Methods for detecting an Anti-drug antibody (ADA) against an Anti-tnf alpha antibody
Patent Information
- Application Number
- EP2024793540
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-06-15
- Filing Date
- 2024-04-19
- Publication Date
- 2026-02-25
AI Technical Summary
Current methods for detecting anti-drug antibodies (ADAs) against anti-TNFα antibodies are inadequate in sensitivity and reliability, which hinders the development and efficacy of treatments using these biologics due to immune responses and reduced drug efficacy.
An in vitro assay method involving incubation with a composition of affinity and detection antibodies conjugated to labels, followed by isolation and detection using a solid phase with a second affinity label, allowing for sensitive measurement of ADAs with a chemiluminescent or electrochemiluminescent signal, achieving a sensitivity of less than 5ng/mL.
The method effectively detects ADAs with high sensitivity and reliability, enabling better assessment of immunogenicity and treatment efficacy by accurately measuring ADA levels in samples, thereby improving the development and implementation of anti-TNFα antibody therapies.
Smart Images

Figure US2024025346_24102024_PF_FP_ABST
Abstract
Description
Docket No. 140505.8005.WO00 METHODS FOR DETECTING AN ANTI-DRUG ANTIBODY (ADA) AGAINST AN ANTI-TNF ALPHA ANTIBODY CROSS-REFERENCE TO RELATED APPLICATION(S)
[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 460,821, filed on April 20, 2023, U.S. Provisional Patent Application No. 63 / 461,131, filed on April 21, 2023, and U.S. Provisional Patent Application No.63 / 508,436, filed on June 15, 2023. The contents of each of these provisional applications are incorporated by reference in their entirety. SEQUENCE LISTING
[0002] This application contains an ST.26 compliant Sequence Listing, which was submitted in xml format via Patent Center and is hereby incorporated by reference in its entirety. The .xml copy, created on April 16, 2024, is named 140505_8005_WO00_SL.xml and is 20,939 bytes in size. TECHNICAL FIELD
[0003] The present technology includes an in vitro assay for identifying antibodies, such as an anti-drug antibody (ADA) that bind an anti-TNFα antibody. SUMMARY
[0004] In some embodiments, the present technology generally relates to methods for detecting an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) incubating the sample with a composition comprising: (a) a first affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label, and (b) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (ii) isolating ADAs that form a complex with both the first affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; and (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut- point.Docket No. 140505.8005.WO00
[0005] In some embodiments, isolating the ADAs comprises: (a) providing a solid phase comprising the second affinity label; (b) contacting the sample and the composition with the solid phase; and (c) washing the solid phase.
[0006] In some embodiments, the target antibody, the affinity antibody, and / or the detection antibody comprise a chimeric human-murine monoclonal IgG1-kappa antibody. In some embodiments, the target antibody, the affinity antibody, and / or the detection antibody comprise SEQ ID NOs: 1 and 4.
[0007] In some embodiments, the solid phase is a plate.
[0008] In some embodiments, the first affinity label is biotin. In some embodiments, the second affinity label is streptavidin.
[0009] In some embodiments, the detection antibody comprises a sulfo-Tag labeled anti-TNFα antibody.
[0010] In some embodiments, measuring the level of the detection label comprises: (1) contacting the solid phase with a marker configured to produce a chemiluminescent or electrochemiluminescent signal when the marker is proximal to the detection label; and (2) detecting the chemiluminescent or electrochemiluminescent signal.
[0011] In some embodiments, the marker is tripropylamine (TPA), and measuring the level of the detection label further comprises applying an electrical current to the marker to produce the chemiluminescent or electrochemiluminescent signal.
[0012] In some embodiments, the solid phase is blocked with a blocking buffer before the sample and the composition are contacted with the solid phase.
[0013] In some embodiments, the methods further comprise performing steps (i) to (iii) on a control sample. In some embodiments, the control sample is incubated with the composition and contacted with the second affinity label.
[0014] In some embodiments, the predetermined cut-point corresponds to a level with a 5% false-positive rate. In some embodiments, the 5% false-positive rate is determined by measuring the detection label in a plurality of control samples and calculating the 5% false-positive rate.Docket No. 140505.8005.WO00
[0015] In some embodiments, the chemiluminescent or electrochemiluminescent signal is measured as electrochemiluminescence (ECL).
[0016] In some embodiments, the predetermined cut-point is an ECL value of at least 1. In some embodiments, the predetermined cut-point is an ECL value of about 1.10.
[0017] In some embodiments, the methods have a sensitivity that is less than 6ng / mL. In some embodiments, the sensitivity is less than 4ng / mL. In some embodiments, the methods have a drug tolerance of about 100ng / mL.
[0018] In some embodiments, the present technology generally relates to methods for detecting an ADA that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) contacting a sample with one or more anti-TNFα conjugates to form a complex between the ADA and the anti-TNFα conjugates; and (ii) measuring a level of anti-TNFα conjugates in the complex; wherein the methods detect the ADA with a sensitivity less than 5ng / mL.
[0019] In some embodiments, the one or more anti-TNFα conjugates comprise an affinity antibody comprising an anti-TNFα antibody conjugated to an affinity label.
[0020] In some embodiments, the one or more anti-TNFα conjugates comprise a detection antibody comprising an anti-TNFα antibody conjugated to a detection label.
[0021] In some embodiments, the affinity label comprises biotin. In some embodiments, the detection label comprises a sulfo-Tag.
[0022] In some embodiments, the methods detect the ADA with a sensitivity less than 3ng / mL. In some embodiments, the methods detect the ADA with a sensitivity of 2.77ng / mL or less.
[0023] In some embodiments, the present technology generally relates to methods for estimating a quantity of an ADA that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) incubating the sample with a composition comprising: (a) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label, and (b) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (ii) isolating ADAs that form a complex with both the affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut-point; (iv) performingDocket No. 140505.8005.WO00 steps (i)-(iii) on a known sample having a known concentration of ADA; and (v) comparing the level of the detection label in the sample to the level of the detection label in the known sample.
[0024] In some embodiments, the known sample is serially diluted into a plurality of titer samples, wherein comparing the level of the detection label in the sample to the level of the detection label in the known sample comprises generating a curve of the levels of the detection label in each of the titer samples and comparing the detection label in the sample to the curve.
[0025] In some embodiments, the present technology generally relates to a methods of confirming that an ADA binds to a target antibody comprising an anti-TNFα antibody in a sample by performing a competitive binding assay comprising (i) incubating the sample with a composition comprising: (a) a first affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label, and (b) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (ii) isolating ADAs that form a complex with both the first affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; and (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut-point, wherein the composition further comprises an unlabeled anti-TNFα antibody.
[0026] In some embodiments, the ADA is confirmed in the sample by measuring a level of the detection label that is lower by a predetermined factor than the level of the detection label when the unlabeled anti-TNFα antibody is not present.
[0027] In some embodiments, the present technology generally relates to kits for detecting an ADA that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label; (ii) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; and (iii) a solid phase comprising a second affinity label, wherein the second affinity label binds to the first affinity label.
[0028] In some embodiments, the solid phase is a plate. In some embodiments, the second affinity label is streptavidin. In some embodiments, the first affinity label is biotin. In some embodiments, the detection antibody comprises a sulfo-Tag labeled anti-TNFα antibody.Docket No. 140505.8005.WO00
[0029] In some embodiments, the kit further comprises a marker configured to produce a chemiluminescent or electrochemiluminescent signal where the marker is proximal to the detection label. In some embodiments, the marker is tripropylamine (TPA).
[0030] In some embodiments, the kit further comprises a blocking buffer. In some embodiments, the kit further comprises a wash buffer.
[0031] In some embodiments, the present technology generally relates to a kit for estimating a quantity of an ADA that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label; (ii) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (iii) a solid phase comprising a second affinity label, wherein the second affinity label binds to the first affinity label; and (iv) a positive control. In some embodiments, the positive control is a plurality of titer samples.
[0032] In some embodiments, the present technology generally relates to a kit for confirming that an ADA binds a target antibody comprising an anti-TNFα antibody comprising: (i) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label; (ii) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (iii) an unlabeled anti- TNFα antibody; and (iv) a solid phase comprising a second affinity label, wherein the second affinity label binds to the first affinity label. BACKGROUND
[0033] Anti-TNFα (Tumor Necrosis Factor alpha) antibodies are novel biologics that may be used for the treatment of various diseases. One hurdle to the development and implementation of anti- TNFα antibodies as a treatment is the potential for a subject administered such anti-TNFα antibodies to exhibit an immune response against them. A subject’s immunogenicity toward the anti-TNFα antibodies, particularly the subject’s development of anti-drug antibodies (ADAs) that bind the anti- TNFα antibody, would thereby reduce efficacy of the anti-TNFα antibody to treat the subject’s disease. To advance the development of treatments that use anti-TNFα antibodies, there is need for assays that reliably determine the presence of ADAs and amounts thereof in subjects receiving or having been administered the anti-TNFα antibody.Docket No. 140505.8005.WO00 BRIEF DESCRIPTION OF THE DRAWINGS
[0034] FIG.1 shows a flow diagram of an example method according to the present technology.
[0035] FIGS.2A and 2B show normality of a set of values of percent inhibition that were tested according to the Shapiro-Wilk W Test in an example screening and titration data normality test (FIG. 2A) and in an example confirmatory data normality test (FIG. 2B) according to the methods of the present technology. DETAILED DESCRIPTION
[0036] The present technology comprises methods for detecting an anti-drug antibody (ADA) against a target antibody. The target antibody may comprise an anti-TNFα antibody. In some embodiments, the anti-TNFα antibody is a chimeric human-murine monoclonal IgG1-kappa antibody. In some embodiments, the target antibody comprises heavy chain complementarity- determining regions (CDRs) of SEQ ID NOs: 9-11 and light chain CDRs of SEQ ID NOs: 12-14. In some embodiments, the target antibody comprises heavy chain CDRs of SEQ ID NOs: 15-17 and light chain CDRs of SEQ ID NOs: 18-20. In some embodiments, the target antibody comprises a heavy chain variable region of SEQ ID NO: 2 and a light chain variable region of SEQ ID NO: 5. In some embodiments, the target antibody comprises a heavy chain of SEQ ID NO: 1 and a light chain of SEQ ID NO: 4. The present technology also includes a kit for detecting the target antibody in the sample according to the methods of the present technology.
[0037] While the present technology is capable of being embodied in various forms, the description below of several embodiments is made with the understanding that the present technology is to be considered as an exemplification of the technology and is not intended to limit the present technology to the specific embodiments illustrated. Headings are provided for convenience only and are not to be construed to limit the present technology in any manner. Embodiments illustrated under any heading may be combined with embodiments illustrated under any other heading.
[0038] The use of numerical values in the various quantitative values specified in this application, unless expressly indicated otherwise, are stated as approximations as though the minimum and maximum values within the stated ranges were both preceded by the word "about." It is to be understood, although not always explicitly stated, that all numerical designations are preceded by the term "about." It is to be understood that such range format is used for convenience and brevityDocket No. 140505.8005.WO00 and should be understood flexibly to include numerical values explicitly specified as limits of a range, but also to include all individual numerical values or sub-ranges encompassed within that range, as if each numerical value and sub-range is explicitly specified. For example, a ratio in the range of about 1 to about 200 should be understood to include the explicitly recited limits of about 1 and about 200, but also to include individual ratios, such as about 2, about 3, and about 4, and sub-ranges, such as about 10 to about 50, about 20 to about 100, and so forth. It also is to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.
[0039] To the extent any materials incorporated by reference herein conflict with the present technology, the present technology controls. Definitions
[0040] The term "about," as used herein when referring to a measurable value, such as an amount or concentration and the like, is meant to encompass variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.
[0041] As used herein, an “affinity antibody” comprises an anti-TNFα antibody. In some embodiments, the affinity antibody comprises the target antibody. The affinity antibody may also comprise an affinity label that has a high affinity with a separate label. For example, the affinity label may be a first affinity label (i.e., biotin) that has a high affinity with a second affinity label (i.e., streptavidin). In some embodiments, the affinity antibody comprises an anti-TNFα antibody and an affinity label. In some embodiments, the affinity antibody comprises the target antibody and an affinity label.
[0042] As used herein, a “detection antibody” comprises a TNFα antibody. In some embodiments, the detection antibody comprises the target antibody. The detection antibody may also comprise a detection label that may be directly or indirectly detected. In some embodiments, the detection antibody comprises an anti-TNFα antibody and a detection label. In some embodiments, the detection antibody comprises the target antibody and a detection label.
[0043] In some embodiments, the method for detecting an ADA that binds the target antibody in a sample comprises: (i) contacting a sample with one or more anti-TNFα conjugates to form a complex between the ADA and the anti-TNFα conjugates; and (ii) measuring a level of anti-TNFαDocket No. 140505.8005.WO00 conjugates in the complex; wherein the method detects the ADA with a sensitivity less than 5ng / mL. In some embodiments, the one or more anti-TNFα conjugates comprise a detection antibody. In some embodiments, measuring a level of anti-TNFα conjugates comprises measuring the level of the detection label. In some embodiments, the one or more anti-TNFα conjugates comprise an affinity antibody.
[0044] As used herein, a “screening assay” generally refers to a method of detecting an ADA that binds the target antibody. For example, a screening assay includes a method of detecting an ADA that binds a target antibody comprising: (i) incubating the sample with a composition comprising: (a) an anti-TNFα antibody conjugated to a first affinity label (affinity antibody), and (b) an anti-TNFα antibody conjugated to a detection label (detection antibody); (ii) isolating ADAs that form a complex with both the affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; and (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut-point. A screening assay may also include a method of detecting an ADA comprising: (i) contacting a sample with one or more anti-TNFα conjugates to form a complex between the ADA and the anti-TNFα conjugates; and (ii) measuring a level of anti-TNFα conjugates in the complex; wherein the method detects the ADA with a sensitivity less than 5ng / mL.
[0045] In some embodiments, measuring the level of the detection label comprises contacting the solid phase with a marker configured to produce a chemiluminescent or electrochemiluminescent (ECL) signal when the marker is proximal to the detection label and detecting the chemiluminescent or ECL signal. As used herein, the marker is “proximal” to the detection label when the marker is at a distance from the detection label that is small enough to cause a reaction that produces a chemiluminescent or ECL signal. In some embodiments, the ECL is produced when the marker is proximal to the detection label and an electrode.
[0046] The sample may be a sample obtained from a mammal, including human, rat, mouse, rabbit, or other animal. In some embodiments, the sample is a blood, plasma, or serum sample. In some embodiments, the sample is plasma. In some embodiments, the sample is serum. In some embodiments, the sample is pre-processed before the ADA is detected according to the methods of the present technology. As used herein, “pre-processing” includes extracting tissue from a subject andDocket No. 140505.8005.WO00 identifying the sample (e.g., drawing a blood sample and identifying or isolating a plasma or serum sample, or separating the blood sample into the plasma sample and / or the serum sample). Anti-Drug Antibodies (ADAs)
[0047] During or after administration of a drug (e.g., a therapeutic drug) to a subject, the subject’s immune system may respond by generating anti-drug antibodies (ADAs). ADAs may bind at least a portion of the drug, thereby sequestering, neutralizing, and / or reducing efficacy of the drug.
[0048] ADAs may be naturally produced as part of a subject’s innate immune response. The ADA may be a natural antibody produced by the subject, for example by lymphocytes using variable (diversity) joining (V(D)J) recombination. For example, the ADA may be an immunoglobulin. In some embodiments, the ADA is an IgG, IgA, IgE, monoclonal antibody, polyclonal antibody, or any other kind of antibody that is capable of binding to the target antibody. Target Antibodies
[0049] During or after administration of a drug (i.e., a therapeutic drug), ADAs which bind at least a portion of the drug may develop. In some embodiments, the drug comprises antibodies, and, when ADAs develop, the ADAs may bind the drug antibodies. In some embodiments, the drug antibodies comprise an anti-TNFα antibody.
[0050] Presence of ADAs and / or binding of ADAs to the drug antibodies may be detected using antibodies which are the same as or mimic the drug antibodies (i.e., “target antibodies”). In some embodiments, the target antibodies comprise one or more anti-TNFα antibodies. The anti-TNFα antibodies are antibodies which bind at least a portion of a TNFα protein or peptide.
[0051] In some embodiments, the target antibodies comprise a monoclonal antibody.
[0052] In some embodiments, the target antibodies of the present technology are chimeric antibodies. Nonlimiting examples of chimeric antibodies include human-murine antibodies, human- rat antibodies, human-hamster antibodies, human-rabbit antibodies, human-bovine antibodies, and human-goat antibodies. In some embodiments, the chimeric antibodies comprise a humanized antibody (e.g., a full humanized antibody or a partially humanized antibody).
[0053] In some embodiments, the target antibodies (e.g., anti-TNFα antibodies) of the present technology may comprise an isotype that influences functional properties and / or structural featuresDocket No. 140505.8005.WO00 of the antibody. In some embodiments the target antibodies comprise an isotype selected from the group consisting of IgG (e.g., IgG1, IgG2, IgG3, IgG4), IgM, IgA, IgD, and IgE. The light chain may comprise isotype kappa (ĸ) or isotype lambda (λ). In some embodiments, the target antibody comprises an IgG1-kappa antibody.
[0054] Target Antibody Sequences
[0055] Heavy Chain:
[0056] The target antibodies of the present technology comprise a heavy chain having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 1.
[0057] The target antibodies of the present technology comprise a heavy chain having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 1.
[0058] The target antibodies of the present technology comprise a heavy chain having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 1.
[0059] The heavy chain of the target antibodies may comprise a variable region domain (VH) having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 2.
[0060] The heavy chain of the target antibodies may comprise a VHhaving an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 2.
[0061] The heavy chain of the target antibodies may comprise a VH having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 2.
[0062] The heavy chain of the target antibodies may comprise a constant region having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 3.
[0063] The heavy chain of the target antibodies may comprise a constant region having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 3.Docket No. 140505.8005.WO00
[0064] The heavy chain of the target antibodies may comprise a constant region having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 3.
[0065] The target antibodies of the present technology comprise a heavy chain having at least one Complementarity Determining Region (CDR) sequence. The at least one CDR sequence confers binding to a specific antigen (e.g., a TNFα peptide).
[0066] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 9.
[0067] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 9.
[0068] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 9.
[0069] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 10.
[0070] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 10.
[0071] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 10.
[0072] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 11.Docket No. 140505.8005.WO00
[0073] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 11.
[0074] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 11.
[0075] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 15.
[0076] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 15.
[0077] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 15.
[0078] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 16.
[0079] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 16.
[0080] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 16.
[0081] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 17.Docket No. 140505.8005.WO00
[0082] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 17.
[0083] In some embodiments, the target antibodies comprise a heavy chain having a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 17.
[0084] In some embodiments, the target antibodies comprise a heavy chain comprising (1) a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 9, (2) a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 10, and (3) a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 11.
[0085] In some embodiments, the target antibodies comprise a heavy chain comprising (1) a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 9, (2) a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 10, and (3) a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 11.
[0086] In some embodiments, the target antibodies comprise a heavy chain comprising (1) a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 9, (2) a CDR having an amino acid sequence that is at least about75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 10, and (3) a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 11.
[0087] In some embodiments, the target antibodies comprise a heavy chain comprising (1) a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 15, (2) a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 16, and (3) a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 17.
[0088] In some embodiments, the target antibodies comprise a heavy chain comprising (1) a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100%Docket No. 140505.8005.WO00 identical to SEQ. ID NO: 15, (2) a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 16, and (3) a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 17.
[0089] In some embodiments, the target antibodies comprise a heavy chain comprising (1) a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 15, (2) a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 16, and (3) a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 17.
[0090] In some embodiments, the heavy chain of the target antibodies of the present technology is encoded by a nucleotide sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 8.
[0091] In some embodiments, the heavy chain of the target antibodies of the present technology is encoded by a nucleotide sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 8.
[0092] In some embodiments, the heavy chain of the target antibodies of the present technology is encoded by a nucleotide sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 8.
[0093] Light Chain:
[0094] The target antibodies of the present technology comprise a light chain having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 4.
[0095] The target antibodies of the present technology comprise a light chain having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 4.
[0096] The target antibodies of the present technology comprise a light chain having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 4.Docket No. 140505.8005.WO00
[0097] The light chain of the target antibodies may comprise a variable region domain (VL) having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 5.
[0098] The light chain of the target antibodies may comprise a VLhaving an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 5.
[0099] The light chain of the target antibodies may comprise a VL having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 5.
[0100] The light chain of the target antibodies may comprise a constant region having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 6.
[0101] The light chain of the target antibodies may comprise a constant region having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 6.
[0102] The light chain of the target antibodies may comprise a constant region having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 6.
[0103] The target antibodies of the present technology comprise a light chain having at least one CDR sequence. The at least one CDR sequence confers binding to a specific antigen (e.g., a TNFα peptide).
[0104] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 12.
[0105] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 12.
[0106] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 12.Docket No. 140505.8005.WO00
[0107] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 13.
[0108] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 13.
[0109] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 13.
[0110] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 14.
[0111] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 14.
[0112] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 14.
[0113] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 18.
[0114] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 18.
[0115] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 18.Docket No. 140505.8005.WO00
[0116] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 19.
[0117] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 19.
[0118] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 19.
[0119] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 20.
[0120] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 20.
[0121] In some embodiments, the target antibodies comprise a light chain having a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 20.
[0122] In some embodiments, the target antibodies comprise a light chain comprising (1) a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 12, (2) a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 13, and (3) a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 14.
[0123] In some embodiments, the target antibodies comprise a light chain comprising (1) a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 12, (2) a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 13, and (3) a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 14.Docket No. 140505.8005.WO00
[0124] In some embodiments, the target antibodies comprise a light chain comprising (1) a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 12, (2) a CDR having an amino acid sequence that is at least about75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 13, and (3) a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 14.
[0125] In some embodiments, the target antibodies comprise a light chain comprising (1) a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 18, (2) a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 19, and (3) a CDR having an amino acid sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 20.
[0126] In some embodiments, the target antibodies comprise a light chain comprising (1) a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 18, (2) a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 19, and (3) a CDR having an amino acid sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 20.
[0127] In some embodiments, the target antibodies comprise a light chain comprising (1) a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 18, (2) a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 19, and (3) a CDR having an amino acid sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 20.
[0128] In some embodiments, the light chain of the target antibodies of the present technology is encoded by a nucleotide sequence that is about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 7.
[0129] In some embodiments, the light chain of the target antibodies of the present technology is encoded by a nucleotide sequence that is at least 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 7.Docket No. 140505.8005.WO00
[0130] In some embodiments, the light chain of the target antibodies of the present technology is encoded by a nucleotide sequence that is at least about 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ. ID NO: 7. Table 1: Sequences of Example Anti-TNFα Antibodies of the Present Technology SEQ ID NO: Description Sequence Q V S C F K Q S L Q V S YI E K D L G T GDocket No. 140505.8005.WO00 antibody (XTMAB-16, E T C C G G A C T C A G C A C G G T T A T A T C G G G C T CDocket No. 140505.8005.WO00 ATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACC GTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCT CATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGT T A G T T G G C T TDocket No. 140505.8005.WO00 CDR-IMGT of anti-TNFαDocket No. 140505.8005.WO00 (XTMAB-16, target antibody)
[0131] Antibody Labels
[0132] The target antibodies of the present technology may be labeled, such as with an affinity label or a detection label. Nonlimiting examples of antibody labels include a biotin label, a fluorescent label, an enzyme label (e.g., horseradish peroxidase (HRP) and alkaline phosphatase (AP)), gold nanoparticles, radioisotopes, and drug molecules.
[0133] In some embodiments, the target antibodies are conjugated to an additional molecule or compound, forming an antibody conjugate. The conjugation may occur via a covalent linkage.
[0134] In some embodiments, the target antibodies of the present technology are directly (e.g., labeled via conjugation) or indirectly labeled with an affinity label or a detection label. A detection label may be any label that may be detected directly or indirectly. As used herein, “direct” detectionDocket No. 140505.8005.WO00 of the detection label includes measuring the presence of the detection label or inducing the detection label to produce a detectable substance. For example, the detection label may be a luminescent compound. In some embodiments, the detection is configured to produce a chemiluminescent or ECL signal in the presence of a marker. In some embodiments, the detection label is an enzyme configured to convert a chromogenic marker into a pigment. For example, the enzyme is a HRP and the chromogenic marker may be 3,3',5,5'-tetramethylbenzidine (TMB). In some embodiments, the detection label comprises a sulfo-Tag. The sulfo-Tag (Ru-tag) may be contacted with a marker comprising tripropylamine (TPA), and the level of the detection label may be measured by applying an electrical current to the marker in the presence of the detection label to produce the ECL signal.
[0135] In some embodiments, the detection label is detected by a meso scale discovery (MSD) assay. In some embodiments, the detection label is detected by ECL. In some embodiments, the detection label is a ruthenium (Ru) metal ion. In some embodiments, the Ru ion is detected when the ion comes in close proximity with an electrode. As used herein, a “close proximity” between the Ru ion and the electrode is a distance between the Ru ion and the electrode that is small enough to cause a detectable oxidation-reduction reaction by ECL as understood by a person of skill in the art. In some embodiments, the solid phase comprises an electrode. In some embodiments, a Ru ion is detected by a charge-coupled device (CCD) camera when it is in close proximity with the electrode.
[0136] In some embodiments, the detection label is detected indirectly. As used herein, “indirect” detection of the detection antibody includes adding a separate component that interacts with the detection label, where the separate component is capable of being detected. For example, a secondary antibody may be added, where the secondary antibody is conjugated to a detectable luminescent probe or enzyme configured to convert a chromogenic substrate into a pigment (e.g., a detection antibody conjugated to a detection label).
[0137] An affinity label may be any molecular label that has affinity with the second affinity label. In some embodiments, a first affinity label is configured to make a covalent bond with the second affinity label. For example, the first affinity label may be biotin and the second affinity label may be streptavidin or vice versa. The first and second affinity labels may be any pairing of affinity labels known to one of ordinary skill in the art. In some embodiments, the first affinity label may be glutathione and the second affinity label may be glutathione S-transferase or vice versa. In some embodiments, the first affinity label may be maltose and the second affinity label may be maltose-Docket No. 140505.8005.WO00 binding protein or vice versa. In some embodiments, the first affinity label is chitin and the second affinity label is chitin-binding protein or vice versa.
[0138] In some embodiments, the detection label may be a third affinity label and detecting the detection label further comprises contacting the third affinity label with a fourth affinity label conjugated to a detectable compound, where the third affinity label binds to the fourth affinity label. For example, the fourth affinity label may be conjugated to a luminescent compound or enzyme configured to convert a chromogenic substrate into a pigment.
[0139] The third affinity label may be any molecular label that has affinity with the fourth affinity label. In some embodiments, the third affinity label is configured to make a covalent bond with the fourth affinity label. For example, the third affinity label may be biotin and the fourth affinity label may be streptavidin or vice versa. The third and fourth affinity labels may be any pairing of affinity labels known to one of ordinary skill in the art. In some embodiments, the third affinity label may be glutathione and the fourth affinity label may be glutathione S-transferase or vice versa. In some embodiments, the third affinity label may be maltose and the fourth affinity label may be maltose-binding protein or vice versa. In some embodiments, the third affinity label is chitin and the fourth affinity label is chitin-binding protein or vice versa. Compositions
[0140] The present technology comprises compositions having antibodies for detecting ADAs. In some embodiments, the compositions comprise one or more target antibodies that are bound by ADAs. The one or more target antibodies bound by ADAs may include an affinity antibody and / or a detection antibody. Both the affinity antibody and the detection antibody may be anti-TNFα antibodies and / or may comprise one or more of a heavy chain, a light chain, a variable region (e.g., VH or VL), a constant region (e.g., a heavy chain constant region or a light chain constant region), or a CDR of the present technology.
[0141] In some embodiments, the affinity antibody comprises an affinity label. The affinity antibody may be labeled with the affinity label directly or indirectly. Nonlimiting examples of affinity labels include fluorescent labels, enzyme labels (e.g., horseradish peroxidase and alkaline phosphatase), biotin labels, streptavidin labels, and radioisotopes. In some embodiments, the detection antibody is conjugated to a detection label. Nonlimiting examples of detection labels includeDocket No. 140505.8005.WO00 a biotin label, a fluorescent label, an enzyme label (e.g., horseradish peroxidase and alkaline phosphatase), gold nanoparticles, and radioisotopes.
[0142] In some embodiments, the compositions further comprise a second affinity antibody. The second affinity antibody may bind an affinity label, such as an affinity label conjugated to the first affinity antibody described in supra. In some embodiments, the second affinity antibody binds the affinity label when the first affinity antibody and / or the detection antibody are bound by one or more ADAs. The second affinity antibody may be an unlabeled antibody. Nonlimiting examples of unlabeled antibodies include an antibody that is not conjugated to an affinity label or a detection label.
[0143] In some embodiments, the compositions comprise a single composition having a first affinity antibody of the present technology, a detection antibody of the present technology, and a second affinity antibody of the present technology. In some embodiments, the compositions comprise (1) a first composition having a first affinity antibody and a detection antibody and (2) a second composition having a second affinity antibody. In some embodiments, the compositions comprise (1) a first composition having a first affinity antibody, (2) a second composition having a detection antibody, and (3) a third composition having a second affinity antibody. In some embodiments, the compositions comprise (1) a first composition having a first affinity antibody and (2) a second composition having a detection antibody and a second affinity antibody. In some embodiments, the compositions comprise (1) a first composition having a first affinity antibody and a second affinity antibody and (2) a second composition having a detection antibody. In some embodiments, the first and second compositions are incubated with a sample simultaneously or sequentially. In some embodiments, the first and third compositions are incubated with a sample simultaneously or sequentially. In some embodiments, the second and third compositions are incubated with a sample simultaneously or sequentially. In some embodiments, the first, second, and third compositions are each incubated with a sample simultaneously or sequentially.
[0144] Samples may comprise biological samples. Nonlimiting examples of biological samples include serum, blood, synovial fluid, plasma, saliva, and respiratory secretions. Methods of Detecting ADAsDocket No. 140505.8005.WO00
[0145] The present technology comprises methods for detecting the ADAs of the present technology in a sample. ADAs may be detected and / or isolated using the compositions of the present technology.
[0146] In some embodiments, detecting the ADA comprises incubating the sample with a composition of the present technology (e.g., a composition comprising one or more of an affinity antibody, a detection antibody, or an unlabeled antibody). In some embodiments, the affinity antibody is conjugated to the detection label.
[0147] In some embodiments, detecting the ADA comprises contacting the sample with a composition comprising a first affinity antibody of the present technology. In some embodiments, the affinity antibody is added at a concentration of about 1ng / mL to about 10ng / mL, about 10ng / mL to about 20ng / mL, about 20ng / mL to about 50ng / mL, or about 50ng / mL about 100ng / mL.
[0148] In some embodiments, the affinity antibody is added at a concentration of at least 1ng / mL to at least 10ng / mL, at least 10ng / mL to at least 20ng / mL, at least 20ng / mL to at least 50ng / mL, or at least 50ng / mL at least 100ng / mL.
[0149] In some embodiments, the affinity antibody is added at a concentration of at least about 1ng / mL to at least about 10ng / mL, at least about 10ng / mL to at least about 20ng / mL, at least about 20ng / mL to at least about 50ng / mL, or at least about 50ng / mL at least about 100ng / mL.
[0150] In some embodiments, the affinity antibody is added at a concentration of about 25ng / mL.
[0151] In some embodiments, the affinity antibody is added at a concentration of at least 25ng / mL.
[0152] In some embodiments, the affinity antibody is added at a concentration of at least about 25ng / mL.
[0153] In some embodiments, detecting the ADA comprises incubating the sample with a composition comprising a detection antibody.
[0154] In some embodiments, the detection antibody is added at a concentration of about 0.001mg / mL to about 0.01mg / mL, about 0.01mg / mL to about 0.1mg / mL, about 0.1mg / mL to about 1mg / mL, about 1mg / mL to about 10mg / mL. In some embodiments, the affinity antibody is added atDocket No. 140505.8005.WO00 a concentration of about 1.2mg / mL. In some embodiments, the detection antibody comprises a ruthenium label (i.e., Ru-XTMAB-16), and it is added at a concentration of about 1.2mg / mL.
[0155] In some embodiments, the detection antibody is added at a concentration of at least 0.001mg / mL to at least 0.01mg / mL, at least 0.01mg / mL to at least 0.1mg / mL, at least 0.1mg / mL to at least 1mg / mL, at least 1mg / mL to at least 10mg / mL. In some embodiments, the affinity antibody is added at a concentration of at least 1.2mg / mL. In some embodiments, the detection antibody comprises a ruthenium label (i.e., Ru-XTMAB-16), and it is added at a concentration of at least 1.2mg / mL.
[0156] In some embodiments, the detection antibody is added at a concentration of at least about 0.001mg / mL to at least about 0.01mg / mL, at least about 0.01mg / mL to at least about 0.1mg / mL, at least about 0.1mg / mL to at least about 1mg / mL, at least about 1mg / mL to at least about 10mg / mL. In some embodiments, the affinity antibody is added at a concentration of at least about 1.2mg / mL. In some embodiments, the detection antibody comprises a ruthenium label (i.e., Ru-XTMAB-16), and it is added at a concentration of at least about 1.2mg / mL.
[0157] In some embodiments, the methods further comprise isolating an ADA that binds a target antibody of the present technology (e.g., an affinity antibody or a detection antibody). As used herein, “isolating” ADAs that form a complex with both the affinity antibody and the detection antibody includes identifying the ADAs that form a complex and separating them from ADAs that do not form a complex. Isolating ADAs also includes identifying and separating ADAs from other compounds that bind the target antibody. Isolating ADAs may be performed using any technique known to one of skill for isolating or purifying an antibody. For example, the ADAs may be isolated using antibody pull-down or purification techniques. In some embodiments, the ADAs are isolated by contacting the ADA complex with a solid phase comprising a second affinity label, such that the first affinity label of the ADA complex binds to the second affinity label on a solid phase.
[0158] As used herein, “solid phase” may be any medium that remains stationary or temporarily stationary as a mobile phase moves across or through the solid phase, such that components of the mobile phase may interact with the solid phase. A solid phase may include a plate, chromatography column, microbead, magnetic microbead, or any other solid phase known to one of ordinary skill in the art. In some embodiments, the solid phase is a microbead, plate, or column. In some embodiments,Docket No. 140505.8005.WO00 the solid phase is a plate. In some embodiments, the plate is coated with a second affinity label. In some embodiments, the solid phase is blocked with a blocking buffer before the sample and the composition are contacted with the solid phase.
[0159] In some embodiments, isolating the ADA complex comprises: (a) providing a solid phase comprising the second affinity label; (b) contacting the sample and the composition with the solid phase; and (c) washing the solid phase. In some embodiments, the solid phase is washed with a wash buffer that does not disrupt the interaction between the ADA and the affinity antibody or the interaction between the ADA and the detection antibody. In some embodiments, the wash buffer comprises phosphate-buffered saline (PBS). In some embodiments, the wash buffer comprises a phosphate-buffered solution with a surfactant. In some embodiments, the wash buffer comprises Tween-20. In some embodiments, the wash buffer comprises 1x PBS with 0.05% Tween-20. In some embodiments, the wash buffer comprises 50mM Tris. In some embodiments, the wash buffer comprises 0.14 M NaCl. In some embodiments, the wash buffer has a pH of about 8.0. In some embodiments, the wash buffer comprises 50mM Tris, 0.14 M NaCl, 0.05% Tween-20, and has a pH of about 8.0.
[0160] In some embodiments, the method further comprises detecting the detection label. In some embodiments, the detection label is detected by measuring a luminescent compound. In some embodiments, the detection label is detected by inducing an enzyme to convert a chromogenic substrate into the pigment and detecting the pigment and measuring the presence of the pigment. In some embodiments, detecting the detection label comprises converting the chromogenic substrate into the pigment and detecting the optical density of the sample. In some embodiments, detecting the detection label comprises contacting a sulfo-Tag (Ru-tag) detection label with a marker comprising TPA) and the level of the detection label may be detected by applying an electrical current to the marker in the presence of the detection label to produce a detectable ECL signal. As such, a higher level of the detection label correlates with a higher amount of ADAs in the sample.
[0161] In some embodiments, the ADA is detected by determining whether the detection label is present at a level above a predetermined level. In some embodiments, the ADA is detected by determining that the ECL of the sample is above a predetermined cut-point.
[0162] In some embodiments, the method further comprises performing the method on a negative control sample. In some embodiments, the negative control sample has no detectable ADA.Docket No. 140505.8005.WO00 In some embodiments, the negative control sample is a drug naïve sample from a healthy subject who has not received the target antibody. In some embodiments, the method is performed on the negative control sample in parallel with the sample. As used herein, performing the method “in parallel” includes performing the method on the negative control sample at the same time and / or on the same plate as the sample. Performing the method on the negative control sample comprises: (i) incubating the control sample with a composition comprising an affinity antibody and a detection antibody; (ii) contacting the complex with a second affinity label that binds to the first affinity label; and (iii) measuring a level of the detection label.
[0163] In some embodiments, the method further comprises performing the method on a positive control sample. In some embodiments, the positive control sample is a sample from a subject who has received the target antibody. In some embodiments, the positive control sample is a sample that has been shown to contain an ADA in a previous assay. The method may be performed on the positive control sample in parallel with the sample. The method may be performed on a sample, a negative control sample, and a positive control sample in parallel.
[0164] In some embodiments, the cut-point is determined by performing the method on a plurality of negative control samples. In some embodiments, the negative control samples are drug- naïve samples from healthy subjects who have never received the target antibody. In some embodiments, the cut-point is determined by performing the method on at least 20, 30, 40, or 50 negative control samples. In some embodiments, the ECL signal from the 50 negative control samples is normalized by the mean of all negative control samples. In some embodiments, outliers are identified and removed.
[0165] In some embodiments, the cut-point is identified based on about a 0.01%-0.05%, 0.05%- 0.1%, 0.1%-0.5%, 0.5%-1.0%, 1%-2%, 2%-5%, or 5%-10% false-positive rate. In some embodiments, the cut-point is identified based on about a 0.1%, 1%, or 5% false-positive rate. In some embodiments, the cut-point is identified based on about a 5% false-positive rate. In some embodiments, the cut-point is identified based on about a 1% false-positive rate. In some embodiments, the cut-point is identified based on about a 0.1% false-positive rate.
[0166] In some embodiments, the cut-point is identified based on at least a 0.01%-0.05%, 0.05%-0.1%, 0.1%-0.5%, 0.5%-1.0%, 1%-2%, 2%-5%, or 5%-10% false-positive rate. In some embodiments, the cut-point is identified based on at least a 0.1%, 1%, or 5% false-positive rate. InDocket No. 140505.8005.WO00 some embodiments, the cut-point is identified based on at least a 5% false-positive rate. In some embodiments, the cut-point is identified based on at least a 1% false-positive rate. In some embodiments, the cut-point is identified based on at least a 0.1% false-positive rate.
[0167] In some embodiments, the cut-point is identified based on at least about a 0.01%-0.05%, 0.05%-0.1%, 0.1%-0.5%, 0.5%-1.0%, 1%-2%, 2%-5%, or 5%-10% false-positive rate. In some embodiments, the cut-point is identified based on at least about a 0.1%, 1%, or 5% false-positive rate. In some embodiments, the cut-point is identified based on at least about a 5% false-positive rate. In some embodiments, the cut-point is identified based on at least about a 1% false-positive rate. In some embodiments, the cut-point is identified based on at least about a 0.1% false-positive rate.
[0168] In some embodiments, the method further comprises performing the method on a quality control (QC) sample. One or more QC samples may be included to assess the performance of the method. In some embodiments, the QC sample is a blank sample, matrix spike sample (i.e., a plasma or serum sample spiked with ADA), field duplicate sample, replicate sample, and / or reference material sample. The method may be performed on the QC sample in parallel with the sample. The method may be performed on a sample, a negative control sample, a positive control sample, and a QC sample in parallel.
[0169] In some embodiments, the predetermined cut-point is an electrochemiluminescence (ECL) of about 0.1-1, 1-2, 2-5, or 5-10. In some embodiments, the predetermined cut-point is about 1. In some embodiments, the predetermined cut-point is about 1.1.
[0170] In some embodiments, the predetermined cut-point is an ECL of at least 0.1-1, 1-2, 2- 5, or 5-10. In some embodiments, the predetermined cut-point is at least 1. In some embodiments, the predetermined cut-point is at least 1.1.
[0171] In some embodiments, the predetermined cut-point is an ECL of at least about 0.1-1, 1- 2, 2-5, or 5-10. In some embodiments, the predetermined cut-point is at least about 1. In some embodiments, the predetermined cut-point is at least about 1.1.
[0172] In some embodiments, the sensitivity of detecting the ADA is less than about 3ng / mL, less than about 5ng / mL, less than about 10ng / mL, less than about 50ng / mL, or less than about 100ng / mL. In some embodiments, the sensitivity of detecting the ADA is less than about 3ng / mL. In some embodiments, the sensitivity of detecting the ADA is less than about 2.77ng / mL. In someDocket No. 140505.8005.WO00 embodiments, the sensitivity of detecting the ADA is about 4ng / mL. In some embodiments, the sensitivity of detecting the ADA is about 6ng / mL.
[0173] In some embodiments, the sensitivity of detecting the ADA is less than at least 3ng / mL, less than at least 5ng / mL, less than at least 10ng / mL, less than at least 50ng / mL, or less than at least 100ng / mL. In some embodiments, the sensitivity of detecting the ADA is less than at least 3ng / mL. In some embodiments, the sensitivity of detecting the ADA is less than at least 2.77ng / mL. In some embodiments, the sensitivity of detecting the ADA is at least 4ng / mL. In some embodiments, the sensitivity of detecting the ADA is at least 6ng / mL.
[0174] In some embodiments, the sensitivity of detecting the ADA is less than at least about 3ng / mL, less than at least about 5ng / mL, less than at least about 10ng / mL, less than at least about 50ng / mL, or less than at least about 100ng / mL. In some embodiments, the sensitivity of detecting the ADA is less than at least about 3ng / mL. In some embodiments, the sensitivity of detecting the ADA is less than at least about 2.77ng / mL. In some embodiments, the sensitivity of detecting the ADA is at least about 4ng / mL. In some embodiments, the sensitivity of detecting the ADA is at least about 6ng / mL.
[0175] In some embodiments, the drug tolerance of detecting the ADA is about 1ng / mL to about 10ng / mL, about 10ng / mL to about 50ng / mL, about 50ng / mL to about 100ng / mL, about 100ng / mL to about 1000ng / mL, or about 1000ng / mL to about 5000ng / mL. In some embodiments, the drug tolerance is about 100ng / mL.
[0176] In some embodiments, the drug tolerance of detecting the ADA is at least 1ng / mL to at least 10ng / mL, at least 10ng / mL to at least 50ng / mL, at least 50ng / mL to at least 100ng / mL, at least 100ng / mL to at least 1000ng / mL, or at least 1000ng / mL to at least 5000ng / mL. In some embodiments, the drug tolerance is at least 100ng / mL.
[0177] In some embodiments, the drug tolerance of detecting the ADA is at least about 1ng / mL to at least about 10ng / mL, at least about 10ng / mL to at least about 50ng / mL, at least about 50ng / mL to at least about 100ng / mL, at least about 100ng / mL to at least about 1000ng / mL, or at least about 1000ng / mL to at least about 5000ng / mL. In some embodiments, the drug tolerance is at least about 100ng / mL.Docket No. 140505.8005.WO00
[0178] In some embodiments, the method comprises disassociating the ADA from the target by adding an acid wash to the sample. The acid wash may be any acid wash known to one of skill in the art to disassociate an antibody from its target. In some embodiments, the acid wash may comprise acetic acid. In some embodiments, the acid wash comprises about 2M acetic acid. In some embodiments, the acid wash is added to the sample before an anti-TNFα conjugate is added. In some embodiments, the acid wash comprises about 300mM acetic acid. In some embodiments, the acid wash comprises about 0.1M glycine-HCl. In some embodiments, the acid has a pH of about 2.5.
[0179] In some embodiments, all or a portion of the method is performed using an automated system. As used herein, an “automated system” refers to a system that processes samples according to steps that are in part performed by a robotic or mechanical platform. The automated system may be completely automated or partially automated. In some embodiments, a human “loads” the automated system with the samples and reagents of the present technology and the automated system performs the remaining steps. For example, the automated system may be a KingFisher™ Flex Purification System. Other automated systems having at least the foregoing features and known to one of skill in the art are within the scope of this technology.
[0180] In some embodiments, the method for detecting an ADA that binds the target antibody in a sample comprises: (i) incubating the sample with a composition comprising: (a) an affinity antibody comprising a first affinity label and (b) a detection antibody comprising a detection label; (ii) providing a solid phase comprising a second affinity label, wherein the second affinity label is configured to bind to the first affinity label; (iii) contacting the sample and the composition with the solid phase; (iv) washing the solid phase; and (v) detecting the ADA by measuring a level of the detection label above a predetermined cut-point.
[0181] In some embodiments, the method for detecting an ADA that binds the target antibody in a sample comprises: (i) incubating the sample with a composition comprising an affinity antibody comprising a first affinity label; (ii) incubating the sample with a detection antibody comprising a detection label; (iii) providing a solid phase comprising a second affinity label, wherein the second affinity label is configured to bind to the first affinity label; (iv) contacting the sample and the composition with the solid phase; (v) washing the solid phase; and (vi) detecting the ADA by measuring a level of the detection label above a predetermined cut-point.Docket No. 140505.8005.WO00
[0182] In some embodiments, the method for detecting an ADA that binds the target antibody in a sample comprises: (i) contacting a sample with an affinity antibody comprising a first affinity label and a detection antibody comprising a detection label; and (ii) measuring the ADA that forms a complex with the affinity antibody and the detection antibody by detecting the level of the detection label in the complex; wherein the method detects the ADA with a sensitivity less than 5ng / mL.
[0183] The present technology also includes a method for estimating a quantity of an ADA that binds a target antibody in a sample. The method comprises: (i) incubating the sample with a composition comprising an affinity antibody and a detection antibody; (ii) isolating ADAs that form a complex with both the affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut-point; (iv) performing steps (i)-(iii) on a known sample having a known concentration of target antibody; and (v) comparing the level of the detection label in the sample to the level of the detection label in the known sample. As used herein, estimating “a quantity” of an ADA includes estimating a concentration of an ADA. As used herein, a “titration assay” generally refers to a method for estimating a quantity of an ADA that binds a target antibody.
[0184] As used herein, a “known sample” includes a positive control where the concentration of ADAs has been previously determined. In some embodiments, the known sample is serially diluted into a plurality of titer samples. As used herein, a “titer sample” is one of a plurality of titer samples that are diluted from a known sample. As such, the titer samples create a dilution curve.
[0185] In some embodiments, the titer samples have a concentration of, for example, between about 0.49ng / mL and about 4000ng / mL. In some embodiments, the titer samples have a concentration of, for example, about 4000ng / mL, about 2000ng / mL, about 1000ng / mL, about 500ng / mL, about 250ng / mL, about 125ng / mL, about 62.5ng / mL, about 31.25ng / mL, about 15.63ng / mL, about 7.81ng / mL, about 3.91ng / mL, about 1.95ng / mL, about 0.98ng / mL, and about 0.49ng / mL.
[0186] In some embodiments, the titer samples have a concentration of, for example, between at least 0.49ng / mL and at least 4000ng / mL. In some embodiments, the titer samples have a concentration of, for example, at least 4000ng / mL, at least 2000ng / mL, at least 1000ng / mL, at least 500ng / mL, at least 250ng / mL, at least 125ng / mL, at least 62.5ng / mL, at least 31.25ng / mL, at leastDocket No. 140505.8005.WO00 15.63ng / mL, at least 7.81ng / mL, at least 3.91ng / mL, at least 1.95ng / mL, at least 0.98ng / mL, and at least 0.49ng / mL.
[0187] In some embodiments, the titer samples have a concentration of, for example, between at least about 0.49ng / mL and at least about 4000ng / mL. In some embodiments, the titer samples have a concentration of, for example, at least about 4000ng / mL, at least about 2000ng / mL, at least about 1000ng / mL, at least about 500ng / mL, at least about 250ng / mL, at least about 125ng / mL, at least about 62.5ng / mL, at least about 31.25ng / mL, at least about 15.63ng / mL, at least about 7.81ng / mL, at least about 3.91ng / mL, at least about 1.95ng / mL, at least about 0.98ng / mL, and at least about 0.49ng / mL.
[0188] In some embodiments, the quantity or concentration of the sample is estimated by comparing the level of the detection label in the sample to the level of the detection label in the known sample or the titer samples. In some embodiments, the method further comprises generating a curve of the levels of the detection label in each of the titer samples and comparing the detection label in the sample to the curve.
[0189] The present technology also includes a method for estimating a quantity of an ADA that binds a target antibody in a sample. The method comprises: (i) incubating the sample with a composition comprising an affinity antibody comprising a first affinity label and a detection antibody comprising a detection label; (ii) providing a solid phase comprising a second affinity label, wherein the second affinity label is configured to bind to the first affinity label; (iii) contacting the sample and the composition with the solid phase; (iv) washing the solid phase; (v) detecting the ADA by measuring a level of the detection label above a predetermined cut-point; (vi) performing steps (i)- (v) on a known sample having a known concentration of target antibody; and (vii) comparing the level of the detection label in the sample to the level of the detection label in the known sample. Step (vi) may be performed in parallel with steps (i)-(v).
[0190] The present technology also includes a method of confirming that an ADA compound binds a target antibody in a sample by performing a competitive binding assay comprising performing any of the methods described in this technology for detecting an ADA within the sample, wherein the composition further comprises unlabeled anti-TNFα antibody (unlabeled antibody). As used herein, a “confirmation assay” or “confirmatory assay” generally refers to a method of confirming that an ADA component binds a target antibody.Docket No. 140505.8005.WO00
[0191] In some embodiments, the method of confirming that an ADA compound binds a target antibody comprises: (i) incubating the sample with a composition comprising: an affinity antibody, a detection antibody, and an unlabeled antibody; (ii) isolating ADAs that form a complex with both the affinity antibody and the detection antibody and / or unlabeled antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; and (iii) confirming the ADA by measuring a level of the detection label that is lower by a predetermined factor than the level of the detection label when the unlabeled antibody is not present.
[0192] In some embodiments, the unlabeled antibody will be present at an excess concentration in the composition. For example, the excess concentration of the unlabeled antibody may be about 150µg / mL or more, about 175µg / mL or more, about 200µg / mL or more, or about 250µg / mL or more. In some embodiments, the excess concentration of the unlabeled antibody may be about 200µg / mL or more.
[0193] In some embodiments, the excess concentration of the unlabeled antibody may be at least 150µg / mL or more, at least 175µg / mL or more, at least 200µg / mL or more, or at least 250µg / mL or more. In some embodiments, the excess concentration of the unlabeled antibody may be at least 200µg / mL or more.
[0194] In some embodiments, the excess concentration of the unlabeled antibody may be at least about 150µg / mL or more, at least about 175µg / mL or more, at least about 200µg / mL or more, or at least about 250µg / mL or more. In some embodiments, the excess concentration of the unlabeled antibody may be at least about 200µg / mL or more.
[0195] In some embodiments, ADA is confirmed in a sample by measuring a level of the detection label that is lower by a predetermined factor of about 10% or more, about 12% or more, about 14% or more, about 16% or more, about 18% or more, or about 20% or more than the level of the detection label when the unlabeled antibody is not present. In some embodiments, the predetermined factor is about 16% or more.
[0196] In some embodiments, ADA is confirmed in a sample by measuring a level of the detection label that is lower by a predetermined factor of at least 10% or more, at least 12% or more, at least 14% or more, at least 16% or more, at least 18% or more, or at least 20% or more than theDocket No. 140505.8005.WO00 level of the detection label when the unlabeled antibody is not present. In some embodiments, the predetermined factor is at least 16% or more.
[0197] In some embodiments, ADA is confirmed in a sample by measuring a level of the detection label that is lower by a predetermined factor of at least about 10% or more, at least about 12% or more, at least about 14% or more, at least about 16% or more, at least about 18% or more, or at least about 20% or more than the level of the detection label when the unlabeled antibody is not present. In some embodiments, the predetermined factor is at least about 16% or more.
[0198] In some embodiments, the level of the detection label when the unlabeled antibody is not present is above the pre-determined cut-point.
[0199] In some embodiments, the method of confirming that an ADA compound binds a target antibody comprises: (i) incubating the sample with a composition comprising: an affinity antibody, a detection antibody, and an unlabeled antibody; (ii) providing a solid phase comprising a second affinity label, wherein the second affinity label is configured to bind to the first affinity label; (iii) contacting the sample and the composition with the solid phase; (iv) washing the solid phase; and (v) confirming the ADA by measuring a level of the detection label that is lower by a predetermined factor than the level of the detection label when the unlabeled antibody is not present.
[0200] The methods of the present technology may further comprises steps for assessing one or more of hook effects, assay selectivity, drug tolerance, intra-assay precision, inter-assay precision, and sample, control, and / or antibody stability.
[0201] The hook (prozone) effect is a phenomenon in which the signal of the assay changes from increasing to decreasing when the ADA concentration increases. The hook effect may not be critical to ADA detection if all concentrations of positive antibody yield positive results.
[0202] Stability assessments may comprise quantifying the ability of the methods to detect ADAs in the presence of other matrix components.
[0203] Drug tolerance assessments may comprise evaluating the ability of the methods to correctly detect ADAs. The presence of drug antibodies in samples may interfere with the detection of ADAs.Docket No. 140505.8005.WO00
[0204] Stability assessments may comprise assessing positive controls. Positive controls may be assessed, for example, in a biological sample such as human serum. The ADAs of the present technology may be stable for up to six freeze / thaw cycles from about -70°C (nominal) to ambient temperature and may be stable for up to about 24.5 hours at ambient surroundings. Kits
[0205] The present technology includes a kit for detecting an ADA against the target antibody. In some embodiments, the technology includes a kit for estimating the quantity of ADA in a sample. In some embodiments, the technology includes a kit for confirming that an ADA binds the target antibody.
[0206] In some embodiments, the kit comprises an affinity antibody comprising a first affinity label, a detection antibody, and a solid phase comprising a second affinity label. In some embodiments, the kit comprises a composition comprising the affinity antibody and the detection antibody.
[0207] In some embodiments, the solid phase is a plate. In some embodiments, the second affinity label is streptavidin. In some embodiments, the first affinity label is biotin. In some embodiments, the detection antibody comprises a sulfo-Tag labeled anti-TNFα antibody. In some embodiments, the kit further comprises a marker configured to produce a chemiluminescent or ECL signal in the presence of the detection label. In some embodiments, the marker is TPA.
[0208] In some embodiments, the kit includes an undetected antibody. In some embodiments, the undetected antibody is at an excess concentration, for example, about 200µg / mL or more. The kit may also comprise a composition comprising an affinity antibody, a detection antibody, and an unlabeled antibody.
[0209] In some embodiments, the affinity antibody comprises a first affinity label. In some embodiments, the first affinity label is biotin. In some embodiments, the detection antibody comprises a detection label. In some embodiments, the detection label is a luminescent compound, an enzyme configured to convert a chromogenic substrate into a pigment, or biotin. In some embodiments, the detection label is biotin.
[0210] In some embodiments, the kit comprises a negative control. The negative control may be a sample from a drug naïve subject. In some embodiments, the negative control is a sample that isDocket No. 140505.8005.WO00 known to contain no ADA. In some embodiments, the kit comprises a positive control. The positive control may be a sample from a subject that has received the target antibody. In some embodiments, the positive control is a sample known to contain ADA. In some embodiments, the kit may comprise ADA or ADA solution and instructions for making a positive control. For example, the kit may comprise an ADA solution and instructions to “spike” a plasma or serum sample with the ADA solution to prepare the positive control.
[0211] In some embodiments, the kit comprises a “high” positive control (HPC) and a “low” positive control (LPC), where the HPC has a higher concentration than the LPC. For example, the HPC may have a concentration of about 500ng / mL to about 1000ng / mL, about 1000ng / mL to about 2000ng / mL, about 2000ng / mL to about 5000ng / mL, or about 5000ng / mL to about 10000ng / mL. In some embodiments, the HPC has an ADA concentration of about 4000ng / mL. The concentration of the LPC may be less than about 1ng / mL, about 1ng / mL to about 10ng / mL, about 10ng / mL to about 100ng / mL, about 100ng / mL to about 200ng / mL, about 200ng / mL to about 300ng / mL, or about 300ng / mL to about 500ng / mL. In some embodiments, the LPC has an ADA concentration of about 9.7ng / mL.
[0212] In some embodiments, the HPC may have a concentration of at least 500ng / mL to at least 1000ng / mL, at least 1000ng / mL to at least 2000ng / mL, at least 2000ng / mL to at least 5000ng / mL, or at least 5000ng / mL to at least 10000ng / mL. In some embodiments, the HPC has an ADA concentration of at least 4000ng / mL. The concentration of the LPC may be less than at least 1ng / mL, at least 1ng / mL to at least 10ng / mL, at least 10ng / mL to at least 100ng / mL, at least 100ng / mL to at least 200ng / mL, at least 200ng / mL to at least 300ng / mL, or at least 300ng / mL to at least 500ng / mL. In some embodiments, the LPC has an ADA concentration of at least 9.7ng / mL.
[0213] In some embodiments, the HPC may have a concentration of at least about 500ng / mL to at least about 1000ng / mL, at least about 1000ng / mL to at least about 2000ng / mL, at least about 2000ng / mL to at least about 5000ng / mL, or at least about 5000ng / mL to at least about 10000ng / mL. In some embodiments, the HPC has an ADA concentration of at least about 4000ng / mL. The concentration of the LPC may be less than at least about 1ng / mL, at least about 1ng / mL to at least about 10ng / mL, at least about 10ng / mL to at least about 100ng / mL, at least about 100ng / mL to at least about 200ng / mL, at least about 200ng / mL to at least about 300ng / mL, or at least about 300ng / mLDocket No. 140505.8005.WO00 to at least about 500ng / mL. In some embodiments, the LPC has an ADA concentration of at least about 9.7ng / mL.
[0214] In some embodiments, the kit comprises a known sample. In some embodiments, the known sample has a concentration of ADAs of about 4000ng / mL or more, about 40µg / mL or more, about 400µg / mL or more, or about 4000µg / mL or more. The known sample may have a concentration of ADAs of about 4000ng / mL or more. The kit may also comprise one or more titer samples. For example, the kit may comprise a titer sample having an ADA concentration of about 4000ng / mL, about 2000ng / mL, about 1000ng / mL, about 500ng / mL, about 250ng / mL, about 125ng / mL, about 62.5ng / mL, about 31.25ng / mL, about 15.63ng / mL, about 7.81ng / mL, about 3.91ng / mL, about 1.95ng / mL, about 0.98ng / mL, and about 0.49ng / mL.
[0215] In some embodiments, the kit comprises a known sample. In some embodiments, the known sample has a concentration of ADAs of at least 4000ng / mL or more, at least 40µg / mL or more, at least 400µg / mL or more, or at least 4000µg / mL or more. The known sample may have a concentration of ADAs of at least 4000ng / mL or more. The kit may also comprise one or more titer samples. For example, the kit may comprise a titer sample having an ADA concentration of at least 4000ng / mL, at least 2000ng / mL, at least 1000ng / mL, at least 500ng / mL, at least 250ng / mL, at least 125ng / mL, at least 62.5ng / mL, at least 31.25ng / mL, at least 15.63ng / mL, at least 7.81ng / mL, at least 3.91ng / mL, at least 1.95ng / mL, at least 0.98ng / mL, and at least 0.49ng / mL.
[0216] In some embodiments, the kit comprises a known sample. In some embodiments, the known sample has a concentration of ADAs of at least about 4000ng / mL or more, at least about 40µg / mL or more, at least about 400µg / mL or more, or at least about 4000µg / mL or more. The known sample may have a concentration of ADAs of at least about 4000ng / mL or more. The kit may also comprise one or more titer samples. For example, the kit may comprise a titer sample having an ADA concentration of at least about 4000ng / mL, at least about 2000ng / mL, at least about 1000ng / mL, at least about 500ng / mL, at least about 250ng / mL, at least about 125ng / mL, at least about 62.5ng / mL, at least about 31.25ng / mL, at least about 15.63ng / mL, at least about 7.81ng / mL, at least about 3.91ng / mL, at least about 1.95ng / mL, at least about 0.98ng / mL, and at least about 0.49ng / mL.
[0217] The affinity antibody and / or the detection antibody may be affinity purified. In some embodiments, the affinity antibody and / or the detection antibody may be stored as a lyophilizedDocket No. 140505.8005.WO00 powder. In some embodiments, the affinity antibody and / or detection antibody may be stored as a reconstituted liquid antibody.
[0218] Any of the components of the kit may be provided at a concentration that is more concentrated than the concentration at which it is used. For example, the components of the kit may be provided as a “stock solution” that must be diluted to the desired concentration of the “working solution.” In some embodiments, the stock solution may be about 2X, 5X, 10X, 50X, 100X, 500X, 1000X, 5000X, or 10000X more concentrated than the working solution.
[0219] The affinity antibody and / or the detection antibody may be lyophilized using methods known to one of skill in the art. One or more lyophilizers may be included. Examples of suitable lyophilizers include, for example, Tris-EDTA and sucrose. Any other lyophilizer commonly used in the art is also available. Determining the appropriate lyophilizer as well as the effective amount of other lyophilizers is within the scope of routine skill in the art.
[0220] The kit may include about 50µg to about 100µg, about 100µg to about 500µg, about 500µg to about 1000µg, about 1mg to about 10mg, about 10mg to about 50mg, about 50mg to about 100mg, about 100mg to about 500mg, or about 500mg to about 1000mg of the affinity antibody and / or the detection antibody. The kit may include about 50µg to about 200µg of the affinity antibody and / or the detection antibody. The kit may include about 100mg of the affinity antibody and / or the detection antibody. The kit may include about 1mg of the affinity antibody and / or the detection antibody. The purity of the affinity antibody and / or the detection antibody may be about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater than 99%.
[0221] The kit may include at least 50µg to at least 100µg, at least 100µg to at least 500µg, at least 500µg to at least 1000µg, at least 1mg to at least 10mg, at least 10mg to at least 50mg, at least 50mg to at least 100mg, at least 100mg to at least 500mg, or at least 500mg to at least 1000mg of the affinity antibody and / or the detection antibody. The kit may include at least 50µg to at least 200µg of the affinity antibody and / or the detection antibody. The kit may include at least 100mg of the affinity antibody and / or the detection antibody. The kit may include at least 1mg of the affinity antibody and / or the detection antibody. The purity of the affinity antibody and / or the detection antibody may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater than 99%.Docket No. 140505.8005.WO00
[0222] The kit may include at least about 50µg to at least about 100µg, at least about 100µg to at least about 500µg, at least about 500µg to at least about 1000µg, at least about 1mg to at least about 10mg, at least about 10mg to at least about 50mg, at least about 50mg to at least about 100mg, at least about 100mg to at least about 500mg, or at least about 500mg to at least about 1000mg of the affinity antibody and / or the detection antibody. The kit may include at least about 50µg to at least about 200µg of the affinity antibody and / or the detection antibody. The kit may include at least about 100mg of the affinity antibody and / or the detection antibody. The kit may include at least about 1mg of the affinity antibody and / or the detection antibody. The purity of the affinity antibody and / or the detection antibody may be at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater than 99%.
[0223] In some embodiments, the lyophilized affinity antibody and / or detection antibody may be reconstituted in about 50µg to about 100µL, about 100µg to about 150µL, about 150µg to about 200µL, about 200µg to about 250µL, about 250µg to about 300µL, about 300µg to about 350µL, about 350µg to about 400µL, about 400µg to about 450µg, about 350µg to about 400µL, about 400µg to about 450µL, or about 450µg to about 500µL of a reconstitution buffer.
[0224] In some embodiments, the lyophilized affinity antibody and / or detection antibody may be reconstituted in at least 50µg to at least 100µL, at least 100µg to at least 150µL, at least 150µg to at least 200µL, at least 200µg to at least 250µL, at least 250µg to at least 300µL, at least 300µg to at least 350µL, at least 350µg to at least 400µL, at least 400µg to at least 450µg, at least 350µg to at least 400µL, at least 400µg to at least 450µL, or at least 450µg to at least 500µL of a reconstitution buffer.
[0225] In some embodiments, the lyophilized affinity antibody and / or detection antibody may be reconstituted in at least about 50µg to at least about 100µL, at least about 100µg to at least about 150µL, at least about 150µg to at least about 200µL, at least about 200µg to at least about 250µL, at least about 250µg to at least about 300µL, at least about 300µg to at least about 350µL, at least about 350µg to at least about 400µL, at least about 400µg to at least about 450µg, at least about 350µg to at least about 400µL, at least about 400µg to at least about 450µL, or at least about 450µg to at least about 500µL of a reconstitution buffer.
[0226] The reconstitution buffer may comprise any components known to one of skill in the art. For example, the reconstitution buffer may comprise water, PBS, DMSO, glycerol, or sodiumDocket No. 140505.8005.WO00 azide. The reconstitution buffer may comprise about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, or about 30% to about 35% glycerol. The reconstitution buffer may comprise about 0.02% to about 0.04%, about 0.04% to about 0.06%, about 0.06% to about 0.08%, about 0.08% to about 0.1%, about 0.1% to about 0.12%, about 0.12% to about 0.14%, or about 0.14% to about 0.16% sodium azide. In some embodiments, the reconstitution buffer has a pH of about 6 to about 7 or about 7 to about 8. In some embodiments, the reconstitution buffer has a pH of about 7.2.
[0227] The reconstitution buffer may comprise at least 10% to at least 15%, at least 15% to at least 20%, at least 20% to at least 25%, at least 25% to at least 30%, or at least 30% to at least 35% glycerol. The reconstitution buffer may comprise at least 0.02% to at least 0.04%, at least 0.04% to at least 0.06%, at least 0.06% to at least 0.08%, at least 0.08% to at least 0.1%, at least 0.1% to at least 0.12%, at least 0.12% to at least 0.14%, or at least 0.14% to at least 0.16% sodium azide. In some embodiments, the reconstitution buffer has a pH of at least 6 to at least 7 or at least 7 to at least 8. In some embodiments, the reconstitution buffer has a pH of at least 7.2.
[0228] The reconstitution buffer may comprise at least about 10% to at least about 15%, at least about 15% to at least about 20%, at least about 20% to at least about 25%, at least about 25% to at least about 30%, or at least about 30% to at least about 35% glycerol. The reconstitution buffer may comprise at least about 0.02% to at least about 0.04%, at least about 0.04% to at least about 0.06%, at least about 0.06% to at least about 0.08%, at least about 0.08% to at least about 0.1%, at least about 0.1% to at least about 0.12%, at least about 0.12% to at least about 0.14%, or at least about 0.14% to at least about 0.16% sodium azide. In some embodiments, the reconstitution buffer has a pH of at least about 6 to at least about 7 or at least about 7 to at least about 8. In some embodiments, the reconstitution buffer has a pH of at least about 7.2.
[0229] In some embodiments, the kit includes a reconstitution buffer. In some embodiments, the kit includes an affinity antibody and / or a detection antibody that is reconstituted.
[0230] The kit may include about 1µg / mL to about 10µg / mL, about 10µg / mL to about 50µg / mL, about 50µg / mL to about 100µg / mL, about 100µg / mL to about 500µg / mL, or about 500µg / mL to about 1000µg / mL, about 1mg / mL to about 10mg / mL, about 10mg / mL to about 50mg / mL, about 50mg / mL to about 100mg / mL, about 100mg / mL to about 1000mg / mL, or about 1000mg / mL to about 10000mg / mL of the detection antibody and / or affinity antibody in solution.Docket No. 140505.8005.WO00
[0231] The kit may include at least 1µg / mL to at least 10µg / mL, at least 10µg / mL to at least 50µg / mL, at least 50µg / mL to at least 100µg / mL, at least 100µg / mL to at least 500µg / mL, or at least 500µg / mL to at least 1000µg / mL, at least 1mg / mL to at least 10mg / mL, at least 10mg / mL to at least 50mg / mL, at least 50mg / mL to at least 100mg / mL, at least 100mg / mL to at least 1000mg / mL, or at least 1000mg / mL to at least 10000mg / mL of the detection antibody and / or affinity antibody in solution.
[0232] The kit may include at least about 1µg / mL to at least about 10µg / mL, at least about 10µg / mL to at least about 50µg / mL, at least about 50µg / mL to at least about 100µg / mL, at least about 100µg / mL to at least about 500µg / mL, or at least about 500µg / mL to at least about 1000µg / mL, at least about 1mg / mL to at least about 10mg / mL, at least about 10mg / mL to at least about 50mg / mL, at least about 50mg / mL to at least about 100mg / mL, at least about 100mg / mL to at least about 1000mg / mL, or at least about 1000mg / mL to at least about 10000mg / mL of the detection antibody and / or affinity antibody in solution.
[0233] In some embodiments, the second affinity label is streptavidin. In some embodiments, the kit includes a solid phase, a second affinity label, and instructions for coating the solid phase with the second affinity label.
[0234] The solid phase may be any material known to one of skill that is imageable and capable of binding a second affinity label, including streptavidin. For example, the substrate may be a slide, plate, dish, or flask. In some embodiments, the kit comprises a solid phase that is coated with streptavidin. In some embodiments, the kit comprises a solid phase, streptavidin, and instructions for coating the solid phase with streptavidin.
[0235] The kit may comprise one or more buffers. In some embodiments, the kit comprises an acid wash buffer. In some embodiments, the kit further comprises a washing buffer. In some embodiments, the kit comprises a blocking buffer. The buffers of the present technology may be formulated according to any of the formulations of this technology or the formulations known to one of skill in the art.
[0236] In accordance with some embodiments, the kit may contain one or more consumables for performing the methods of the present technology. For example, the kit may include one or more plates containing a plurality of wells. In some embodiments, the plate may include 6, 9, 12, 16, 24,Docket No. 140505.8005.WO00 36, 96, 384, or 1536 wells. In some embodiments, a kit or system includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more than twenty assay plates.
[0237] The kit may also include instructions for performing all or part of the methods described in the present technology. In some embodiments, the kit includes links (e.g., URLs or QR codes) that direct a user to instructions for performing all or part of the methods of the present technology. The kit may include software or other computer technology to facilitate performing the methods of the present technology.
[0238] The components of the kit may be stored to provide stability to the particular components. For example, components of the kit may be stored in a light-impermeable container if the component comprises a light-sensitive compound. In some embodiments, the components of the kit may be stored in an airtight container. In some embodiments, the components of the kit are stored frozen, in liquid form, or in solid form. In some embodiments, the components of the kit are stored at about -195°C, -80°C, -20°C, 4°C, or 20°C.
[0239] In some embodiments, the kit comprises: (i) an affinity antibody comprising biotin; (ii) a detection antibody comprising a sulfo-Tag; (iii) a plate comprising streptavidin; (iv) TPA; and (v) a wash buffer.
[0240] As used herein, the word "about" when immediately preceding a numerical value means a range of plus or minus 10 % of that value, e.g., "about 50" means 45 to 55, "about 10" means "9 to 11", etc. Furthermore, the phrases "less than about" a value or "greater than about" a value should be understood in view of the definition of the term "about" provided herein.
[0241] In another embodiment, the kit includes one or more of the components, consumables, or reagents described in the examples below. EXAMPLES
[0242] Examples provided in this technology include example methods for detecting ADAs in human samples with an ECL assay, methods of validating the assay, and results from the validation.
[0243] List of abbreviations and definitions: ADA: Anti-Drug Antibody; A.T.: Ambient Temperature; Bio-XTMAB-16: Biotin Labeled XTMAB-16; CCP: Confirmatory Cut-Point; CP: Cut- Point; CV: Coefficient of Variation; diH2O: Deionized Water; ECL: Electrochemiluminescence;Docket No. 140505.8005.WO00 ECLIA: Electrochemiluminescence Immunoassay; HPC: High Positive Control; iNHS: Individual Naïve Human Serum; LPC: Low Positive Control; MRD: Minimum Required Dilution; MSD: Meso Scale Discovery; NA: Not Applicable; NC: Negative Control; pNHS: Pooled Naïve Human Serum; PBS: Phosphate-Buffered Saline; QC: Quality Control; rECL: Relative ECL; Ru-XTMAB-16: Ruthenium Labeled XTMAB-16; SCP: Screening Cut-Point; S-CPF: Screening Cut-Point Factor; SD: Standard Deviation; TCP: Titration Cut-Point; T-CPF: Titration Cut-Point Factor. EXAMPLE 1: Methods for detecting ADAs in a subject by an ECL assay and methods of validating the same
[0244] Overview: FIG. 1 illustrates an exemplary method (method 100) for detecting an ADA that binds the target antibody in a sample. Method 100 may be used for immunogenicity assessments of various antibodies, including, but not limited to, anti-TNFα antibodies. Method 100 comprises: (i) incubating the sample with a composition comprising: (a) an anti-TNFα antibody conjugated to a first affinity label (affinity antibody), and (b) an anti-TNFα antibody conjugated to a detection label (detection antibody) 110; (ii) isolating ADAs that form a complex with both the affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label 120; and (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut-point 130. Isolating the ADAs may comprise: (a) providing a solid phase comprising the second affinity label; (b) contacting the sample and the composition with the solid phase; and (c) washing the solid phase. Validation Summary: To support an immunogenicity assessment of XTMAB-16 in human samples, methods of detecting antibodies in human serum samples were assessed.
[0245] An MSD streptavidin plate was blocked to prevent non-specific antibody binding. The control and experimental samples were incubated with Bio-XTMAB-16 and transferred to the blocked MSD streptavidin plate. Following incubation, the plate was washed and then incubated with Ru-XTMAB-16. After Ru-XTMAB-16 incubation, the MSD streptavidin plate was washed again and read with plate reader (MSD Sector Imager S600). Screening, confirmatory, and titration steps were also incorporated into the validation methods.
[0246] Screening methods were used to detect potentially positive ADAs to XTMAB-16 in human serum samples. Confirmatory methods were used to determine whether the potential ADA-Docket No. 140505.8005.WO00 positive samples were specific to XTMAB-16. Titration methods were used to provide an estimate of ADA levels in human serum samples that were confirmed to be positive for antibodies to XTMAB- 16.
[0247] Materials: The validation methods used the reagents and controls listed in Table 2 Table 2: Reagents and controls in ECL validation Reagent Storage ConditionDocket No. 140505.8005.WO00 MSD Read Buffer 4X A.T.
[0248] Negative Controls: A pooled lot of pNHS was prepared by pooling together equal volumes of 40 lots of iNHS (29 male lots and 11 female lots).
[0249] High and Low Positive Controls: An ECL assay was validated for detection of anti- XTMAB-16 antibodies in human serum and to determine whether potentially ADA-positive samples were specific to anti-XTMAB-16. A titration method was incorporated to provide a quasi-quantitative estimate of ADA level in human serum samples that were confirmed as positive for having anti- XTMAB-16. Preparation of positive controls is further detailed in Table 3. Table 3: Preparation of Positive Controls ADA ADA Stock NC Total Resulting Resulting n
[0250] Reagent Preparation: The validation PCs were prepared by adding the anti-XTMAB- 16 antibody to the pNHS at high (4,000.0ng / mL) and low (9.70ng / mL) concentrations for HPC and LPC, respectively.
[0251] Reagents were prepared, including MSD 2X Read Buffer (4x MSD Read Buffer diluted with diH2O), Wash Buffer (1x PBS with 0.05% Tween-20), Blocking Buffer (Protein-Free), Assay Buffer (NGBI), and XTMAB-16 Drug Stock Solution (XTMAB-16 dissolved in PBS to 10mg / mL).Docket No. 140505.8005.WO00
[0252] QC preparation included preparation of an NC (pNHS made from at least 40 individual lots) and LPC and HPC positive controls. HPC concentration was 4,000ng / mL and the LPC final concentration was prepared at a 99.9% confidence interval.
[0253] Establishment of LPC Concentration: The LPC concentration was calculated in both screening and confirmatory assay using the mean of the corresponding sensitivity + t0.99, df X SD (sensitivity). The final LPC concentration was the higher LPC concentration between the screening LPC and the confirmatory LPC. Each sensitivity will be obtained from a separate sensitivity run. The screening sensitivity concentration will be interpolated from the screening sensitivity curve at the SCP. The confirmatory sensitivity concentration will be interpolated from the confirmatory sensitivity curve at the CCP. Once the LPC has been finalized, at least two sets of LPCs and HPCs and at least four sets of NCs will be included as plate controls in each run.
[0254] System Suitability Criteria: System suitability will be assessed from all accepted validation runs (except the robustness run and the long-term stability run, if any) to set up assay acceptance ranges for the NC, LPC, and HPC. The control ranges will be set using the response values of NC, LPC, and HPC, as detailed below.
[0255] Examples of control range calculations:
[0256] Upper limit of NC = Mean of NC responses + 3xSD of NC responses
[0257] LPC range = Mean of LPC responses ± 3xSD of LPC responses
[0258] Lower limit of HPC = Mean of HPC responses - 3xSD of HPC responses
[0259] In cut-point and sensitivity runs, at least 50% of each level of HPC must have %CV of the replicates ≤ 20.0%.
[0260] After LPC concentration is finalized, at least 50% of each level of plate controls must have: %CV of ≤ 20.0%.
[0261] The relationship of the accepted control samples should be as follows:
[0262] For screening and titration assays, the mean ECL: NC < SCP (if applicable) ≤ LPC (if applicable) < HPC
[0263] For confirmatory assay, the %inhibition: NC < CCP (if applicable) ≤ LPC (if applicable) and HPC.Docket No. 140505.8005.WO00
[0264] To accept a run, at least 50% of each level of control samples and at least 66.7% of total control samples should meet the above criteria.
[0265] Screening Assay Plate Control Acceptance Criteria: For the screening assay, the CV of each plate control was 20.0% or less, and plate controls were present in duplicates. The plate NC was considered the mean of all accepted NCs, and %CV failure and outliers were excluded. The relationship of accepted control samples in the screening assays were mean response (ECL): NC < SCP ≤ LPC < HPC, and the ECL was within the range established during validation:
[0266] NC: ECL mean ≤ 158.8; LPC: 95.5 ≤ ECL mean ≤ 156.1; HPC: 4761.7 ≤ ECL mean.
[0267] The S-CPF was 1.10, and the plate-specific SCP was the value calculated from the NC multiplied by the S-CPF.
[0268] Confirmatory Assay Plate Control Acceptance Criteria: For the confirmatory assay, the CV of each plate control was 20.0% or less, and plate controls were present in duplicates. The relationship of the accepted control samples were %inhibition: NC < CCP ≤ LPC and HPC. Plate NC was the mean of all accepted NCs, and %CV failure and outliers were excluded. The CCP was 16.45% in the presence of XTMAB-16, and %inhibition was calculated by the following formula:
[0269] %inhibition = 100*(1-[Mean ECL of spiked samples / Mean ECL of unspiked samples])
[0270] Titration Assay Plate Control Acceptance Criteria: For the titration assay, the CV of each plate control was 20.0% or less, and plate controls were present in duplicates. The plate NC was considered the mean of all accepted NCs, and %CV failure and outliers were excluded. The relationship of accepted control samples in the titration assays were mean response (ECL): NC < SCP ≤ LPC < HPC, and the ECL was within the range established during validation:
[0271] NC: ECL mean ≤ 158.8; LPC: 95.5 ≤ ECL mean ≤ 156.1; HPC: 4761.7 ≤ ECL mean.
[0272] Titer control was 25600 ≤ titer for XTMAB-16 ADA PC at 4,000mg / mL ≤ 102,400.
[0273] The T-CPF was 1.20, and the plate-specific TCP was calculated by multiplying the T- CPF by the plate NC.
[0274] Screening Assay Sample Acceptance Criteria: The mean ECL values for screening samples had a %CV of 20.0% or less. Samples with mean ECL values ≥ plate-specific SCP wereDocket No. 140505.8005.WO00 classified as potentially positive. Samples with mean ECL values less than the plate-specific SCP were classified as negative.
[0275] Confirmatory Assay Sample Acceptance Criteria: The mean ECL values for confirmatory samples had a %CV of 20.0% or less. Samples were classified as positive for anti- XTMAB-16 antibodies if the following conditions were met: (1) the mean ECL for the sample in the screening assay was ≥ plate-specific SCP and (2) the %inhibition in the confirmatory assay was ≥ CCP. Samples were classified as negative for anti-XTMAB-16 antibodies if any of the following conditions were met: (1) the mean ECL in the screening assay < plate-specific SCP and (2) the %inhibition in the confirmatory assay < CCP.
[0276] Titration Assay Sample Acceptance Criteria: The titer of undiluted samples with an ECL below plate TCP were reported as MRD. The titer of undiluted samples with an ECL above the TCP, but where the first dilution (minimum dilution) had an ECL below the plate TCP, were reported as MRD. For samples with at least one dilution that reaches an ECL below the TCP, the diluted sample must have at least two dilutions spanning the TCP with a %CV ≤ 20.0%.
[0277] The titer of a diluted sample with ECL above the plate-specific TCP was considered the dilution factor of the last dilution sample with ECL above the plate-specific TCP.
[0278] Determination of Cut-Point: SCP: The ECL signal of each individual sample was normalized by the plate NC (expressed as S / N). The data was then log-transformed. After outlier removal, normality test was performed on the data using JMP. The S-CPF was calculated based on 5% false-positive rate using the equation below based on the data distribution.
[0279] S-CPF = “Mean + 1.645xSD” (if data normally distributed) or “95thpercentile” (if data not normally distributed)
[0280] A plate-specific SCP will be calculated using the following formula:
[0281] SCP = Mean NC ECL values in a plate * S-CPF
[0282] CCP: CCP was defined by the inhibition rate from individual samples with and without spiking reference drug. The %inhibition and CCP, using a 1% false-positive rate, are calculated using the equation below based on the data distribution by JMP.
[0283] %inhibition = 100 * (ECL without drug — ECL with drug) / ECL without drugDocket No. 140505.8005.WO00
[0284] CCP = “Mean %inhibition + 2.33 * SD %inhibition” (if data normally distributed) or “99thPercentile” (if data not normally distributed)
[0285] TCP: T-CPF will be calculated using the S-CPF normalized data. T-CPF will be calculated based on 0.1% false-positive rate using the equation below based on the data distribution. T-CPF will be reported to two decimal places.
[0286] T-CPF = “Mean + 3.09 x SD” (if data normally distributed) or “99.9thpercentile” (if data not normally distributed)
[0287] Plate TCP = Mean NC ECL values in a plate * T-CPF
[0288] Experimental design and target specifications for determining cut-point are outlined in Table 4. Table 4: Experimental Design and Target Specifications for Determining Cut-Point Experimental Design Target Specifications g he he or in ed ed al g he heDocket No. 140505.8005.WO00 Analysts: 2 minimum ^ Calculate the %inhibition using the Days: 2 minimum following formula: of of or in ed ed al [ on atwhich a positive control antibody preparation consistently provides a positive signal in the assay. Assay sensitivity was determined in the presence and absence of drug. The experimental design for the sensitivity assay for the screening assay is outlined in Table 5, and for the confirmatory assay in Table 6. Table 5: Screening Assay Experimental Design and Target Specifications for Sensitivity Assay Experimental DesignTarget SpecificationsA ADA PC 4000 / L d Pl i i i tyDocket No. 140505.8005.WO00 Table 6: Confirmatory Assay Experimental Design and Target Specifications for Sensitivity Assay Experimental Design Target Specifications Assay ADA PCs (4000ng / mL) prepared•Plate acceptance criteria is ty n
[0290] sment wasprepared at a concentration level higher than HPC to demonstrate that higher concentrations may not cause a decrease in response. The prepared samples were frozen for a minimum of 12 hours before serial dilution and analysis. On the day of the assay, the sample was diluted using negative serum as diluent before analysis to give concentrations above and at the assay sensitivity level. At least 80% of the validation sample used in hook effect evaluation had a %CV ≥ 20.0%.
[0291] Intra-Assay and Inter-Assay Precision: Intra-assay precision was evaluated based on the %CV of of six independent preparations of the samesample in one run, and confirmatory assays. The experimental design and target specifications for the intra-assay precision are outlined in Table 7. Table 7: Intra-Assay Precision in Screening and Confirmatory Assays Experimental DesignTarget SpecificationsDocket No. 140505.8005.WO00 • No intra CV criteria for NC
[0292] HPC resultsacross all applicability accepted validation runs, except for the test of robustness and long-term stability. The experimental design and target specifications for the inter-assay precision are outlined in Table 8. Table 8: Inter-Assay Precision in Screening and Confirmatory Assays Experimental Design Target Specifications Inter-assay All NC LPC HPC acce ted in • CV ≤ 20% between CDocket No. 140505.8005.WO00 Intra-assay All NC, LPC, HPC accepted in • CV ≤ 20% between precision in validation runs, except robustness replicates fi t C
[0293] erence forindividual normal matrix was evaluated by spiking ADA at LPC level to at least 10 individual normal matrixes in both screening and confirmatory tests. The selectivity and matrix interference for individual diseased matrix was evaluated by spiking ADA at LPC level to at least 10 individual diseased matrixes in both screening and confirmatory tests. In the screening assay, ADA spiked and non-ADA spiked matrix samples were analyzed in comparison to SCP. In the confirmatory assay, the analyzed samples will be compared with CCP. Samples may be frozen prior to analysis. The selectivity samples confirmed with pre-existing antibodies were excluded in evaluating assay selectivity. The selectivity evaluation experimental design and target specifications are outlined in Table 9. Table 9: Selectivity Evaluation Experimental Design and Target Specifications Experimental Design Target Specifications l i i Mi i f 1 i i i l l Pl i i i f s yDocket No. 140505.8005.WO00 20.0% between replicates
[0294] nt includeshaemolyzed (2%) and lipemic (150mg / dL) matrix assessment. A minimum of three control matrix pooled serum samples for each condition were assessed unspiked and spiked at LPC level. The spiked matrix samples will be analyzed in comparison to plate SCP. In confirmatory assays, the analyzed samples were compared with CCP. Samples may be frozen prior to analysis. The matrix interference experimental design and target specifications are detailed in Table 10. Table 10: Matrix Interference Experimental Design and Target Specifications Experimental Design Target Specifications Matrix Minimum of 3 pooled lot of 2% • Pl t t n rit ri i ) s ≥ s
[0295] est level of drug that may be added to a sample spiked with the positive control antibodies without interferingDocket No. 140505.8005.WO00 with its detection as positive antibody response. Various drug concentrations were spiked into matrix samples containing various concentrations of positive control antibodies.
[0296] Drug tolerance limit may be defined as the highest level of drug in the presence of which ADA is still detected. ADA PC at 100ng / mL and LPC level will be tested. The highest drug concentration that retains a positive response in the screening assay for each ADA level tested will be defined as the drug tolerance level of the screening assay. The experimental design and target specifications for testing drug tolerance are outlined in Table 11. Table 11: Experimental Design and Target Specifications for Testing Drug Tolerance Experimental Design Target Specifications Selectivity Positive control samples at various Plate acceptance criteria is met e
[0297] Stability Test: Combined stressed samples with bench-top (24±6 hours or 8±2 hours) and freeze / thaw (6 or 3 cycles from -70°C ± 10°C to ambient temperature) were tested. The samples were prepared and stored at -70°C ± 10°C for overnight (at least 12 hours) before being thawed at ambient temperature for the first cycle. For the subsequent freeze / thaw cycles, samples were frozen for at least 12 hours under the same conditions and then thawed. Samples were left at the bench-top for 2±1 hours before refreezing. The experimental design and target specifications are outlined in Table 12. Table 12: Experimental Design and Target Specifications for Bench-Top and Freeze / Thaw Stability Assays Parameter Experimental Target SpecificationDocket No. 140505.8005.WO00 Bench-top, freeze / thaw NC, LPC, and HPC System acceptance criteria is met stability Plate acce tance criteria is met C ia. [0298 ager S600and Discovery Workbench Software Version 4.0. %CV, SD, and %inhibition were each calculated. Statistical evaluation of cut-point factors was conducted using JMP software.
[0299] Assay Performance Characteristics: All samples and controls, including two sets of LPC and HPC and at least four sets of NC, were evaluated in duplicate. The text file imported from the MSD Sector Imager S600 was used as the source data for analysis and verified against the screen capture of the original data. The source data was processed in Microsoft Excel to calculate mean of ECL values, %CV, and %inhibition. The S-CPF, T-CPF, and CCPs were calculated using JMP 14 statistical software. All mean duplicate or quadruplicate ECL values were assessed in the analysis.
[0300] Failed tests: Plate control testing resulting in failed runs was repeated twice. If the repeated run failed again and failure was not due to the experimental error, the method was investigated and the method was revised or reoptimized with runs repeated, where necessary. EXAMPLE 2: Validation of method of detecting ADAs in serum samples using an electrochemiluminescence immunoassay
[0301] Cut-Point Determination: To determine the screening, confirmatory, and titration assay cut-point factors for the detection of anti-XTMAB-16 antibodies, two serum samples from 54 lots of naïve male and female human serum were tested over five days. Each sample was tested six times across 18 individual runs.Docket No. 140505.8005.WO00
[0302] Cut-point statistical outliers were determined using quantile range outlier’s method, and identified outliers were removed. Cut-point normality values were tested by Shapiro-Wilk W Test using JMP software.
[0303] For each run, the mean ECL signal of each individual serum sample was normalized using the mean ECL of a plate NC. The normalized ECL (rECL) was log-transformed. Examples of data analyzed according to the present technology are shown in Tables 12-14, for example. Table 12 shows raw data from one run of samples that were tested according to the methods of the present technology. Table 13 shows raw data for S-CPF and T-CPF for the runs in Table 12. Table 14 illustrates an example of the summarized normalized data for S-CPF and T-CPF calculation. Table 12:Example raw data from a single run Example Validation Parameter Result RunDocket No. 140505.8005.WO00 58 Pooled Sensitivity-01 Pass 59 Pooled Sensitivity-02 PassExample Plate NC Rep 1 Rep 2 Mean %CV rECL Run*Docket No.140505.8005.WO00 83 89 86.0 4.9 1.0710 83 88 85.5 4.1 1.0648Table 14: S-CPF and T-CPF raw data Screening 1* Screening 2 Screening 3 Screening 4 Screening 5 Screening 6 1 17 1 2 7 721Docket No. 140505.8005.WO00 0.9508 0.9807 1.0060 0.9481 1.0138 1.1908 0.9508 1.0289 1.0060 0.9783 1.0484 1.0510Docket No. 140505.8005.WO00 1.0476 0.9722 1.0361 0.8879 1.0710 0.9649 0.9769 0.9656 1.0070 0.8435 1.0229 0.9336
[0304] Analytical outliers were identified using box-plot analysis on the normalized and log- transformed serum values (Table 15). Biological outliers were identified and excluded from analysis, and the normalized and log-transformed data for each individual serum sample was averaged across the six determinations, if available. Box-plot analysis was then performed to identify biological outliers (Table 16). Examples of the outliers analyzed are shown in Tables 15-17, for example. Tables 15, 16, 18, and 19 show examples of the analytical and biological outlier identification from the lots assessed in Tables 12-14. Table 17 illustrates an example of the summarized data of log-transformed rECL for S-CPF and T-CPF calculation after the removal of the biological and analytical outliers, such as those shown in Tables 15, 16, 18, and 19. Table 15: Analytical and Biological Outlier Identification (Example A) Screening 1* Screening 2 Screening 3 Screening 4 Screening 5 Screening 6 1.0179 0.9988 0.9880 1.0205 0.9793 0.9721Docket No. 140505.8005.WO00 1.0710 1.0276 1.0495 1.0395 1.0583 0.9893 1.0710 1.0338 1.0330 1.1556 1.0745 0.9833Table 16: Analytical and Biological Outlier Identification (Example B) Screening 1* Screening 2 Screening 3 Screening 4 Screening 5 Screening 6 MeanDocket No. 140505.8005.WO00 1.0011 1.0349 1.1325 1.0266 1.0023 1.1543 0.0240 0.9899 1.0168 1.0843 1.0145 0.9735 1.0875 0.0115Docket No. 140505.8005.WO00 1.0411 0.9392 1.0070 0.8824 1.0229 0.9461 -0.0126 0.9447 0.9458 1.0012 0.9323 0.9988 0.9336 -0.0182Table 17: log-transformed rECL for S-CPF and T-CPF Screening 1* Screening 2 Screening 3 Screening 4 Screening 5 Screening 6 1.0179 0.9988 0.9880 1.0205 0.9793 0.9721Docket No. 140505.8005.WO00 1.0648 1.0526 1.0165 1.1556 1.0529 1.0012 0.9776 0.9774 1.0165 1.0337 0.9665 0.9118 lytical OutliersMeasurement ValueDocket No. 140505.8005.WO00 High end (Q3+3*[Q3-Q1]) 0.1269 TableMeasurement Value
[0305] ormednormalized values were tested by Shapiro-Wilk W Test using JMP software (FIG. 2A). Normal distribution was confirmed, and a parametric approach was used to calculate S-CPF and T-CPF (Table 20). Table 20: Calculated Parametric S-CPF and T-CPF Measurement Value
[0306] using the following formula:
[0307] %inhibition = 100 * (ECLwithout drug- ECLwith drug) / ECLwithout drugDocket No. 140505.8005.WO00
[0308] SCPs and TCPs were removed from the CCP analysis.
[0309] CCP analytical outliers were identified and excluded from analysis using box-plot analysis on the %inhibition values (Table 21). Table 21: Calculation of CCP Analytical Outliers Measurement Value Q1 (25% rtil ) 05600
[0310] eachindividual serum sample was averaged across the six determinations, if available. Box-plot analysis was performed on the values to identify biological outliers (Table 22). Table 22: Calculation of CCP Biological Outliers Measurement Value
[0311] tested by Shapiro-Wilk W Test using JMP software (FIG. 2B). Normal distribution was confirmed, and a parametric approach was used to calculate S-CPF and T-CPF (Table 23). Table 23: Calculated Parametric CCP Factors Measurement ValueDocket No. 140505.8005.WO00 SD 6.1523
[0312] As to XTMAB-16 in human serum (Table 24). Examples of the CCP values assessed are shown in Tables 25-28. An example of the raw data values assessed is shown in Table 25, and examples of these values after the removal of outliers are shown in Tables 26-28, no outliers were found in the example. Table 24: Cut-Point Values Determined for Detection Assay Description Units False-Positive Parametric / Non- Result Rate Parametric TableExample Drug Unspiked Drug Spiked (MAB-16 at 200 ug / mL) Run* Rep 1 Rep 2 Mean %CV Rep 1 Rep 2 Mean %CV %InhibitionDocket No. 140505.8005.WO00 76 77 76.5 0.9 77 76 76.5 0.9 0.00 84 88 86.0 3.3 72 72 720 0.0 16.28Table 26: Values after Outlier Removal (Example A) Confirmatory 1 Confirmatory 2 Confirmatory 3 Confirmatory 4 Confirmatory 5 Confirmatory 6 110 -18 -55 -30 24 -25Docket No. 140505.8005.WO00 6.2 2.0 -12.3 4.4 5.1 -5.6 10.4 4.4 -9.9 5.9 -0.6 -4.3Table 27: Values after Outlier Removal (Example B) Confirmatory Confirmatory 2 Confirmatory 3 Confirmatory 4 Confirmatory 5 Confirmatory 6Docket No. 140505.8005.WO00 -3.6 -5.9 -9.0 NA -5.0 -11.6 7.3 11.1 16.5 10.0 3.5 16.3Docket No. 140505.8005.WO00 10.9 1.4 -4.7 10.1 8.8 5.7 12.4 0.0 -4.1 8.8 0.6 7.3Table 28: Values after Outlier Removal (Example C) Confirmatory Confirmatory 2 Confirmatory 3 Confirmatory 4 Confirmatory 5 Confirmatory 6 1*Docket No. 140505.8005.WO00 16.3 6.1 9.4 18.4 8.7 3.0 15.1 6.1 0.5 9.1 -2.0 -0.6
[0313] Sensitivity: The screening assay sensitivity was evaluated six times, in pooled human serum (three times) and three individual lots of human serum (one time for each lot). Each sample was spiked with anti-XTMAB-16 antibodies PC. Serial two-fold dilutions of the spiked samples (fromDocket No. 140505.8005.WO00 4,000ng / mL to 0.49ng / mL) in pNHS and individual mouse serum (iNMS) were performed. The screening sensitivity was determined for each sensitivity set using Microsoft Excel Forecast, by interpolation at the SCP (5% false-positive). The final assay sensitivity in screening assay is the mean of calculated concentration among all the qualified curves. The results showed that the screening sensitivity of the assay to detect anti-XTMAB-16 antibodies was 2.77ng / mL in human serum. An example of this result is shown in Table 29. Table 29: Screening Sensitivity Screening Sensitivity in Individual serum Assay te P 6. 8Docket No. 140505.8005.WO00 409 0.98 83.0 8.5 79.0 1.8 86.5 4.1 6 819
[0314] Confirmatory assay sensitivity was performed by spiking XTMAB-16 into diluted samples prepared for screening sensitivity. The confirmatory sensitivity is determined for each sensitivity set using Microsoft Excel Forecast, by interpolation at the CCP (1% false-positive). The final assay sensitivity in confirmatory assay is the mean of calculated concentration among all the qualified curves. The results showed that the confirmatory sensitivity of the assay to detect anti- XTMAB-16 antibodies was 4.25ng / mL. An example of this result is shown in Table 30. Table 30: Confirmatory Sensitivity Confirmatory Sensitivity in Individual serum Sensitivity 57 tio P P P P P P P P P PDocket No. 140505.8005.WO00 102 79. 72. 84. 3.91 7.2 15.96 <CCP 9.8 18.18 >CCP 0.8 13.33 <CCP 4 0 0 5 204 73 72 81 P P P
[0315] The sensitivity data was also used to determine the LPC of the assay. The LPC is based on the sensitivity with a 1% false-positive rate, which was calculated in both screening and confirmatory assays using the mean of the Sensitivity + t0.99, df × SD (Sensitivity). The LPC concentration was 6.80 and 9.70ng / mL for screening and confirmatory assay, respectively. Results are detailed in Table 31. The calculated LPC concentration is the higher LPC between the screening assay and the confirmatory assay, which is 9.70ng / mL. Table 31: LPC Determination for Screening Assay and Confirmatory Assay LPC Calculation Screening Assay Confirmatory Assay
[0316] of the assay changes from increasing to decreasing when the ADA concentration increases. The hook effect may not be critical to ADA detection if all concentrations of positive antibody yield positive results. The hook effect was assessed using a sample with an ultra-high concentration of anti- XTMAB-16 antibodies in pNHS (32,000ng / mL), which was prepared by spiking ADA PC into pooled serum and freezing for at least 12 hours. The sample was then serially two-fold diluted to a concentration below the plate-specific TCP. All samples with a concentration of 7.81ng / mL anti-Docket No. 140505.8005.WO00 XTMAB-16 antibodies or greater demonstrated a positive ECL value as compared to the plate- specific TCP, indicating that no prozone effect was observed. An example of data showing this result is illustrated in Table 32. Table 32: Hook Effect Assay Run Example Hook Effect & Titration Dilution ADAConc. (ng / mECL %CV Plate JC Plate TCP ConditionFactorL)
[0317] Selectivity: Selectivity is the ability of the assay to detect anti-XTMAB-16 antibodies in the presence of other matrix components. ADA unspiked and spiked samples at LPC level (9.70ng / mL) were prepared from 10 lots of normal human serum, 10 lots of disease human serum, 3 lots of hemolyzed human serum, and 3 lots of lipemic human serum that originally tested in 4 runs with both screening and confirmatory assay. For individual lots of normal human serum, 9 out of 10 unspiked samples (90%) were confirmed as negative, while 9 out of 10 spiked LPC samples (90%) were confirmed as positive. For individual lots of disease human serum, 10 out of 10 unspiked samples (100%) were confirmed as negative, while 10 out of 10 spiked LPC samples (100%) were confirmed as positive. For individual lots of hemolyzed human serum, 3 out of 3 unspiked samplesDocket No. 140505.8005.WO00 (100%) were confirmed as negative, while 3 out of 3 spiked LPC samples (100%) were confirmed as positive. For individual lots of lipemic human serum, 3 out of 3 unspiked samples (100%) were confirmed as negative, while 3 out of 3 spiked LPC samples (100%) were confirmed as positive, which met the acceptance criteria. This suggests there is no matrix interference for detection of anti- XTMAB-16 antibodies in human serum. An example of data showing this result is illustrated in Table 33. Table 33: Assessing Selectivity and Matrix Interference Drug Unspiked Drug Spiked (MAB-16 at 200 µg / mL) Sample Exampl Plat condition Serum ID %C Plate Conditio %C %Inhibitio CCP Conditio R E L E L N / P / FailDocket No. 140505.8005.WO00 Disease 80.0 1.8 <SCP 86.0 1.6 -7.50 <CCP Negative -05 Disease
[0318] Drug Tolerance: The presence of drug XTMAB-16 in samples may interfere with the detection of anti-XTMAB-16 antibodies and, hence, the ability of the assay system to correctly detect the ADA was evaluated. Drug tolerance limit was defined as the highest level of drug in the presence of which ADA is still detected. Potential interference by the drug was evaluated using a positive control prepared at concentrations of 100ng / mL and 9.7ng / mL. These controls were spiked with XTMAB-16 at concentrations ranging from 5.0µg / mL to 400µg / mL. The addition of up to 100.0µg / mL XTMAB-16 had no impact on the ADA detection in samples spiked at 100ng / mL, and the addition of up to 5.0µg / mL XTMAB-16 had impact on the ADA detection in samples spiked at 9.7ng / mL, which led to a false-negative result. An example of data showing this result is illustrated in Table 34. Table 34: Assessing Drug Tolerance Example Run Drug ToleranceDocket No. 140505.8005.WO00 400.0 85.5 5.8 <SCP 91.0 4.7 <SCP 200.0 98.5 0.7 <SCP 88.0 1.6 <SCP 1
[0319] Intra-assay precision: Intra-assay precision, an evaluation of the within-run performance of the controls, was evaluated in one run using six independent preparations of the HPC (4,000ng / mL), LPC (9.70ng / mL), and NC. The results demonstrate that the controls met the intra- assay precision criteria of ≤ 20.0% for the ECL signal for both screening and confirmatory assays. The controls also met the criteria of ECL of NC < plate-specific SCP ≤ LPC < HPC for screening assay, and %inhibition of NC < CCP ≤ LPC < and HPC for confirmatory assay. The screening intra- assay precision of the HPC and LPC was 18.2% and 4.3%, respectively. The confirmatory intra-assay precision of the ECL signal for HPC and LPC was 6.3% and 4.1%, respectively. The intra-assay precision of percent for HPC and LPC was 0.2% and 9.1%, respectively. An example of data showing these results is illustrated in Table 35. Table 35: Assessing Intra-assay Precision Examp Drug Unspiked Drug Spiked (MAB-16 at 200 µg / mL) le Run biti 7 3Docket No. 140505.8005.WO00 7880. 128. 106. 6 0.1 0.6 91.5 3.9 91.5 5.4 98.84 86.5 8.2 32.42 4.6 -16.39 50 59110 136
[0320] Inter-assay precision: Inter-assay precision, an evaluation of the between-run performance of the controls, was evaluated based on the HPC (4,000ng / mL), LPC (9.7ng / mL), and NC results across all accepted validation runs, excluding PCs from the robustness run. The screening inter-assay precision of the method was 14.1% (HPC) and 7.9% (LPC). The controls met the inter- assay precision criteria of ≤ 20.0% for HPC and LPC. The confirmatory inter-assay precision of the %inhibition for HPC and LPC was 0.2% and 13.3%, respectively. The controls also met the criteria of ECL NC < plate-specific SCP ≤ LPC < HPC for screening assay, and %inhibition of NC < CCP ≤ LPC and HPC for confirmatory assay, respectively. An example of data showing this result is illustrated in Table 36. Table 36: Assessing Inter-assay Precision Example Screening Assay Run Parameter Run HPC HPC LPC LPC NC NC NC NC .5 .0 .0 .0 .0 .5 .5 .5 .5 .0 .5 .0 .5 .0 .0 .5 .0 .5Docket No. 140505.8005.WO00 55 Individual Sensitivity- 1 8187.5 7516.0 NA NA 90.5 84.5 76.0 80.0 56 Individual Sensitivity-2 8348.5 8288.5 NA NA 84.5 79.5 81.0 82.0 .5 .0 .5 .0
[0321] Stability: The stability of positive controls in human serum was used to assess sample stability. Freeze / thaw (6 cycles of -70°C ± 10°C to ambient temperature) and bench-top (24 hours at ambient temperature) stability were tested. The acceptance criteria for the stability samples were as follows: (1) NC < plate-specific SCP ≤ LPC < HPC for screening assay, (2) %inhibition of NC < CCP ≤ LPC and HPC for confirmatory assay, (3) %CV ≤ 20% for the NC, LPC, and HPC, (4) at least 66.7% (two out of three) stability samples must meet the above acceptance criteria.
[0322] The tested samples were stored at -70°C (nominal) for at least 24 hours prior to first thaw and 12 hours prior to each additional thaw. Samples were at ambient temperature for 1-2 hours prior to refreezing. Three aliquots for each control (HPC, LPC, and NC) were tested after undergoing six freeze / thaw cycles on a plate using both screening and confirmatory assay, with frozen PCs and NC, which were used for plate acceptance. The results met the acceptance criteria, therefore, anti- XTMAB-16 antibodies in human serum are stable for up to six freeze / thaw cycles from -70°C (nominal) to ambient temperature. An example of these results is shown in Table 37. Table 37: Assessing Stability (Example A) Freeze / Thaw Drug Unspiked Drug Spiked (MAB-16 at 200 µg / mL)itiDocket No. 140505.8005.WO00 133. LPC-1 2.6 Pass 90.0 3.1 32.58 Pass 5
[0323] The tested samples were stored at -70°C (nominal) for at least 24 hours prior to first thaw. Three aliquots of each pre-existing frozen control (HPC, LPC, and NC) were thawed on the bench-top for 24.5 hours, prior to analysis on a plate using both screening and confirmatory assay with frozen PCs and NC, which were used for plate acceptance. All HPC, LPC, and NC stability samples met the acceptance criteria, therefore, anti-XTMAB-16 antibodies in human serum are stable for up to 24.5 hours at ambient surroundings. An example of these results is shown in Table 38. Table 38: Assessing Stability (Example B) Bench top (245 hours)Drug Unspiked Drug Spiked (MAB-16 at 200 µg / mL)itiDocket No. 140505.8005.WO00 122. LPC-3 2.3 Pass 92.5 3.8 24.18 Pass 0
[0324] Study Phase Bioanalysis Acceptance Criteria for Controls: System suitability criteria was established using data from all valid runs in the validation except robustness runs. In future sample analysis, the criteria are utilized as acceptance criteria for the acceptance or rejection of a run. The %CV criterion for intra-replicate measurements of controls and samples is ≤ 20.0%.
[0325] Acceptance criteria for NC included an in screening and titration assay and an ECL of NC < plate-specific SCP, and an ECL of NC mean ≤ 142.2. These results are further outlined in Table 39. Table 39: Plate Control Acceptance Ranges System Suitability HPC LPC NC
[0326] NC < CCP (16.45%).
[0327] Acceptance criteria for LPC included an in screening and titration assay and an ECL of LPC ≥ plate-specific SCP and an LPC where the ECL mean ≥ 96.8 or ≤ 156.8.
[0328] Acceptance criteria for LPC also included an in confirmatory assay, and %inhibition of LPC ≥ CCP (16.45%).Docket No. 140505.8005.WO00
[0329] Acceptance criteria for HPC included an in screening and titration assay with an ECL of HPC > ECL of LPC, and HPC of 4695.6 ≤ ECL mean.
[0330] Acceptance criteria for HPC also included an in confirmatory assay with %inhibition of HPC ≥ CCP (16.45%).
[0331] Acceptance criteria for titer control included the titer control value equaling ±2 × overall mean titers from sensitivity runs (inclusive), and the titer of XTMAB-16 ADA PC at 4000ng / mL in pNHS is 25600-102400.
[0332] Assay Robustness: To determine assay robustness, the parameters of the assay were tested. The HPC, LPC, and NC were tested in both screening and confirmatory assay with different incubation times in two runs. The results of both runs met the method acceptance criteria, and the controls were within the established ranges, indicating that the assay demonstrated robustness. Examples of these results are shown in Tables 40 and 41. Table 40: Assessing Assay Robustness (Example A) Drug Unspiked Drug Spiked (MAB-16 at 200 µg / mL) Run Exampl Sampl Plat tio sDocket No. 140505.8005.WO00 124. 26. NC 114.0 1.2 Pass -8.77 Fail 0 2 sMin Incubation Time Max Incubation Time Incubation StepAdditional Embodiments
[0333] The present technology includes, but is not limited to, the following specific embodiments set forth herein below in paragraphs
[0334] -
[0410] :Docket No. 140505.8005.WO00
[0334] 1. A method for detecting an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) incubating the sample with a composition comprising: (a) a first affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label, and (b) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (ii) isolating ADAs that form a complex with both the first affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; and (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut- point.
[0335] 2. The method of embodiment 1, wherein isolating the ADAs comprises: (a) providing a solid phase comprising the second affinity label; (b) contacting the sample and the composition with the solid phase; and (c) washing the solid phase.
[0336] 3. The method of embodiment 1 or 2, wherein the target antibody, the affinity antibody, and / or the detection antibody comprise a chimeric human-murine monoclonal IgG1-kappa antibody.
[0337] 4. The method of any one of embodiments 1-3, wherein the target antibody, the affinity antibody, and / or the detection antibody comprise SEQ ID NOs: 1 and 4.
[0338] 5. The method of any one of embodiments 2-4, wherein the solid phase is a plate.
[0339] 6. The method of any one of embodiments 1-5, wherein the first affinity label is biotin.
[0340] 7. The method of any one of embodiments 1-6, wherein the second affinity label is streptavidin.Docket No. 140505.8005.WO00
[0341] 8. The method of any one of embodiments 1-7, wherein the detection antibody comprises a sulfo-Tag labeled anti-TNFα antibody.
[0342] 9. The method of any one of embodiments 2-8, wherein measuring the level of the detection label comprises: (1) contacting the solid phase with a marker configured to produce a chemiluminescent or electrochemiluminescent signal when the marker is proximal to the detection label; and (2) detecting the chemiluminescent or electrochemiluminescent signal.
[0343] 10. The method of embodiment 9, wherein the marker is tripropylamine (TPA), and measuring the level of the detection label further comprises applying an electrical current to the marker to produce the chemiluminescent or electrochemiluminescent signal.
[0344] 11. The method of any one of embodiments 2-10, wherein the solid phase is blocked with a blocking buffer before the sample and the composition are contacted with the solid phase.
[0345] 12. The method of any one of embodiments 1-11, further comprising performing steps (i) to (iii) on a control sample.
[0346] 13. The method of embodiment 12, wherein the control sample is incubated with the composition and contacted with the second affinity label.
[0347] 14. The method of any one of embodiments 1-13, wherein the predetermined cut- point corresponds to a level with a 5% false-positive rate.
[0348] 15. The method of embodiment 14, wherein the 5% false-positive rate is determined by measuring the detection label in a plurality of control samples and calculating the 5% false-positive rate.
[0349] 16. The method of embodiment 9, wherein the chemiluminescent or electrochemiluminescent signal is measured as electrochemiluminescence (ECL).
[0350] 17. The method of embodiment 16, wherein the predetermined cut-point is an ECL value of at least 1.Docket No. 140505.8005.WO00
[0351] 18. The method of embodiment 16 or 17, wherein the predetermined cut-point is an ECL value of about 1.10.
[0352] 19. The method of any one of embodiments 1-18, wherein the method has a sensitivity that is less than 6ng / mL.
[0353] 20. The method of embodiment 19, wherein the sensitivity is less than 4ng / mL.
[0354] 21. The method of any one of embodiments 1-20, wherein the method has a drug tolerance of about 100ng / mL.
[0355] 22. A method for detecting an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) contacting a sample with one or more anti-TNFα conjugates to form a complex between the ADA and the anti-TNFα conjugates; and (ii) measuring a level of anti-TNFα conjugates in the complex; wherein the method detects the ADA with a sensitivity less than 5ng / mL.
[0356] 23. The method of embodiment 22, wherein the one or more anti-TNFα conjugates comprise an affinity antibody comprising an anti-TNFα antibody conjugated to an affinity label.
[0357] 24. The method of embodiment 22 or 23, wherein the one or more anti-TNFα conjugates comprise a detection antibody comprising an anti-TNFα antibody conjugated to a detection label.
[0358] 25. The method of embodiment 23, wherein the affinity label comprises biotin.
[0359] 26. The method of embodiment 24, wherein the detection label comprises a sulfo- Tag.
[0360] 27. The method of any one of embodiments 22-26, wherein the method detects the ADA with a sensitivity less than 3ng / mL.
[0361] 28. The method of any one of embodiments 22-27, wherein the method detects the ADA with a sensitivity of 2.77ng / mL or less.
[0362] 29. A method for estimating a quantity of an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising:Docket No. 140505.8005.WO00 (i) incubating the sample with a composition comprising: (a) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label, and (b) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (ii) isolating ADAs that form a complex with both the affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut- point; (iv) performing steps (i)-(iii) on a known sample having a known concentration of ADA; and (v) comparing the level of the detection label in the sample to the level of the detection label in the known sample.
[0363] 30. The method of embodiment 29, wherein the known sample is serially diluted into a plurality of titer samples, wherein comparing the level of the detection label in the sample to the level of the detection label in the known sample comprises generating a curve of the levels of the detection label in each of the titer samples and comparing the detection label in the sample to the curve.
[0364] 31. A method of confirming that an anti-drug antibody (ADA) binds a target antibody comprising an anti-TNFα antibody in a sample by performing a competitive binding assay comprising performing the method of embodiment 1 on the sample, wherein the composition further comprises an unlabeled anti-TNFα antibody.
[0365] 32. The method of embodiment 31, wherein the ADA is confirmed in the sample by measuring a level of the detection label that is lower by a predetermined factor than the level of the detection label when the unlabeled anti-TNFα antibody is not present.
[0366] 33. A kit for detecting an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label;Docket No. 140505.8005.WO00 (ii) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; and (iii) a solid phase comprising a second affinity label, wherein the second affinity label binds to the first affinity label.
[0367] 34. The kit of embodiment 33, wherein the solid phase is a plate.
[0368] 35. The kit of embodiment 33 or 34, wherein the second affinity label is streptavidin.
[0369] 36. The kit of any one of embodiments 33-35, wherein the first affinity label is biotin.
[0370] 37. The kit of any one of embodiments 33-36, wherein the detection antibody comprises a sulfo-Tag labeled anti-TNFα antibody.
[0371] 38. The kit of any one of embodiments 33-37, further comprising a marker configured to produce a chemiluminescent or electrochemiluminescent signal where the marker is proximal to the detection label.
[0372] 39. The kit of embodiment 38, wherein the marker is tripropylamine (TPA).
[0373] 40. The kit of any one of embodiments 33-39, further comprising a blocking buffer.
[0374] 41. The kit of any one of embodiments 33-40, further comprising a wash buffer.
[0375] 42. A kit for estimating a quantity of an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label; (ii) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (iii) a solid phase comprising a second affinity label, wherein the second affinity label binds to the first affinity label; and (iv) a positive control.
[0376] 43. The kit of embodiment 42, wherein the positive control is a plurality of titer samples.Docket No. 140505.8005.WO00
[0377] 44. A kit for confirming that an anti-drug antibody (ADA) binds a target antibody comprising an anti-TNFα antibody comprising: (i) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label; (ii) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (iii) an unlabeled anti-TNFα antibody; and (iv) a solid phase comprising a second affinity label, wherein the second affinity label binds to the first affinity label.
[0378] 45. Use of a target antibody comprising an anti-TNFα antibody for detecting an ADA that binds the target antibody in a sample comprising: (i) incubating the sample with a composition comprising: (a) a first affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label, and (b) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (ii) isolating ADAs that form a complex with both the first affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; and (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut- point.
[0379] 46. The use of embodiment 45, wherein isolating the ADAs comprises: (a) providing a solid phase comprising the second affinity label; (b) contacting the sample and the composition with the solid phase; and (c) washing the solid phase.
[0380] 47. The use of embodiment 45 or 46, wherein the target antibody, the affinity antibody, and / or the detection antibody comprise a chimeric human-murine monoclonal IgG1-kappa antibody.Docket No. 140505.8005.WO00
[0381] 48. The use of any one of embodiments 45-47, wherein the target antibody, the affinity antibody, and / or the detection antibody comprise SEQ ID NOs: 1 and 4.
[0382] 49. The use of any one of embodiments 46-48, wherein the solid phase is a plate.
[0383] 50. The use of any one of embodiments 45-49, wherein the first affinity label is biotin.
[0384] 51. The use of any one of embodiments 45-50, wherein the second affinity label is streptavidin.
[0385] 52. The use of any one of embodiments 45-51, wherein the detection antibody comprises a sulfo-Tag labeled anti-TNFα antibody.
[0386] 53. The use of any one of embodiments 46-52, wherein measuring the level of the detection label comprises: (1) contacting the solid phase with a marker configured to produce a chemiluminescent or electrochemiluminescent signal when the marker is proximal to the detection label; and (2) detecting the chemiluminescent or electrochemiluminescent signal.
[0387] 54. The use of embodiment 53, wherein the marker is tripropylamine (TPA), and measuring the level of the detection label further comprises applying an electrical current to the marker to produce the chemiluminescent or electrochemiluminescent signal.
[0388] 55. The use of any one of embodiments 46-54, wherein the solid phase is blocked with a blocking buffer before the sample and the composition are contacted with the solid phase.
[0389] 56. The use of any one of embodiments 45-55, further comprising performing steps (i) to (iii) on a control sample.
[0390] 57. The use of embodiment 56, wherein the control sample is incubated with the composition and contacted with the second affinity label.
[0391] 58. The use of any one of embodiments 45-57, wherein the predetermined cut- point corresponds to a level with a 5% false-positive rate.Docket No. 140505.8005.WO00
[0392] 59. The use of embodiment 58, wherein the 5% false-positive rate is determined by measuring the detection label in a plurality of control samples and calculating the 5% false-positive rate.
[0393] 60. The use of embodiment 53, wherein the chemiluminescent or electrochemiluminescent signal is measured as electrochemiluminescence (ECL).
[0394] 61. The use of embodiment 60, wherein the predetermined cut-point is an ECL value of at least 1.
[0395] 62. The use of embodiment 60 or 61, wherein the predetermined cut-point is an ECL value of about 1.10.
[0396] 63. The use of any one of embodiments 45-62, wherein the method has a sensitivity that is less than 6ng / mL.
[0397] 64. The use of embodiment 63, wherein the sensitivity is less than 4ng / mL.
[0398] 65. The use of any one of embodiments 45-64, wherein the method has a drug tolerance of about 100ng / mL.
[0399] 66. Use of one or more anti-TNFα conjugates for detecting an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) contacting a sample with the one or more anti-TNFα conjugates to form a complex between the ADA and the anti-TNFα conjugates; and (ii) measuring a level of anti-TNFα conjugates in the complex; wherein the method detects the ADA with a sensitivity less than 5ng / mL.
[0400] 67. The use of embodiment 66, wherein the one or more anti-TNFα conjugates comprise an affinity antibody comprising an anti-TNFα antibody conjugated to an affinity label.
[0401] 68. The use of embodiment 66 or 67, wherein the one or more anti-TNFα conjugates comprise a detection antibody comprising an anti-TNFα antibody conjugated to a detection label.
[0402] 69. The use of embodiment 67, wherein the affinity label comprises biotin.
[0403] 70. The use of embodiment 68, wherein the detection label comprises a sulfo-Tag.Docket No. 140505.8005.WO00
[0404] 71. The use of any one of embodiments 66-70, wherein the method detects the ADA with a sensitivity less than 3ng / mL.
[0405] 72. The use of any one of embodiments 66-71, wherein the method detects the ADA with a sensitivity of 2.77ng / mL or less.
[0406] 73. Use of a target antibody comprising an anti-TNFα antibody for estimating a quantity of an anti-drug antibody (ADA) that binds the target antibody comprising the anti-TNFα antibody in a sample comprising: (i) incubating the sample with a composition comprising: (a) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label, and (b) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (ii) isolating ADAs that form a complex with both the affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut- point; (iv) performing steps (i)-(iii) on a known sample having a known concentration of ADA; and (v) comparing the level of the detection label in the sample to the level of the detection label in the known sample.
[0407] 74. The use of embodiment 73, wherein the known sample is serially diluted into a plurality of titer samples, wherein comparing the level of the detection label in the sample to the level of the detection label in the known sample comprises generating a curve of the levels of the detection label in each of the titer samples and comparing the detection label in the sample to the curve.
[0408] 75. Use of a target antibody comprising an anti-TNFα antibody for confirming that an anti-drug antibody (ADA) binds the target antibody comprising the anti-TNFα antibody in aDocket No. 140505.8005.WO00 sample by performing a competitive binding assay comprising performing the method of embodiment 1 on the sample, wherein the composition further comprises an unlabeled anti-TNFα antibody.
[0409] 76. The use of embodiment 75, wherein the ADA is confirmed in the sample by measuring a level of the detection label that is lower by a predetermined factor than the level of the detection label when the unlabeled anti-TNFα antibody is not present.
[0410] From the foregoing, it will be appreciated that specific embodiments of the present technology have been described herein for purposes of illustration, but that various modifications may be made without deviating from the scope of the present technology. Accordingly, the present technology is not limited except as by the appended claims.
Claims
Docket No. 140505.8005.WO00 CLAIMS What is claimed is:
1. A method for detecting an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) incubating the sample with a composition comprising: (a) a first affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label, and (b) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (ii) isolating ADAs that form a complex with both the first affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; and (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut-point.
2. The method of claim 1, wherein isolating the ADAs comprises: (a) providing a solid phase comprising the second affinity label; (b) contacting the sample and the composition with the solid phase; and (c) washing the solid phase.
3. The method of claim 1 or 2, wherein the target antibody, the affinity antibody, and / or the detection antibody comprise a chimeric human-murine monoclonal IgG1-kappa antibody.
4. The method of any one of claims 1-3, wherein the target antibody, the affinity antibody, and / or the detection antibody comprise SEQ ID NOs: 1 and 4.
5. The method of any one of claims 2-4, wherein the solid phase is a plate.
6. The method of any one of claims 1-5, wherein the first affinity label is biotin.Docket No. 140505.8005.WO00 7. The method of any one of claims 1-6, wherein the second affinity label is streptavidin.
8. The method of any one of claims 1-7, wherein the detection antibody comprises a sulfo-Tag labeled anti-TNFα antibody.
9. The method of any one of claims 2-8, wherein measuring the level of the detection label comprises: (1) contacting the solid phase with a marker configured to produce a chemiluminescent or electrochemiluminescent signal when the marker is proximal to the detection label; and (2) detecting the chemiluminescent or electrochemiluminescent signal.
10. The method of claim 9, wherein the marker is tripropylamine (TPA), and measuring the level of the detection label further comprises applying an electrical current to the marker to produce the chemiluminescent or electrochemiluminescent signal.
11. The method of any one of claims 2-10, wherein the solid phase is blocked with a blocking buffer before the sample and the composition are contacted with the solid phase.
12. The method of any one of claims 1-11, further comprising performing steps (i) to (iii) on a control sample.
13. The method of claim 12, wherein the control sample is incubated with the composition and contacted with the second affinity label.
14. The method of any one of claims 1-13, wherein the predetermined cut-point corresponds to a level with a 5% false-positive rate.
15. The method of claim 14, wherein the 5% false-positive rate is determined by measuring the detection label in a plurality of control samples and calculating the 5% false-positive rate.Docket No. 140505.8005.WO00 16. The method of claim 9, wherein the chemiluminescent or electrochemiluminescent signal is measured as electrochemiluminescence (ECL).
17. The method of claim 16, wherein the predetermined cut-point is an ECL value of at least 1.
18. The method of claim 16 or 17, wherein the predetermined cut-point is an ECL value of about 1.
10.
19. The method of any one of claims 1-18, wherein the method has a sensitivity that is less than 6ng / mL.
20. The method of claim 19, wherein the sensitivity is less than 4ng / mL.
21. The method of any one of claims 1-20, wherein the method has a drug tolerance of about 100ng / mL.
22. A method for detecting an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) contacting a sample with one or more anti-TNFα conjugates to form a complex between the ADA and the anti-TNFα conjugates; and (ii) measuring a level of anti-TNFα conjugates in the complex; wherein the method detects the ADA with a sensitivity less than 5ng / mL.
23. The method of claim 22, wherein the one or more anti-TNFα conjugates comprise an affinity antibody comprising an anti-TNFα antibody conjugated to an affinity label.
24. The method of claim 22 or 23, wherein the one or more anti-TNFα conjugates comprise a detection antibody comprising an anti-TNFα antibody conjugated to a detection label.Docket No. 140505.8005.WO00 25. The method of claim 23, wherein the affinity label comprises biotin.
26. The method of claim 24, wherein the detection label comprises a sulfo-Tag.
27. The method of any one of claims 22-26, wherein the method detects the ADA with a sensitivity less than 3ng / mL.
28. The method of any one of claims 22-27, wherein the method detects the ADA with a sensitivity of 2.77ng / mL or less.
29. A method for estimating a quantity of an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) incubating the sample with a composition comprising: (a) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label, and (b) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (ii) isolating ADAs that form a complex with both the affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut-point; (iv) performing steps (i)-(iii) on a known sample having a known concentration of ADA; and (v) comparing the level of the detection label in the sample to the level of the detection label in the known sample.
30. The method of claim 29, wherein the known sample is serially diluted into a plurality of titer samples, wherein comparing the level of the detection label in the sample to the level of the detection label in the known sample comprises generating a curve of the levels of the detection label in each of the titer samples and comparing the detection label in the sample to the curve.Docket No. 140505.8005.WO00 31. A method of confirming that an anti-drug antibody (ADA) binds a target antibody comprising an anti-TNFα antibody in a sample by performing a competitive binding assay comprising performing the method of claim 1 on the sample, wherein the composition further comprises an unlabeled anti-TNFα antibody.
32. The method of claim 31, wherein the ADA is confirmed in the sample by measuring a level of the detection label that is lower by a predetermined factor than the level of the detection label when the unlabeled anti-TNFα antibody is not present.
33. A kit for detecting an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label; (ii) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; and (iii) a solid phase comprising a second affinity label, wherein the second affinity label binds to the first affinity label.
34. The kit of claim 33, wherein the solid phase is a plate.
35. The kit of claim 33 or 34, wherein the second affinity label is streptavidin.
36. The kit of any one of claims 33-35, wherein the first affinity label is biotin.
37. The kit of any one of claims 33-36, wherein the detection antibody comprises a sulfo- Tag labeled anti-TNFα antibody.
38. The kit of any one of claims 33-37, further comprising a marker configured to produce a chemiluminescent or electrochemiluminescent signal where the marker is proximal to the detection label.Docket No. 140505.8005.WO00 39. The kit of claim 38, wherein the marker is tripropylamine (TPA).
40. The kit of any one of claims 33-39, further comprising a blocking buffer.
41. The kit of any one of claims 33-40, further comprising a wash buffer.
42. A kit for estimating a quantity of an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label; (ii) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (iii) a solid phase comprising a second affinity label, wherein the second affinity label binds to the first affinity label; and (iv) a positive control.
43. The kit of claim 42, wherein the positive control is a plurality of titer samples.
44. A kit for confirming that an anti-drug antibody (ADA) binds a target antibody comprising an anti-TNFα antibody comprising: (i) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label; (ii) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (iii) an unlabeled anti-TNFα antibody; and (iv) a solid phase comprising a second affinity label, wherein the second affinity label binds to the first affinity label.
45. Use of a target antibody comprising an anti-TNFα antibody for detecting an ADA that binds the target antibody in a sample comprising: (i) incubating the sample with a composition comprising:Docket No. 140505.8005.WO00 (a) a first affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label, and (b) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (ii) isolating ADAs that form a complex with both the first affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; and (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut-point.
46. The use of claim 45, wherein isolating the ADAs comprises: (a) providing a solid phase comprising the second affinity label; (b) contacting the sample and the composition with the solid phase; and (c) washing the solid phase.
47. The use of claim 45 or 46, wherein the target antibody, the affinity antibody, and / or the detection antibody comprise a chimeric human-murine monoclonal IgG1-kappa antibody.
48. The use of any one of claims 45-47, wherein the target antibody, the affinity antibody, and / or the detection antibody comprise SEQ ID NOs: 1 and 4.
49. The use of any one of claims 46-48, wherein the solid phase is a plate.
50. The use of any one of claims 45-49, wherein the first affinity label is biotin.
51. The use of any one of claims 45-50, wherein the second affinity label is streptavidin.
52. The use of any one of claims 45-51, wherein the detection antibody comprises a sulfo- Tag labeled anti-TNFα antibody.
53. The use of any one of claims 46-52, wherein measuring the level of the detection labelDocket No. 140505.8005.WO00 comprises: (1) contacting the solid phase with a marker configured to produce a chemiluminescent or electrochemiluminescent signal when the marker is proximal to the detection label; and (2) detecting the chemiluminescent or electrochemiluminescent signal.
54. The use of claim 53, wherein the marker is tripropylamine (TPA), and measuring the level of the detection label further comprises applying an electrical current to the marker to produce the chemiluminescent or electrochemiluminescent signal.
55. The use of any one of claims 46-54, wherein the solid phase is blocked with a blocking buffer before the sample and the composition are contacted with the solid phase.
56. The use of any one of claims 45-55, further comprising performing steps (i) to (iii) on a control sample.
57. The use of claim 56, wherein the control sample is incubated with the composition and contacted with the second affinity label.
58. The use of any one of claims 45-57, wherein the predetermined cut-point corresponds to a level with a 5% false-positive rate.
59. The use of claim 58, wherein the 5% false-positive rate is determined by measuring the detection label in a plurality of control samples and calculating the 5% false-positive rate.
60. The use of claim 53, wherein the chemiluminescent or electrochemiluminescent signal is measured as electrochemiluminescence (ECL).
61. The use of claim 60, wherein the predetermined cut-point is an ECL value of at least 1.
62. The use of claim 60 or 61, wherein the predetermined cut-point is an ECL value ofDocket No. 140505.8005.WO00 about 1.
10.
63. The use of any one of claims 45-62, wherein the method has a sensitivity that is less than 6ng / mL.
64. The use of claim 63, wherein the sensitivity is less than 4ng / mL.
65. The use of any one of claims 45-64, wherein the method has a drug tolerance of about 100ng / mL.
66. Use of one or more anti-TNFα conjugates for detecting an anti-drug antibody (ADA) that binds a target antibody comprising an anti-TNFα antibody in a sample comprising: (i) contacting a sample with the one or more anti-TNFα conjugates to form a complex between the ADA and the anti-TNFα conjugates; and (ii) measuring a level of anti-TNFα conjugates in the complex; wherein the method detects the ADA with a sensitivity less than 5ng / mL.
67. The use of claim 66, wherein the one or more anti-TNFα conjugates comprise an affinity antibody comprising an anti-TNFα antibody conjugated to an affinity label.
68. The use of claim 66 or 67, wherein the one or more anti-TNFα conjugates comprise a detection antibody comprising an anti-TNFα antibody conjugated to a detection label.
69. The use of claim 67, wherein the affinity label comprises biotin.
70. The use of claim 68, wherein the detection label comprises a sulfo-Tag.
71. The use of any one of claims 66-70, wherein the method detects the ADA with a sensitivity less than 3ng / mL.
72. The use of any one of claims 66-71, wherein the method detects the ADA with aDocket No. 140505.8005.WO00 sensitivity of 2.77ng / mL or less.
73. Use of a target antibody comprising an anti-TNFα antibody for estimating a quantity of an anti-drug antibody (ADA) that binds the target antibody comprising the anti-TNFα antibody in a sample comprising: (i) incubating the sample with a composition comprising: (a) an affinity antibody comprising an anti-TNFα antibody conjugated to a first affinity label, and (b) a detection antibody comprising an anti-TNFα antibody conjugated to a detection label; (ii) isolating ADAs that form a complex with both the affinity antibody and the detection antibody, wherein the ADA is isolated by contacting the complex with a second affinity label that binds to the first affinity label; (iii) detecting the ADA by measuring a level of the detection label above a predetermined cut-point; (iv) performing steps (i)-(iii) on a known sample having a known concentration of ADA; and (v) comparing the level of the detection label in the sample to the level of the detection label in the known sample.
74. The use of claim 73, wherein the known sample is serially diluted into a plurality of titer samples, wherein comparing the level of the detection label in the sample to the level of the detection label in the known sample comprises generating a curve of the levels of the detection label in each of the titer samples and comparing the detection label in the sample to the curve.
75. Use of a target antibody comprising an anti-TNFα antibody for confirming that an anti- drug antibody (ADA) binds the target antibody comprising the anti-TNFα antibody in a sample by performing a competitive binding assay comprising performing the method of claim 1 on the sample, wherein the composition further comprises an unlabeled anti-TNFα antibody.Docket No. 140505.8005.WO00 76. The use of claim 75, wherein the ADA is confirmed in the sample by measuring a level of the detection label that is lower by a predetermined factor than the level of the detection label when the unlabeled anti-TNFα antibody is not present.