodiments, an antisense oligonucleotide comprising one or more mismatches relative to an mRNA transcript encoded by any one of SEQ ID Nos: 270-272 comprises at least 60% sequence identity (e.g., 60- 70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a nucleic acid sequence set forth in any one of SEQ ID Nos: 1-269. In some embodiments, an antisense oligonucleotide comprising at least 60% sequence identity to a nucleic acid sequence set forth in any one of SEQ ID Nos: 1-269 differs at one or more nucleotide positions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide positions comprising a substitution, an insertion, or a deletion) relative to the nucleic acid sequence set forth in any one of SEQ ID Nos: 1-269.

[0102] In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) are provided in a homogeneous preparation, e.g., in which at least 85%, at least 90%, at least 95%, or at least 99% of the RNA processing modulators (e.g., antisense oligonucleotides) are identical. In some embodiments, a homogeneous preparation is stereo-pure (e.g. diastereomeric). For example, in some embodiments, homogeneous preparations of antisense oligonucleotides are provided in which at least 85%, at least 90%, at least 95%, or at least 99% of the oligonucleotides in the preparation are 10 to 25 nucleotides in length and comprise a region of complementarity that is complementary with at least 6 contiguous nucleotides of an mRNA transcript encoded by a GRIN2A gene (e.g., a GRIN2A gene encoding an mRNA comprising the nucleic acid sequence set forth in any one of SEQ ID Nos: 270-272). In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) are provided in a heterogeneous preparation, e.g., comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different RNA processing modulators (e.g., antisense oligonucleotides each targeting a different sequence of a GRIN2A mRNA transcript).

[0103] RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may be modified to achieve one or more desired properties, such as, for example, improved cellular uptake, improved stability, reduced immunogenicity, improved potency, improved target hybridization, susceptibility to RNAse cleavage, etc. In some embodiments, an antisense nucleic acid is modified such that when present in a cell that contains a GRIN2A gene, it is capable of hybridizing with RNA (e.g., an mRNA, such as a mature mRNA or a pre-mRNA) transcribed from the GRIN2A gene without inducing cleavage of the RNA by an RNase. In some embodiments, an antisense nucleic acid is modified such that when present in a cell that contains a GRIN2A gene, it is capable of hybridizing with RNA transcribed from the GRIN2A gene and inducing cleavage of the RNA by an RNase.

[0104] RNA processing modulators (e.g., antisense oligonucleotides, e.g. a nucleic acid comprising the sequence set forth in any one of SEQ ID NOs: 1-269, as recited in column A of Table 1) can be modified at a base moiety, sugar moiety and / or phosphate backbone. Accordingly, RNA processing modulators (e.g., antisense oligonucleotides) may have one or more modified nucleotides (e.g., a nucleotide analog) and / or one or more backbone modifications (e.g., a modified internucleotide linkage). RNA processing modulators (e.g., antisense oligonucleotides) may have a combination of modified and unmodified nucleotides. RNA processing modulators (e.g., antisense oligonucleotides) may also have a combination of modified and unmodified internucleotide linkages. RNA processing modulators (e.g., antisense oligonucleotides) may comprise one or more chemical modifications (or combinations of chemical modifications) from Column B of Table 1. In some embodiments, an RNA processing modulator comprises a nucleic acid sequence from Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications) from Column B of Table 1, where Columns A and B are from the same row of Table 1.

[0105] In some embodiments, the one or more modifications is between 1 and 50 modifications, 2 and 20, 5 and 30, 10 and 40, or 15 and 50 modifications. In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 modifications. In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises more than 50 modifications (e.g., 60, 70, 80, 90, 100, etc., modifications). In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises no more than 100 modifications. In some embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) comprises chemical modifications on each nucleotide and each sugar-phosphate backbone linkage. Such a modified RNA processing modulator (e.g., antisense oligonucleotide) may be referred to as a “fully modified” RNA processing modulator (e.g., antisense oligonucleotide). In some embodiments, a fully modified antisense oligonucleotide comprises the nucleic acid sequence of any one of SEQ ID NOs: 1-269. In some embodiments, not all of the nucleotides of an antisense oligonucleotide are modified.

[0106] RNA processing modulators (e.g., antisense oligonucleotides) may include ribonucleotides, deoxyribonucleotides, and combinations thereof (e.g., RNA processing modulators comprising a gapmer structure). Examples of modified nucleotides which can be used in antisense nucleic acids include, for example, 5-fluorouracil, 5 -bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1-methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3 -methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5- oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2 -thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2 -thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine.

[0107] In some embodiments, a modified nucleotide is a 2'-modified nucleotide. For example, the 2'-modified nucleotide may be a 2'-deoxy, 2'-fluoro, 2'-O-methyl, 2'-O-methoxy ethyl, 2'- amino or 2'-aminoalkoxy modified nucleotide. In some embodiments, the 2'-modified nucleotide comprises a 2'-O-4'-C methylene bridge, such as a locked nucleic acid (LNA) nucleotide. In some embodiments of a 2' modified nucleotide the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety. In such embodiments, the linkage may be a methylene ( — CH2 — )ngroup bridging the 2' oxygen atom and the 3' or 4' carbon atom wherein n is 1 or 2. In some embodiments, a linkage comprises a cEt modification (e.g., a -CH3 replacing a hydrogen in the methylene group of the bridge). RNA processing modulators (e.g., antisense oligonucleotides) may include combinations of LNA nucleotides and unmodified nucleotides. Antisense nucleic acids may include combinations LNA and RNA nucleotides. Antisense nucleic acids may include combinations LNA and DNA nucleotides. A further preferred oligonucleotide modification includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety.

[0108] RNA processing modulators (e.g., antisense oligonucleotides) acids may also include nucleobase-modified nucleotides, e.g., nucleotides containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase. Bases may be modified to block the activity of adenosine deaminase, for example. Examples of modified nucleobases include, but are not limited to, uridine and / or cytidine modified at the 5-position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and / or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g., N6- methyl adenosine are suitable. It should be noted that the above modifications may be combined.

[0109] Within antisense nucleic acids (e.g., antisense oligonucleotides) of the disclosure, as few as one and as many as all nucleotides can be modified. In some embodiments, a modified RNA processing modulator (e.g., antisense oligonucleotide) will contain as few modified nucleotides as are necessary to achieve a desired level of in vivo stability and / or bioaccessibility or other desired property.

[0110] Certain antisense oligonucleotides may include non-ionic DNA analogs, such as alkyland aryl-phosphates (in which the charged non-bridging oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Nucleic acids which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation and may be used herein. In some embodiments, antisense nucleic acids may include at least one lipophilic substituted nucleotide analog and / or a pyrimidine-purine dinucleotide.

[0111] In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) may have one or two accessible 5' ends. It is possible to create modified oligonucleotides having two such 5' ends, for instance, by attaching two oligonucleotides through a 3 '-3' linkage to generate an oligonucleotide having one or two accessible 5' ends. The 3 '-3 '-linkage may be a phosphodiester, phosphorothioate, or any other modified internucleoside bridge. Additionally, 3 '-3 '-linked oligonucleotides where the linkage between the 3' terminal nucleosides is not a phosphodiester, phosphorothioate, or other modified bridge, can be prepared using an additional spacer, such as tri- or tetra-ethylenglycol phosphate moiety.

[0112] A phosphodiester internucleotide linkage of an RNA processing modulator (e.g., antisense oligonucleotide) can be replaced with a modified linkage. The modified linkage may be selected from, for example, phosphorothioate, phosphorodithioate, NRlR2-phosphoramidate, borano-phosphate, a-hydroxybenzyl phosphonate, phosphate-(Cl-C21) — O-alkyl ester, phosphate-[(C6-C12)aryl-(Cl-C21) — O-alkyl] ester, (Cl-C8)alkylphosphonate and / or (C6- C12)arylphosphonate bridges, and (C7-C12)-a-hydroxymethyl-aryl. In some embodiments, a triazole ring is used.

[0113] A phosphate backbone of the RNA processing modulators (e.g., antisense oligonucleotides) can be modified to generate peptide nucleic acid molecules. As used herein, the terms “peptide nucleic acids” or “PNAs” refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols, for example.

[0114] RNA processing modulators (e.g., antisense oligonucleotides) also be formulated as morpholino oligonucleotides. In such embodiments, the riboside moiety of each subunit of an oligonucleotide of the oligonucleotide reagent is converted to a morpholine moiety. Morpholinos may also be modified, e.g. as peptide conjugated morpholino, etc.

[0115] Aspects of the disclosure relate to RNA processing modulators (e.g., antisense oligonucleotides) comprising a “gapmer” structure. A “gapmer” refers to an antisense oligonucleotide comprising the following formula Xni-(Y)n2-(X)n3, where (X) is a ribonucleotide (e.g., an RNA base) and (Y) is a deoxyribonucleotide (e.g., DNA base), and where each of nl, n2, and n3 are an integer ranging from 1 to 50 (inclusive of all integers therebetween). In some embodiments, antisense oligonucleotides having a gapmer structure bind (e.g., hybridize) to a target mRNA (e.g., an mRNA encoded by a GRIN2A gene) and induce ribonuclease Hl (RNAseHl)-mediated degradation of the target mRNA. Gapmer antisense oligonucleotides are known in the art, for example as described by Kasuya et al. Sci Rep. 2016; 6: 30377. The number of DNA bases in a gapmer may vary. In some embodiments, a gapmer comprises between 1 and 10 DNA bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 DNA bases). In some embodiments, a gapmer comprises between 2 and 6 DNA bases (e.g., 2, 3, 4, 5, or 6 DNA bases). The DNA bases of a gapmer antisense oligonucleotide may be positioned toward to 5' end of the ASO (e.g., within 1, 2, 3, 4, 5, etc. nucleotides of the 5' terminal nucleotide of the ASO), toward the 3' end of the ASO (e.g., within 1, 2, 3, 4, 5, etc. nucleotides of the 3' terminal nucleotide of the ASO), or in the middle of the ASO (e.g., having an equal number of RNA bases flanking the DNA bases).

[0116] In other embodiments, an RNA processing modulator (e.g., antisense oligonucleotide) can be linked to functional groups, such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane or the blood-brain barrier. For example, oligonucleotide reagents of the disclosure also may be modified with chemical moi eties (e.g., cholesterol) that improve the in vivo pharmacological properties of the RNA processing modulator. In some embodiments, a functional group comprises a peptide, small molecule, sugar, lipid, nucleic acid, or combination of any of the foregoing.

[0117] Sequences and chemical modifications of representative RNA processing modulators (e.g., antisense oligonucleotides) targeting GRIN2A (e.g., an mRNA encoded by a GRIN2A gene, such as a pre-mRNA or mature mRNA) are shown in Columns A and B, respectively, of Table 1.

[0118] Table 1 : Representative RPMs targeting GRIN2A 245 ACTAGGCATTTTCTTGTACA Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0119] 246 GACCGAAGATAGCTGTCATT Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0120] 247 CCTGTCTCCTGAAGCATCTG Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0121] 248 TTGTGGTTCTTACTGTTGTC Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0122] 249 CTCTTCTGGAAGATACCTAG Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0123] 250 GGGTTGGACTCATTGAGAGT Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0124] 251 AGGAGTTCATGTTGGACATG Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0125] 252 GTTCTTCTCGTTGTGGCAGA Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0126] 253 GTGGTGGCAAAGATGTACC Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base C from 5' end, PO after 3rd base from 3' end

[0127] 254 GAATAGTCATGAGGTCTCTG Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0128] 255 AGCCATATAGCTTTTCCAAT Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0129] 256 TGGCTAAGTTTCTGTTGTAT Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0130] 257 GTTGATAGACCACCTGGATG Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0131] 258 CCATTCCACACATTGTTAAC Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0132] 259 CCGTAGCAGCTGGCCTTGGC Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0133] 260 AGCCCACAAAGCTGTTGTCC Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0134] 261 GCATGATCTTCAGCATGACC Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0135] 262 GAGATAAAATCCAGCATCT Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base

[0136] G from 5' end, PO after 3rd base from 3' end

[0137] 263 GTCGTGGCTGTGACCCAGCA Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0138] 264 CCGGAGGCTCTGCAGCAGG Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base

[0139] G from 5' end, PO after 3rd base from 3' end

[0140] 265 CCACATAGTTCTCAGCAGTG Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0141] 266 CAGATGAAGGTGATGAGGC Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base T from 5' end, PO after 3rd base from 3' end

[0142] 267 ATCACAAACATCATCACCCA Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0143] 268 ATGAGCAGCATCACAAACA Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base T from 5' end, PO after 3rd base from 3' end

[0144] 269 CAGCATCACAAACATCATCA Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end

[0145] In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises at least 18 continuous nucleotides (e.g., comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 nucleotides) of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (see Column A of Table 1). In some embodiments, an RNA processing modulator consists of 18 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “18mers” in Column B of the same row in Table 1. In some embodiments, an RNA processing modulator comprises 18 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “18mers” in Column B of the same row in Table 1 and comprises one additional nucleotide (either at the 5' end or 3' end) or two additional nucleotides (either both at the 5' end, both at the 3' end, or one at the 5' end and the other at the 3' end) which are complementary to a target sequence in a GRIN2A mRNA that hybridizes to the 18 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1. In some embodiments, an RNA processing modulator consists of 19 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “20mers” in Column B of the same row in Table 1 and comprises one additional nucleotide either at the 5' end or 3' end which are complementary to a target sequence in a GRIN2A mRNA that hybridizes to the 20 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1. In some embodiments, an RNA processing modulator comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “20mers” in Column B of the same row in Table 1. In some embodiments, an RNA processing modulator comprises 20 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “20mers” in Column B of the same row in Table 1 and comprises one or more additional nucleotides either at the 5' end, at the 3' end, or both the 5' end and the 3' end which are complementary to a target sequence in a GRIN2A mRNA that hybridizes to the 20 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1) comprises one or more chemical modifications as set forth in any one of the rows in Column B of Table 1. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1) comprises a pattern of chemical modifications as set forth in any one of the rows in Column B of Table 1. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 106. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 134. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 136. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 234. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 237. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 251. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 252. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 254. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 269. In some embodiments, an RNA processing modulator comprising the at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 reduces the levels of a GRIN2A mRNA (e.g., a mature mRNA or a pre-mRNA) and / or a GRIN2A protein by 50% or more (e.g., 50-60%, 60- 70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount. In some embodiments, an RNA processing modulator comprising the at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1, 106, 134, 136, 234, 237, 251, 252, 254, and 269 reduces the levels of a GRIN2A mRNA (e.g., a mature mRNA or a pre-mRNA) and / or a GRIN2A protein by 50% or more (e.g., 50-60%, 60- 70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.

[0146] In some embodiments, an RNA processing modulator comprises or consists of 18 continuous nucleotides, comprises or consists of 19 continuous nucleotides, or comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (see Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue. In some embodiments, an RNA processing modulator comprises or consists of 18 continuous nucleotides, comprises or consists of 19 continuous nucleotides, or comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (see Column A of Table 1), wherein each position comprising a “T” residue is substituted for a “U” residue. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue and wherein the RNA processing modulator comprises one or more chemical modifications as set forth in any one of the rows in Column B of Table 1. In some embodiments, an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue and wherein the RNA processing modulator comprises a pattern of chemical modifications as set forth in any one of the rows in Column B of Table 1. In some embodiments, one or more positions in an RNA processing modulator comprising “U” residues comprises a uracil nitrogenous base or a chemically modified uracil nitrogenous base described herein and a deoxyribose sugar or a chemically modified deoxyribose sugar described herein. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 1, wherein one or more of positions in SEQ ID NO: 1 comprising a “T” residue (e.g., each position in SEQ ID NO: 1 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 106, wherein one or more of positions in SEQ ID NO: 106 comprising a “T” residue (e.g., each position in SEQ ID NO: 106 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 134, wherein one or more of positions in SEQ ID NO: 134 comprising a “T” residue (e.g., each position in SEQ ID NO: 134 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 136, wherein one or more of positions in SEQ ID NO: 136 comprising a “T” residue (e.g., each position in SEQ ID NO: 136 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 234, wherein one or more of positions in SEQ ID NO: 234 comprising a “T” residue (e.g., each position in SEQ ID NO: 234 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 237, wherein one or more of positions in SEQ ID NO: 237 comprising a “T” residue (e.g., each position in SEQ ID NO: 237 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 251, wherein one or more of positions in SEQ ID NO: 251 comprising a “T” residue (e.g., each position in SEQ ID NO: 251 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 252, wherein one or more of positions in SEQ ID NO: 252 comprising a “T” residue (e.g., each position in SEQ ID NO: 252 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 254, wherein one or more of positions in SEQ ID NO: 254 comprising a “T” residue (e.g., each position in SEQ ID NO: 254 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 269, wherein one or more of positions in SEQ ID NO: 269 comprising a “T” residue (e.g., each position in SEQ ID NO: 269 comprising a “T” residue) is substituted for a “U” residue. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises a gapmer structure, wherein a region of 10 deoxyribonucleotides is flanked by regions each comprising 4 ribonucleotides (thereby totaling 8 ribonucleotides and 10 deoxyribonucleotides). In some embodiments, 1, 2, 3, or 4 ribonucleotides in each of the regions flanking the region of 10 deoxyribonucleotides comprise a 2'-O-methoxy ethyl (- OCH2CH2OCH3 (2' MOE)) modification. In some embodiments, 1, 2, 3, or 4 ribose sugars comprised in each region flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage or a phosphodiester linkage. In some embodiments, 1-10 deoxyribose sugars (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deoxyribose sugars) comprised in the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, one or more ribose sugars (e.g., 1, 2, 3, or 4 ribose sugars) comprised in each of the regions flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, 16 out of the 18 positions are linked by phosphorothioate linkages. In some embodiments, 16 out of the 18 positions are linked by phosphorothioate linkages, wherein the second position is linked to the third position (relative to the 5' terminal end) by a phosphodiester linkage and the sixteenth position is linked to the seventeenth position (relative to the 5' terminal end) by a phosphodiester linkage. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (see Column A of Table 1). In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 106. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 134. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 136. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 234. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 237. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 251. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 252. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 254. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 269. In some embodiments, an RNA processing modulator comprising the gapmer structure reduces the levels of a GRIN2A mRNA (e.g., a mature mRNA or a pre-mRNA) and / or a GRIN2A protein by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.

[0147] In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprises a gapmer structure, wherein a region of 10 deoxyribonucleotides is flanked by regions each comprising 5 ribonucleotides (thereby totaling 10 ribonucleotides and 10 deoxyribonucleotides). In some embodiments, 1, 2, 3, 4, or 5 ribonucleotides in each of the regions flanking the region of 10 deoxyribonucleotides comprise a 2'-O-methoxy ethyl (- OCH2CH2OCH3 (2' MOE)) modification. In some embodiments, 1, 2, 3, 4, or 5 ribose sugars comprised in each region flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage or a phosphodiester linkage. In some embodiments, 1-10 deoxyribose sugars (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deoxyribose sugars) comprised in the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, one or more ribose sugars (e.g., 1, 2, 3, 4, or 5 ribose sugars) comprised in each of the regions flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage. In some embodiments, 18 out of the 20 positions are linked by phosphorothioate linkages. In some embodiments, 18 out of the 20 positions are linked by phosphorothioate linkages, wherein the second position and third position (relative to the 5' terminal end) are linked by a phosphodiester linkage and the seventeenth position and eighteenth position (relative to the 5' terminal end) are linked by a phosphodiester linkage. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gampmer structure comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (see Column A of Table 1). In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 234. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 237. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 252. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 254. In some embodiments, an RNA processing modulator (e.g., an antisense oligonucleotide) comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 269. In some embodiments, an RNA processing modulator comprising the gapmer structure reduces the levels of a GRIN2A mRNA (e.g., a mature mRNA or a pre-mRNA) and / or a GRIN2A protein by 50% or more (e.g., 50-60%, 60- 70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and / or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.

[0148] In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 1 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 2 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 3 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 4 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 5 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 6 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 7 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 8 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 9 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 10 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 11 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 12 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 13 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 14 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 15 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 16 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 17 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 18 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10-5; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 19 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 20 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 21 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 22 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 23 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 24 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 25 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 26 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 27 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 28 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 29 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 30 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 31 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 32 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 33 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 34 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 35 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 36 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4, PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 37 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 38 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 39 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 40 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 41 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 42 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 43 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 44 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 45 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 46 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 47 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 48 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 49 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 50 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 51 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 52 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 53 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 54 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 55 and the following modification pattern: Full PS; 2'MOE; 20mer; 5- 10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 56 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 57 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 58 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 59 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 60 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 61 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 62 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 63 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 64 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 65 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 66 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 67 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 68 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 69 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 70 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 71 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 72 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 73 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10-5; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 74 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 75 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10-5; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 76 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 77 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 78 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 79 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 80 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 81 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 82 and the following modification pattern: Full PS; 2'MOE;

[0149] 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 83 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 84 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 85 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 86 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 87 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 88 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 89 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 90 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 91 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 92 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 93 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 94 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 95 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 96 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 97 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 98 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 99 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 100 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 101 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 102 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 103 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 104 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 105 and the following modification pattern: Full PS; 2'MOE; 18mer; 4- 10-4, PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 106 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 107 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 108 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 109 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 110 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 111 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 112 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 113 and the following modification pattern: Full PS;

[0150] 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 114 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 115 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 116 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 117 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 118 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10- 5; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 119 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 120 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4, PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 121 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 122 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 123 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 124 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 125 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 126 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 127 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10-5; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 128 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 129 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 130 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 131 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 132 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 133 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 134 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 135 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 136 and the following modification pattern: Full PS; 2'MOE; 20mer; 5- 10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 137 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 138 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 139 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 140 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 141 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 142 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 143 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 144 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 145 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 146 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 147 and the following modification pattern: Full PS; 2'MOE; 20mer; 5- 10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 148 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 149 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 150 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 151 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 152 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 153 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 154 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 155 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 156 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10-5; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 157 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 158 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 159 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 160 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 161 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 162 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 163 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 164 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 165 and the following modification pattern: Full PS;

[0151] 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 166 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 167 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 168 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 169 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 170 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 171 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 172 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 173 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 174 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 175 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 176 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 177 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 178 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 179 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 180 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 181 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 182 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 183 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 184 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 185 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 186 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 187 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 188 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 189 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 190 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 191 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 192 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 193 and the following -n - modification pattern: Full PS; 2'MOE; 18mer; 4-10-4, PO after 2nd from 5' end, PO after 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 194 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 195 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 196 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 197 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 198 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 199 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 200 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 201 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 202 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 203 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 204 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 205 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 206 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 207 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 208 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10- 4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 209 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 210 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 211 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 212 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 213 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 214 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 215 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10- 4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 216 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 217 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 218 and the following modification pattern: Full PS; 2'MOE; 18mer; 4- 10-4. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 219 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 220 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 221 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 222 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10- 5; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 223 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 224 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 225 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 226 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 227 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 228 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 229 and the following modification pattern: Full PS; 2'MOE; 18mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 230 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 231 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 232 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 233 and the following modification pattern: Full PS; 2'MOE; 20mer. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 234 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 235 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 236 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 237 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 238 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 239 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 240 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 241 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 242 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 243 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 244 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 245 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 246 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 247 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 248 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 249 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 250 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 251 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 252 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 253 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 254 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 255 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 256 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 257 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 258 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 259 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 260 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 261 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 262 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 263 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 264 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 265 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 266 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 267 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 268 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In some embodiments, an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 269 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end. In any of the foregoing embodiments: positions comprising “T” residues comprise a thymine (T) nitrogenous base bonded to the 1' carbon of either ribose or deoxyribose; isolated nucleic acids comprising a gapmer structure are indicated by structures denoted “(X)-(Y)-(X)”, wherein “(X)” refers to regions comprising an ‘X’ number of nucleotide positions having ribose and which flank a region referred to as “(Y)” comprising a ‘ Y’ number of nucleotide positions having deoxyribose; isolated nucleic acids comprising a skipmer structure (alternatively referred to herein as skippers) are indicated by the lack of notation reciting “(X)-(Y)-(X)” and each nucleotide position comprises ribose; “Full PS” refers to each nucleotide position linked by an internucleotide linkage comprising a phosphorothioate modification unless otherwise indicated by nucleotide positions comprising a phosphodiester group (PO) at the 3' carbon of ribose; “2'MOE” refers to the 2' carbon of ribose bonded to an oxygen atom which is bonded to a methoxyethyl group; “#mer” refers to the number of nucleotide positions; and “PO” refers to nucleotide positions, wherein the 3' carbon of ribose comprises a phosphodiester bond which links the nucleotide position to an immediately adjacent nucleotide position in the 3' direction, wherein nucleotide positions comprising a PO group (e.g., a position referred to as 2ndor 3rd from a 5’ or 3' terminal end) at the 3' carbon of ribose is indicated by the location of the PO group which is referred to either as being “at” or “after”.

[0152] Pharmaceutical Compositions

[0153] In some embodiments of the disclosure, RNA processing modulators (e.g., antisense oligonucleotides) are formulated into compositions for therapeutic purposes. In some embodiments, the compositions are designed to enhance the therapeutic effect of the RNA processing modulators, for example by increasing biocompatibility, targeting the RNA processing modulator to a site of interest in vivo, reducing clearance of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo, increasing the stability of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo, increasing uptake of an isolated nucleic acid (e.g., an antisense oligonucleotide) in target cells, or amplifying the intended effect of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo.

[0154] In some embodiments, the RNA processing modulator (e.g., antisense oligonucleotide) is provided in combination with a pharmaceutically acceptable carrier. A “pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it may perform its intended function. Additional ingredients that may be included in the pharmaceutical compositions used in the practice of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference.

[0155] Methods and Medical uses

[0156] Aspects of the disclosure relate to methods of modulating transcription, translation, function, or activity of genes associated with glutamate signaling in a cell or subject. Also provided is an RNA processing modulator (e.g., antisense oligonucleotide) described by the disclosure for use as a medicament. The RNA processing modulators (e.g., antisense oligonucleotides) may be used in methods of modulating transcription, translation, function, or activity of genes associated with glutamate signaling, e.g. in a cell or subject. The RNA processing modulators may also be used in methods for reducing NMDA receptor-mediated exci totoxi city in a subject. Further, the RNA processing modulators may be used in methods of preventing or treating a psychiatric disease or disorder in a subject in need thereof. In some embodiments, the methods comprise administering a composition comprising one or more RNA processing modulators (e.g., 1, 2, 3, 4, 5, or more RNA processing modulators, for example 1, 2, 3, 4, 5, or more antisense oligonucleotides) to a cell or subject. In some embodiments, administration of the compositions (e.g., RNA processing modulators) results in decreased sensitivity to glutamate in the cell or subject, or alteration of levels of one or more biological products dependent upon glutamate signaling in the subject. The cell may be in vivo, ex vivo, or in vitro.

[0157] For example, in some embodiments, administration of an RNA processing modulator (e.g., an antisense oligonucleotide) targeting GRIN2A mRNA results in a decrease of glutamate signaling in the cell or subject. In some embodiments, administration of an RNA processing modulator (e.g., an antisense oligonucleotide) targeting GRIN2A mRNA results in an increase of glutamate signaling in the cell or subject. The disclosure is based, in part, on the recognition that contacting a cell or subject with an RNA processing modulator that decreases transcription, translation, function or activity of GRIN2A protein results in decreased glutamate signaling and / or reduction of exci totoxi city (e.g., NMDA receptor-mediated exci totoxi city) in the subject. The term “NMDA receptor-mediated exci totoxi city” refers to a condition in which neuronal dysfunction and death occur due to uncontrolled activation of NMDA receptor signaling and high levels of excitatory postsynaptic potentials.

[0158] Accordingly, in some aspects, the disclosure provides a method for decreasing glutamate signaling in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-269. In some embodiments, the isolated nucleic acid (e.g., antisense oligonucleotide) is administered as a monotherapy. In some embodiments, the isolated nucleic acid (e.g., antisense oligonucleotide) is administered as a component of a combination therapy with one or more additional therapeutic agents described herein. In some embodiments, the isolated nucleic acid (e.g., antisense oligonucleotide) is administered as a component of a combination therapy with one or more additional therapeutic agents (e.g., one or more selective serotonin reuptake inhibitors (SSRIs), other antidepressants, or antipsychotics). Generally, it is desirable to decrease glutamate signaling (e.g., by reducing GRIN2A levels, transcription, splicing, and / or translation) in certain subjects (e.g., subjects having certain psychiatric diseases or disorders, for example diseases associated with NMDA receptor- mediated exci totoxi city). However, it should be appreciated that, in some embodiments, the disclosure provides a method for increasing glutamate signaling in a cell or subject (e.g., by increasing GRIN2A levels, transcription, splicing, and / or translation), the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-269 (provided in column A of Table 1, optionally comprising one or more modifications in column B of Table 1, and optionally wherein the sequence in column A and the chemistry in column B are provided in the same row of Table 1).

[0159] In some embodiments, an isolated nucleic acid (e.g., antisense oligonucleotide) binds to an mRNA expressed from a particular allele of GRIN2A (e.g., binds to a target mRNA in an allele-specific manner).

[0160] In some aspects, RNA processing modulators (e.g., antisense oligonucleotides) described by the disclosure are useful for treating a disease or disorder associated with dysregulation of glutamate signaling. Thus, provided herein are RNA processing modulators (e.g., antisense oligonucleotides) described by the disclosure for use in a method of treating a disease or disorder associated with dysregulation of glutamate signaling. A disease or disorder associated with dysregulation of glutamate signaling refers to a disease or disorder in which the subject (e.g., patient) is 1) characterized as having dysfunctional glutamate signaling, and / or 2) has one or more mutations in one or more genes associated with glutamate signaling, and / or 3) has one or more mutations in one or more genes that are involved in a biological pathway that utilizes glutamate (e.g., release of other neurotransmitters, paracrine signaling, etc.).

[0161] Methods of measuring glutamate levels in a subject are known in the art. In some embodiments, a glutamate level of a subject is determined by measuring the concentration of glutamate in a biological sample obtained from the subject, for example a blood sample, serum sample, cerebrospinal fluid (CSF) sample, etc.

[0162] In some embodiments, a subject has one or more mutations in a GRIN2A gene. In some embodiments, a subject having one or more mutations in a GRIN2A gene has (or is at risk of developing) a psychiatric disease or disorder. Methods of detecting mutations in a subject’s genes are known in the art and include, for example DNA sequencing, RNA sequencing, microarray analysis, etc.

[0163] Accordingly, in some aspects, the disclosure provides a method for treating a disease or disorder associated with glutamate signaling, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof. Also provided is an RNA processing modulator (e.g., antisense oligonucleotide) described by the disclosure for use in a method of treating a disease or disorder associated with glutamate signaling. The method may comprise administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-269 (provided in column A of Table 1, optionally comprising one or more modifications in column B of Table 1, and optionally wherein the sequence in column A and the chemistry in column B are provided in the same row of Table 1). In some embodiments, the disease is a psychiatric disease or disorder. In some embodiments, the disease is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.). In some embodiments, the disease is a disease associated with seizures, for example Rett’s syndrome, Fragile X syndrome, etc.

[0164] Also provided herein are methods and RNA processing modulators (e.g., antisense oligonucleotides) described by the disclosure for use in a method of reducing NMDA receptor- mediated exci totoxi city in a subject. Dysregulated NMDA receptor-mediated excitotoxicity can be present in a subject having or suspected of having a psychiatric disease or disorder. In some embodiments, the psychiatric disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drugresistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.). The method may comprise administering an isolated nucleic acid as described herein to a subject in need thereof (e.g., a subject characterized as having or suspected of having dysregulated NMDA receptor-mediated excitotoxicity, such as a subject having or suspected of having a psychiatric disease or disorder). In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-269 (provided in column A of Table 1, optionally comprising one or more modifications in column B of Table 1, and optionally wherein the sequence in column A and the chemistry in column B are provided in the same row of Table 1). In some embodiments, administering an isolated nucleic acid as described herein to a subject characterized as having or suspected of having dysregulated NMDA receptor-mediated excitotoxicity is used to treat the subject (e.g., to treat the subject for a psychiatric disease or disorder).

[0165] Further provided herein are methods and RNA processing modulators (e.g., antisense oligonucleotides described by the disclosure for use in a method of preventing or treating a psychiatric disease or disorder in a subject. In some embodiments, the psychiatric disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.). The method may comprise administering an isolated nucleic acid as described herein to a subject in need thereof. In some embodiments, the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-269 (provided in column A of Table 1, optionally comprising one or more modifications in column B of Table 1, and optionally wherein the sequence in column A and the chemistry in column B are provided in the same row of Table 1).

[0166] As used herein “treat” or “treating” refers to preventing or delaying disease onset, reducing or preventing the development of symptoms associated with a disease, reducing the severity of a disease, and / or preventing the worsening of symptoms associated with a disease. Accordingly, in some aspects, the disclosure provides a method for treating a subject having or suspected of having a disease caused by dysregulated glutamate signaling. Treatment of a subject involves administration of a composition to the subject (e.g., an RNA processing modulator, such as an antisense oligonucleotide) as described herein.

[0167] As used herein, the term “treating” refers to the application or administration of a composition (e.g., an RNA processing modulator, such as an antisense oligonucleotide as described herein) to a subject who has a disease or disorder associated with high levels of glutamate, or with dysregulation of glutamate signaling, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disorder, the symptom of the disease, or the predisposition toward the disease.

[0168] Alleviating a disease associated with glutamate signaling includes delaying the development or progression of the disease, or reducing disease severity. Alleviating the disease does not necessarily require curative results. As used therein, "delaying" the development of a disease (such as a disease associated with glutamate signaling) means to defer, hinder, slow, retard, stabilize, and / or postpone progression of the disease. This delay can be of varying lengths of time, depending on the history of the disease and / or individuals being treated. A method that "delays" or alleviates the development of a disease, or delays the onset of the disease, is a method that reduces probability of developing one or more symptoms of the disease in a given time frame and / or reduces extent of the symptoms in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a number of subjects sufficient to give a statistically significant result.

[0169] "Development" or "progression" of a disease means initial manifestations and / or ensuing progression of the disease. Development of the disease can be detectable and assessed using standard clinical techniques as well known in the art. However, development also refers to progression that may be undetectable. For purpose of this disclosure, development or progression refers to the biological course of the symptoms. "Development" includes occurrence, recurrence, and onset. As used herein "onset" or "occurrence" of a disease associated with high glutamate levels and / or dysregulation of glutamate signaling.

[0170] A subject may be a human, a mouse, a rat, a pig, a dog, a cat, or a non-human primate. In some embodiments, a subject has or is suspected of having a disease or disorder associated with high glutamate levels and / or dysregulation of glutamate signaling. In some embodiments, a subject having a disease or disorder associated with high glutamate levels and / or dysregulation of glutamate signaling comprises at least one GRIN2A allele having a mutation. In some embodiments, a GRIN2A allele having a mutation (e.g., associated with high glutamate levels and / or dysregulation of glutamate signaling, for example schizophrenia) comprises a frameshift mutation, a splice site mutation, a missense mutation, a truncation mutation or a nonsense mutation. A subject may have two GRIN2A alleles having the same mutations (homozygous state) or two GRIN2A alleles having different mutations (compound heterozygous state).

[0171] The optimal course of administration or delivery of the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may vary depending upon the desired result and / or on the subject to be treated. As used herein “administration” refers to contacting cells with an RNA processing modulator and can be performed in vitro or in vivo. Compositions (e.g., pharmaceutical compositions) provided herein can be administered a number of routes including, but not limited to, by oral administration, intravenous administration (e.g., systemic intravenous injection / administration), administration to the brain and / or spinal cord, intracerebral injection, intraventricular injection, intracerebroventricular (ICV) injection, intraci sternal injection, intraparenchymal injection, intrathecal injection, and any combination of the foregoing. In some embodiments, administration comprises administration to cerebral spinal fluid, and / or direct administration to an affected site (e.g., a target tissue, for example central nervous system (CNS) tissue, or peripheral nervous system (PNS) tissue).

[0172] In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the agent (e.g., its stability in the environment of the gastrointestinal tract), and / or the condition of the subject (e.g., whether the subject is able to tolerate oral administration, injection, etc.). In some embodiments, administration (e.g., injection) of a compound or pharmaceutical composition is performed on a patient in a Trendelenburg position. In some embodiments, compositions are administered to a subject through only one administration route. In some embodiments, multiple administration routes may be exploited (e.g., serially, or simultaneously) for administration of the composition to a subject.

[0173] In some embodiments, it may be desirable to deliver the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure to the CNS of a subject. By “CNS” is meant all cells and tissue of the brain and spinal cord of a vertebrate. Thus, the term includes, but is not limited to, neuronal cells, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone, cartilage and the like. RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may be delivered directly to the CNS or brain by injection into, e.g., the ventricular region, as well as to the striatum (e.g., the caudate nucleus or putamen of the striatum), spinal cord and neuromuscular junction, or cerebellar lobule, with a needle, catheter or related device, using neurosurgical techniques known in the art, such as by stereotactic injection (see, e.g., Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther.

[0174] 11 :2315-2329, 2000). In some embodiments, RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intravenous injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intracerebral injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intracerebroventricular (ICV) injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intrathecal injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intrastriatal injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by intracranial injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by cisterna magna injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by cerebral lateral ventricle injection. The skilled artisan will also recognize that the foregoing administration routes may be combined in a single subject (e.g., a subject may be administered RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure using a combination of two or more of the foregoing techniques).

[0175] RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure may be administered to a subject once (e.g., a single dose) or more than once (e.g., as multiple doses). In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered to a subject one time by any administration method described herein. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered to a subject more than one time by any administration method described herein. For example, in some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered to a subject one, two, three, four, five, six, or more times by any administration method described herein. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered to a subject more than six times (e.g., seven , eight, nine, ten, or more times) by any administration method described herein.

[0176] When RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered to a subject more than once, the time between each administration may be on the order of hours, days, or weeks. In some embodiments, multiple administrations of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are performed on the same day (e.g., one, two, three, four, five, six, seven, eight, etc. hours apart).

[0177] When RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered to a subject more than twice, the time between each administration may be equal or different. In some embodiments, when at least three separate administrations of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are performed, the time between each administration may be determined by the levels of glutamate signaling, GRIN2A mRNA, GRIN2A protein, or symptoms of the subject or any combination thereof using methods described herein.

[0178] In some embodiments, administration of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure to a subject may be performed before, during, and / or after the subject has been administered other treatments for diseases or disorders associated with dysfunctional glutamate signaling, altered NMDA receptor levels, altered NMDA receptor activity, altered GRIN2A levels, and / or altered GRIN2A activity. In some embodiments, administration of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure to a subject may be performed hours, days, weeks, or years after the subject has been administered other treatments for diseases or disorders associated with dysfunctional glutamate signaling, altered NMDA receptor levels, altered NMDA receptor activity, altered GRIN2A levels, and / or altered GRIN2A activity. In some embodiments, administration of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure to a subject may be performed throughout the duration that a subject is being administered other treatments for diseases or disorders associated with dysfunctional glutamate signaling, altered NMDA receptor levels, altered NMDA receptor activity, altered GRIN2A levels, and / or altered GRIN2A activity. In some embodiments, administration of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure to a subject may be performed hours, days, weeks, or years before the subject has been administered other treatments for diseases or disorders associated with dysfunctional glutamate signaling, altered NMDA receptor levels, altered NMDA receptor activity, altered GRIN2A levels, and / or altered GRIN2A activity. In some embodiments, the other treatment for the disease or disorder is a treatment for schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain- of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevel opmental disorders, etc.).

[0179] Non-limiting examples of treatments for schizophrenia (e.g., treatment resistant schizophrenia) include antipsychotics, Seroquel, Chlorpromazine, Invega, Latuda, Perphenazine, Trifluoperazine, Brexpiprazole, Risperidone, Olanzapine, Haolperidol, Fluphenazine, Saphris, Molindone, Clozaril, Aripiprazole, Geodon, Loxapine, Fanapt, Cariprazine, Thiothixene, Fluphenazine decanoate, and any brand name or generic (e.g., non-brand name) version thereof.

[0180] Non-limiting examples of treatments for depression (e.g., treatment resistant depression, major depressive disorder, etc.) include selective serotonin reuptake inhibitors (SSRIs) (e.g., fluoxetine, paroxetine, fluvoxamine, citalopram, escitalopram, sertraline, etc.), selective norepinephrine reuptake inhibitors (SNRIs) (e.g., venlafaxine, duloxetine, levomilnacipran, desvenlafaxine, etc.), norepinephrine and dopamine reuptake inhibitors (NDRIs) (e.g., bupropion), noradrenergic and specific serotonergic antidepressant (e.g., mirtazapine), non- selective cyclic (e.g., amitriptyline, imipramine, desipramine, nortriptyline, trimipramine, clomipramine, etc.), monoamine oxidase inhibitors (MAOIs) (e.g., phenelzine, tranylcypromine, etc.) and any brand name or generic (e.g., non-brand name) version thereof.

[0181] Non-limiting examples of treatments for Alzheimer’s Disease include Donepezil, Rivastigmine, Galantamine, Memantine, combination of Memantine and Donepezil, Aducanumab, Lacanemab and generic (e.g., non-brand name) version thereof.

[0182] Non-limiting examples of treatments for Parkinson’s Disease include Levodopa, catechol-O-methyltransferase inhibitors, Cogentin, Azilect, Neupro, Safinamide, dopamine agonists, anticholinergics, Ropinirole, Trihexyphenidyl, Entacapone, Amantadine, Selegiline, Carbidopa, combination of Carbidopa and Levodopa, Tolcapone, and any brand name or generic (e.g., non-brand name) version thereof. Non-limiting examples of treatments for epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.) include Gabapentin, Lamotrigine, Levetiracetam, Oxcarbazepine, Ethosuximide, Lyrica, Gabtril, Perampanel, Phenytoin, Valproic acid, Topiramate, Clonazepam, Lacosamide, Felbatol, Rufinamide, Acetazolamide, Phenobarbital, Carbamazepine, anticonvulsants, Zonisamide, Primidone, Clobazam, Vigabatrin, Eslicarbazepine acetate, and any brand name or generic (e.g., non-brand name) version thereof. In some embodiments, a disease or disorder associated with dysregulation of glutamate signaling is refractory epilepsy. In some embodiments, a disease or disorder associated with dysregulation of glutamate signaling is drug-resistant epilepsy. In some embodiments, a subject having or suspected of having refractory epilepsy or drug-resistant epilepsy is characterized as being resistant to a treatment for epilepsy, such as Gabapentin, Lamotrigine, Levetiracetam, Oxcarbazepine, Ethosuximide, Lyrica, Gabtril, Perampanel, Phenytoin, Valproic acid, Topiramate, Clonazepam, Lacosamide, Felbatol, Rufinamide, Acetazolamide, Phenobarbital, Carbamazepine, anticonvulsants, Zonisamide, Primidone, Clobazam, Vigabatrin, Eslicarbazepine acetate, and any brand name or generic (e.g., non-brand name) version thereof.

[0183] In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA) is administered to a subject. In some embodiments, an effective amount of an RNA processing modulator (e.g., antisense oligonucleotide) is an amount sufficient to increase transcription, translation, function, or activity of a target mRNA (e.g., of a desired mutant, variant, and / or allele). In some embodiments, an effective amount of an RNA processing modulator (e.g., antisense oligonucleotide) is an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA (e.g., of an undesired mutant, variant, and / or allele). The effective amount will depend primarily on factors such as the species, age, weight, health of the subject, and the tissue to be targeted, and may thus vary among animal and tissue. In some embodiments, an effective amount can be a combination of an effective dosage, frequency, and duration for administration. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1 ng-100 mg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1-1000 ng. In some embodiments, an effective amount of (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1-10, 10-50, 50-100, 100- 200, 200-300, 300-500, 500-750, or 750-1000 ng. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 0.1 pg-100.0 pg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 0.1-1.0, 1.0-5.0, 5.0-20.0, 20.0-50.0, or 50.0-100.0 pg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1 pg-1000 pg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 100-250, 250-500, 500-750, or 750-1000 pg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 0.1-1.0, 1.0-5.0, 5.0-20.0, 20.0-50.0, or 50.0-100.0 mg.

[0184] In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 0.1-1.0, 1.0-20.0, 20.0-50.0, 50.0-200.0, or 200.0-500.0 mg.

[0185] During the course of treatment, administration of the composition may be altered or adjusted accordingly. For example, expression of the protein encoded by the nucleic acid targeted by the isolated nucleic acid of the pharmaceutical composition may be monitored to inform methods of use of the composition. Expression information may be obtained, for example, through measuring changes in the levels of the protein or RNA products of the target nucleic acid. Alternatively, sequencing analyses of the target nucleic acid may be employed to determine if expression changes include alterations in the structure or sequence of the protein or RNA product of the target nucleic acid sequence. The amount of the composition will vary depending on a number of factors such as, but not limited to, clinical features (e.g. disease severity, rate of disease progression, physical characteristics, etc.) of a subject and the mode of administration. Accordingly, the composition may, in certain instances, be administered once or more than one to a single subject. In certain instances, the composition may be administered to the same subject through different modes or routes at different times during the treatment process.

[0186] EXAMPLES

[0187] Example 1: RNA Processing Modulators (RPMs)

[0188] This example describes the use of RNA Processing Modulators (RPMs) for modulating translation of one or more mRNA transcripts in a cell or subject. RPMs function by binding to a target-specific mRNA sequence and altering (e.g., upregulating or down-regulating) translation of protein of the mRNA sequence.

[0189] In some embodiments, an RPM is an antisense oligonucleotide (ASO). Antisense oligonucleotides (ASOs) typically range from about 10 to 30 nucleotides in length, and may comprise a non-natural sugar-phosphate backbone (e.g., phosphorodiamidate morpholino backbone, phosphorothioate backbone, etc.) and / or one or more modified sugar moieties (e.g., 2 '-O-m ethoxy ethyl ribose (2'-0-M0E) modifications, etc.).

[0190] In some embodiments, an RPM (e.g., an ASO) targets a structural element of an mRNA transcript, for example an untranslated region (UTR) to modulate the expression of the target (e.g., the target gene encoding the mRNA transcript) by increasing or decreasing transcription and / or translation of the protein encoded by the mRNA transcript (alternatively referred to as modulating expression in the up or the down direction). In another example, an RPM (e.g., an ASO) may target a regulatory region (and thus interfere with protein binding, such as ribosomal protein binding) of a UTR region to modulate the expression of the target in the up or the down direction. Alternatively, an RPM (e.g., an ASO) may target a splice site (e.g., a splice acceptor site or a splice donor site or one or more nucleotide positions thereof in a UTR region) to modulate the expression of the target in the up or the down direction (and thus generating novel protein variants). Additional examples of structural elements that can be targeted by RPMs (e.g., ASOs) include, but are not limited to, intronic regulatory sites, exonic regulatory sites, exonintron boundaries, antisense binding sites of a target mRNA transcript, long-non-coding RNA (LncRNA) binding sites of a target gene, and a retained exon of a canonical mRNA.

[0191] Non-limiting examples of ASOs targeting various structural elements of an mRNA are show in FIG. 1. Composition “A” represents an ASO that binds to the 5’ untranslated region (5’ UTR) of an RNA. Composition “B” represents an ASO that binds to an intron of an RNA. Composition “C” represents an ASO that binds to a splice boundary (e.g., a splice junction) between an exon and intron of an RNA. Composition “D” represents an ASO that binds to an exon (e.g., a protein coding region) of an RNA. Composition “E” represents a combination of an ASO binding to a 3’ UTR of an RNA, alone or with a trans-regulator. Composition “F” represents a “gapmer” ASO that binds to an exon (e.g., protein coding region) of an RNA and mediates RNaseH decay. Composition “G” represents a “gapmer” ASO that binds to a 3’ UTR of an RNA, alone or with a trans-regulator, and mediates RNaseH decay. In some embodiments, ASOs binding to an RNA result in translation of a truncated protein that has a dominant negative effect on the wild-type, full-length protein.

[0192] Example 2: Glutamate Signaling and Psychiatric Disease

[0193] This example describes diseases and disorders that are associated with glutamate signaling, particularly psychiatric diseases and disorders. Many of the diseases and disorders are associated with aberrant (e.g., abnormal) signaling through glutamate receptors, for example N- methyl-D-aspartate (NMDA) receptors.

[0194] NMDA receptors are ionotropic glutamate receptors that consist of four subunits. Certain NMDA receptors comprise two GluNl subunits and two GRIN2A subunits. Activation of NMDA results in opening of a cation-selective ion channel, which in turn produces an excitatory postsynaptic potential.

[0195] It has been observed that aberrant NMDA activity or function is associated with several psychiatric diseases or disorders. For example, NMDA dysfunction has been associated with schizophrenia, and epileptic disorders (e.g., seizures). Overstimulation of NMDA receptors has also been implicated in excitotoxicity, which has been linked to certain neurodegenerative disorders, such as Alzheimer’s disease (AD). Historically, NMDA receptors have not been attractive therapeutic targets, due to a lack of selective agonists or antagonists, and also due to the challenges of delivering small molecule agents into portions of the brain important for NMDA signaling. Additionally, currently available NMDA agonists lack subunit-level specificity needed to target specific NMDA receptor subtypes.

[0196] Example 3: ASOs targeting GRIN2A

[0197] This example describes design of RPMs (e.g., ASOs) that target human GRIN2A. In the context of diseases associated with certain psychiatric diseases and disorders, it is desirable to decrease protein levels of GRIN2A (e.g., by decreasing translation of GRIN2A mRNA) or decrease GRIN2A function (e.g., by decreasing activity of GRIN2A protein). In some embodiments, reducing the level of GRIN2A reduces the level or activity of NMDA receptors that incorporate GRIN2A subunit (e.g., NMD AR). In some embodiments, ASOs are designed to target regions of GRIN2A mRNA that will result in increased translation of GRIN2A protein and / or increased activity of GRIN2A protein. In some embodiments, increasing the level of GRIN2A increases the level or activity of NMDA receptors that incorporate GRIN2A subunit (e.g., NMD AR). In other embodiments, ASOs are designed to target regions of GRIN2A mRNA that will result in decreased translation of GRIN2A protein and / or decreased activity of GRIN2A protein. In some embodiments, decreasing the level of GRIN2A decreases the level or activity of NMDA receptors that incorporate GRIN2A subunit (e.g., NMD AR).

[0198] Expression profiling of GRIN2A was performed. FIGs. 2A-2C show representative data regarding expression profiling of human Glutamate ionotropic receptor NMDA type subunit 2A (GRIN2A). FIG. 2A shows bulk tissue gene expression of human GRIN2A\ data indicate GRIN2A mRNA is expressed in various tissues. FIG. 2B shows a schematic depicting exons and introns present in the GRIN2A gene. FIG. 2C shows representative data for exon expression analysis of human GRIN2A splice variants in tissue. FIG. 3 is a schematic depicting the primary AUG, and upstream regions of GRIN2A mRNA transcript.

[0199] ASOs targeting several of regions of GRIN2A were designed, and are described in Column A of Table 1. In some embodiments, any one of the ASOs comprise one or more chemical modifications and / or comprise a non-natural sugar-phosphate backbone (e.g., a phosphorothioate backbone). In some embodiments, the ASO has a “gapmer” structure. In some embodiments any one of the ASOs comprise one or more chemical modification(s) listed in Column B of Table 1. In some embodiments, an ASO comprises a nucleic acid sequence from Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications) from Column B of Table 1, wherein the nucleic acid sequence from Column A and the one or more chemical modifications (or combinations of chemical modifications) from Column B are from the same row of Table 1.

[0200] Example 4: In vitro screening of ASOs

[0201] Cell lines (e.g., U-138 MG human glioblastoma cells) are cultured and maintained using appropriate media (e.g., Dulbecco's Modified Eagle's Medium containing 10% fetal bovine serum). When appropriate, several approaches are used to generate in vitro models for assessment of glutamate signaling. For instance, cell lines may be engineered to stably express NMDA receptors containing GRIN2A. When appropriate, glutamate-deficient media is optionally used.

[0202] A screen of ASOs targeting GRIN2A RNA (Table 1; FIG. 4A) was performed in 96 well plate format, seeding about 20,000 U-138 MG cells per well and treating with the ASOs at different concentrations of 5 nM and 20 nM using the RNAiMAX Lipofectamine protocol. Each concentration was transfected in 4 independent wells for biological quadruplicates. Two different ASO chemistries were assayed for targeting of GRIN2A RNA. Short interfering RNAs (siRNAs) were used as a positive control for GRIN2A expression measurements. A nontargeting ASO sequence with matched chemistry and length was used as a negative control, in addition to mock transfected wells treated with PBS or water. Cells were incubated at 37 °C in a cell culture incubator for 48 hours before isolating total RNA for measurement of gene expression. Total RNA was isolated and evaluated using a branched DNA (bDNA) signal amplification assay in order to quantify GRIN2A gene modulation. Cells were lysed and assayed using QuantiGene2.0 bDNA probe sets specific for human GRIN2A RNA, as well as for the housekeeping gene glyceraldehyde-3 -phosphate dehydrogenase (GAPDH), which was used as an internal control. RNA expression levels were measured and reported as a luminescence signal in arbitrary Relative Light Units (RLUs) for both GRJN2A and GAPDH. Measured luminescence levels were then used for analysis.

[0203] GRJN2A gene expression levels were normalized to both GAPDH and the negative controls. For each sample, GRIN2A gene expression levels, provided as RLUs, were first normalized to the housekeeping gene GAPDH (GRIN2A RLU / GAPDH RLU). Outliers were detected by testing the value furthest from the mean using the Dixon test on log2 -transformed data within each treatment group per plate. Values with a p-value below 0.01 were removed from subsequent analysis. GRIN2A expression relative to controls was then calculated for each sample based on the mean values of the mock and non-targeting control wells within each plate and shown as a percentage ((Sample / Control Mean) * 100). Resulting values for all treatment groups are shown in FIG. 4B.

[0204] Three (3) ASOs resulted in a decrease in GRIN2A RNA expression by more than 50% at the 20 nM dose and achieved knock-down comparable to the siRNA positive control. The effects of 10 of the most potent ASOs of each chemistry at the 5 nM dose and the 20 nM dose are shown in FIG. 4C.

[0205] The effect of these ASOs on glutamate signaling may further be measured by methods known in the art, for example by using radiolabeled glutamate. ASO efficacy may be determined by comparing the levels of glutamate signaling between treated and untreated cells.

[0206] To further characterize ASO-dependent changes on glutamate signaling, cytotoxicity may be measured to understand the physiological impact of changes in glutamate levels. Cell viability may be measured by generating survival curves through manually counting Trypan blue staining of cells following ASO treatment. Alternatively, propidium iodide staining of cells followed by flow cytometry analysis may be used to measure cell death.

[0207] Example 5: In Vitro Dose Response of ASOs Targeting GRIN2A

[0208] To further characterize ASOs targeting GRIN2A, select ASOs (e.g., as described in Table 1) were assayed in U138-MG cells over a 10-dose series, and knockdown efficacy was compared to results obtained previously as part of a 2-dose series. To assess the efficacy of GRJN2A -targeting ASOs in U138-MG cells, 22 ASOs were assayed over a 10-dose series by treating cells with a dosage of 40 nM ASO, 20 nM ASO, 10 nM ASO, 5 nM ASO, 2.5 nM ASO, 1.25 nM ASO, 0.625 nM ASO, 0.3125 nM ASO, 0.156250 nM ASO, or 0.078125 nM ASO. The ASOs included ASOs of either a gapmer chemistry or a skipmer chemistry. U138-MG cells were plated in 96-well plates at 1.5 x 104cells per well, then forward transfected with ASOs using the RNAiMAX protocol, with 4 biological replicates per transfection condition. Control cells were transfected with water and a non-targeting control. After incubation at 37 °C for 48 hours, GRJN2A gene expression levels were analyzed by a branched DNA (bDNA) assay as described previously. The effect of GRJN2A -targeting ASOs on GRIN2A gene expression was compared against corresponding conditions previously tested in a 2-dose series of U138-MG cells. The tested ASOs were observed to effectively inhibit GRIN2A expression at both 20 nM and 5 nM, as in the previous 2-dose series (FIG. 5). Furthermore, the degree of knockdown was determined to be correlated between both sets of samples (R = 0.53). These results indicate high reproducibility of ASO effectiveness. The efficacy of 4 select ASOs (e.g., as described in Table 1) was specifically examined in the 10-dose series. Each of these skipmer ASOs were observed to effectively inhibit GRIN2A expression in U138-MG cells, attaining >50% knockdown between 10 nM and 40 nM, with most ASOs attaining >50% knockdown around 10 nM (FIG. 6A). The 4 assayed ASOs did not significantly affect the expression of GAPDH, even at the highest tested concentration (FIG. 6B).

[0209] In another set of experiments, iPSC-Derived Glutamatergic Neurons (FujiCDI) plated 67k cells / well were treated with a panel of 64 GRIN2A ASOs by gymnotic delivery at 4 concentrations (3 uM, 1 uM, 0.3 uM, and 0.1 uM). Six days post-treatment, RT-qPCR assay was performed to determine normalized expression levels of GRIN2A mRNA (Taqman Hs00168219_ml assay, Thermofisher), using 18S rRNA as a normalizer (Taqman Hs03003631_gl assay, Thermofisher). FIG. 7A (top panel) shows representative data in which GRIN2A mRNA levels are presented relatively to mock-transfected controls in function of the dose of transfected ASOs for the 64 tested GRIN2A ASOs (Skippers and Gapmers are shown). Means are presented, error bars are Standard Error for N=2 biological replicates by group. FIG 7A (bottom panel) shows representative data in which GRIN2A mRNA levels are presented relatively to mock-transfected controls in function of the dose of transfected ASOs for the 15 most potent of the tested GRIN2A ASOs shown in FIG. 7 top panel (Skippers and Gapmers are shown). Means are presented, error bars are Standard Error for N=2 biological replicates by group.

[0210] An additional 37 ASOs (SEQ ID NOs: 234-269) were designed and screened in iPSC derived neurons. Assays were performed in a 96 well plate format and iPSCs were treated with ASOs at concentrations of 0.08 pM, 0.4 pM, 2.0 pM, or 10.0 pM. Biological duplicates of each ASO treatment were performed. All ASOs were provided comprising a gapmer chemistry as set forth in rows 235-269 of column B of Table 1. Total RNA was isolated and converted (reverse- transcribed) to cDNA, then Taqman gene expression assays were used to quantify GRIN2A gene modulation relative to a human housekeeping gene, hypoxanthine guanine phosphoribosyltransferase 1 (HPR11). GRJN2A gene expression levels were analyzed using the Delta-Delta Ct method. For each sample, GRIN2A gene expression levels, provided as cycle threshold (Ct) values, were normalized to the housekeeping gene HPRT1 (2'(GRIN2A ct~HPRT1 ct)y GRIN2A expression relative to controls was then calculated for each sample based on the mean values of non-transfected control wells treated with PBS and shown as a percentage ((Sample / Control Mean) * 100). Resulting values for all treatment groups are shown in FIGs. 7B-7G. Five of the tested GRIN2A ASOs resulted in a decrease in GRIN2A RNA expression by more than 50% at the 2 pM dose. The five GRIN2A ASOs included: an ASO comprising the nucleotide sequence of SEQ ID NO: 237, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 238 of Table 1 (see GRIN2A RNA expression in FIG. 7B); an ASO comprising the nucleotide sequence of SEQ ID NO: 251, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 252 of Table 1 (see GRIN2A RNA expression in FIG. 7C); an ASO comprising the nucleotide sequence of SEQ ID NO: 252, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 253 of Table 1 (see GRIN2A RNA expression in FIG. 7D); an ASO comprising the nucleotide sequence of SEQ ID NO: 254, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 255 of Table 1 (see GRIN2A RNA expression in FIG. 7E); an ASO comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1 (see GRIN2A RNA expression in FIG. 7F); and an ASO comprising the nucleotide sequence of SEQ ID NO: 269, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 270 of Table 1 (see GRIN2A RNA expression in FIG. 7G). One ASO comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B, respectively, of row 235 of Table 1 (also referred to as “ASO 2” herein) was selected for further in vivo analyses as described in Example 8.

[0211] Example 6: In Vivo ASO Methods

[0212] A rodent model of schizophrenia, for example as described by Jones et al. Br J Pharmacol. 2011 Oct; 164(4): 1162-1194, may be used. Animals are maintained in a consistent light and dark cycle and allowed to acclimate for at least five days prior to experiments. Regular feedings are executed at a consistent time, frequency, and amounts each day. ASOs targeting GRIN2A are administered to the animals by infusion. When multiple ASO infusions are performed, administration of the ASO is done at the same time each day to minimize changes in metabolism due to circadian rhythm. ASO infusions are either directly provided to the affected area or into the cerebral spinal fluid (CSF). Animals may be placed in the Trendelenburg position during and after the infusion to aid in distribution of the ASOs into the tissue (e.g., CNS tissue) of the animals. ASOs are solubilized in an appropriate buffer and sterilized prior to infusions. Following infusions, animals are maintained for a predetermined period of time prior to analysis. In some instances, animals are fed a diet with radioactive glutamate to determine the extent of glutamate signaling. To analyze the effect of ASO treatment, animals are anesthetized, and tissue is harvested. Harvested tissue samples are flash frozen in appropriate extraction buffers. Blood samples are isolated, when appropriate, and mixed with buffer for preservation purposes. Harvested tissue samples are cryosectioned and used for immunohistochemistry analysis. Tissue samples are used for measuring glutamate levels.

[0213] Example 7: In Vivo Administration of ASOs to Mouse Brains

[0214] C57BL / 6 mouse subjects received administration of ASOs and brain tissues were subjected to Grin2a mRNA knockdown analyses to assess in vivo effects of ASOs. Mouse subjects were administered either vehicle (artificial CSF) or ASOs via intracerebroventricular (ICV) injection. ASO injection comprised either single or repeated administration. Single administration comprised unilateral ICV injection of 100 pg of ASO through a canula. Repeated administration comprised two unilateral ICV injections through a canula, with a 1-week interval, at either 50 pg or 100 pg of ASO.

[0215] Cortex and hippocampus samples were harvested from injected mouse subjects at 2 weeks post-treatment. Grin2a mRNA levels were measured by RT-qPCR using two independent assays (light / dark colors). For RT-qPCR, frozen tissues were lysed and homogenized in RLT buffer using beads (MP Biomedical) before RNA extraction using RNeasy Mini Kit (Qiagen) in a QIAcube station (Qiagen). RNA concentration was evaluated using a nanodrop spectrometer (ThermoFisher). RNA integrity was evaluated using 2100 Bioanalyzer LabChip (Agilent). Then, 500 ng of RNA was reverse-transcribed using SuperScript IV VILO Master Mix ezDNase (Invitrogen). qPCR was performed with TaqMan Fast Advance Master Mix (Invitrogen) in a Quantstudio thermocycler (Applied Biosystems) with 2 independent Taqman (VIC) assays for GRIN2A (Thermofi scher and IDT721, IDT). PGK1 levels were measured using a Taqman (FAM) assay (Mm00435617_ml, Thermofi scher) for normalization using the Delta Delta Ct method. After single ICV injection of 100 pg of ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)), Grin2a mRNA was significantly knocked down (-50-60%) in hippocampus tissue samples from injected mouse subjects (FIG. 8 A). After repeated ICV injection of 100 pg ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)), Grin2a mRNA was significantly knocked down (-50-90%) in cortex tissue samples from injected mouse subjects (FIG. 8B). Repeated ICV injection of either 50 pg or 100 pg ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) both resulted in significant knockdown of Grin2a mRNA levels in hippocampus tissue samples from injected mouse subjects (FIG. 8B). Further analyses using hybridization ELISA (hELISA) in frontal cortex and hippocampus tissue samples from injected mouse subjects revealed significant in vivo ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) levels (FIGs. 9A-9B).

[0216] These results indicate that ICV administration of ASOs targeting Grin2a mRNA into mouse subjects resulted in accumulation of ASOs in the frontal cortex and hippocampus tissues which coincided with target knockdown.

[0217] Further analyses were used to determine the effect of repeated intracerebroventricular injection of ASOs performed three times on mouse subjects. Mouse subjects (BalbJ / C) at 8-9 weeks of age underwent cannulation. Three weeks later, mouse subjects received either vehicle or 100 pg of ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) via intracerebroventricular injection. Additional injections were performed at week four and week five using the same approach. At 5.5 weeks, an open-field assay was performed to determine the effect of in vivo ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) administration on animal subjects, wherein an Open Field Assay was used. The Open Field Assay comprised placing the subject in the center of a field for thirty minutes and the time spent in the center was recorded approximately every 5 min. The recordings were plotted, and the median total time spent in the center was calculated. At 6.5 weeks, animals were sacrificed and tissue samples from the cortex, cerebellum, hippocampus, striatum, and cerebrospinal fluid were harvested for further analyses (FIG. 10A). RT-qPCR analyses of harvested brain tissue samples showed significant knockdown of Grin2a mRNA in cortex and hippocampus tissues (~ 60-65% and -50-60%, respectively) of injected subjects (FIGs. 10B- 10C). Administration of ASOs (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) significantly increased the amount of time the subjects spent in the center of the field relative to vehicle- treated control subjects (FIG. 10D). These results indicated that ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) administration reduced anxiety and depression-like behavior and occurred in conjunction with Grin2a mRNA knockdown.

[0218] Further analyses were conducted to correlate ASO levels and Grin2a mRNA knockdown in mouse brain tissue. For single ICV injection, mouse subjects received ICV injection of either vehicle (artificial CSF) or a single dose of 100 pg ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)). For repeated ICV injection, mouse subjects received repeated ICV injection with either vehicle, a total dose of 100 pg ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) (50 pg+50 pg), or a total dose of 200 pg ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) (100 pg+100 pg) as described herein. Repeated ICV injections (50pg+50pg and 100 pg+100 pg) were performed one week apart (days 7 and 14). Injected mouse subjects were sacrificed at 28 days (two weeks after the last ICV injection) and frontal cortex and hippocampus tissue samples were collected as described herein. ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) levels in tissue samples were measured via hybridization ELISA and Grin2a mRNA knockdown in tissue samples were measured via RT-qPCR as described herein (FIG. 11 A). ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) levels and Grin2a mRNA knockdown in hippocampus tissue samples were correlated. The results indicated that ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) at a concentration of 10 pg / g tissue correlated with an approximate 40% knockdown in Grin2a mRNA in mouse hippocampus tissue samples (FIG. 1 IB).

[0219] Example 8: In Vivo ASO Administration to Non-Human Primates

[0220] This example describes in vivo administration of GRIN2A ASOs to cynomolgus monkey (Macaca fascicularis) subjects (also referred to as “non-human primate subjects”). Non-human primate subjects were used to compare in vivo pharmacokinetics (ASO levels) between non- human primate subjects and mouse subjects that underwent injection with ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)).

[0221] Briefly, non-human primate subjects were administered a series of two intrathecal (“IT”) injections of either vehicle (artificial CSF), ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) at a “low dose” of 20 mg (10 mg+10 mg), or ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) at a “high dose” of 40 mg (20 mg+20mg). The vehicle- injected non-human primate group consisted of two male subjects and one female subject. The low ASO dose-injected non-human primate group consisted of one male subject and one female subject. The high ASO dose-injected non-human primate group consisted of one male subject and two female subjects. For all non-human primate subjects, each round of IT injection was performed two weeks apart (days 1 and 14). Non-human primate treatment groups, administrations to each treatment group, and ASO pharmacokinetic results observed in each treatment group are summarized in Table 2. Non-human primate subjects were sacrificed at day 28 (two weeks after the last IT injection) and samples of cerebrospinal fluid as well as brain (frontal cortex, sensory cortex, and hippocampus), lumbar spinal cord, dorsal root ganglion, kidney, liver, spleen, heart, stomach, and gonads tissues were collected. Additionally, serum and plasma were collected 3 days prior to day 1 and before day 14 (FIG. 12). Liquid chromatography-mass spectrometry analysis was used to measure ASO pharmacokinetics (ASO levels) and RT-qPCR was used to measure ASO pharmacodynamics (GRIN2A mRNA expression) in tissue samples obtained from injected non-human primates. ASO concentrations in frontal cortex, hippocampus, and lumbar spinal cord samples were quantified to determine ASO levels as a result of IT injection.

[0222] Additionally, mouse subjects were administered a series of two unilateral intracerebroventricular (“ICV”) injections through a cannula of either vehicle (artificial CSF), ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) at a “low dose” of 100 pg (50 pg+50 pg), or ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) at a “high dose” of 200 pg (100 pg+100 pg). Each ICV injection was performed one week apart. A total of 4-5 mouse subjects were used in each group. Mouse subjects were sacrificed two weeks after the last ICV injection and samples from frontal cortex and hippocampus tissues were collected. Hybridization ELISA analysis was used to measure ASO levels in tissue samples of mouse subjects. Further details regarding mouse subject ICV injection and hybridization ELISA methods are provided in Example 7.

[0223] Table 2. ASO Pharmacokinetics in Non-Human Primate Subjects

[0224] Low dose ASO and high dose ASO treatments groups received an ASO comprising the nucleotide sequence of SEQ ID NO: 134 (*) and chemical modifications (**) as set forth in Columns A and B, respectively, of row 135 of Table 1 (also referred to as “ASO 1” herein) No ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) was detected in tissue samples from non-human primate subjects that underwent two IT injections with vehicle. No in-life safety signals were observed in non- human primate subjects who received IT injection with vehicle or ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)).

[0225] In frontal cortex and hippocampus samples obtained from non-human primate subjects that underwent two IT injections of a low dose of ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) targeting GRIN2A mRNA, ASO was detected at a mean concentration of approximately 11-13 pg / g tissue (FIGs. 13A-13D and Table 2). In lumbar spinal cord tissue samples obtained from said subjects, ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) was detected at a mean concentration of approximately 16 pg / g tissue (Table 2).

[0226] In frontal cortex and hippocampus tissue samples obtained from non-human primate subjects that underwent two IT injections of a high dose of ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) targeting GRIN2A mRNA, ASO was detected at a mean concentration of approximately 25-47 pg / g tissue (FIGs. 13A-13D and Table 2). In lumbar spinal cord tissue samples obtained from said subjects, ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) was detected at a mean concentration of approximately 51 pg / g tissue (Table 2). Further analyses indicated that two IT injections of the high dose of ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) resulted in significant GRIN2A mRNA knockdown (-30-45%) in frontal cortex and sensory cortex tissue samples obtained from non-human primate subjects (FIGs. 13E-13O). Injection with vehicle (artificial CSF) or a non-specific ASO had no significant effect on GRIN2A mRNA knockdown (FIGs. 13E-13O).

[0227] ASO pharmacokinetics in tissue samples obtained from non-human primate subjects that underwent two IT injections of ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) far exceeded levels of the same ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) that resulted in Grin2a mRNA knockdown in CNS tissue samples obtained from mouse subjects that underwent ICV injection with ASO. For example, in injected mouse subjects, ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) levels greater than 10 pg / g tissue correlated with 50% knockdown of Grin2a mRNA (FIG. 8 A, FIGs. 10B-10C, FIGs. 11A-11B, FIGs. 13A-13O, and Table 2). Additionally, ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) pharmacokinetics in tissue samples obtained from non-human primate subjects that underwent two IT injections of ASO met or exceeded pharmacokinetic data in non-human primate ASO studies that have been previously described (see, e.g., Malatl ASO administration in Jafar-Nejad et al. (2021). Nucleic Acids Research. 49 (2): 657-673).

[0228] The pharmacokinetic effects associated with a series of four IT injections of ASO were assessed in additional non-human primate subjects. Three male non-human primate subjects were administered a series of four IT injections of either vehicle (artificial CSF) or ASO 1 (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein))) at a dose of 100 mg (30 mg+30 mg+20 mg+20 mg). For all non-human primate subjects, each round of IT injection was performed two weeks apart (days 0, 14, 28, and 42). Samples of cerebrospinal fluid as well as brain (frontal cortex, sensory cortex, and hippocampus), lumbar spinal cord, dorsal root ganglion, kidney, liver, spleen, heart, stomach, and gonads tissues were collected at two weeks following the last IT injection (FIG. 18). Liquid chromatography-tandem mass spectrometry (LC-MS / MS) analysis was used to measure ASO pharmacokinetics (levels of ASO comprising the nucleotide sequence of SEQ ID NO: 134 and - I l l - chemical modifications as set forth in Columns A and B, respectively, of row 135 of Table 1 (also referred to as “ASO 1” herein)) in tissue samples obtained from injected non-human primates. ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) concentrations in tissue samples were quantified to determine ASO levels as a result of IT injection (FIG. 19).

[0229] Example 9: In Vivo Administration of ASO s to Mouse Seizure Models

[0230] C57BL / 6 mouse subjects were evaluated for the effect of Grin2a silencing on seizure phenotypes associated with epilepsy. Mouse subjects at 8-10 weeks of age underwent cannulation. Three weeks later, mouse subjects received either vehicle (artificial CSF) or 100 pg of an ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein) or an ASO comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1 (also referred to as “ASO 2” herein) via intracerebroventricular (ICV) injection. Additional ICV injections were performed at week four and week five using the same approach. At 6 weeks, intraperitoneal injection of 85 mg / kg of a GABAA agonist, pentylenetetrazol (PTZ), was used to induce acute seizure phenotypes in all subjects. Positive control group mouse subjects received 400 mg / kg of an antiepileptic agent, Valproate, 30 minutes prior to seizure analyses. In parallel, brain tissues were harvested from vehicle- and ASO-injected subjects and used for Grin2a mRNA knockdown analyses (FIG. 14A).

[0231] Acute PTZ-induced seizures were observed and scored against several endpoints over a 30-minute period. Endpoints included: latency to first twitch, latency to first clonic seizure / tonic seizure, latency to first tonic seizure, latency to death, and survival 1-hour post-PTZ administrated. Indicators of seizure phenotypes were also scored in 10-minute bins over a 30- minute period following PTZ administration. Scoring comprised ranking seizure phenotypes as shown below.

[0232] • Rank 0 = no motor seizure.

[0233] • Rank 1 = staring, moving into prone posture, ears flattened, mouth or facial movement, slight tremor, small movements, sight intermittent twitch, tail elevated, increased respiration, ataxia. • Rank 2 = prone, immobility, hindlimb splay, increased tremor intensity, absence seizure, ataxia, head nod / bow, isolated body twitches, straub or elevated tail, tail wag.

[0234] • Rank 3 = slight clonic / tonic seizures less than 5 sec in duration, muscle fasciculation, straub tail, tonic praying seizure; salivation.

[0235] • Rank 4 = rearing, pawing, chomping, head bow, head arch, salivation, absence seizure, praying seizure, trumpet seizure, pop seizure, clonic / tonic seizure with increased frequency and duration.

[0236] • Rank 5 = clonic / tonic seizure greater than 5 sec in duration with loss of right reflex.

[0237] • Rank 6 = crazy seizure, tonic seizure with extension of hindlimbs; death.

[0238] Vehicle-treated subjects exhibited low latency to death and low percent survival. These results were observed in concert with seizure incidence. Specifically, vehicle-treated subjects exhibited low latencies to first twitch, first clonic / tonic seizure, and first tonic seizure. In contrast, Valproate-treated subjects exhibited significantly increased latency to death and percent survival relative to vehicle-treated subjects. This was observed in concert with significantly increased latencies to first twitch, first clonic / tonic seizure, and first tonic seizure relative to vehicle-treated subjects. Importantly, GRIN2A ASO administration produced similar results to that of Valproate treatment. All subjects that received GRIN2A ASOs exhibited significant improvements in PTZ-induced seizure phenotypes, latency to death, and survival relative to vehicle-treated subjects. Administration of a GRIN2A ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein) resulted in significantly increased latency to death, percent survival, latency to first twitch, latency to first clonic / tonic seizure, and latency to first tonic seizure. More dramatic increases in these parameters were observed in subjects that received administration of a GRIN2A ASO comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1 (also referred to as “ASO 2” herein) (FIGs. 14A-14F). Additionally, when seizure phenotype scores were measured over time, vehicle-treated subjects exhibited no change in phenotype over the 30 minutes following PTZ administration. However, similar to Valproate-treated subjects, GRIN2A ASO-treated subjects exhibited decreases in seizure phenotypes scores across the 30-minute time frame (FIG. 14G).

[0239] Further analyses were used to determine if changes in seizure phenotypes of GRIN2A ASO-injected mouse subjects were associated with Grin2a knockdown. For RT-qPCR, frozen tissues were lysed and homogenized in RLT buffer using beads (MP Biomedical) before RNA extraction using RNeasy Mini Kit (Qiagen) in a QIAcube station (Qiagen). RNA concentration was evaluated using a nanodrop spectrometer (ThermoFisher). RNA integrity was evaluated using 2100 Bioanalyzer LabChip (Agilent). Then, 500 ng of RNA was reverse-transcribed using SuperScript IV VILO Master Mix ezDNase (Invitrogen). qPCR was performed with TaqMan Fast Advance Master Mix (Invitrogen) in a Quantstudio thermocycler (Applied Biosystems) with 2 independent Taqman (VIC) assays for GRIN2A (TF066, Thermofischer and IDT721, IDT). PGK1 levels were measured using a Taqman (FAM) assay (Mm00435617_ml, Thermofischer) for normalization using the DeltaDeltaCt method.

[0240] Grin2a mRNA in cortex tissue samples from mouse subjects that received repeated ICV injection of the GRIN2A ASOs were significantly reduced. The highest levels of Grin2a mRNA silencing in the cortex was achieved using the ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to herein as “ASO 1”) (FIGs. 15A-15B). In hippocampus tissue samples, GRIN2A ASOs also achieved significant Grin2a mRNA knockdown. The highest levels of Grin2a mRNA silencing in the hippocampus was also achieved using the ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to herein as “ASO 1”) . However, both GRIN2A ASOs achieved higher Grin2a mRNA knockdown in the hippocampus tissue samples relative to knockdown in the cortex tissue samples (FIGs. 15C- 15D). Further statistical analyses were performed on the Grin2a knockdown data which further supported the significance of these Grin2a silencing effects in vivo (FIGs. 16A-16B).

[0241] Example 10: Immunostimulatory Effects of ASOs In Vitro

[0242] This Example relates to analyses of immunostimulatory effects of GRIN2A ASOs in human peripheral blood mononuclear cells (huPBMCs).

[0243] All ASOs were prepared using in vivo quality grade material in manner that was consistent with analyses performed in animal subjects as described above. huPBMCs were harvested from healthy donors and went either untreated, treated with a cytokine / chemokine response control agent, or treated with a GRIN2A ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to herein as “ASO 1”) ) at a concentration of IpM, 3pM, or lOpM for 24 hours.

[0244] Cytokine / chemokine response control agents included: XD-01024, a cholesterol - conjugated ApoB siRNA which has TLR7 / 8 agonist effects; CL097, a water-soluble derivative of imidazoquinoline compound R848 which is a TLR7 / 8 ligand; Imiquimod (R837), an immune response modifier having potent antiviral activity and also induces production of cytokines and activates TLR7; ODN2006 having preference towards TLR9, one or more CpGs, class B; and ODN2395, TLR9, CpG with palindromic motif, class C.

[0245] Following treatment of huPBMCs, the levels of IFN-a2a, IFN-b, IL-1B, IL-6, IL-10, IP- 10, MCP-1, MIP-la, MIP-lb and TNF-a were measured using the MSD-U-Plex platform. Representative data from these analyses are shown in FIGs. 17A-17J. Negative control cells exhibited minimal increases or no detectable increase in chemokine / cytokine levels following treatment. Treatment with TLR agonist positive controls resulted in increased chemokine / cytokine levels as expected. When compared relative to cell samples treated under negative or positive control conditions, immunogenic responses to GRIN2A ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to herein as “ASO 1”) were either minimal or not detected (FIGs. 17A-17J).

[0246] EQUIVALENTS

[0247] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the inventive teachings is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.

[0248] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0249] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.

[0250] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”

[0251] The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, z.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, z.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

[0252] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as being inclusive, z.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of’ or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (ie., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0253] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and / or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0254] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0255] In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, z.e., to mean including but not limited to. Only the transitional phrases “consisting of’ and “consisting essentially of’ shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of’ and “consisting essentially of’ the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B”, the disclosure also contemplates the alternative embodiments “a composition consisting of A and B” and “a composition consisting essentially of A and B”.

Claims

CLAIMSWhat is claimed is:

1. An isolated nucleic acid that comprises a region of complementarity with a human GRIN2A mRNA transcript, has at least 60% identity to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-269, and upon binding to the mRNA transcript decreases transcription, splicing, and / or translation of functional GRIN2A protein encoded by the mRNA transcript.

2. The isolated nucleic acid of claim 1, wherein the isolated nucleic acid comprises RNA.

3. The isolated nucleic acid of claim 1 or 2, wherein the isolated nucleic acid is an antisense oligonucleotide.

4. The isolated nucleic acid of any one of claims 1 to 3, comprising or consisting of between 10 and 40 nucleotides.

5. The isolated nucleic acid of claim 4, wherein the isolated nucleic acid comprises or consists of between 18 and 25 nucleotides.

6. The isolated nucleic acid of any one of claims 1 to 5, wherein the isolated nucleic acid comprises one or more chemical modifications.

7. The isolated nucleic acid of claim 6, wherein the one or more chemical modifications comprise one or more nucleoside modifications and / or one or more sugar-phosphate backbone modifications.

8. The isolated nucleic acid of claim 7, wherein the one or more nucleoside modifications comprises a 2'-O-methyl (2’-0Me) modification, a 2'-0-M0E modification, a 2'-O-fluoro modification, or a locked nucleic acid (LNA) modification.

9. The isolated nucleic acid of claim 7 or 8, wherein the one or more sugar-phosphate backbone modifications comprises a phosphorothioate backbone modification.

10. The isolated nucleic acid of any one of claims 1 to 9, wherein the isolated nucleic acid is fully chemically modified.

11. The isolated nucleic acid of any one of claims 1 to 10, wherein the isolated nucleic acid comprises one or more deoxyribonucleotides, optionally wherein the isolated nucleic acid is a gapmer.

12. The isolated nucleic acid of any one of claims 1 to 11, wherein the region of complementarity is located in an untranslated region (UTR) of the GRIN2A mRNA transcript.

13. The isolated nucleic acid of claim 12, wherein the untranslated region comprises a 5’ UTR, an intron, or a 3 ’UTR of the GRIN2A mRNA transcript.

14. The isolated nucleic acid of any one of claims 1 to 11, wherein the region of complementarity is located in a protein coding region of the GRIN2A mRNA transcript.

15. The isolated nucleic acid of any one of claims 1 to 11, wherein the region of complementarity is located on an intron-exon boundary of the GRIN2A mRNA transcript.

16. The isolated nucleic acid of any one of claims 1 to 15, wherein the region of complementarity comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 continuous nucleotides of the sequence set forth in any one of SEQ ID NOs: 270-272.

17. The isolated nucleic acid of any one of claims 1 to 16, comprising the nucleotide sequence set forth in any one of the nucleotide sequences set forth in Table 1.

18. A composition comprising the isolated nucleic acid of any one of claims 1 to 17, and a pharmaceutically acceptable excipient.

19. A method for reducing glutamate signaling in a cell or a subject, the method comprising administering the isolated nucleic acid of any one of claims 1 to 17 or the composition of claim 18 to a cell or a subject in need thereof.

20. The method of claim 19, wherein the cell is a neuronal cell.

21. The method of claim 19 or 20, wherein the subject comprises one or more mutations in a gene that is associated with a psychiatric disease or disorder, optionally wherein the gene is GRIN2A.

22. The method of any one of claims 19 to 21, wherein the cell is a human cell, optionally wherein the cell is in a subject.

23. The method of any one of claims 19 to 22, wherein the subject is a human subject.

24. The method of any one of claims 19 to 23, wherein the subject has or is suspected of having a psychiatric disease or disorder.

25. The method of claim 24, wherein the disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of- function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).

26. The method of any one of claims 19 to 25, wherein the administration is systemic administration, optionally wherein the systemic administration comprises intravenous injection.

27. The method of any one of claims 19 to 25, wherein the administration comprises direct administration to a target tissue of the subject, optionally wherein the direct administrationcomprises direct injection to the central nervous system (CNS) or direct injection to the peripheral nervous system.

28. The method of claim 27, wherein the administration comprises placing the subject in a Trendelenburg position during the administration.

29. A method for reducing NMDA receptor-mediated exci totoxi city in a subject, the method comprising administering the isolated nucleic acid of any one of claims 1 to 17, or the composition of claim 18, to a subject in need thereof.

30. The method of claim 29, wherein the subject is characterized as not having a mutation in a gene associated with glutamate signaling, optionally wherein the gene is GRIN2A.

31. The method of claim 29, wherein the subject comprises one or more mutations in a gene that is associated with glutamate signaling, optionally wherein the gene is GRIN2A.

32. The method of any one of claims 29 to 31, wherein the subject is a human subject.

33. The method of any one of claims 29 to 32, wherein the subject has or is suspected of having a psychiatric disease or disorder.

34. The method of claim 33, wherein the psychiatric disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).

35. The method of any one of claims 29 to 34, wherein the administration is systemic administration, optionally wherein the systemic administration comprises intravenous injection.

36. The method of any one of claims 29 to 34, wherein the administration comprises direct administration to the central nervous system (CNS), optionally wherein the direct administration comprises direct injection to the CNS.

37. The method of claim 36, wherein the administration comprises placing the subject in a Trendelenburg position during the administration.

38. A method for preventing or treating a psychiatric disease or disorder in a subject in need thereof, the method comprising administering to the subject the isolated nucleic acid of any one of claims 1 to 17 or the composition of claim 18.

39. The method of claim 38, wherein the subject is a human.

40. The method of claim 38 or 39, wherein the disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).

41. The method of any one of claims 38 to 40, wherein the administration comprises direct administration to a target tissue of the subject, optionally wherein the direct administration comprises direct injection to the central nervous system (CNS) or direct injection to the peripheral nervous system (PNS).

Images