Set of primers, composition of the reaction mixture and method for detecting selected orthomyxoviruses

Abstract

The first subject of the invention is a set of primers for amplifying the nucleotide sequence of the segment number 7 of influenza A virus. The second subject of the invention is a set of primers for amplifying the nucleotide sequence of the segment number 8 of influenza B virus. The third subject of the invention is a method for detecting influenza A virus and / or influenza B virus. Another subject of the invention is a method for detecting an infection caused by influenza A virus and / or influenza B virus. The fifth subject of the invention is a kit for detecting an infection caused by influenza A virus and / or influenza B virus.

Description

[0001] Set of primers, composition of the reaction mixture and method for detecting selected Orthomyxoviruses

[0002] The invention relates to a set of primers for detecting selected orthomyxoviruses using the set of primers and the use of the set of primers for detecting selected orthomyxoviruses. The invention is applicable in medical diagnostics.

[0003] Influenza viruses are the best-known viruses of the Orthomyxovirus family (Orthomyxoviridae). Orthomyxoviruses belong to group V viruses according to the Baltimore classification, and their genetic material is single-stranded, segmented RNA with negative polarity (-)ssRNA. It is a family of viruses infecting mainly vertebrates. There are 7 types of viruses belonging to the orthomyxovirus family: influenza A virus, influenza B virus, influenza C virus, influenza D virus, Isavirus, Thogoto virus and Quaranjavirus. Influenza viruses types A, B and C causing acute respiratory infection in vertebrates, including humans, are the most pathogenic. Influenza A viruses (mainly subtypes H1N1, H2N2, H3N2), which infect not only human cells, but also the cells of other mammals and birds, are mainly responsible for influenza pandemics occurring around the world every dozen or so years. These viruses are characterised by extremely high genetic variability. Influenza B viruses primarily infect human cells and are responsible for seasonal illnesses and large epidemics that recur on average every 3-5 years.

[0004] Influenza virus infection occurs mainly via the droplet route. The main symptoms of infection are fever, chills, headache and muscle pain. The onset of the illness is sudden, and the symptoms worsen quickly. Influenza is also accompanied by a feeling of weakness, disorientation and malaise. On the respiratory side, the main symptoms are sore throat, rhinitis and a dry cough. Sometimes, especially in children, nausea, vomiting and diarrhoea can occur. The course of influenza virus infection can be mild, severe or even fatal. According to the WHO (World Health Organisation), approximately 5-10% of adults and 20-30% of children fall ill with influenza every year. Cases of hospitalisation and death increase in chronically ill, elderly or very young people. Therapies and prevention of influenza virus infections using vaccination (especially with influenza A viruses) are hampered by the high genetic variability of these viruses. In view of the life-threatening nature of an influenza virus infection, it is important that diagnosis is performed quickly and that diagnostic methods are characterised by high sensitivity and specificity.

[0005] One of the diagnostic methods used to detect the influenza virus is the isolation of the pathogen, but this method is rarely used due to the long waiting time for the result. Routine diagnosis of infection is based on confirmation of the presence of antigen or genetic material of the virus in the biological specimen collected from the patient or by serological confirmation of virus infection by detecting a rise in the level of antibodies in the patient's serum. The presence of influenza virus antigens or genetic material in clinical samples can be confirmed by collecting material by nasopharyngeal swab, nasopharyngeal washings, middle ear exudate, nasopharyngeal aspirate or bronchial tree washings. The most commonly used methods for virus antigen detection are based on immunofluorescence (IF) or enzyme-linked immunosorbent assay (ELISA) tests. The methods characterized by the greatest specificity and sensitivity are those involving the detection of RSV nucleic acid in biological material, so-called NAAT methods (Nucleic Acid Amplification Tests). The most commonly used tests in NAAT technology are assays based on Real-Time RT-PCR method. A wide variety of tests using the Real-Time PCR technique are available on the market, but despite the fierce competition, these methods are still relatively expensive. Moreover, they require highly specialized personnel, expensive devices and the isolation of genetic material from the patient's sample. Furthermore, since cyclic heating and cooling of the reaction mixture is necessary, this method is time-consuming, and the equipment used consumes relatively large amounts of energy to perform the diagnostic process.

[0006] Isothermal methods, including the LAMP (Loop-mediated isothermal amplification) method, are methods that allow to accelerate the diagnostic process and reduce the cost of energy and reagents needed to perform the analysis. According to the literature data, these methods are characterized by higher sensitivity and specificity than the aforementioned Real-Time PCR technique, they are also much faster. Their isothermal course does not require specialized equipment.

[0007] Due to the low equipment requirements, isothermal methods are an ideal diagnostic solution both for primary care units (point-of-care testing - POCT), where the test can be performed in the practice of a general practitioner of specialist doctor during the patient's office visit. Such a solution enables a rapid diagnostic test (in less than 15 minutes), allowing targeted therapy to be selected at the first visit. This is particularly important in the case of influenza virus infections, due to the rapid progression of the infection, which can lead to an immediately life-threatening condition in a short time. Delayed diagnosis of influenza virus infection increases the patient's risk of death, as well as the risk of developing serious complications. On the other hand, the use of freeze-dried reagents allows the tests to be stored at room temperature, without the need to freeze the diagnostic tests.

[0008] The LAMP method is disclosed, for example, in patent specifications W00028082 and W00224902. Most of the patent applications published to date that describe the use of primers in the RT-LAMP method for the diagnosis of influenza viruses relate to the identification of a single type or subtype of the virus, few include diagnosis of both type A and B virus, examples of applications that include diagnosis of both types are: KR20220040073A, US10907222B2, CN113136454A or CN112195275A. The detection method in the mentioned patent applications (US10907222B2, CN113136454A) does not allow quantitative measurement and it is an end-point detection, with the use of agarose gel or markers based on the colour change of the reaction mixture upon a positive amplification reaction. Furthermore, the mentioned patent descriptions (KR20220040073A, CN113136454A) do not contain information on the sensitivity of the presented method. In patent description CN112195275A, the sensitivity of the method was determined without taking into account the reverse transcription step, which is the basis of RNA detection of viruses, moreover, the detection of type A and B viruses takes place in two separate amplification reactions. None of the mentioned patent descriptions covers the lyophilisation process.

[0009] Therefore, there is still a need to provide a diagnostic method using appropriately refined sets of primers used for the diagnosis of influenza virus infection with the LAMP method, intended for use in point-of-care testing, which would have very high sensitivity. The use of fluorescent markers allowed a significantly lower detection limit of 10 copies per reaction. Moreover, the fluorescent dyes allow for Real-Time detection of the reaction product, which significantly reduces the reaction time (< 21 min) and enables quantitative measurement of the pathogen. The first subject of the invention is a set of primers for amplifying the nucleotide sequence of segment number 7 of influenza A virus, characterized in that it comprises a set of internal primers with the following nucleotide sequences a) and b), as well as a set of external primers containing the following nucleotide sequences c) and d) specific for a selected fragment of the segment number 7 of influenza A virus: a) Flc 5' CTCAAGATCTGTGTTTTTCCCAGCA 3'- nucleotide sequence SEQ ID NO: 3, linked at the 3' end, preferably by a TTTT bridge, to the sequence F2 5' CCCCCTCAAAGCCGAGA 3'- nucleotide sequence SEQ ID NO: 4 b) Bic 5' TCATGGAATGGCTAAAGACAAGAC 3'- nucleotide sequence SEQ ID NO: 5, linked at the 3' end, preferably by a TTTT bridge, to the sequence B2 5' GTGAGCGTGAACACAAACC 3'- nucleotide sequence SEQ ID NO: 6 c) F3 5' CTCTCTATCGTTCCATCAGG 3' - nucleotide sequence SEQ ID NO: 1 and d) B3 5' TACGCTGCAGTCCTCG 3' - nucleotide sequence SEQ ID NO: 2.

[0010] In a preferred embodiment of the invention, the set of primers comprises a set of loop primer sequences comprising nucleotide sequences contained in or complementary to the segment number 7 of influenza A virus SEQ ID NO: 7 - LF 5' GACATCTTCAAGTCTCTGCGC 3' and SEQ ID NO: 8 - LB 5' ATTCTGTCACCTCTGACTAAGGGGA 3'.

[0011] The second subject of the invention is a set of primers for amplifying the nucleotide sequence of the segment number 8 of influenza B virus, characterized in that it comprises a set of internal primers with the following nucleotide sequences a) and b), as well as a set of external primers containing the following nucleotide sequences c) and d) specific to a selected fragment of the segment number 8 of influenza B virus: a) Flc 5' CGAAGAGTGAGTTGAGGATCCG 3'- nucleotide sequence SEQ ID NO: 11 linked at the 3' end, preferably by a TTTT bridge, to the sequence F2 5' GCTACTGATGATCKKACAG 3' nucleotide sequence SEQ ID NO: 12 b) Bic 5' AAGCCAATTCGAGCAGCTGA 3'- nucleotide sequence SEQ ID NO: 13 linked at the 3' end, preferably by a TTTT bridge, to the sequence B2 5' ATCGGTGCTCTTGACCAA 3'- nucleotide sequence SEQ ID NO: 14 c) F3 5' GRCTTGTTGCTAAACTTGTT 3' - nucleotide sequence SEQ ID NO: 9 and d) B3 5' TTGTCTCCCTCTTCTGGT 3' - nucleotide sequence SEQ ID NO: 10.

[0012] In a preferred embodiment of the invention, the set of primers comprises a set of loop primer sequences comprising nucleotide sequences contained in or complementary to the segment number 8 of influenza B virus SEQ ID NO: 15 - LF 5' GGCCATCTTYTTCATCCTCCA 3' and SEQ ID

[0013] NO: 16: LB 5' GCGGTGGGAGTCTTATCCC 3'. The third subject of the invention is a method for detecting influenza A and influenza B viruses, characterised in that selected regions of the nucleotide sequence of the influenza A virus genome (segment fragment number 7) and the influenza B virus genome (segment number 8) are amplified using a mixture of primer sets as defined in the first and second subjects of the invention, the amplification method being the RT-LAMP method.

[0014] In a preferred embodiment, the amplification is carried out with a temperature profile: 64°C, 40 min.

[0015] In a further preferred embodiment of the invention, the end-point reaction is carried out with an additional temperature profile of 80°C, 5 min carried out after the amplification step.

[0016] The fourth subject of the invention is a method for detecting an infection caused by influenza A virus and / or influenza B virus characterised in that it comprises the detection method defined in the third subject of the invention.

[0017] The fifth subject of the invention is a kit for detecting an infection caused by influenza A virus and / or influenza B virus characterised in that it comprises the set of primers as defined in the first and second subjects of the invention.

[0018] In a preferred embodiment of the invention, the infection detection kit comprises 5.0 pL of Universal WarmStart® LAMP 2X Master Mix (New England Biolabs).

[0019] In a further preferred embodiment of the invention, the kit comprises individual amplification primers as defined in the first and second subjects of the invention, the primers having the following concentrations for influenza A virus: 0.15 pM F3, 0.15 pM B3, 1.20 pM FIP A, 1.20 pM BIP, 0.30 pM LF, 0.30 pM LB and for influenza B virus: 0.15 pM F3, 0.15 pM B3, 1.20 pM FIP, 1.20 pM BIP, 0.30 pM LF; 0.30 pM LB; D-(+)-Trehalose dihydrate - 6%; mannitol - 1.25%; fluorescent marker interacting with double-stranded DNA - EvaGreen <1X (Biotium) or Fluorescent Dye (New England Biolabs) in the amount of <1 pL or Syto-13 <16 pM (ThermoFisher Scientific) or SYTO-82 <16 pM (ThermoFisher Scientific) or another fluorescent dye interacting with double-stranded DNA at a concentration that does not inhibit the amplification reaction.

[0020] The advantage of the primer sets of the invention for detecting influenza A virus and influenza B virus, as well as the method for detecting an infection caused by influenza A virus and / or influenza B virus and the method for detecting the amplification products, is the possibility of using them in medical diagnostics at the point of care (POCT) in the target application with a portable genetic analyser. Freeze-drying of the reaction mixtures of the invention allows the diagnostic kits to be stored at room temperature without reducing the diagnostic parameters of the tests. In turn, the use of a fluorescent dye to detect the amplification product increases the sensitivity of the method, allows for detecting 10 copies of influenza A virus per reaction and 10 copies of influenza B virus per reaction, as well as it allows for measuring the viral load in the test sample.

[0021] Exemplary embodiments of the invention are presented in the drawing, in which:

[0022] Fig. 1 shows the sensitivity characteristics of the method, where a specific signal was obtained with the template: Quantitative Genomic RNA from Influenza virus (H1N1), strain A / PR / 8 / 34, ATCC number: VR-95DQ™ at 10, 20, 50 copies / pL, but there was no product in NTC. Fig. 2 shows the sensitivity characteristics of the method, where a specific signal was obtained with the template: Quantitative Genomic RNA from Influenza A virus (H3N2), strain A / Wisconsin / 15 / 2009, ATCC number: VR-1882DQ™ at 10, 20, 50 copies / pL, but there was no product in NTC. Fig. 3 shows the sensitivity characteristics of the method, where a specific signal was obtained with the template: Quantitative Genomic RNA from Influenza B virus, strain B / Wisconsin / 1 / 2010 BX-41A, ATCC number: VR-1885DQ™ at 10, 20, 50 copies / pL, but there was no product in NTC;

[0023] Fig. 1: lane 1: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lane 2: 10 copies of the template; lane 3: 20 copies of the template; lane 4: 50 copies of the template; lane 5: NTC.

[0024] Fig. 2: lane 1: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lane 2: 10 copies of the template; lane 3: 20 copies of the template; lane 4: 50 copies of the template; lane 5: NTC.

[0025] Fig. 3: lane 1: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lane 2: 10 copies of the template; lane 3: 20 copies of the template; lane 4: 50 copies of the template; lane 5: NTC.

[0026] Fig. 4 shows the sensitivity of the method of the invention as measured by assaying a serial dilution of the influenza A virus subtype H1N1 standard: Quantitative Genomic RNA from Influenza virus (H1N1), strain A / PR / 8 / 34, ATCC number: VR-95DQ™ in the range of 10-50 copies per reaction, where the product amplification was measured in real time. The results of the real-time detection are presented in Table 1, indicating the minimum time required to detect the fluorescence signal.

[0027] Fig. 5 shows the sensitivity of the method of the invention as measured by assaying a serial dilution of the influenza A virus subtype H3N2 standard: Quantitative Genomic RNA from Influenza A virus (H3N2), strain A / Wisconsin / 15 / 2009, ATCC number: VR-1882DQ™ in the range of 10-50 copies per reaction, where the product amplification was measured in real time. The results of the real-time detection are presented in Table 2, indicating the minimum time required to detect the fluorescence signal.

[0028] Fig. 6 shows the sensitivity of the method of the invention as measured by assaying a serial dilution of the influenza B virus standard: Quantitative Genomic RNA from Influenza B virus, strain B / Wisconsin / 1 / 2010 BX-41A, ATCC number: VR-1885DQ™ in the range of 10-50 copies per reaction, where the product amplification was measured in real time. The results of the real-time detection are presented in Table 3, indicating the minimum time required to detect the fluorescence signal.

[0029] Fig. 7 shows the specificity of the product obtained after influenza A virus subtype H1N1 detection as measured by the dissociation curve of the amplification product using the Quantitative Genomic RNA from Influenza virus (H1N1), strain A / PR / 8 / 34, ATCC number: VR-95DQ™ standard over the range 10-50 copies per reaction by real-time fluorescence measurement, with a target dissociation temperature (Tm) in the range 83.5-84.5°C for the specific reaction product for influenza A virus subtype H1N1.

[0030] Fig. 8 shows the specificity of the product obtained after influenza A virus subtype H3N2 detection as measured by the dissociation curve of the amplification product using the Quantitative Genomic RNA from Influenza A virus (H3N2), strain A / Wisconsin / 15 / 2009, ATCC number: VR-1882DQ™ standard over the range 10-50 copies per reaction by realtime fluorescence measurement, with a target dissociation temperature (Tm) of 85-86°C for the specific reaction product for influenza A virus subtype H3N2.

[0031] Fig. 9 shows the specificity of the product obtained after influenza B virus detection as measured by the dissociation curve of the amplification product using the Quantitative Genomic RNA from Influenza B virus, strain B / Wisconsin / 1 / 2010 BX-41A, ATCC number: VR-1885DQ™ standard over the range 10-50 copies per reaction by real-time fluorescence measurement, with a target dissociation temperature (Tm) of 84-85°C for the specific reaction product for influenza B virus.

[0032] Figs. 10, 11 and partly 12 illustrate the specificity of the method of the invention with standard templates for a number of pathogens potentially present in the tested biological material as natural physiological flora, those which may result from co-infections or those which share similar genomic sequences. Fig. 12 illustrates the specificity of the primers against different strains of influenza A and B virus.

[0033] Fig 10: lane 1: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lanes 2 and 3: Mycoplasma genitalium; lanes 4 and 5: Klebsiella pneumoniae; lanes 6 and 7: Bordetella pertussis; lanes 8 and 9: Streptococcus pyogenes; lanes 10 and 11: Staphylococcus aureus (MRSA); lanes 12 and 13: Enterococcus faecalis; lanes 14 and 15: Enterococcus faecium; lanes 16 and 17: Pseudomonas aeruginosa; lanes 18 and 19: Moraxella catarrhalis; lanes 20 and 21: Acinetobacter baumannii; lanes 22 and 23: Listeria monocytogenes; lanes 24 and 25: Legionella pneumophila; lanes 26 and 27: Mycoplasma hominis; lanes 28 and 30: Haemophilus ducreyi; lane 29: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lanes 31 and 32: Escherichia coli; lanes 33 and 34: Ureaplasma urealyticum; lanes 35 and 36: Campylobacter jejuni; lanes 37 and 38: HPV 18, lanes 39 and 40: Candida albicans; lanes 41 and 42: Mycoplasma pneumoniae; lanes 43 and 44: Influenza A virus (H3N2), strain A / Wisconsin / 15 / 2009; lanes 45 and 46: Influenza B virus, strain B / Wisconsin / 1 / 2010 BX-41A; lanes 47 and 48: NTC;

[0034] Fig. 11: lane 1: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lanes 2 and 3: Chlamydophila pneumoniae; lanes 4 and 5: Haemophilus influenza; lanes 6 and 7: Streptococcus pneumoniae; lanes 8 and 9: Homo sapiens; lanes 10 and 11: SARS- CoV-2 Frankfurt 1; lanes 12 and 13: SARS-CoV-2 Isolate Ita ly-l N M 11; lanes 14 and 15: Human Coronavirus, OC43; lanes 16 and 17: SARS-CoV-2 Isolate Germany / BavPatl / 2020; lanes 18 and 19: SARS-CoV-2 from NR 52726 Human Coronavirus 229E; lanes 20 and 21: SARS-CoV- 2 Isolate USA-CA1 / 2020; lanes 22 and 23: SARS-CoV-2 Isolate New York-PV08410 / 2020; lanes 24 and 25: SARS-CoV-2 Isolate USA-IL1 / 2020; lanes 26 and 27: SARS-CoV-2 Isolate Chi Ie / Santiago_op4d 1 / 2020; lanes 28 and 29: Amplirun Respiratory Syncytial Virus (subtype A); lanes 30 and 32: Amplirun Respiratory Syncytial Virus (subtype B); lane 31: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lanes 33 and 34: MERS Coronavirus England-1 Stain; lanes 35 and 36: SARS-CoV-2 B. 1 .1.7; lanes 37 and 38: Staphylococcus aureus (MSSA); lanes 39 and 40: HPV 16, lanes 41 and 42: Influenza virus (H1N1), strain A / PR / 8 / 34; lanes 43 and 44: Influenza A virus (H3N2), strain A / Wisconsin / 15 / 2009; lanes 45 and 46: Influenza B virus, strain B / Wisconsin / 1 / 2010 BX- 41A; lanes 47 and 48: NTC;

[0035] Fig. 12: lane 1: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lanes 2 and 3: Influenza B Virus B / Texas / 06 / 2011(BY); lanes 4 and 5: Influenza B Virus B / Nevada / 03 / 2011(BV); lanes 6 and 7: Influenza A Virus A / California / 07 / 2009(H1N1) Egg grown; lanes 8 and 9: Influenza A Virus A / Brisbane / 59 / 2007 (HA, NA) x A / PR / 8 / 34 (H1N1); lanes 10 and 11: Influenza B Virus B / Nevada / 03 / 2011; lanes 12 and 13: Influenza A Virus A / Uruguay / 716 / 2007 (H3N2); lanes 14 and 15: Influenza B Virus B / Qhio / 01 / 2005 (BV); lanes 16 and 17: Influenza A Virus A / Mississippi / 1 / 85 (HA, NA) x A / PR / 8 / 34; lanes 18 and 19: Influenza A Virus A / Wisconsin / 67 / 2005 x A / PR / 8 / 34; lanes 20 and 21: Influenza A Virus A / Guizhou / 54 / 89 (HA, NA) x A / PR8 / 34 (H3N2); lanes 22 and 23: Influenza A Virus A / Victoria / 3 / 75(HA,NA) x A / PR / 8 / 34; lanes 24 and 25: Influenza A Virus A / California / 07 / 2009 (H1N1); lanes 26 and 27: Influenza B Virus B / Texas / 06 / 2011; Lines 28 AND 29: Influenza B Virus B / Malaysia / 2506 / 2004; lanes 30 and 32: Influenza B Virus B / Hong Kong / 330 / 2001(BV), lane 31: mass marker (Quick-Load® Purple 100 bp DNA Ladder, NewEngland Biolabs); lanes 33 and 34: SARS-CoV-2 Isolate USA-WI / 202; lanes 35 and 36: 1stWHO International Standard for SARS-CoV-2; lanes 37 and 38: Zika Virus; lanes 39 and 40: Influenza virus (H1N1), strain A / PR / 8 / 34; lanes 41 and 42: Influenza A virus (H3N2), strain A / Wisconsin / 15 / 2009; lanes 43 and 44: Influenza B virus, strain B / Wisconsin / 1 / 2010 BX-41A; lanes 45 and 46: NTC.

[0036] Fig. 13 illustrates the efficiency of the method of the invention measured by assaying reactions using the oligonucleotides defined in the first and second subjects of the invention with selective omission of the LF oligonucleotides of influenza A virus and influenza B virus and using the influenza A virus subtype H1N1 standard - Quantitative Genomic RNA from Influenza virus (H1N1), strain A / PR / 8 / 34, ATCC number: VR-95DQ™ at 1000 copies per reaction and reactions using the influenza B virus standard - Quantitative Genomic RNA from Influenza B virus, strain B / Wisconsin / 1 / 2010 BX-41A, ATCC number: VR-1885DQ™ at 1000 copies per reaction, where the product amplification was measured in real time.

[0037] Fig. 14 illustrates the efficiency of the method of the invention measured by assaying reaction using the oligonucleotides defined in the first and second subjects of the invention with selective omission of the LB oligonucleotides of influenza A virus and influenza B virus and using the influenza A virus subtype H1N1 standard - Quantitative Genomic RNA from Influenza virus (H1N1), strain A / PR / 8 / 34, ATCC number: VR-95DQ™ at 1000 copies per reaction and reactions using the influenza B virus standard - Quantitative Genomic RNA from Influenza B virus, strain B / Wisconsin / 1 / 2010 BX-41A, ATCC number: VR-1885DQ™ at 1000 copies per reaction, where the product amplification was measured in real time.

[0038] Example 1. Primer sequences

[0039] The sequences of the specific oligonucleotides used for detecting genetic material of influenza A and B virus using RT-LAMP technology are presented and characterised below.

[0040] 1. The influenza A virus F3 oligonucleotide sequence: 5' CTCTCTATCGTTCCATCAGG 3' is a sequence identical to the fragment of segment number 7 of influenza A virus (5'-3' strand).

[0041] 2. The influenza A virus B3 oligonucleotide sequence: 5' TACGCTGCAGTCCTCG 3' is a complementary fragment of the segment number 7 of influenza A virus (5'-3' strand) 160 nucleotides away from the 3' end of the oligonucleotide 1.

[0042] 3. The influenza A virus F2 oligonucleotide sequence: 5' CCCCCTCAAAGCCGAGA 3' is a sequence identical to the fragment of segment number 7 of influenza A virus (strand 5'-3') immediately adjacent to the 3' end of the oligonucleotide 1.

[0043] 4. The influenza A virus B2 oligonucleotide sequence: 5' GTGAGCGTGAACACAAACC 3' is a complementary fragment of the segment number 7 of influenza A virus (strand 5'-3') 128 nucleotides away from the 3' end of the oligonucleotide 1. 5. The influenza A virus Flc oligonucleotide sequence: 5' CTCAAGATCTGTGTTTTTCCCAGCA 3' is a complementary fragment of the segment number 7 of influenza A virus (5'-3' strand) 42 nucleotides away from the 3' end of the oligonucleotide 1.

[0044] 6. The influenza A virus Bic oligonucleotide sequence: 5' TCATGGAATGGCTAAAGACAAGAC 3' is a sequence identical to the fragment of segment number 7 of influenza A virus (5'-3' strand) 71 nucleotides away from the 3' end of the oligonucleotide 1.

[0045] The sequences of the Flc and F2 oligonucleotides have preferably been linked by a TTTT bridge and used as FIP. The sequences of the Bic and B2 oligonucleotides have preferably been linked by a TTTT bridge and used as BIP.

[0046] 7. The influenza A virus LF oligonucleotide sequence: 5' GACATCTTCAAGTCTCTGCGC 3'.

[0047] 8. The influenza A virus LB oligonucleotide sequence: 5' ATTCTGTCACCTCTGACTAAGGGGA 3'.

[0048] 9. The influenza B virus F3 oligonucleotide sequence: 5' GRCTTGTTGCTAAACTTGTT 3' is a sequence similar to the fragment of segment number 8 of influenza B virus (5'-3' strand).

[0049] 10. The influenza B virus B3 oligonucleotide sequence: 5' TTGTCTCCCTCTTCTGGT 3' is a complementary fragment of the segment number 8 of influenza B virus (5'-3' strand) 155 nucleotides away from the 3' end of the oligonucleotide 9.

[0050] 11. The influenza B virus F2 oligonucleotide sequence: 5' GCTACTGATGATCKKACAG 3' is a sequence similar to the fragment of segment number 8 of influenza B virus (5'-3' strand) immediately adjacent to the 3' end of the oligonucleotide 9.

[0051] 12. The influenza B virus B2 oligonucleotide sequence: 5' ATCGGTGCTCTTGACCAA 3' is a complementary fragment of the segment number 8 of influenza B virus (5'-3' strand) 133 nucleotides away from the 3' end of the oligonucleotide 9.

[0052] 13. The influenza B virus Flc oligonucleotide sequence: 5' CGAAGAGTGAGTTGAGGATCCG 3' is a complementary fragment of the segment number 8 of influenza B virus (5'-3' strand) 42 nucleotides away from the 3' end of the oligonucleotide 9. 14. The influenza B virus Bic oligonucleotide sequence: 5' AAGCCAATTCGAGCAGCTGA 3' is a sequence identical to the fragment of segment number 8 of influenza B virus (5'-3' strand) 87 nucleotides away from the 3' end of the oligonucleotide 9.

[0053] The sequences of the Flc and F2 oligonucleotides have preferably been linked by a TTTT bridge and used as FIP. The sequences of the Bic and B2 oligonucleotides have preferably been linked by a TTTT bridge and used as BIP.

[0054] 15. The influenza B virus LF oligonucleotide sequence: 5' GGCCATCTTYTTCATCCTCCA 3'.

[0055] 16. The influenza B virus LB oligonucleotide sequence: 5' GCGGTGGGAGTCTTATCCC 3'.

[0056] Example 2. Composition of the reaction mixture

[0057] The method of amplifying the segment number 7 of influenza A virus and the segment number 8 of influenza B virus using the oligonucleotides characterized in Example 1 with RT-LAMP technology and the following composition of the reaction mixture:

[0058] 5.0 pL Universal WarmStart® LAMP 2X Master Mix (New England Biolabs)

[0059] 0.15 pM F3 influenza A virus / 0.15 pM F3 influenza B virus

[0060] 0.15 pM B3 influenza A virus / 0.15 pM B3 influenza B virus

[0061] 1.20 pM FIP influenza A virus / 1.20 pM FIP influenza B virus

[0062] 1.20 pM BIP influenza A virus / 1.20 pM BIP influenza B virus

[0063] 0.30 pM LF influenza A virus / 0.30 pM LF influenza B virus

[0064] 0.30 pM LB influenza A virus / 0.30 pM LB influenza B virus

[0065] D-(+)-Trehalose dihydrate - 6%

[0066] Mannitol - 1.25%

[0067] Fluorescent marker - EvaGreen (Biotium) <1X or Fluorescent dye 50X (New England Biolabs) in the amount of <1 pL or GreenFluorescent Dye (Lucigen) in the amount of <1 pL or Syto-13 <16 pM or SYTO-82 <16 pM or another fluorescent dye that interacts with double-stranded DNA at a concentration that does not inhibit the amplification reaction.

[0068] RNA matrix > 10 copies per reaction for influenza A virus and RNA matrix > 10 copies per reaction for influenza B virus.

[0069] Total reaction volume adjusted to 10 pL with DNase- and RNase-free water. Example 3. Temperature profile

[0070] The method of amplifying a fragment of the segment number 7 of influenza A virus and a fragment of the segment number 8 of influenza B virus using the oligonucleotides characterized in Example 1 with RT-LAMP technology and the composition of the reaction mixture characterized in Example 2 with the following temperature profile:

[0071] 1) 64°C, 40 min

[0072] 2) preferably for end-point reactions additionally after the above step 80°C, 5 min.

[0073] Example 4. Method of detection

[0074] The method of amplification and detection of a fragment of the segment number 7 of influenza A virus and a fragment of the segment number 8 of influenza B virus using the oligonucleotides characterized in Example 1 with RT-LAMP technology and the composition of the reaction mixture characterized in Example 2 and the temperature profile characterized in Example 3 and the detection method described below. The fluorescent dye used added to the reaction mixture in the amount of 0.5 pL EvaGreen 20X; 0.5 pL or a concentration of <1X; <16 pM for GreenFluorescent Dye (Lucigen); SYTO-13 and SYTO-82, respectively, before starting the reaction, real-time and / or end-point measurement. Excitation wavelength in the range similar to the FAM dye - 490-500 nm (optimally 494 nm) for EvaGreen; Fluorescent dye 50X (New England Biolabs), GreenFluorescent Dye (Lucigen); SYTO-13 dyes and 535 nm (optimally 541 nm) for the SYTO-82 dye; emission wavelength in the range of 509-530 nm (optimally 518 nm) for EvaGreen; GreenFluorescent Dye (Lucigen); SYTO-13 dyes and 556 nm (optimally 560 nm) for the SYTO-82 dye, the method of detection, change recording time starting from 15 minute after the start of the reaction for influenza A virus and influenza B virus and the negative control.

[0075] Example 5.

[0076] The method of preparation and freeze-drying of reagents for detecting the amplification and detection of a fragment of the segment number 7 of influenza A virus and a fragment of the segment number 8 of influenza B virus using the oligonucleotides characterized in Example 1 with RT-LAMP technology and the composition of the reaction mixture characterized in Example 2 and the temperature profile characterized in Example 3 and the detection method described in Example 4.

[0077] Example 6. Description of freeze-drying process

[0078] The reaction components were mixed according to the composition described in Example 2 using EvaGreen dye (Biotium) <1X, except the template RNA, to a total volume of 10 pL. The mixture was transferred to 0.2 mL tubes and subjected to the freeze-drying process according to the parameters below.

[0079] The mixture placed in test tubes was pre-cooled to -80°C for 2 hours. Then the freeze-drying process was carried out at the temperature of -25°C for 18 hours under the pressure of 5-2mBar and a further 3 hours 30 minutes at the temperature of 25°C under the same pressure.

[0080] Example 7. Sensitivity and specificity of the method

[0081] The sensitivity and specificity of the method was determined by assaying serial dilutions using the oligonucleotides characterized in Example 1 with RT-LAMP technology and the composition of the reaction mixture characterized in Example 2 and the temperature profile characterized in Example 3 and the detection method described in Example 4 and using the standards for influenza A virus: Quantitative Genomic RNA from Influenza virus (H1N1), strain A / PR / 8 / 34, ATCC number: VR-95DQ™ and Quantitative Genomic RNA from Influenza A virus (H3N2), strain A / Wisconsin / 15 / 2009, ATCC number: VR-1882DQ™, and for influenza B virus: Quantitative Genomic RNA from Influenza B virus, strain B / Wisconsin / 1 / 2010 BX-41A, ATCC number: VR-1885DQ™ in the range of 10-50 copies per reaction mixture, where product amplification was measured in real time - Figure 4, Figure 5 and Figure 6 (Real-Time LAMP for serial dilutions) along with recording the dissociation temperature in the range of 83.5-84.5°C (Figure 7) for influenza A virus subtype H1N1, 85-86°C (Figure 8) for influenza A virus subtype H3N2 and 84-85°C (Figure 9) for influenza B virus. The time required to detect the emitted fluorescence for individual samples is shown in Table 1 for influenza A virus subtype H1N1, Table 2 for influenza A virus subtype H3N2 and Table 3 for influenza B virus.

[0082] The characterized primers allow for the detection of influenza A virus of subtypes H1N1 and H3N2 by detecting a fragment of the segment number 7 at a minimum number of 10 genome copies / reaction mixture and the detection of influenza B virus by detecting a fragment of the segment number 8 at a minimum number of 10 genome copies / reaction mixture. The inclusivity of the method against different influenza A and B virus strains was determined by assaying standard templates of specific influenza A and B virus strains shown in Table 4 (Figure 12). Table 1. Time required to detect fluorescence for each dilution of the standard: Quantitative

[0083] Genomic RNA from Influenza virus (H1N1), strain A / PR / 8 / 34, ATCC number: VR-95DQ™

[0084] Sample Time to exceed the baseline fluorescence

[0085] [min] NTC Indefinite

[0086] 10 copies 17.5

[0087] 20 copies 17.1

[0088] 50 copies 19.6

[0089] Table 2. Time required to detect fluorescence for each dilution of the standard: Quantitative Genomic RNA from Influenza virus (H1N1), strain A / PR / 8 / 34, ATCC number: VR-95DQ™

[0090] Sample Time to exceed the baseline fluorescence

[0091] [min]

[0092] NTC Indefinite

[0093] 10 copies 20.4

[0094] 20 copies 19.2

[0095] 50 copies 16.8

[0096] Table 3. Time required to detect fluorescence for each dilution of the standard: Quantitative Genomic RNA from Influenza B virus, strain B / Wisconsin / 1 / 2010 BX-41A, ATCC number: VR- 1885DQ™

[0097] Sample Time to exceed the baseline fluorescence

[0098] [min]

[0099] NTC Indefinite

[0100] 10 copies 17.2

[0101] 20 copies 17.1

[0102] 50 copies 17.6 Table 4. Influenza A and influenza B strains used to determine the inclusivity of the invention.

[0103] Influenza type Strain

[0104] A California / 07 / 2009(H1N1) Egg grown

[0105] A Brisbane / 59 / 2007 (HA, NA) x A / PR / 8 / 34 (H1N1)

[0106] A Uruguay / 716 / 2007 (H3N2)

[0107] A Mississi ppi / 1 / 85 (HA, NA) x A / PR / 8 / 34

[0108] A Wisconsin / 67 / 2005 x A / PR / 8 / 34;

[0109] A Guizhou / 54 / 89 (HA, NA) x A / PR8 / 34 (H3N2)

[0110] A Victoria / 3 / 75(HA, NA) x A / PR / 8 / 34

[0111] A California / 07 / 2009 (H1N1)

[0112] B Texas / 06 / 2011(BY)

[0113] B Nevada / 03 / 2011(BV)

[0114] B Nevada / 03 / 2011

[0115] B 0hio / 01 / 2005 (BV)

[0116] B Texas / 06 / 2011

[0117] B Hong Kong / 330 / 2001(BV)

[0118] B Malaysia / 2506 / 2004

[0119] Example 8. Selectivity of the method against other pathogens The selectivity of the method towards other pathogens was determined by assaying reactions using the oligonucleotides characterized in Example 1 with RT-LAMP technology and the composition of the reaction mixture characterized in Example 2 and the temperature profile characterized in Example 3 and the detection method described in Example 4, and using the standard templates for a number of pathogens potentially present in the biological material tested as natural physiological flora, that may be the result of co-infection or that share similar genomic sequences (Figure 10, 11, 12). The list of pathogens against which specificity was determined is shown in Table 5.

[0120] Table 5. Pathogens potentially present in the biological material tested as natural physiological flora used to determine the specificity of the invention. Pathogen name Pathogen name

[0121] Mycoplasma genitalium Haemophilus influenzae

[0122] Klebsiella pneumoniae Streptococcus pneumoniae

[0123] Bordetella pertussis SARS-CoV-2 Frankfurt 1

[0124] Streptococcus pyogenes SARS-CoV-2 Isolate Italy-INMIl

[0125] Staphylococcus aureus (MRSA) Human Coronavirus, OC43

[0126] Enterococcus faecalis SARS-CoV-2lsolateGermany / BavPatl / 2020

[0127] Enterococcus faecium SARS-CoV-2 from NR 52726 Human Coronavirus 229E

[0128] Pseudomonas aeruginosa SARS-CoV-2 Isolate USA-CA1 / 2020

[0129] Moraxella catarrhalis SARS-CoV-2 Isolate New York-PV08410 / 2020

[0130] Acinetobacter baumannii SARS-CoV-2 Isolate USA-IL1 / 2020

[0131] Listeria monocytogenes SARS-CoV-2 Isolate Chile / Santiago_op4dl / 2020

[0132] Legionella pneumophila SARS-CoV-2 Isolate USA-WI / 202

[0133] Mycoplasma hominis 1stWHO International Standard for SARS-CoV-2

[0134] Haemophilus ducreyi

[0135] Escherichia coli

[0136] Ureaplasma urealyticum; Amplirun Respiratory Syncytial Virus (subtype A)

[0137] Campylobacter jejuni Amplirun Respiratory Syncytial Virus (subtype B)

[0138] Candida albicans MERS Coronavirus England-1 Stain

[0139] Mycoplasma pneumoniae SARS-CoV-2 B.1.1.7

[0140] Chlamydophila pneumoniae Staphylococcus aureus (MSSA)

[0141] Zika Virus HPV 16

[0142] Example 9. Inclusivity of the method

[0143] The bioinformatics analysis demonstrated that the method of amplification and detection of a fragment of the segment number 7 of influenza A virus using the oligonucleotides characterized in Example 1 with RT-LAMP technology and the composition of the reaction mixture characterized in Example 2 and the temperature profile characterized in Example 3 and the detection method described in Example 4 allows for detecting the influenza A virus subtypes shown in Table 6. The application is accompanied by a report generated using the publicly available Influenza Virus BLAST tool (The Influenza Virus Resource at the National Center for Biotechnology Information).

[0144] Table 6: Influenza A subtypes detected

[0145] Influenza type Subtype

[0146] A H1N1

[0147] A H1N2

[0148] A H2N2

[0149] A H3N1

[0150] A H3N2

[0151] A H3N8

[0152] A H5N1

[0153] A H5N2

[0154] A H5N3

[0155] A H5N8

[0156] A H5N9

[0157] A H7N1

[0158] A H7N2

[0159] A H7N3

[0160] A H7N4

[0161] A H7N7

[0162] A H7N9

[0163] A H9N2

[0164] A H10N7

[0165] Example 10. Efficiency of the method with omission of loop primers

[0166] The efficiency of the method with omission of the loop primers in the reaction mixture was determined by assaying reactions using the oligonucleotides characterized in Example 1 with selective omission of the LF oligonucleotides of influenza A virus and influenza B virus or the LB oligonucleotides of influenza A virus and influenza B virus, and with omission of all loop oligonucleotides, i.e. LF and LB for both influenza A virus and influenza B virus with RT-LAMP technology and the composition of the reaction mixture characterized in Example 2 and the temperature profile characterized in Example 3 and the detection method described in Example 4, and using the standards for influenza A virus: Quantitative Genomic RNA from Influenza virus (H1N1), strain A / PR / 8 / 34, ATCC no: VR-95DQ™ and for influenza B virus: Quantitative Genomic RNA from Influenza B virus, strain B / Wisconsin / 1 / 2010 BX-41A, ATCC number: VR-1885DQ™ at 1000 copies per reaction mixture, where product gain was measured in real time.

[0167] Selective omission of the LF oligonucleotides of influenza A virus and influenza B virus or the LB oligonucleotides of influenza A virus and influenza B virus does not interfere with the efficiency of the method (Figure 13 and Figure 14).

[0168] The superiority of the amplification method and the oligonucleotides characterized in this patent specification over the tests based on the Real-Time LAMP technology is due to the significantly higher sensitivity and the reduced analysis time.

[0169] Sequence listing

[0170] <110> Genomtec S .A.

[0171] <120> Set of primers for detecting influenza A virus and influenza B virus , method for detecting influenza A virus and influenza B virus using the set of primers and kit for detecting influenza A virus and influenza B virus

[0172] <170> Patentin version 3 . 5

[0173] <210> 1 Influenza A F3

[0174] <211> 20

[0175] <212> DNA

[0176] <213> arti ficial

[0177] <223> primer

[0178] <400> 1

[0179] F3

[0180] CTCTCTATCGTTCCATCAGG 20

[0181] <210> 2 Influenza A B3

[0182] <211> 16

[0183] <212> DNA

[0184] <213> arti ficial

[0185] <223> primer

[0186] <400> 2

[0187] TACGCTGCAGTCCTCG 16 <210> 3 Influenza A Flc

[0188] <211> 25

[0189] <212> DNA

[0190] <213> arti ficial

[0191] <223> primer

[0192] <400> 3

[0193] Flc

[0194] CTCAAGATCTGTGTTTTTCCCAGCA 25

[0195] <210> 4 Influenza A F2

[0196] <211> 17

[0197] <212> DNA

[0198] <213> arti ficial

[0199] <223> primer

[0200] <400> 4

[0201] F2

[0202] CCCCCTCAAAGCCGAGA 17

[0203] <210> 5 Influenza A Bic

[0204] <211> 24

[0205] <212> DNA

[0206] <213> arti ficial

[0207] <223> primer

[0208] <400> 5

[0209] Bic

[0210] TCATGGAATGGCTAAAGACAAGAC 24 <210> Influenza A B2

[0211] <211> 19

[0212] <212> DNA

[0213] <213> arti ficial

[0214] <223> primer

[0215] <400> 6

[0216] B2

[0217] GTGAGCGTGAACACAAACC 19

[0218] <210> 7 Influenza A LF

[0219] <211> 21

[0220] <212> DNA

[0221] <213> arti ficial

[0222] <223> primer

[0223] <400> 7

[0224] LF

[0225] GACATCTTCAAGTCTCTGCGC 21

[0226] <210> 8 Influenza A LB

[0227] <211> 25

[0228] <212> DNA

[0229] <213> arti ficial

[0230] <223> primer

[0231] <400> 8

[0232] LB

[0233] ATTCTGTCACCTCTGACTAAGGGGA 25 <170> Patentin version 3 . 5

[0234] <210> 9 Influenza B F3

[0235] <211> 20

[0236] <212> DNA

[0237] <213> arti ficial

[0238] <223> primer

[0239] <400> 9

[0240] F3

[0241] GRCTTGTTGCTAAACTTGTT 20

[0242] <210> 10 Influenza B B3

[0243] <211> 18

[0244] <212> DNA

[0245] <213> arti ficial

[0246] <223> primer

[0247] <400> 10

[0248] B3

[0249] TTGTCTCCCTCTTCTGGT 18

[0250] <210> 11 Influenza B Flc :

[0251] <211> 22

[0252] <212> DNA

[0253] <213> arti ficial

[0254] <223> primer

[0255] <400> 11 Flc

[0256] CGAAGAGTGAGTTGAGGATCCG 22

[0257] <210> 12 Influenza B F2

[0258] <211> 19

[0259] <212> DNA

[0260] <213> arti ficial

[0261] <223> primer

[0262] <400> 12

[0263] F2

[0264] GC TACT GAT GAT CKKACAG 19

[0265] <210> 13 Influenza B Bic

[0266] <211> 20

[0267] <212> DNA

[0268] <213> arti ficial

[0269] <223> primer

[0270] <400> 13

[0271] Bic

[0272] AAGCCAATTCGAGCAGCTGA 20

[0273] <210> 14 Influenza B B2

[0274] <211> 18

[0275] <212> DNA

[0276] <213> arti ficial

[0277] <223> primer

[0278] <400> 14

[0279] B2 ATCGGTGCTCTTGACCAA 18

[0280] <210> 15 Influenza B LF

[0281] <211> 21

[0282] <212> DNA

[0283] <213> arti ficial

[0284] <223> primer

[0285] <400> 15

[0286] LF

[0287] GGCCATCTTYTTCATCCTCCA

[0288] <210> 16 Influenza B LB

[0289] <211> 19

[0290] <212> DNA

[0291] <213> arti ficial

[0292] <223> primer

[0293] <400> 16

[0294] LB

[0295] GCGGTGGGAGTCTTATCCC 19

[0296] <210> Influenza A Seg . 7

[0297] <211> 1027

[0298] <212> DNA

[0299] <213>

[0300] <223> segment <400> 17

[0301] AGCAAAAGCAGGTAGATATTGAAAGATGAGCCTTCTAACCGAGGTCGAAACGTATGTTCTCT CTATCGTTCCATCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAAGATGTCTTTGCT GGGAAAAACACAGAT C T T GAGGCT C T CAT GGAAT GGC TAAAGACAAGACCAAT T C T GT CACC TCTGACTAAGGGGATTTTGGGGTTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGC AGCGTAGACGCTTTGTCCAAAATGCCCTCAATGGGAATGGAGATCCAAATAACATGGACAAA GCAGTTAAACTGTATAGGAAACTTAAGAGGGAGATAACGTTCCATGGGGCCAAAGAAATAGC TCTCAGTTATTCTGCTGGTGCACTTGCCAGTTGCATGGGCCTCATATACAATAGGATGGGGG CTGTAACCACTGAAGTGGCATTTGGCCTGGTATGTGCAACATGTGAACAGATTGCTGACTCC CAGCACAGGTCTCATAGGCAAATGGTGGCAACAACCAATCCATTAATAAAACATGAGAACAG AATGGTTTTGGCCAGCACTACAGCTAAGGCTATGGAGCAAATGGCTGGATCAAGTGAGCAGG CAGCGGAGGCCATGGAAATTGCTAGTCAGGCCAGGCAAATGGTGCAGGCAATGAGAGCCGTT GGGACTCATCCTAGCTCCAGTACTGGTCTAAGAGATGATCTTCTTGAAAATTTGCAGACCTA TCAGAAACGAATGGGGGTGCAGATGCAACGATTCAAGTGACCCGCTTGTTGTTGCCGCGAGT ATCATTGGGATCTTGCACTTGATATTGTGGATTCTTGATCGTCTTTTTTTCAAATGCGTCTA TCGACTCTTCAAACACGGCCTTAAAAGAGGCCCTTCTACGGAAGGAGTACCTGAGTCTATGA GGGAAGAATATCGAAAGGAACAGCAGAATGCTGTGGATGCTGACGACAGTCATTTTGTCAGC AT AGAG T T G GAG T AAAAAAC TACCTTGTTTCTACT

[0302] <210> Inf luenza B Seg . 8

[0303] <211 > 1063

[0304] <212 > DNA

[0305] <213>

[0306] <223> segment

[0307] <400> 18

[0308] GAT T T GT T TAGT GAG T GGCAAACAGGAAAAAAT GGCGGACAATAT GACCACAACACAAAT T G AGGTGGGTCCGGGAGCAACCAATGCCACCATAAACTTCGAAGCAGGAATTCTGGAGTGCTAT GAAAGACTTTCATGGCAAAGGGCCCTTGACTACCCTGGTCAAGACCGCCTAAACAGACTAAA GAGAAAAT T AGAG T C AAGAAT AAAGAC T C AC AAC AAAAG T GAG C C T GAAAG T AAAAG GAT G T C T C T T GAAGAGAGAAAAG C AAT T GGAG T AAAAAT GAT GAAAG TACTTCTATTTAT GAAT C C G TCTGCTGGAATTGAAGGGTTTGAGCCATACTGTATGAAAAGTTCCTCAAAGAGCAACTGTCC GAAATACAATTGGATTGATTACCCTTCAACCCCAGGGAGGTGCCTTGATGACATAGAAGAAG AACCAGATGGTGTTGATGGCCCAACTGAAATAGTATTAAGGGACATGAACAACAAAGATGCA AGGCAAAAGATAAAGGAGGAAGTAAACACTCAGAAAGAAGGGAAGTTCCGTTTGACAATAAA AAG G GAT AT G C G T AAT G T AT T G T C C C T GAGAG T G T T AG T AAAC G GAAC AT T C C T C AAAC AC C CCAATGGATACAAGTCCTTATCAACTCTGCATAGATTGAATGCATATGACCAGAGTGGAAGG CTTGTTGCTAAACTTGTTGCTACTGATGATCTTACAGTGGAGGATGAAGAAGATGGCCATCG T1

[0309] GAT CC T CAAT T CAC T C T T CGAGCG T C T TAAT GAAGGACAT T CAAAGCCAAT T CGAGCAGC T G AAACTGCGGTGGGAGTCTTATCCCAATTTGGTCAAGAGCACCGATTATCACCAGAAGAGGGA GAG AAT T AGAC T G G T CAC G GAAGAAC TTTATCTTT T AAG T AAAAGAAT T GAT GAT AAC AT AT T G T T C C AC AAAAC AG TAAT AG C T AAC AG CTCCATAATAGCT GAC AT GGTTGTATCATTATCA TTATTAGAAACATTGTATGAAATGAAGGATGTGGTTGAAGTGTACAGCAGGCAGTGCTTGTG AATTTAAAA

Claims

Claims1. A set of primers for amplifying the nucleotide sequence of segment number 7 of influenza A virus, characterized in that it comprises a set of internal primers with the following nucleotide sequences a) and b), as well as a set of external primers containing the following nucleotide sequences c) and d) a) Flc 5' CTCAAGATCTGTGTTTTTCCCAGCA 3'- nucleotide sequence SEQ ID NO: 3, linked at the 3' end, preferably by a TTTT bridge, to the sequence F2 5' CCCCCTCAAAGCCGAGA 3'- nucleotide sequence SEQ ID NO: 4 b) Bic 5' TCATGGAATGGCTAAAGACAAGAC 3'- nucleotide sequence SEQ ID NO: 5, linked at the 3' end, preferably by a TTTT bridge, to the sequence B2 5' GTGAGCGTGAACACAAACC 3'- nucleotide sequence SEQ ID NO: 6 c) F3 5' CTCTCTATCGTTCCATCAGG 3' - nucleotide sequence SEQ ID NO: 1 and d) B3 5' TACGCTGCAGTCCTCG 3' - nucleotide sequence SEQ ID NO: 2.

2. The set of primers of claim 1, characterised in that it comprises a set of loop primer sequences comprising nucleotide sequences contained in or complementary to the segment number 7 of influenza A virus SEQ ID NO: 7 - LF 5' GACATCTTCAAGTCTCTGCGC 3' and SEQ ID NO: 8 - LB 5' ATTCTGTCACCTCTGACTAAGGGGA 3'.

3. A set of primers for amplifying the nucleotide sequence of the segment number 8 of influenza B virus, characterized in that it comprises a set of internal primers with the following nucleotide sequences a) and b), as well as a set of external primers containing the following nucleotide sequences c) and d) a) Flc 5' CGAAGAGTGAGTTGAGGATCCG 3'- nucleotide sequence SEQ ID NO: 11 linked at the 3' end, preferably by a TTTT bridge, to the sequence F2 5' GCTACTGATGATCKKACAG 3' nucleotide sequence SEQ ID NO: 12b) Bic 5' AAGCCAATTCGAGCAGCTGA 3'- nucleotide sequence SEQ ID NO: 13 linked at the 3' end, preferably by a TTTT bridge, to the sequence B2 5' ATCGGTGCTCTTGACCAA 3'- nucleotide sequence SEQ ID NO: 14 c) F3 5' GRCTTGTTGCTAAACTTGTT 3' - nucleotide sequence SEQ ID NO: 9 and d) B3 5' TTGTCTCCCTCTTCTGGT 3' - nucleotide sequence SEQ ID NO: 10.

4. The set of primers of claim 3, characterised in that it contains a set of loop primer sequences comprising nucleotide sequences contained in or complementary to the segment number 8 of influenza B virus SEQ ID NO: 15 - LF 5' GGCCATCTTYTTCATCCTCCA 3' and SEQ ID NO: 16: LB 5' GCGGTGGGAGTCTTATCCC 3'.

5. A method for detecting influenza A virus and / or influenza B virus in a single reaction, characterised in that selected regions of the nucleotide sequence of the viral genome are amplified using a set of primers as defined in claims 1, 2, 3 and 4, the amplification method being the RT-LAMP method.

6. The method for virus detection of claim 5, characterised in that the amplification is carried out with a temperature profile:- 64°C, 40 min.

7. The method of claims 5 and 6, characterised in that the end-point reaction is carried out with an additional temperature profile of 80°C, 5 min.

8. A method for detecting influenza A virus and / or influenza B virus infection, characterised in that it comprises the detection method as defined in claims 5-7.

9. A kit for detecting an infection caused by influenza A virus and / or influenza B virus, characterised in that it comprises the set of primers as defined in claims 1, 2 and in claims 3 and 4.

10. The infection detection kit of claims 5-9, characterised in that it contains 5.0 pL of Universal WarmStart® LAMP 2X Master Mix (New England Biolabs).

11. The infection detection kit of claims 5-9, characterised in that it comprises amplification primers as defined in claims 1 and 2 and in claims 3 and 4, the primers having the following concentrations for influenza A virus: 0.15 pM F3, 0.15 pM B3, 1.20 pM FIP A, 1.20 pM BIP, 0.30 pM LF, 0.30 pM LB and for influenza B virus: 0.15 pM F3, 0.15 pM B3, 1.20 pM FIP, 1.20 pM BIP, 0.30 pM LF; 0.30 pM LB; D-(+)-Trehalose dihydrate - 6%; mannitol - 1.25%; fluorescent marker interacting with double-stranded DNA - EvaGreen <1X (Biotium) or Fluorescent Dye (New England Biolabs) in the amount of <1 pL or Syto-13 <16 pM (ThermoFisher Scientific) or SYTO-82 <16 pM (ThermoFisher Scientific) or another fluorescent dye interacting with doublestranded DNA at a concentration that does not inhibit the amplification reaction.

Images