Targets for treatment of alt-positive cancers

Abstract

The present invention relates to the treatment and / or prevention of ALT-positive (alternative lengthening of telomeres-positive) cancers.

Description

TARGETS FOR TREATMENT OF ALT-POSITIVE CANCERS

[0001] The present invention relates to the treatment and / or prevention of ALT-positive (alternative lengthening of telomeres-positive) cancers.Background

[0002] Alternative Lengthening of Telomeres (ALT) is a telomere maintenance mechanism observed in a subset of cancers that enables cells to bypass the normal process of telomere shortening and maintain their telomeres through alternative means. This mechanism is distinct from the well-known telomerase pathway, which is active in most cancers and involves the enzyme telomerase to elongate telomeres.

[0003] ALT-positive cancers represent a unique subgroup characterized by the activation of the ALT pathway for telomere maintenance. The ALT mechanism was first identified in certain types of cancers, particularly in sarcomas and certain subtypes of glioblastoma multiforme, but has since been reported in other cancer types as well, including soft tissue tumors and some epithelial malignancies.

[0004] ALT is a complex and multi-step process that involves recombination and homology-directed repair mechanisms. The key hallmark of ALT-positive cancers is the presence of characteristic features at the telomeres, including the presence of long, heterogeneous telomeric DNA repeats known as ALT- associated promyelocytic leukemia (PML) bodies, or APBs, and the formation of extrachromosomal telomeric DNA circles (C-circles).

[0005] The exact molecular mechanisms underlying the ALT pathway are still not fully understood, but several proteins have been implicated in ALT-associated processes. ALT-positive cancers exhibit unique biological and clinical characteristics. They often present with distinct chromosomal alterations, including telomeric rearrangements, amplifications, and large-scale genomic instability.

[0006] Understanding the molecular mechanisms and clinical implications of ALT activation in cancer is of great interest in cancer research. ALT-positive cancers pose challenges for treatment strategies due to their distinct telomere maintenance mechanisms, which may impact the effectiveness of therapies targeting telomerase or telomere lengthening. Therefore, further investigations into therapies for ALT- positive cancers are essential for developing novel therapeutic approaches and improving patient outcomes in this unique subset of malignancies.Summary of the invention

[0007] A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an inhibitor for one or more genes selected from the list consisting of: lysineacetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor 11 IC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl-Diphosphate Delta Isomerase 1 (IDI1), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L1 1 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate-binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1) to the subject.

[0008] The present invention provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of one or more genes selected from the list consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor IIIC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl-Diphosphate Delta Isomerase 1 (I D11 ), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L1 1 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN bindingprotein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate- binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1).

[0009] The present invention provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an inhibitor for one or more genes selected from the list consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor I IIC subunit 3 (GTF3C3) and tRNA methyltransferase 6 (TRMT6) to the subject.

[0010] The present invention provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of one or more genes selected from the list consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor IIIC subunit 3 (GTF3C3) and tRNA methyltransferase 6 (TRMT6).

[0011] The present invention provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an inhibitor for one or more genes selected from the list consisting of: growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl- Diphosphate Delta Isomerase 1 (IDI1), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L11 (RPL11), 60S ribosomalprotein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate-binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1) to the subject.

[0012] The present invention provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of one or more genes selected from the list consisting of: growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl-Diphosphate Delta Isomerase 1 (IDI1), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L1 1 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate- binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1).

[0013] In some embodiments, the one or more genes are chaperone proteins. In some embodiments, the one or more genes are selected from the list consisting of heat shock protein family D (Hsp60) member 1 (HSPD1). In some embodiments, the one or more genes are enzymes. In some embodiments, the one or more genes are selected from the list consisting of lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), transketolase (TKT), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), DNA methyltransferase 1 (DNMT1), tRNA methyltransferase 6 (TRMT6), ubiquitin like modifier activating enzyme 5 (UBA5), Isopentenyl-Diphosphate Delta Isomerase 1 (ID11 ), RuvB-like 1 (RUVBL1), ubiquitin- conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate-binding protein 2 (PABPN1) and aldolase A (ALDOA). In some embodiments, the one or more genes are scaffold proteins. In some embodiments, the one or more genes are selected from the list consisting of COP9 signalosome subunit 4 (COPS4), proteasome subunit beta type-1 (PSMB1), IK cytokine (IK), SDS3 homolog SIN3A corepressor complex component (SUDS3), proteasome activator complex subunit 3 (PSME3), growth factor receptor bound protein 2) (GRB2), RING-box protein 1 (RBX1), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), ring finger protein 113A (RNF113A) and pre- mRNA processing factor 8 (PRPF8). In some embodiments, the one or more genes are transcription factors. In some embodiments, the one or more genes are selected from the list consisting of zinc finger protein 207 (ZNF207), general transcription factor 111 C subunit 3 (GTF3C3) and nuclear respiratory factor 1 (NRF1). In some embodiments, the one or more genes are transporter proteins. In some embodiments, the one or more genes are selected from the list consisting of nucleoporin 155 (NUP155), complement C1Q binding protein (C1 QBP), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1) and mRNA export factor (RAE1). In some embodiments, the one ormore genes are part of the SUMO activating enzyme complex (G0:0031510). In some embodiments, the one or more genes are selected from the list consisting of ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), and RAN binding protein 2 (RANBP2). In some embodiments, the one or more genes have Ubiquitin-like modifier activating enzyme activity (G0:0008641). In some embodiments, the one or more genes are selected from the list consisting of ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), ubiquitin like modifier activating enzyme 5 (UBA5), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9) and RAN binding protein 2 (RANBP2). In some embodiments, the one or more genes are part of the proteosome complex (G0:0000502). In some embodiments, the one or more genes are selected from the list consisting of proteasome 20S subunit beta 1 (PSMB1), proteasome activator complex subunit 3 (PSME3), proteasome 20S subunit alpha 4 (PSMA4) and proteasome 20S subunit alpha 5 (PSMA5). In some embodiments, the one or more genes are involved in the regulation of mRNA metabolic processes (GO:1903311). In some embodiments, the one or more genes are selected from the list consisting of proteasome 20S subunit beta 1 (PSMB1), proteasome activator complex subunit 3 (PSME3), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), complement C1 Q binding protein (C1 QBP), 60S ribosomal protein L11 (RPL11) and 60S ribosomal protein L10a (RPL10A). In some embodiments, the one or more genes are involved in mRNA splicing (G0:0000398). In some embodiments, the one or more genes are selected from the list consisting of cleavage and polyadenylation specific factor 1 (CPSF1), IK cytokine (IK), proline rich mitotic checkpoint control factor (PRCC), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), cleavage and polyadenylation specificity factor subunit 6 (CPSF6) and polyadenylate- binding protein 2 (PABPN1). In some embodiments, the one or more genes are involved in tRNA processing (G0:0008033). In some embodiments, the one or more genes are selected from the list consisting of cleavage and polyadenylation specific factor 1 (CPSF1), tRNA methyltransferase 6 (TRMT6), cleavage and polyadenylation specificity factor subunit 6 (CPSF6) and polyadenylate-binding protein 2 (PABPN1). In some embodiments, the one or more genes are involved in RNA export from the nucleus (G0:0006405). In some embodiments, the one or more genes are selected from the list consisting of cleavage and polyadenylation specific factor 1 (CPSF1), nucleoporin 155 (NUP155), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), cleavage and polyadenylation specificity factor subunit 6 (CPSF6) and polyadenylate-binding protein 2 (PABPN1). In some embodiments, the one or more genes are involved in chromatin regulation. In some embodiments, the one or more genes are selected from the list consisting of lysine acetyltransferase 5 (KAT5), corepressor complex component (SUDS3), DNA methyltransferase 1 (DNMT1) and RuvB-like 1 (RUVBL1). In some embodiments, the one or more genes are involved in negative regulation of the mitotic cell cycle (G0:0045930). In some embodiments, the one or more genes are selected from the list consisting of zinc finger protein 207 (ZNF207), IK cytokine (IK), proline rich mitotic checkpoint control factor (PRCC), ring finger protein 113A (RNF113A) and pre-mRNA processing factor 8 (PRPF8). In some embodiments, the one or more genes are involved in positive regulation of apoptotic processes (G0:0043065). In some embodiments, the one or more genes are selected from the list consisting of ubiquitin A-52 residue ribosomal protein fusion product 1(UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1 QBP), heat shock protein family D (Hsp60) member 1 (HSPD1), 60S ribosomal protein L11 (RPL11) and 60S ribosomal protein L10a (RPL10A). In some embodiments, the one or more genes are involved in the MyD88-dependent toll-like receptor signalling pathway (G0:0002755). In some embodiments, the one or more genes are selected from the list consisting of ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), heat shock protein family D (Hsp60) member 1 (HSPD1), 60S ribosomal protein L11 (RPL11) and 60S ribosomal protein L10a (RPL10A). In some embodiments, the one or more genes are involved in intracellular protein transmembrane transport (G0:0065002). In some embodiments, the one or more genes are selected from the list consisting of signal recognition particle 54 (SRP54) and heat shock protein family D (Hsp60) member 1 (HSPD1).

[0014] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a lysine acetyltransferase 5 (KAT5) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of lysine acetyltransferase 5 (KAT5). The present invention also provides a lysine acetyltransferase 5 (KAT5) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a lysine acetyltransferase 5 (KAT5) inhibitor to the subject. In some embodiments, the KAT5 protein comprises the sequence of SEQ ID NO:1 (PDB reference: 2OU2). The present invention also provides a KAT5 inhibitor that specifically inhibits a KAT5 protein having a structure defined by PDB reference 2OU2. In some embodiments, the KAT5 inhibitor is selected from the list consisting of: MG149 (CAS: 1243583-85-8), Nu9056 (CAS: 1450644-28-6) and NVP-2 (CAS: 1263373-43-8).

[0015] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a cleavage and polyadenylation specific factor 1 (CPSF1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of cleavage and polyadenylation specific factor 1 (CPSF1). The present invention also provides a cleavage and polyadenylation specific factor 1 (CPSF1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a cleavage and polyadenylation specific factor 1 (CPSF1) inhibitor to the subject. In some embodiments, the CPSF1 protein comprises the sequence of SEQ ID NO:2 (PDB reference 6BM0). The present invention also provides a CPSF1 inhibitor that specifically inhibits a CPSF1 protein having a structure defined by PDB reference 6BM0.

[0016] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a B-TFIID TATA-box binding protein associated factor 1 (BTAF1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of B-TFIID TATA-box binding protein associated factor 1 (BTAF1). The present invention also provides a B-TFIID TATA-box binding protein associated factor 1 (BTAF1) inhibitor for use in a method of treating orpreventing an ALT positive cancer in a subject, the method comprising administering a B-TFIID TATA- box binding protein associated factor 1 (BTAF1) inhibitor to the subject. In some embodiments, the BTAF1 protein comprises a sequence of SEQ ID NO: 3 (AlphaFold reference: 014981). The present invention also provides a BTAF1 inhibitor that specifically inhibits a BTAF1 protein having a structure defined by AlphaFold reference: 014981.

[0017] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a signal recognition particle 54 (SRP54) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of signal recognition particle 54 (SRP54). The present invention also provides a signal recognition particle 54 (SRP54) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a signal recognition particle 54 (SRP54) inhibitor to the subject. In some embodiments, the SRP54 protein comprises the sequence of SEQ ID N0:4 (PDB reference 6Y2Z). The present invention also provides an SRP54 inhibitor that specifically inhibits an SRP54 protein having a structure defined by PDB reference 6Y2Z.

[0018] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a COP9 signalosome subunit 4 (COPS4) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of COP9 signalosome subunit 4 (COPS4). The present invention also provides a COP9 signalosome subunit 4 (COPS4) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a COP9 signalosome subunit 4 (COPS4) inhibitor to the subject. In some embodiments, the COPS4 protein comprises the sequence of SEQ ID NO:5 (PDB reference 4D09). The present invention also provides a COPS4 inhibitor that specifically inhibits a COPS4 protein having a structure defined by PDB reference 4D09.

[0019] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome 20S subunit beta 1 (PSMB1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of proteasome 20S subunit beta 1 (PSMB1). The present invention also provides a proteasome 20S subunit beta 1 (PSMB1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome 20S subunit beta 1 (PSMB1) inhibitor to the subject. In some embodiments, the PSMB1 protein comprises the sequence of SEQ ID NO:6 (PDB reference 7NHT). The present invention also provides a PSMB1 inhibitor that specifically inhibits a PSMB1 protein having a structure selected defined by PDB reference 7NHT. In some embodiments, the PSMB1 inhibitor is selected from the list consisting of: bortezomib (CAS: 179324-69-7), carfilzomib (CAS: 868540-17-4) and ixazomib (1072833-77-2).

[0020] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a zinc finger protein 207 (ZNF207) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of zinc finger protein 207 (ZNF207). The present invention also provides a zinc finger protein 207 (ZNF207) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a zinc finger protein 207 (ZNF207) inhibitor to the subject. In some embodiments, the ZNF207 protein comprises the sequence of SEQ ID NOT (AlphaFold reference: 043670). The present invention also provides a ZNF207 inhibitor that specifically inhibits a ZNF207 protein having a structure defined by AlphaFold reference 043670.

[0021] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an IK cytokine (IK) inhibitorto the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of IK cytokine (IK). The present invention also provides an IK cytokine (IK) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an IK cytokine (IK) inhibitor to the subject. In some embodiments, the IK protein comprises the sequence of SEQ ID NO:8 (PDB reference 6Q8I). The present invention also provides an IK inhibitor that specifically inhibits an IK protein having a structure defined by PDB reference 6Q8L

[0022] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nucleoporin 155 (NUP155) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of nucleoporin 155 (NUP155). The present invention also provides a nucleoporin 155 (NUP155) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nucleoporin 155 (NUP155) inhibitor to the subject. In some embodiments, the NUP155 protein comprises the sequence of SEQ ID NO:9 (PDB reference 7R1Y). The present invention also provides a NUP155 inhibitor that specifically inhibits a NUP155 protein having a structure defined by PDB reference 7R1Y.

[0023] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52). The present invention also provides a ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52) inhibitor to thesubject. In some embodiments, the UBA52 protein comprises the sequence of SEQ ID NO:10 (AlphaFold reference P62987). The present invention also provides a UBA52 inhibitor that specifically inhibits a UBA52 protein having a structure defined by AlphaFold reference P62987.

[0024] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a SDS3 homolog, SIN3A corepressor complex component (SUDS3) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of SDS3 homolog, SIN3A corepressor complex component (SUDS3). The present invention also provides a SDS3 homolog, SIN3A corepressor complex component (SUDS3) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a SDS3 homolog, SIN3A corepressor complex component (SUDS3) inhibitor to the subject. In some embodiments, the SUDS3 protein comprises the sequence of SEQ ID NO:11 (AlphaFold reference Q9H7L9). The present invention also provides a SUDS3 inhibitor that specifically inhibits a SUDS3 protein having a structure defined by AlphaFold reference Q9H7L9.

[0025] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a complement C1 Q binding protein (C1 QBP) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of complement C1Q binding protein (C1QBP). The present invention also provides a complement C1 Q binding protein (C1 QBP) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a complement C1 Q binding protein (C1 QBP) inhibitor to the subject. In some embodiments, the C1 QBP protein comprises the sequence of SEQ ID NO:12 (PDB reference 3RPX). The present invention also provides a C1 QBP inhibitor that specifically inhibits a C1 QBP protein having a structure defined by PDB reference 3RPX.

[0026] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a transketolase (TKT) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of transketolase (TKT). The present invention also provides a transketolase (TKT) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a transketolase (TKT) inhibitor to the subject. In some embodiments, the TKT protein comprises the sequence of SEQ ID NO:13 (PDB reference 3OOY). The present invention also provides a TKT inhibitor that specifically inhibits a TKT protein having a structure defined by PDB reference 3OOY. In some embodiments, the TKT inhibitor is N3PT.

[0027] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a heat shock protein family D (Hsp60) member 1 (HSPD1) inhibitor to the subject. The present invention also provides a method of providing a diagnosisor prognosis of an ALT positive cancer in a subject based on the expression status or activity of heat shock protein family D (Hsp60) member 1 (HSPD1). The present invention also provides a heat shock protein family D (Hsp60) member 1 (HSPD1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a heat shock protein family D (Hsp60) member 1 (HSPD1) inhibitor to the subject. In some embodiments, the HSPD1 protein comprises the sequence of SEQ ID NO:14 (PDB reference 7AZP). The present invention also provides a HSPD1 inhibitor that specifically inhibits a HSPD1 protein having a structure defined by PDB reference 7AZP. In some embodiments, the HSPD1 inhibitor is KHS101 .

[0028] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome activator complex subunit 3 (PSME3) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of proteasome activator complex subunit 3 (PSME3). The present invention also provides a proteasome activator complex subunit 3 (PSME3) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome activator complex subunit 3 (PSME3) inhibitor to the subject. In some embodiments, the PSME3 protein comprises the sequence of SEQ ID NO:15 (PDB reference 7YQC). The present invention also provides a PSME3 inhibitor that specifically inhibits a PSME3 protein having a structure defined by PDB reference 7YQC.

[0029] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin like modifier activating enzyme 5 (UBA5) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of ubiquitin like modifier activating enzyme 5 (UBA5). The present invention also provides a ubiquitin like modifier activating enzyme 5 (UBA5) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin like modifier activating enzyme 5 (UBA5) inhibitor to the subject. In some embodiments, the UBA5 protein comprises the sequence of SEQ ID NO:16 (PDB reference 6H77). The present invention also provides a UBA5 inhibitor that specifically inhibits a UBA5 protein having a structure defined by PDB reference 6H77.

[0030] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a farnesyl diphosphate synthase (FDPS) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of farnesyl diphosphate synthase (FDPS). The present invention also provides a farnesyl diphosphate synthase (FDPS) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a farnesyl diphosphate synthase (FDPS) inhibitor to the subject. In some embodiments, the FDPS protein comprises the sequence of SEQ ID NO:17 (PDB reference 3RYE). The present invention also provides a FDPS inhibitor that specifically inhibits a FDPS protein having a structuredefined by PDB reference 3RYE. In some embodiments, the FDPS inhibitor is selected from the list consisting of: risedronate, alendronate, minodronate and zoledronate.

[0031] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering cleavage and polyadenylation specificity factor subunit 3 (CPSF3) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of cleavage and polyadenylation specificity factor subunit 3 (CPSF3). The present invention also provides a cleavage and polyadenylation specificity factor subunit 3 (CPSF3) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a cleavage and polyadenylation specificity factor subunit 3 (CPSF3) inhibitor to the subject. In some embodiments, the CPSF3 protein comprises the sequence of SEQ ID NO:44 (AlphaFold reference: Q9UKF6). The present invention also provides a CPSF3 inhibitor that specifically inhibits a CPSF3 protein having a structure defined by AlphaFold reference Q9UKF6. In some embodiments, the CPSF3 inhibitor is JTE-607.

[0032] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin like modifier activating enzyme 2 (UBA2) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of ubiquitin like modifier activating enzyme 2 (UBA2). The present invention also provides a ubiquitin like modifier activating enzyme 2 (UBA2) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin like modifier activating enzyme 2 (UBA2) inhibitor to the subject. In some embodiments, the UBA2 protein comprises the sequence of SEQ ID NO:18 (PDB reference 1Y8Q). The present invention also provides a UBA2 inhibitor that specifically inhibits a UBA2 protein having a structure defined by PDB reference 1Y8Q. In some embodiments, the UBA2 inhibitor is subasumstat (TAK-981).

[0033] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a SUMO1 activating enzyme subunit 1 (SAE1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of SUMO1 activating enzyme subunit 1 (SAE1). The present invention also provides a SUMO1 activating enzyme subunit 1 (SAE1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a SUMO1 activating enzyme subunit 1 (SAE1) inhibitor to the subject. In some embodiments, the SAE1 protein comprises the sequence of SEQ ID NO:19 (PDB reference 6XOG). The present invention also provides a SAE1 inhibitor that specifically inhibits a SAE1 protein having a structure defined by PDB reference 6XOG. In some embodiments, the SAE1 inhibitor is subasumstat (TAK-981).

[0034] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proline rich mitotic checkpoint control factor (PRCC) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of proline rich mitotic checkpoint control factor (PRCC). The present invention also provides a proline rich mitotic checkpoint control factor (PRCC) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proline rich mitotic checkpoint control factor (PRCC) inhibitor to the subject. In some embodiments, the PRCC protein comprises the sequence of SEQ ID NO:20 (AlphaFold reference: H0YE12). The present invention also provides a PRCC inhibitor that specifically inhibits a PRCC protein having a structure defined by AlphaFold reference H0YE12 .

[0035] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a DNA methyltransferase 1 (DNMT1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of DNA methyltransferase 1 (DNMT1). The present invention also provides a DNA methyltransferase 1 (DNMT1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a DNA methyltransferase 1 (DNMT1) inhibitor to the subject. In some embodiments, the DNMT1 protein comprises the sequence of SEQ ID NO:21 (PDB reference 4WXX). The present invention also provides a DNMT1 inhibitor that specifically inhibits a DNMT1 protein having a structure defined by PDB reference 4WXX. In some embodiments, the DNMT1 inhibitor is selected from the list consisting of: 5-Azacytidine and GSK-3484862.

[0036] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a general transcription factor 111 C subunit 3 (GTF3C3) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of general transcription factor 111 C subunit 3 (GTF3C3). The present invention also provides a general transcription factor IIIC subunit 3 (GTF3C3) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a general transcription factor IIIC subunit 3 (GTF3C3) inhibitor to the subject. In some embodiments, the GTF3C3 protein comprises the sequence of SEQ ID NO:22 (AlphaFold reference: H7C0C0). The present invention also provides a GTF3C3 inhibitor that specifically inhibits a GTF3C3 protein having a structure defined by AlphaFold reference H7C0C0.

[0037] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a tRNA methyltransferase 6 (TRMT6) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of tRNA methyltransferase 6 (TRMT6). The present invention also provides a tRNA methyltransferase 6 (TRMT6) inhibitor for use ina method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a tRNA methyltransferase 6 (TRMT6) inhibitor to the subject. In some embodiments, the TRMT6 protein comprises the sequence of SEQ ID NO:23 (PDB reference 5CCB). The present invention also provides a TRMT6 inhibitor that specifically inhibits a TRMT6 protein having a structure defined by PDB reference 5CCB.

[0038] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a growth factor receptor bound protein 2 (GRB2) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of growth factor receptor bound protein 2 (GRB2). The present invention also provides a growth factor receptor bound protein 2 (GRB2) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a growth factor receptor bound protein 2 (GRB2) inhibitor to the subject. In some embodiments, the GRB2 protein comprises the sequence of SEQ ID NO:24 (PDB reference: 1JYQ). The present invention also provides a GRB2 inhibitor that specifically inhibits a GRB2 protein having a structure defined by PDB reference 1 JYQ.

[0039] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a RING-box protein 1 (RBX1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of RING-box protein 1 (RBX1). The present invention also provides a RING-box protein 1 (RBX1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a RING-box protein 1 (RBX1) inhibitor to the subject. In some embodiments, the RBX1 protein comprises the sequence of SEQ ID NO:25 (PDB reference: 2LGV). The present invention also provides a RBX1 inhibitor that specifically inhibits a RBX1 protein having a structure defined by PDB reference 2LGV.

[0040] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an Isopentenyl-Diphosphate Delta Isomerase 1 (I D11 ) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of Isopentenyl-Diphosphate Delta Isomerase 1 (I D11 ) . The present invention also provides an Isopentenyl- Diphosphate Delta Isomerase 1 (IDI1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an Isopentenyl-Diphosphate Delta Isomerase 1 (IDI1) inhibitor to the subject. In some embodiments, the IDI1 protein comprises the sequence of SEQ ID NO:26 (PDB reference: 2ICJ). The present invention also provides IDI1 inhibitor that specifically inhibits an I D11 protein having a structure defined by PDB reference 2ICJ.

[0041] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome 20S subunit alpha 4 (PSMA4) inhibitorto the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of proteasome 20S subunit alpha 4 (PSMA4). The present invention also provides a proteasome 20S subunit alpha 4 (PSMA4) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome 20S subunit alpha 4 (PSMA4) inhibitor to the subject. In some embodiments, the PSMA4 protein comprises the sequence of SEQ ID NO:27 (PDB reference: 4R3O). The present invention also provides a PSM4 inhibitor that specifically inhibits a PSMA4 protein having a structure defined by PDB reference 4R3O.

[0042] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome 20S subunit alpha 5 (PSMA5) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of proteasome 20S subunit alpha 5 (PSMA5). The present invention also provides a proteasome 20S subunit alpha 5 (PSMA5) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome 20S subunit alpha 5 (PSMA5) inhibitor to the subject. In some embodiments, the PSMA5 protein comprises the sequence of SEQ ID NO:28 (PDB reference: 4R3O). The present invention also provides a PSMA5 inhibitor that specifically inhibits a PSMA5 protein having a structure defined by PDB reference 4R3O.

[0043] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a RuvB-like 1 (RUVBL1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of RuvB-like 1 (RUVBL1). The present invention also provides a RuvB-like 1 (RUVBL1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a RuvB-like 1 (RUVBL1) inhibitor to the subject. In some embodiments, the RUVBL1 protein comprises the sequence of SEQ ID NO:29 (PDB reference: 2C9O). The present invention also provides a RUVBL1 inhibitor that specifically inhibits a RUVBL1 protein having a structure defined by PDB reference 2C9O.

[0044] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ring finger protein 113 (RNF113A) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of ring finger protein 113 (RNF113A). The present invention also provides a ring finger protein 1 13 (RNF113A) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ring finger protein 113 (RNF113A) inhibitor to the subject. In some embodiments, the ring finger protein 113 (RNF113A) protein comprises the sequence of SEQ ID NQ:30 (Alphafold reference: 015541). The present invention also provides a ring finger protein 113 (RNF113A) inhibitorthat specifically inhibits a ring finger protein 113 (RNF113A) protein having a structure defined by Alphafold reference 015541.

[0045] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a pre-mRNA processing factor 8 (PRPF8) inhibitor to the subject.

[0046] The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of pre-mRNA processing factor 8 (PRPF8). The present invention also provides a pre-mRNA processing factor 8 (PRPF8) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a pre-mRNA processing factor 8 (PRPF8) inhibitor to the subject. In some embodiments, the PRPF8 protein comprises the sequence of SEQ ID NO:31 (PDB reference: 3E9L). The present invention also provides a PRPF8 inhibitor that specifically inhibits a PRPF8 protein having a structure defined by PDB reference 3E9L.

[0047] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an enhanced exportin 1 (XPO1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of enhanced exportin 1 (XPO1). The present invention also provides an enhanced exportin 1 (XPO1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an enhanced exportin 1 (XPO1) inhibitor to the subject. In some embodiments, the XPO1 protein comprises the sequence of SEQ ID NO:32 (PDB reference: 1 W9C). The present invention also provides a XPO1 inhibitor that specifically inhibits a XPO1 protein having a structure defined by PDB reference 1 W9C. In some embodiments, the XPO1 inhibitor is Selinexor.

[0048] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nucleoporin GLE1 (GLE1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of nucleoporin GLE1 (GLE1). The present invention also provides a nucleoporin GLE1 (GLE1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nucleoporin GLE1 (GLE1) inhibitor to the subject. In some embodiments, the GLE1 protein comprises the sequence of SEQ ID NO:33 (Alphafold reference: Q53GS7). The present invention also provides a GLE1 inhibitor that specifically inhibits a GLE1 protein having a structure defined by Alphafold reference Q53GS7.

[0049] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nuclear RNA export factor 1 (NXF1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALTpositive cancer in a subject based on the expression status or activity of nuclear RNA export factor 1 (NXF1). The present invention also provides a nuclear RNA export factor 1 (NXF1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nuclear RNA export factor 1 (NXF1) inhibitor to the subject. In some embodiments, the NXF1 protein comprises the sequence of SEQ ID NO:34 (PDB reference: 4WYK). The present invention also provides a NXF1 inhibitor that specifically inhibits a NXF1 protein having a structure defined by PDB reference 4WYK.

[0050] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a mRNA export factor (RAE1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of mRNA export factor (RAE1). The present invention also provides a mRNA export factor (RAE1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a mRNA export factor (RAE1) inhibitor to the subject. In some embodiments, the RAE1 protein comprises the sequence of SEQ ID NO:35 (PDB reference: 3MMY). The present invention also provides a RAE1 inhibitor that specifically inhibits a RAE1 protein having a structure defined by PDB reference 3MMY.

[0051] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a 60S ribosomal protein L11 (RPL1 1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of 60S ribosomal protein L11 (RPL11). The present invention also provides a 60S ribosomal protein L1 1 (RPL1 1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a 60S ribosomal protein L1 1 (RPL11) inhibitor to the subject. In some embodiments, the RPL1 1 protein comprises the sequence of SEQ ID NO:36 (PDB reference: 4UG0). The present invention also provides a RPL1 1 inhibitor that specifically inhibits a RPL11 protein having a structure defined by PDB reference 4UG0.

[0052] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a 60S ribosomal protein L10a (RPL10A) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of 60S ribosomal protein L10a (RPL10A). The present invention also provides a 60S ribosomal protein L10a (RPL10A) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a 60S ribosomal protein L10a (RPL10A) inhibitor to the subject. The method or RPL10A inhibitor for use according to any one of embodiments 1-6 or 236-238, wherein the RPL10A protein comprises the sequence of SEQ ID NO:37 (PDB reference: 4UG0). The present invention also provides a RPL10A inhibitor that specifically inhibits a RPL10A protein having a structure defined by PDB reference 4UG0.

[0053] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin-conjugating enzyme E2I (UBE2I / UBC9) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of ubiquitin- conjugating enzyme E2I (UBE2I / UBC9). The present invention also provides a ubiquitin-conjugating enzyme E2I (UBE2I / UBC9) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin-conjugating enzyme E2I (UBE2I / UBC9) inhibitor to the subject. In some embodiments, the UBE2I / UBC9 protein comprises the sequence of SEQ ID NO:38 (PDB reference: 1A3S). The present invention also provides a UBE2I (UBC9) inhibitor that specifically inhibits a UBE2I (UBC9) protein having a structure defined by PDB reference 1A3S.

[0054] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a RAN binding protein 2 (RANBP2) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of RAN binding protein 2 (RANBP2). The present invention also provides a RAN binding protein 2 (RANBP2) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a RAN binding protein 2 (RANBP2) inhibitor to the subject. In some embodiments, the RANBP2 protein comprises the sequence of SEQ ID NO:39 (PDB reference: 1 RRP). The present invention also provides a RANBP2 inhibitor that specifically inhibits a RANBP2 protein having a structure defined by PDB reference 1 RRP.

[0055] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a cleavage and polyadenylation specificity factor subunit 6 (CPSF6) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of cleavage and polyadenylation specificity factor subunit 6 (CPSF6). The present invention also provides a cleavage and polyadenylation specificity factor subunit 6 (CPSF6) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a cleavage and polyadenylation specificity factor subunit 6 (CPSF6) inhibitor to the subject. In some embodiments, the CPSF6 protein comprises the sequence of SEQ ID NQ:40 (PDB reference: 3P5T). The present invention also provides a CPSF6 inhibitor that specifically inhibits a CPSF6 protein having a structure defined by PDB reference 3P5T.

[0056] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a polyadenylate-binding protein 2 (PABPN1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of polyadenylate-binding protein 2 (PABPN1). The present invention also provides a polyadenylate-binding protein 2 (PABPN1)inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a polyadenylate-binding protein 2 (PABPN1) inhibitor to the subject. In some embodiments, the PABPN1 protein comprises the sequence of SEQ ID NO:41 (PDB reference: 3B4D). The present invention also provides a PABPN1 inhibitor that specifically inhibits a PABPN1 protein having a structure defined by PDB reference 3B4D.

[0057] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an aldolase A (ALDOA) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of aldolase A (ALDOA). The present invention also provides an aldolase A (ALDOA) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an aldolase A (ALDOA) inhibitor to the subject. In some embodiments, the ALDOA protein comprises the sequence of SEQ ID NO:42 (PDB reference: 1ALD). The present invention also provides an ALDOA inhibitor that specifically inhibits an ALDOA protein having a structure defined by PDB reference 1 ALD.

[0058] The present invention also provides a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nuclear respiratory factor 1 (NRF1) inhibitor to the subject. The present invention also provides a method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of nuclear respiratory factor 1 (NRF1). The present invention also provides a nuclear respiratory factor 1 (NRF1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nuclear respiratory factor 1 (NRF1) inhibitor to the subject. In some embodiments, the NRF1 protein comprises the sequence of SEQ ID NO:43 (Alphafold reference: Q16656). The present invention also provides a NRF1 inhibitor that specifically inhibits a NRF1 protein having a structure defined by Alphafold reference Q16656.

[0059] In some embodiments, the ALT positive cancer is selected from the group consisting of glioma, breast carcinoma (including HER2+ breast carcinoma), angiosarcoma, pancreatic neuroendocrine tumour, neuroblastoma, liposarcoma, leiomyosarcoma, osteosarcoma, rhabdomyosarcoma, fibrosarcoma, astrocytoma and neuroblastoma.

[0060] In some embodiments, the ALT positive cancer is selected from the group consisting of Acute Lymphoblastic Leukemia (ALL), Acute Myeloid Leukemia (AML), Adrenocortical Carcinoma, AIDS- Related cancer, Kaposi Sarcoma, Primary CNS Lymphoma, Anal cancer, Appendix cancer , Astrocytoma, Atypical Teratoid / Rhabdoid tumor, Basal Cell Carcinoma, Bile Duct cancer, Bladder cancer, Bone cancer, Brain cancer, Breast cancer, Lung cancer, Burkitt Lymphoma, Carcinoid tumor, Cardiac cancer, Medulloblastoma, Primary CNS Lymphoma, Cervical cancer, Cholangiocarcinoma, Chordoma, Chronic Lymphocytic Leukemia (CLL), Chronic Myelogenous Leukemia (CML), Chronic Myeloproliferative Neoplasms, Colorectal cancer, Craniopharyngioma, Cutaneous T-Cell Lymphoma,Endometrial cancer, Esophageal cancer, Esthesioneuroblastoma, Extracranial Germ Cell tumor, Eye cancer, Intraocular melanoma, Retinoblastoma, Fallopian tube cancer, Gallbladder cancer, Stomach cancer, Germ cell tumors, Ovarian cancer, Testicular cancer, Hairy Cell Leukemia, Liver cancer, Hodgkin Lymphoma, Hypopharyngeal cancer, Intraocular melanoma, Pancreatic neuroendocrine tumors, Kaposi Sarcoma (Soft Tissue Sarcoma), Kidney cancer, Langerhans Cell Histiocytosis, Laryngeal cancer, Leukemia, Liver cancer, Lung cancer, Lymphoma, Melanoma, Mesothelioma, Mouth cancer, Nasopharyngeal cancer, Neuroblastoma, Non-Hodgkin Lymphoma, Non-Small Cell Lung cancer, Ovarian cancer, Pancreatic cancer, Papillomatosis, Paraganglioma, Parathyroid cancer, Penile cancer, Pheochromocytoma, Pituitary tumor, Prostate cancer, Rectal cancer, Retinoblastoma, Sarcoma, Skin cancer, Small Cell Lung cancer, Small Intestine cancer, Soft Tissue Sarcoma, Testicular cancer, Throat cancer, Nasopharyngeal cancer, Oropharyngeal cancer, Hypopharyngeal cancer, Thymoma and Thymic Carcinoma, Thyroid cancer, Urethral cancer, Uterine cancer, Uterine Sarcoma, Vaginal cancer and Vulvar cancer.

[0061] In some embodiments, determining the activity or expression status of the one or more genes comprises the use of one or more techniques selected from the group consisting of: telomeric fluorescent in situ hybridization (telomeric FISH), C-circle assay, spectroscopy, quantitative sequencing, quantitative PCR (qPCR), RT-PCT, ddPCR, Southern blotting, northern blotting, immunohistochemistry (IHC), spectroscopy, colorimetric detection, Western blotting, mass spectrometry and ELISA.

[0062] In some embodiments, the inhibitor comprises an antisense nucleic acid molecule, a small interfering RNA (siRNA), or a short hairpin RNA (shRNA). In some embodiments, the inhibitor comprises a small molecule. In some embodiments, the inhibitor is an antisense nucleic acid molecule comprising a sense strand. In some embodiments, the sense strand consists of 15 to 25 linked nucleosides.

[0063] In some embodiments, the sense strand comprises a sequence having at least 95% identity to an equal length portion of a pregenomic RNA and / or an mRNA encoding one or more genes selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A- 52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor IHC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl-Diphosphate Delta Isomerase 1 (ID11 ), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5(PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L11 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate-binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1).

[0064] In some embodiments, the sense strand comprises a sequence having 100% identity to an equal length portion of a pregenomic RNA and / or an mRNA encoding one or more genes selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor IIIC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl-Diphosphate Delta Isomerase 1 (ID11 ), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L11 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate-binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1).

[0065] In some embodiments, the inhibitor comprises a CRISPR nuclease system comprising a CRISPR-associated protein (Cas protein) and a guide RNA (gRNA) that binds to a genomic nucleic acid sequence of the target gene.

[0066] In some embodiments, the inhibitor is capable of inhibiting the expression of the target gene in vitro by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or preferably at least 98% or at least 99%.

[0067] The present invention also provides a method of predicting the response of an ALT positive cancer to an agent, wherein the method comprises determining the activity or expression status of one or more genes selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage andpolyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor IIIC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl-Diphosphate Delta Isomerase 1 (I D11 ), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L11 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate- binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1) in a cancer, wherein a decrease in activity or expression status of the one or more genes in the cancer cells relative to control cells is indicative that the cancer would be responsive to the agent.

[0068] In some embodiments, the method is performed on a sample taken from a subject. In some embodiments, the sample is selected from the group consisting of whole blood, plasma, serum, tissue, tumour, semen, urine, hair, faeces, tumour biopsies (for example frozen tumour biopsies) and formalin fixed, paraffin-embedded (FFPE) tissue. In some embodiments, determining the activity or expression status of the one or more genes comprises the use of one or more techniques selected from the group consisting of: telomeric fluorescent in situ hybridization (telomeric FISH), C-circle assay, spectroscopy, quantitative sequencing, quantitative PCR (qPCR), RT-PCT, ddPCR, Southern blotting, northern blotting, immunohistochemistry (IHC), spectroscopy, colorimetric detection, Western blotting, mass spectrometry and ELISA. In some embodiments, the control cells are ALT-negative cells derived from the same cancer.

[0069] In some embodiments, a decrease in activity or expression status of the one or more genes of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% is indicative that the cancer would be responsive to the agent.

[0070] The present invention also provides a method of providing an ALT positive cancer diagnosis or prognosis for a patient suspected of having cancer, the method comprising:(a) providing a patient expression profile comprising the expression status of one or more genes in at least one biological sample obtained from the patient;(b) comparing the patient expression profile to an average expression status of one or more corresponding genes in a reference population;(c) providing a cancer diagnosis or prognosis based on the variance between the patient expression profile and the expression status of one or more corresponding reference genes; wherein the one or more genes are selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A- 52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor IIIC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl-Diphosphate Delta Isomerase 1 (IDI1), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L11 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin- conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate-binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1).

[0071] In some embodiments, the patient is further diagnosed as having one or more characteristics selected from the following list: telomere repeat variants, ALT-associated promyelocytic leukaemia bodies (PML bodies / APBs), telomere sister chromatid exchanges (TSCE), RPA foci at telomeres, DNA damage at telomeres, telomeric DNA damage induced foci (TIFs), single stranded telomeric regions and extrachromosomal telomeric repeats.

[0072] In some embodiments, the expression status comprises sequencing one or more polynucleotides encoding the one or more genes. In some embodiments, the variance between the patient expression profile and the expression status of one or more corresponding reference genes comprises identifying one or more nucleotide mutations, insertions or deletions in the sequence of the patient gene. In some embodiments, the presence of a mutation, insertion or deletion indicates the presence of a cancer. In some embodiments, the expression status comprises quantifying, in a patient biological sample, the amount of one or more polynucleotides encoding the one or more genes. In someembodiments, the one or more polynucleotides encoding the one or more genes are DNA polynucleotides or RNA polynucleotides. In some embodiments, quantifying the amount of one or more polynucleotides is performed using telomeric fluorescent in situ hybridization (telomeric FISH), C-circle assay, spectroscopy, quantitative sequencing, quantitative PCR (qPCR), RT-PCT, ddPCR, Southern blotting or northern blotting. In some embodiments, the expression status consists of quantifying in a patient biological sample, the amount of one or more polypeptides encoded by the one or more genes.

[0073] The present invention also provides a method of treating an ALT positive cancer in a patient in need thereof, the method comprising providing an ALT positive cancer diagnosis or prognosis using a method of the invention and administering to the patient a chemotherapeutic composition.

[0074] The present invention also provides a kit for testing for providing a cancer diagnosis or prognosis for a patient suspected of having cancer comprising a means for measuring the expression status of one or more genes selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor IIIC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl-Diphosphate Delta Isomerase 1 (I D11 ), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L11 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate- binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1).

[0075] In some embodiments, the kit comprises a means for measuring the expression status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 of the genes. In some embodiments, the means for detecting is a biosensor or specific binding molecule. In some embodiments, the biosensor is an electrochemical, electronic, piezoelectric, gravimetric, pyroelectric biosensor, a sequencer, ion channel switch, evanescent wave, surface plasmon resonance or biological biosensor.Brief Description of the Drawings

[0076] Embodiments of the present invention will now be described, by way of example only, with reference to the accompanying drawings, in which:

[0077] Figure 1 - A CRISPR dropout screen targeting the ‘ALT-telomere proteome’. Schematic representation of the telomere-proteomic approach aim to identify ALT vulnerability.

[0078] Figure 2 - Proteomic profile of ALT telomeres. (A) Representative Colloidal Blue Page of PiCh experiments performed in established ALT+ (U2OS and SACS), TEL+ (Hela 1 .2.1 1) cell lines and KSHV isogenic cell model, see reference [1]. (B) Scatterplot of PiCh / proteomic analysis comparing U2OS-SAOS vs HeLa 1.2.11. Factors highlighted are ALT-related known proteins. (C) Venn Diagram showing data integration analysis of the two-proteomics data set (ALT+ vs TEL+ cells / KSHV isogenic model). The intersection highlight an extended list of 1211 proteins enriched at ALT telomeres. (D) Gene Ontology functions (GoTerm) of the ALT selected-enriched factors. (E) Venn Diagram showing the intersection between the ALT-selected enriched-factors and ALT validated know factors from TelNet (http: / / www.cancertelsys.org / telnet / ). 45 factors over 77 are shared, confirming the powerful of the analysis. (F) Schematic representation of the two libraries designed to perform CRISPR-cas9 screens based on ALT enriched factors found by PiCh and DDR factors. (G) Lentiviral vector used for the CRISPR-cas9 screening.

[0079] Figure 3 - CRISPR dropout screen in ALT patient-derived cells. (A) Tables represented the constitutive cas9-cell lines used in the screens. (B) The CRISPR-Cas9 screening workflow used. (C) Schematic representation of the methods used to select the top ALT synthetic lethal hits from the CRISPR-Cas9 dropout screens. (D) in-silico genome-wide loss of function screen performed using the Genetic Dependency CRISPR-Depmap 21 Q2 Public score CERES. SUDS3 is highlighted in red. (E) Table reporting how the hits of interest scored in the proteomic primary screen.

[0080] Figure 4 - Hits Validation. (A) Schematic representations and (B) workflow used to validated the results of the proteomic-primary screen. (C) Heatmap showing the ALT+ and TEL+ cell survival after selected gene knock-out. ELAV1 and FANCM are used as negative and positive control respectively. (D) Heatmap resuming the main hits features related to tractability, essentiality and overlap between the ALT screens.

[0081] Figure 5 - Genome-wide CRISPR screen identifies genetic vulnerabilities in ATRX deficient cells. (A) The CRISPR-Cas9 screening workflow used in the isogenic cell line pair. (B) Volcano plots showing MAGeCK analysis sgRNA scores in eHAP iCas9 cells (WT vs ATRXK0) at day 6 and 16. Main hits are highlighted.

[0082] Figure 6 - UFMylation E1 enzyme (UBA5) catalytic Cys activity is required in ATRXK0cells.(A) Immunoblot of whole cell extract (WCE) in WT or ATRXK0eHAP iCas9 cells transduced with NTCor UBA5 sgRNA following 96 h Dox. Vinculin and Ponceau stain are used as a loading control. (B) eHAP iCas9 WT or ATRXK0cell lines transduced with NTC or UBA5 sgRNA were seeded for colony formation in technical triplicate following 96 h Dox. Cells were grown for 144 hours. Colonies were fixed and stained with crystal violet. Well diameter, 16 mm. Data are mean ± SEM, normalised to WT sgNTC cells (n = 3 biological replicates). Summary statistics by ordinary one-way ANOVA test. (C) Surface representation of UBA5 in a 2-mer, with exposed catalytic Cys highlighted. Representation from PDB 3H8V. (D) Immunoblot of WCE in WT or ATRXK0eHAP iCas9 cells expressing sgRNA-resistant 3xFlag- UBA5 wt, C250A and an empty piggybac, transduced with NTC or UBA5 sgRNA following 96 h Dox. Ponceau stain is used as a loading control. (E) Cell lines as in (D) were seeded following 96 h Dox. Cell viability was determined after 6 days using CellTiter-Glo. Data are mean ± SEM, normalised to WT sgNTC empty-vector cells (n = 3 biological replicates). Statistical analysis with one-way ANOVA.

[0083] Figure 7 - Whole genome ssTELOC phenotypic screening. (A) Diagram showing work-flow of arrayed whole genome CRISPR screen for the identification of ALT repressors / drivers. (B) Scatter plot of whole genome CRISPR screen with ssTELOC foci intensity on y-axis and nuclei count on x-axis performed at day 6. Dark circles represent genes of interests.

[0084] Figure 8 - Hit selection from primary ssTELOC whole genome crRNA KO screen. 417 hits which changed ssTELOC ALT activity were selected for based on whether they caused a change in ssTELOC ALT activity. ALT repressors which when knocked out by crRNA caused an increase in ssTELOC ALT activity, whereas ALT drivers when knocked out by crRNA caused a decrease in ALT activity. These hits were then validated in a secondary screen with 4 ALT positive and 2 ALT negative cell lines using a cherry-picked crRNA knockout library of 300 hits.

[0085] Figure 9 - Mevalonate pathway. Red boxes indicate hits - IDI1 , FDPS and FDFT1 from 3 screening approaches. Figure derived from [2].

[0086] Figure 10 - Genome-wide CRISPR screen identifies genetic vulnerabilities in ATRX deficient cells. Volcano plots showing MAGeCK analysis sgRNA scores in eHAP iCas9 cells (WT vs ATRXKO) at day 16. FDFT1 , FDPS are highlighted.

[0087] Figure 11 - ssTELOC validation screen identifies differential death hits including GLE1 , GRB2, CPSF6, NXF1 , RUVBL1 , IDI1 , PRPF8, RANBP2, UBE2I, RAE1 , PABNP1 , NRF1 , XPO1 , ALDOA, RPL11 AND RPL10A. Secondary screen identifies differential toxicity in ALT+ve (Cal72, G292, U2OS, NY) vs ALT-ve (SJSA1 , HT1080) cell lines. Labelled hits show overlap with other screening approaches (Figure 3). Y-axis, differential rank nuclei count - hits were ranked for nuclei count (1 for highest etc.), mean ALT-ve rank was then subtracted from mean ALT+ve rank. X-axis, differential nuclei count POC (Percentage Of Control) - mean POC of nuclei of count of ALT+ve was subtracted from ALT-ve.

[0088] Figure 12 - ssTELOC validation screen identifies regulators of ALT activity. (A) ssTELOC native-FISH staining (readout for ALT activity) shows NRF1 , GLE1 , PABPN1 , PSMA4, PSMA5, RAE1 , RANBP2, RBX1 , RNF113A, RUVBL1 and XPO1 KO causes hyper-ALT. Experiment was performed in 4 ALT+ve cell lines, Cal72, G292, NY and U2OS to assess effects of gene KO on ALT activity. (B) ssTELOC native-FISH staining (readout for ALT activity) shows ALDOA, CPSF6, UBE2I and ZNF207 KO causes loss of ALT activity. Experiment was performed in 4 ALT+ve cell lines, Cal72, G292, NY and U2OS to assess effects of gene KO on ALT activity.

[0089] Figure 13 - Stable cell lines with inducible Cas9 expression and constitutive sgRNA expression against IDI1, FDPS, FDFT1 and CPSF6. (A) Cells were induced for CRISPR Cas9 KO of IDI1 ,FDPS and FDFT1 and placed in incucyte where growth was measured over 10 days, cell growth was measured as confluency of cells as imaged by phase contrast microscopy. (B) same as (A) but stable cell lines which induced CPSF6 knockout.

[0090] Figures 14 and 15 - Validation of FDPS as a target using alendronate as an inhibitor. Treatment of 10 ALT-positive and 10 ALT-negative patient derived cell lines with alendronate shows differential toxicity.

[0091] Figure 16 and 17 - Validation of FDPS as a target using risendronate as an inhibitor. Treatment of 10 ALT-positive and 10 ALT-negative patient derived cell lines with risendronate shows differential toxicity.

[0092] Figures 18 and 19 - Validation CPSF3 as a target using JTE-607 as an inhibitor. Treatment of 10 ALT-positive and 10 ALT-negative patient derived cell lines with JTE-607 shows differential toxicity.Detailed description of the invention

[0093] In order for the present invention to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification.

[0094] As used herein, the term "approximately" or "about," as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In some embodiments, the term "approximately" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11 %, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 %), or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0095] As used herein, the term "prevention" means delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely.“Prevention” also includes reducing the risk of developing a disease, disorder, or condition. “Prevention includes, but does not require, complete avoidance of a disease condition.

[0096] As used herein, the term "treatment" (also "treat" or "treating") refers to any administration of a therapeutic agent according to a therapeutic regimen that achieves a desired effect in that it partially or completely alleviates, ameliorates, relieves, reduces severity of and / or reduces incidence of one or more symptoms or features of a particular disease, disorder, and / or condition. In some embodiments, administration of the therapeutic agent according to the therapeutic regimen is correlated with achievement of the desired effect. Such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and / or condition and / or of a subject who exhibits only early signs of the disease, disorder, and / or condition. Alternatively, or additionally, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and / or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and / or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and / or condition.

[0097] The term "comparable", as used herein, refers to a system, set of conditions, effects, or results that is / are sufficiently similar to a test system, set of conditions, effects, or results, to permit scientifically legitimate comparison. Those of ordinary skill in the art will appreciate and understand which systems, sets of conditions, effects, or results are sufficiently similar to be "comparable" to any particular test system, set of conditions, effects, or results as described herein.

[0098] The term "correlates", as used herein, has its ordinary meaning of "showing a correlation with". Those of ordinary skill in the art will appreciate that two features, items or values show a correlation with one another if they show a tendency to appear and / or to vary, together. In some embodiments, a correlation is statistically significant when its p-value is less than 0.05; in some embodiments, a correlation is statistically significant when its p-value is less than 0.01 . In some embodiments, correlation is assessed by regression analysis. In some embodiments, a correlation is a correlation coefficient.

[0099] As used herein, the terms "improve," "increase" or "reduce," or grammatical equivalents, indicate values that are relative to a reference (e.g., baseline) measurement, such as a measurement taken under comparable conditions (e.g., in the same individual prior to initiation of treatment described herein, or a measurement in a control individual (or multiple control individuals) in the absence of treatment) described herein.

[0100] As used herein, a "polypeptide" is a string of at least two amino acids attached to one another by a peptide bond. In some embodiments, a polypeptide may include at least 3-5 amino acids, each of which is attached to others by way of at least one peptide bond. Those of ordinary skill in the art willappreciate that polypeptides may optionally include "non-natural" amino acids or other entities that nonetheless are capable of integrating into a polypeptide chain.

[0101] As used herein, the term "protein" refers to a molecule comprising a polypeptide (i.e., a string of at least two amino acids linked to one another by peptide bonds). Proteins may include moieties other than amino acids (e.g., may be glycoproteins, proteoglycans, etc.) and / or may be otherwise processed or modified. Those of ordinary skill in the art will appreciate that a "protein" can be a complete polypeptide chain as produced by a cell (with or without a signal sequence), or can be a characteristic portion thereof. Those of ordinary skill will appreciate that a protein can sometimes include more than one polypeptide chain, for example linked by one or more disulfide bonds or associated by other means. Polypeptides may contain L-amino acids, D- amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, e.g., terminal acetylation, amidation, methylation, etc. In some embodiments, proteins may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof. The term "peptide" is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids.

[0102] As used herein, the term "subject", "individual", or "patient" refers to any organism upon which embodiments of the invention may be used or administered, e.g. , for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.). In a preferred embodiment of the invention the subject is a human.

[0103] As used herein , the terms "target cell" or "target tissue" refers to any cell, tissue, or organism. In preferred embodiments, the target cell or target tissue is a liver cell such as a hepatocyte or liver tissue.

[0104] As used herein, the term "therapeutic regimen" refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of and / or reduce incidence of one or more symptoms or features of a particular disease, disorder, and / or condition. It may include administration of one or more doses, optionally spaced apart by regular or varied time intervals. In some embodiments, a therapeutic regimen is one whose performance is designed to achieve and / or is correlated with achievement of (e.g., across a relevant population of cells, tissues, or organisms) a particular effect, e.g., reduction or elimination of a detrimental condition or disease. In some embodiments, treatment includes administration of one or more therapeutic agents either simultaneously, sequentially or at different times, for the same or different amounts of time. In some embodiments, a "treatment regimen" includes genetic methods such as gene therapy, gene ablation or other methods known to induce or reduce expression (e.g. transcription, processing, and / or translation of a particular gene product, such as a primary transcript or mRNA).

[0105] As used herein, the term "therapeutically effective amount" refers to an amount of a therapeutic agent which confers a therapeutic effect on the treated subject, at a reasonable benefit / risk ratio applicable to any medical treatment. Such a therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect). In some embodiments, "therapeutically effective amount" refers to an amount of a therapeutic agent or composition effective to treat, ameliorate, or prevent (e.g., delay onset of) a relevant disease or condition, and / or to exhibit a detectable therapeutic or preventative effect, such as by ameliorating symptoms associated with the disease, preventing or delaying onset of the disease, and / or also lessening severity or frequency of symptoms of the disease. A therapeutically effective amount is commonly administered in a dosing regimen that may comprise multiple unit doses. For any particular therapeutic agent, a therapeutically effective amount (and / or an appropriate unit dose within an effective dosing regimen) may vary, for example, depending on route of administration, or on combination with other therapeutic agents. Alternatively or additionally, a specific therapeutically effective amount (and / or unit dose) for any particular patient may depend upon a variety of factors including the activity of the specific therapeutic agent employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and / or rate of excretion or metabolism of the specific therapeutic agent employed; the duration of the treatment; and like factors as is well known in the medical arts.

[0106] As used herein "antisense compound" means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

[0107] As used herein “antisense inhibition" means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.

[0108] As used herein "antisense mechanisms" are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing. "Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.

[0109] As used herein "portion" means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In some embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In some embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

[0110] As used herein, "nucleoside" means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.

[0111] As used herein, "chemical modification" or "chemically modified" means a chemical difference in a compound when compared to a naturally occurring counterpart. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications. In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence.

[0112] As used herein, "nucleotide" means a nucleoside further comprising a phosphate linking group. As used herein, "linked nucleosides" may or may not be linked by phosphate linkages and thus includes, but is not limited to "linked nucleotides." As used herein, "linked nucleosides" are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).

[0113] As used herein, "nucleobase" means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.

[0114] As used herein the terms, "unmodified nucleobase" or "naturally occurring nucleobase" means the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).

[0115] As used herein, "modified nucleobase" means any nucleobase that is not a naturally occurring nucleobase. As used herein, "modified nucleoside" means a nucleoside comprising at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides can comprise a modified sugar moiety and / or a modified nucleobase.

[0116] As used herein, "oligonucleotide" means a compound comprising a plurality of linked nucleosides. In some embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides.

[0117] As used herein, "modified oligonucleotide" means an oligonucleotide comprising at least one modified nucleoside and / or at least one modified internucleoside linkage.

[0118] As used herein, "linkage" or "linking group" means a group of atoms that link together two or more other groups of atoms.

[0119] As used herein "internucleoside linkage" means a covalent linkage between adjacent nucleosides in an oligonucleotide.

[0120] As used herein "naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage. As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring internucleoside linkage. In particular, a "modified internucleoside linkage" as referred to herein can include a modified phosphorous linking group such as a phosphorothioate or phosphorodithioate internucleoside linkage.

[0121] As used herein, "terminal internucleoside linkage" means the linkage between the last two nucleosides of an oligonucleotide or defined region thereof.

[0122] As used herein, "oligomeric compound" means a polymeric structure comprising two or more substructures. In some embodiments, an oligomeric compound comprises an oligonucleotide, such as a modified oligonucleotide. In some embodiments, an oligomeric compound further comprises one or more conjugate groups and / or terminal groups and / or ligands. In some embodiments, an oligomeric compound consists of an oligonucleotide. In some embodiments, an oligomeric compound comprises a backbone of one or more linked monomeric sugar moieties, where each linked monomeric sugar moiety is directly or indirectly attached to a heterocyclic base moiety. In some embodiments, oligomeric compounds may also include monomeric sugar moieties that are not linked to a heterocyclic base moiety, thereby providing abasic sites.

[0123] As used herein, "terminal group" means one or more atom attached to either, or both, the 3 ' end or the 5' end of an oligonucleotide. In some embodiments, a terminal group comprises one or more terminal group nucleosides.

[0124] As used herein, "conjugate" or "conjugate group" means an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In some embodiments, a conjugate group links a ligand to a modified oligonucleotide or oligomeric compound. In general, conjugate groups can modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and / or clearance properties.

[0125] As used herein, "conjugate linker" or "linker" in the context of a conjugate group means a portion of a conjugate group comprising any atom or group of atoms and which covalently link an oligonucleotide to another portion of the conjugate group. In some embodiments, the point of attachment on the oligomeric compound is the 3 '-oxygen atom of the 3'-hydroxyl group of the 3' terminal nucleoside of the oligonucleotide. In some embodiments the point of attachment on the oligomeric compound is the 5'- oxygen atom of the 5'-hydroxyl group of the 5' terminal nucleoside of the oligonucleotide. In someembodiments, the bond for forming attachment to the oligomeric compound is a cleavable bond. In certain such embodiments, such cleavable bond constitutes all or part of a cleavable moiety.

[0126] In some embodiments, conjugate groups comprise a cleavable moiety (e.g., a cleavable bond or cleavable nucleoside) and ligand portion that can comprise one or more ligands, such as a carbohydrate cluster portion, such as an N-Acetyl-Galactosamine, also referred to as "GalNAc", cluster portion. In some embodiments, the carbohydrate cluster portion is identified by the number and identity of the ligand. For example, In some embodiments, the carbohydrate cluster portion comprises 2 GalNAc groups. For example, In some embodiments, the carbohydrate cluster portion comprises 3 GalNAc groups and this is particularly preferred. In some embodiments, the carbohydrate cluster portion comprises 4 GalNAc groups. Such ligand portions are attached to an oligomeric compound via a cleavable moiety, such as a cleavable bond or cleavable nucleoside. The ligands can be arranged in a linear or branched configuration, such as a biantennary or triantennary configurations.

[0127] As used herein, "cleavable moiety" means a bond or group that is capable of being cleaved under physiological conditions. In some embodiments, a cleavable moiety is cleaved inside a cell or sub-cellular compartments, such as an endosome or lysosome. In some embodiments, a cleavable moiety is cleaved by endogenous enzymes, such as nucleases. In some embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In some embodiments, a cleavable moiety is a phosphodiester linkage.

[0128] As used herein, "cleavable bond" means any chemical bond capable of being broken. As used herein, "carbohydrate cluster" means a compound having one or more carbohydrate residues attached to a linker group.

[0129] As used herein, "carbohydrate" means a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative. A carbohydrate is a biomolecule including carbon (C), hydrogen (H) and oxygen (O) atoms. Carbohydrates can include monosaccharide, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides or polysaccharides, such as one or more galactose moieties, one or more lactose moieties, one or more N-Acetyl-Galactosamine moieties, and / or one or more mannose moieties. A particularly preferred carbohydrate is N-Acetyl-Galactosamine moieties.

[0130] As used herein, "strand" means an oligomeric compound comprising linked nucleosides. As used herein, "single strand" or "single-stranded" means an oligomeric compound comprising linked nucleosides that are connected in a continuous sequence without a break therebetween. Such single strands may include regions of sufficient self-complementarity so as to be capable of forming a stable self-duplex in a hairpin structure.

[0131] As used herein, "duplex" means two or more complementary strand regions, or strands, of an oligonucleotide or oligonucleotides, hybridized together by way of non-covalent, sequence-specificinteraction therebetween. Most commonly, the hybridization in the duplex will be between nucleobases adenine (A) and thymine (T), and / or (A) adenine and uracil (U), and / or guanine (G) and cytosine (C). The duplex may be part of a single stranded structure, wherein self-complementarity leads to hybridization, or as a result of hybridization between respective strands in a double stranded construct.

[0132] As used herein, "double strand" or "double stranded" means a pair of oligomeric compounds that are hybridized to one another. In some embodiments, a double-stranded oligomeric compound comprises a first and a second oligomeric compound.

[0133] As used herein, "expression" means the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenlyation, addition of 5 '-cap), and translation.

[0134] As used herein, "transcription" or "transcribed" refers to the first of several steps of DNA based gene expression in which a target sequence of DNA is copied into RNA (especially mRNA) by the enzyme RNA polymerase. During transcription, a DNA sequence is read by an RNA polymerase, which produces a complementary, antiparallel RNA sequence called a primary transcript.

[0135] As used herein, "target sequence" means a sequence to which a compound is intended to hybridize to result in a desired activity with respect to expression of the gene of interest. Oligonucleotides have sufficient complementarity to their target sequences to allow hybridization under physiological conditions.

[0136] As used herein, "nucleobase complementarity" or "complementarity" when in reference to nucleobases means a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In both DNA and RNA, guanine (G) is complementary to cytosine (C). In some embodiments, complementary nucleobase means a nucleobase of an oligomeric compound that is capable of base pairing with a nucleobase of its target sequence. For example, if a nucleobase at a certain position of an oligomeric compound is capable of hydrogen bonding with a nucleobase at a certain position of a target sequence, then the position of hydrogen bonding between the oligomeric compound and the target sequence is considered to be complementary at that nucleobase pair. Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.

[0137] As used herein, "non-complementary" in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another. As used herein, "complementary" in reference to oligomeric compounds (e.g., linked nucleosides, oligonucleotides) means the capacity of such oligomeric compounds or regions thereof to hybridize to a target sequence, or to a region of the oligomeric compound itself, through nucleobase complementarity.

[0138] Complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. In some embodiments, complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In some embodiments, complementary oligomeric compounds or regions are at least 80% complementary. In some embodiments, complementary oligomeric compounds or regions are at least 90% complementary. In some embodiments, complementary oligomeric compounds or regions are at least 95% complementary. In some embodiments, complementary oligomeric compounds or regions are at least 100% complementary.

[0139] As used herein, "self-complementarity" in reference to oligomeric compounds means a compound that may fold back on itself, creating a duplex as a result of nucleobase hybridization of internal complementary strand regions. Depending on how close together and / or how long the strand regions are, then the compound may form hairpin loops, junctions, bulges or internal loops.

[0140] As used herein, "mismatch" means a nucleobase of an oligomeric compound that is not capable of pairing with a nucleobase at a corresponding position of a target sequence, or at a corresponding position of the oligomeric compound itself when the oligomeric compound hybridizes as a result of selfcomplementarity, when the oligomeric compound and the target sequence and / or self-complementary regions of the oligomeric compound, are aligned.

[0141] As used herein, "hybridization" means the pairing of complementary oligomeric compounds (e.g., an oligomeric compound and its target sequence). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0142] As used herein, "specifically hybridizes" means the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site.

[0143] As used herein, "fully complementary" in reference to an oligomeric compound or region thereof means that each nucleobase of the oligomeric compound or region thereof is capable of pairing with a nucleobase of a complementary nucleic acid target sequence or a self-complementary region of the oligomeric compound. Thus, a fully complementary oligomeric compound or region thereof comprises no mismatches or unhybridized nucleobases with respect to its target sequence or a self-complementary region of the oligomeric compound.

[0144] As used herein, "percent complementarity" means the percentage of nucleobases of an oligomeric compound that are complementary to an equal-length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucleobases of the oligomeric compound thatare complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.

[0145] As used herein, "percent identity" means the number of nucleobases in a first nucleic acid that are the same type (independent of chemical modification) as nucleobases at corresponding positions in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.

[0146] As used herein, "modulation" means a change of amount or quality of a molecule, function, or activity when compared to the amount or quality of a molecule, function, or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. In a preferred embodiment “modulation” means “inhibition” of amount, quality, function, or activity of a molecule.

[0147] In some embodiments, modulation of the amount, quality, function, or activity of a molecule increases or decreases by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% of the amount, quality, function, or activity of a molecule prior to modulation. In some embodiments, inhibition of the amount, quality, function, or activity of a molecule decreases the amount, quality, function, or activity by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% of the amount, quality, function, or activity of a molecule prior to inhibition.

[0148] As used herein, "type of modification" in reference to a nucleoside or a nucleoside of a "type" means the chemical modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a "nucleoside having a modification of a first type" may be an unmodified nucleoside.

[0149] As used herein, "differently modified" mean chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified naturally occurring RNA nucleoside are "differently modified," even though the naturally occurring nucleoside is unmodified. Likewise, DNA and RNA oligonucleotides are "differently modified," even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2'-OMe modified sugar moiety and an unmodified adenine nucleobase and a nucleoside comprising a 2'-OMe modified sugar moiety and an unmodified thymine nucleobase are not differently modified.

[0150] As used herein, "the same type of modifications" refers to modifications that are the same as one another, including absence of modifications. Thus, for example, two unmodified RNA nucleosideshave "the same type of modification," even though the RNA nucleosides are unmodified. Such nucleosides having the same type modification may comprise different nucleobases.

[0151] As used herein, "region" or "regions", or "portion" or "portions", mean a plurality of linked nucleosides that have a function or character as defined herein, in particular with reference to the claims and definitions as provided herein. Typically, such regions or portions comprise at least 10, at least 11 , at least 12 or at least 13 linked nucleosides. For example, such regions can comprise 13 to 20 linked nucleosides, such as 13 to 16 or 18 to 20 linked nucleosides. Typically, a first region as defined herein consists essentially of 18 to 20 nucleosides and a second region as defined herein consists essentially of 13 to 16 linked nucleosides.

[0152] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administering to an animal. In some embodiments, a pharmaceutically acceptable carrier or diluent is sterile saline. In some embodiments, such sterile saline is pharmaceutical grade saline.

[0153] As used herein, "substituent" and "substituent group," means an atom or group that replaces the atom or group of a named parent compound. For example, a substituent of a modified nucleoside is any atom or group that differs from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2'- substituent is any atom or group at the 2 '-position of a nucleoside other than H or OH). Substituent groups can be protected or unprotected. In some embodiments, compounds of the present disclosure have substituents at one or at more than one position of the parent compound. Substituents may also be further substituted with other substituent groups and may be attached directly or via a linking group such as oxygen or an alkyl or hydrocarbyl group to a parent compound.

[0154] As used herein, "amino" includes primary, secondary and tertiary amino groups. As used herein, "halo" and "halogen," mean an atom selected from fluorine, chlorine, bromine and iodine.

[0155] It will also be understood that nucleic acid molecules or compounds as described herein may have one or more non-hybridizing nucleosides at one or both ends of one or both strands (overhangs) and / or one or more internal non-hybridizing nucleosides (mismatches) provided there is sufficient complementarity to maintain hybridization under physiologically relevant conditions. Alternatively, oligomeric compounds as described herein may be blunt ended at at least one end.

[0156] As used herein, the term “single stranded telomeric regions” refers to the specific ends of linear chromosomes that contain repetitive DNA sequences known as telomeres. Such regions may be observed by fluorescence in-situ hybridisation with the use of a telomeric probe complementary to the G-rich or C-rich telomeric strand.

[0157] As used herein, the term “extrachromosomal telomeric repeats” refers to telomeric DNA sequences that are found outside of the chromosomes, typically in the form of circular or linearextrachromosomal DNA molecules. These can be observed in the form of c-circles and / or t-circles. An exemplary method for observing these can be found in reference [3].

[0158] As used herein, the term “control cells” refers to cells which can be used as a comparison to assess the activity of an agent against an ALT-positive cancer. The term is used to refer to a specific set of cells that are included in an experiment to serve as a comparison or reference point for evaluating the response or behaviour of the ALT-positive test cells. Control cells are used to establish a baseline or standard against which the experimental results can be compared. In some embodiments, control cells are ALT-negative cells derived from the same cancer. In some embodiments, control cells are selected from the list consisting of 143B, HT1080, RD and SJSA-1 cells. In some embodiments, control cells are selected from the list consisting of SF268 and KNS-42 cells.

[0159] In some embodiments, ALT-positive test cells may express ATRX. In some embodiments, the ALT-positive test cells may be ATRX deficient. In some embodiments ALT-positive cells that express ATRX may be selected from the list consisting of SJCRH30, NY and G292 cells. In some embodiments, ALT-positive cells that are ATRX deficient may be selected from the list consisting of U2OS, Saos-2, CAL72 and Huo9 cells. In some embodiments ALT-positive cells that express ATRX may be selected from the list consisting of SK-N-F1 cells. In some embodiments, ALT-positive cells that are ATRX deficient may be selected from the list consisting of SJ-G2 cells.

[0160] As used herein, the term “telomere sister chromatid exchanges” (or TSCEs or T-SCEs) refer to genetic events that occur between the sister chromatids of a chromosome during the process of DNA replication. TSCEs specifically involve the exchange or recombination of telomeric DNA sequences between the sister chromatids. The phenomenon involves the exchange of telomeric DNA between sister chromatids, resulting in the formation of novel telomeric arrangements on the chromosomes. TSCEs can lead to telomere shortening or elongation, depending on the specific recombination event. TSCEs are considered as a form of genetic instability and can have implications for cellular senescence, aging, and cancer development.

[0161] Alternative Lengthening of Telomeres (ALT) is a mechanism by which some cancer cells maintain their telomeres, the protective caps at the ends of chromosomes. Telomeres naturally shorten with each cell division, and this process is typically associated with aging and cell senescence. However, cancer cells can employ mechanisms, such as ALT, to counteract this shortening and continue to divide. In the context of ALT, various proteins and pathways are involved in regulating and influencing the process. There are factors that repress or inhibit the alternative lengthening of telomeres (ALT repressors). There are factors that enhance or drive the alternative lengthening of telomeres (ALT drivers). As used herein, “ALT repressor” refers to any gene or mechanism that is associated with a downregulation or repression of ALT activity. As used herein, “ALT driver” refers to any gene or mechanism that is associated with an upregulation or increase of ALT activity.

[0162] The term "comprising" is used herein to mean including the method steps or elements identified, but that such steps or elements do not comprise an exclusive list and as such there may be present additional steps or elements.

[0163] Further, to the extent that the term "includes" is used in either the detailed description or the claims, such term is intended to be inclusive in a manner similar to the term "comprising" as "comprising" is interpreted when employed as a transitional word in a claim.Biological samples

[0164] Methods of the invention may comprise steps carried out on biological samples. The biological sample that is analysed may be a whole blood sample, a serum sample, saliva, or a biopsy (such as a tissue sample or a tumour sample). The methods of the invention may include a step of obtaining or providing the biological sample, or alternatively the sample may have already been obtained from a patient, for example in ex vivo methods. The samples are considered to be representative of the expression status of the relevant genes in the potentially cancerous tissue.

[0165] Biological samples obtained from a patient can be stored until needed. Suitable storage methods include freezing immediately, within 2 hours or up to two weeks after sample collection. Maintenance at -80oC can be used for long-term storage. Preservative may be added, or the sample may be collected in a tube containing preservative.

[0166] The methods of the invention may be carried out on one test sample from a patient. Alternatively, a plurality of test samples may be taken from a patient, for example at least 2, 3, 4 or 5 samples. Each sample may be subjected to a separate analysis using a method of the invention, or alternatively multiple samples from a single patient undergoing diagnosis could be included in the method.

[0167] The sample may be processed prior to determining the expression status of the biomarkers. The sample may be subject to enrichment (for example to increase the concentration of the biomarkers being quantified), centrifugation or dilution. In other embodiments, the samples do not undergo any preprocessing and are used unprocessed.

[0168] In some embodiments of the invention, the biological sample may be fractionated or enriched for RNA prior to detection and quantification (i.e. measurement). The step of fractionation or enrichment can be any suitable pre-processing method step to increase the concentration of RNA in the sample or select for specific sources of RNA such as cells or extracellular vesicles. For example, the steps of fractionation and / or enrichment may comprise centrifugation and / or filtration to remove cells or unwanted analytes from the sample, or to increase the concentration of EVs in a urine fraction. Methods of the invention may include a step of amplification to increase the amount of gene transcripts that aredetected and quantified. Methods of amplification include RNA amplification, amplification as cDNA, and PCR amplification. Such methods may be used to enrich the sample for any biomarkers of interest.

[0169] RNAs may need to be extracted from the biological sample. This can be achieved by a number of suitable methods. For example, extraction may involve separating the RNAs from the biological sample. Methods include chemical extraction and solid-phase extraction (for example on silica columns). Preferred methods include the use of a silica column. Methods comprise lysing cells or vesicles (if required), addition of a binding solution, centrifugation in a spin column to force the binding solution through a silica gel membrane, optional washing to remove further impurities, and elution of the nucleic acid. Commercial kits are available for such methods, for example from Qiagen or Exigon. If RNAs are extracted from a sample, the extracted solution may require enrichment to increase the relative abundance of RNA transcripts in the sample.Pharmaceutical Compositions of the Agent

[0170] As used herein "pharmaceutical composition" means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.

[0171] As used herein "pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

[0172] Other aspects of the present invention also relate to a medicinal product or a diagnostic aid comprising an adaptor protein according to the invention, a nucleic acid according to the invention or a cell according to the invention and, where appropriate, suitable excipients and additives, such as, for example, a physiological saline solution, stabilizers or proteinase inhibitors.Kits

[0173] Any pharmaceutical composition described herein can be provided in a kit. In some instances, the kit includes (a) a container that contains a pharmaceutical composition described herein and, optionally (b) informational material. The informational material can be descriptive, instructional, marketing or other material that relates to the methods described herein and / or the use of an agent, e.g., for therapeutic benefit.

[0174] The informational material of the kits is not limited in its form. In some instances, the informational material can include information about production of a double-stranded ribonucleic acid molecule or compound comprising a double-stranded ribonucleic acid molecule and a conjugate, molecular weight of a double-stranded ribonucleic acid molecule or compound comprising a doublestranded ribonucleic acid molecule and a conjugate, concentration, date of expiration, batch or production site information, and so forth. In other situations, the informational material relates to methods of administering a double-stranded ribonucleic acid molecule or compound comprising a doublestranded ribonucleic acid molecule and a conjugate, e.g. , in a suitable amount, manner, or mode of administration (e.g. , a dose, dosage form, or mode of administration described herein).

[0175] In some cases, the informational material, e.g., instructions, is provided in printed matter, e.g., a printed text, drawing, and / or photograph, e.g., a label or printed sheet. The informational material can also be provided in other formats, such as Braille, computer readable material, video recording, or audio recording. In other instances, the informational material of the kit is contact information, e.g., a physical address, email address, website, or telephone number, where a user of the kit can obtain substantive information about a therapeutic agent therein and / or their use in the methods described herein. The informational material can also be provided in any combination of formats.

[0176] In addition to a pharmaceutical composition of the invention, the kit can include other ingredients, such as a solvent or buffer, a stabilizer, or a preservative. The kit can also include further agents, e.g., a second or third agent, e.g., other therapeutic agents or other therapeutic compounds or compositions. The components can be provided in any form, e.g., liquid, dried or lyophilized form. The components can be substantially pure (although they can be combined together or delivered separate from one another) and / or sterile. When the components are provided in a liquid solution, the liquid solution can be an aqueous solution, such as a sterile aqueous solution. When the components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. The solvent, e.g., sterile water or buffer, can optionally be provided in the kit.

[0177] The kit can include one or more containers for a pharmaceutical composition or other agents. In some cases, the kit contains separate containers, dividers or compartments for a therapeutic agent and informational material. For example, a therapeutic agent can be contained in a bottle, vial, or syringe, and the informational material can be contained in a plastic sleeve or packet. In other situations, the separate elements of the kit are contained within a single, undivided container. For example, a double-stranded ribonucleic acid molecule or compound comprising a double-stranded ribonucleic acid molecule and a conjugate can be contained in a bottle, vial or syringe that has attached thereto the informational material in the form of a label. In some cases, the kit can include a plurality (e.g., a pack) of individual containers, each containing one or more unit dosage forms (e.g., a dosage form described herein) of a double-stranded ribonucleic acid molecule or compound comprising a double-stranded ribonucleic acid molecule and a conjugate. The containers can include a unit dosage, e.g., a unit that includes a therapeutic agent. For example, the kit can include a plurality of syringes, ampules, foil packets, blister packs, or medical devices, e.g., each containing a unit dose. The containers of the kits can be airtight, waterproof (e.g., impermeable to changes in moisture or evaporation), and / or light-tight.

[0178] The kit can optionally include a device suitable for administration of an agent or composition of the invention, e.g., a syringe or other suitable delivery device. The device can be provided preloaded with the agent or composition of the invention, e.g., in a unit dose, or can be empty, but suitable for loading.Antisense Mechanisms

[0179] In some embodiments, antisense compounds have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

[0180] Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and / or increased inhibitory activity. A second region of a chimeric antisense compound may confer another desired property e.g., serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

[0181] Antisense activity may result from any mechanism involving the hybridization of the antisense compound (e.g., oligonucleotide) with a target nucleic acid, wherein the hybridization ultimately results in a biological effect. In some embodiments, the amount and / or activity of the target nucleic acid is modulated. In some embodiments, the amount and / or activity of the target nucleic acid is reduced. In some embodiments, hybridization of the antisense compound to the target nucleic acid ultimately results in target nucleic acid degradation. In some embodiments, hybridization of the antisense compound to the target nucleic acid does not result in target nucleic acid degradation. In certain such embodiments, the presence of the antisense compound hybridized with the target nucleic acid (occupancy) results in a modulation of antisense activity. In some embodiments, antisense compounds having a particular chemical motif or pattern of chemical modifications are particularly suited to exploit one or more mechanisms. In some embodiments, antisense compounds function through more than one mechanism and / or through mechanisms that have not been elucidated. Accordingly, the antisense compounds described herein are not limited by a particular mechanism.

[0182] Antisense mechanisms include, without limitation, RNase H mediated antisense; RNAi mechanisms, which utilize the RISC pathway and include, without limitation, siRNA, ssRNA and microRNA mechanisms; and occupancy-based mechanisms. Certain antisense compounds may act through more than one such mechanism and / or through additional mechanisms.

[0183] RNase H-Mediated Antisense. In some embodiments, antisense activity results at least in part from degradation of target RNA by RNase H. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNase H activity in mammalian cells. Accordingly, antisense compounds comprising at least a portion of DNA or DNA-like nucleosides may activate RNase H, resulting incleavage of the target nucleic acid. In some embodiments, antisense compounds that utilize RNase H comprise one or more modified nucleosides. In some embodiments, such antisense compounds comprise at least one block of 1-8 modified nucleosides. In certain such embodiments, the modified nucleosides do not support RNase H activity. In some embodiments, such antisense compounds are gapmers, as described herein.

[0184] RNAi Compounds. In some embodiments, antisense compounds are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as shortinterfering RNA or siRNA) and single- stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and / or sequester a target nucleic acid (thus, include microRNA / microRNA-mimic compounds). In some embodiments, antisense compounds comprise modifications that make them particularly suited for such mechanisms.Vectors

[0185] The present invention also provides vectors comprising any one or more of the inhibitory nucleic acid molecules disclosed herein, such as small interfering RNAs (siRNAs). The vectors can be viral or nonviral vectors capable of transporting a nucleic acid molecule. In some embodiments, the vector is a plasmid or cosmid (such as, for example, a circular double-stranded DNA into which additional DNA segments can be ligated). In some embodiments, the vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Expression vectors include, but are not limited to, plasmids, cosmids, retroviruses, adenoviruses, adeno-associated viruses (AAV), plant viruses such as cauliflower mosaic virus and tobacco mosaic virus, yeast artificial chromosomes (YACs), Epstein-Barr (EBV)-derived episomes, and other expression vectors known in the art.CRISPR

[0186] As used herein, "CRISPR nuclease system" refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated ("Cas") genes, including sequences encoding a Cas gene, a guide sequence (also referred to as a "spacer" in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus.

[0187] In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. A CRISPR system is characterised by elements that promote the formation of a CRISPR complex at the site of a target sequence.

[0188] In the context of formation of a CRISPR complex, "target sequence" refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarityis not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell, in some embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or chloroplast.

[0189] When multiple different guide sequences are used, a single expression construct may be used to target CRISPR activity to multiple different, corresponding target sequences within a cell. For example, a single vector may comprise about or more than about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more guide sequences. In some embodiments, about or more than about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more such guide-sequence-containing vectors may be provided, and optionally delivered to a cell. In some embodiments, a vector comprises a regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme, such as a Cas protein, also called Cas enzyme.

[0190] Non- limiting examples of Cas proteins (or Cas enzymes) include Cas1 , Cas1.13, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csx12), Casi o, Csy1 , Csy2, Csy3, Csel, Cse2, Csel, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm.5, Csm6, Cmr1 , Cmr3, Cmr4, Cmr5, Crnr6, Csbl, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1 , Csx15, Csf1 , Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof.

[0191] These enzymes are known; for example, the amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2. In some embodiments, the CRISPR enzyme has DNA cleavage activity, such as Cas9. In some embodiments the CRISPR enzyme is Cas9, and may be Cas9 from S. pyogenes or S. pneumoniae.

[0192] In some embodiments, the CRISPR enzyme directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and / or within the complement of the target sequence. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands within about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence.Alternative modalities

[0193] In some embodiments, the agent or composition of the invention comprises a small molecule. In some embodiments, the agent or composition of the invention comprises an inhibitory peptide. In some embodiments, the agent or composition of the invention is any of the inhibitory nucleic acid molecules described herein. In some embodiments, the agent or composition of the invention comprises an antibody.Combination Therapies

[0194] In some embodiments, the invention features a composition (e.g., one or more compositions, formulations or dosage formulations) or a pharmaceutical combination, comprising an agent or composition of the invention and a second therapeutic agent. In some embodiments, the second therapeutic agent is one or more agents selected from the list consisting of paclitaxel, doxorubicin, cyclophosphamide, cisplatin, fluorouracil, methotrexate, vinblastine, gemcitabine, carboplatin, etoposide, docetaxel, irinotecan, oxaliplatin, vinorelbine, mitomycin, bleomycin, topotecan, bevacizumab, trastuzumab and rituximab.

[0195] In some embodiments, the invention features a composition (e.g., one or more compositions, formulations or dosage formulations) or a pharmaceutical combination, comprising an agent or composition of the invention and a second therapeutic modality. In some embodiments, the second therapeutic modality is one or more modalities selected from the list consisting of surgery, radiation therapy, chemotherapy, immunotherapy and hormone therapy.

[0196] In some embodiments, the composition comprises a pharmaceutically acceptable carrier. In some embodiments, an agent or composition of the invention and the second agent can be present in a single composition or as two or more different compositions. The agent or composition of the invention and the second agent can be administered via the same administration route or via different administration routes. The agent or composition of the invention and the second agent can be administered simultaneously or sequentially. In some embodiments, the pharmaceutical combination comprises an agent or composition of the invention and the second agent separately or together.Routes of Administration

[0197] The agent or pharmaceutical composition can be administered by different routes including orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, intrapleurally, intravenously, intraarterially, intraperitoneally, subcutaneously, intramuscularly, intranasal intrathecally, and / or intraarticularly, or combinations thereof. In some embodiments the agent or pharmaceutical composition is administered orally. In some embodiments the agent or pharmaceutical composition is administered intravenously. In some embodiments the agent or pharmaceutical composition is administered subcutaneously.

[0198] The present invention is further illustrated in the following Examples. It should be understood that these Examples, while indicating embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.Exemplary inhibitors

[0199] The present invention provides a number of exemplary inhibitors which are known to provide at least partial inhibition of target genes. In some embodiments, the exemplary inhibitors disclosed in the table below may be used in methods of the invention. In some embodiments, the inhibitors listed in the claims may comprise or consist of the specific molecules and / or structures set out in the table below. The CAS number refers to the unique identifier in the Chemical Abstracts Service (accessible at https: / / commonchemistrv.cas.org / ) .Sequences

[0200] Certain sequences are disclosed in the present application in relation to particular genes or targets, as summarised in the following table. References herein to particular genes may refer to the specific sequences as defined in the table below by reference to the relevant Uniprot or PDB accession number.ExamplesExample 1 - A CRISPR dropout screen targeting the ‘ALT-telomere proteome’.

[0201] To proteomically profile the composition of ALT and non-ALT telomeres, we performed PiCh analysis. PiCh / proteomic analysis was performed in established ALT+ (U2OS and SAOS2 - osteosarcoma) versus telomerase (TEL+; HeLa.121 1- cervical cancer) cell lines (Fig. 2 A-B) and in the isogenic KSHV model, where rKSHV.219 (KSHV) infection induces the sustained acquisition of ALT in previously telomerase-positive cell lines (BJAB - Human Burkitt lymphoma B cell line) [1].Proteomics of isolated chromatin fragments (PiCh)

[0202] U2OS, SAOS2, HeLa.1211 , and BJAB cells were crosslinked in 3.6% formaldehyde / PBS for 30 min and processed using PiCh protocol reported in Dejardin and Kingston, 2009, EUROSYS protocol, with the following modifications: 109cells per pulldown were used. Cells were sonicated in 50 mM Tris pH8, 10 mM EDTA, 200 mM NaCI, 1 % SDS, desalted and hybridised with 5 pL of 100 pM 2’-F RNA telomere probe (Desthiobiotin-108 Carbons-5'-(UUAGGG)7.5) or scrambled probe (Desthiobiotin-108 Carbons- 5'- (GAUGUG)7.5) and pulled down with 500 pL of streptavidin beads. Each sample was run on a gel, cut into eight bands, and sent for mass spec analysis by the Taplin Mass Spectrometry facility at Harvard.

[0203] The data were filtered for nuclear location and nuclear-related functions using the CanSARBIack database (https: / / cansarblack.icr.ac.uk / cpat). We first excluded the factors uniquely enriched in the ALT- cell line (HeLA12.1 1 non-ALT TEL+ cells vs U2OS, SAOS2 ALT+ cells), which identified 784 proteins (Figure 2C). The remaining 1626 factors were integrated with data from PiCh analysis performed in KSHV-ALT+ infected and non-infected cells. We identified 812 factors uniquely enriched in ALT+ cell line. We decided to consider additional 399 factors enriched both in ALT+ and ALT- cell lines, not to overlook factors that might be important in a subset of ALT+ cells with specific genetic differences (e.g.Loss of either ATRX, DAXX, SMARCAL1 , SLX4IP). We divided the total 1211 factors list based on Gene Ontology (GO) functions; we found that the most representative categories are related to DDR and DNA replication. (Figure 2D).

[0204] To further validate our strategy, we checked if factors known as important for ALT were present in the list. Of the 77 validated ALT factors (http: / / www.cancertelsys.org / telnet / ), 45 factors were found enriched at telomeres in all ALT+ cell lines.Example 2 - A panel of patient-derived ALT tumour cell lines.

[0205] To investigate the mechanisms of ALT and potential genetic vulnerabilities, we performed a two vectors CRISPR Cas9 screen see references [4 and 5] in multiple ALT+ and TEL+ cell lines. Specifically, we established two panels of cancer-derived cells with different telomere lengths and genetic backgrounds (Figure 3A):- Panel 1 Sarcoma: 4 TEL+ and 6 ALT+ cell lines.- Panel 2 Brain tumour: 2 TEL+ and 3 ALT+ cell lines.Source: Childhood Cancer Repository, JCRB cell bank, Riken cell bank, EACC / ATCC, The Crick Cell services.

[0206] After the validation of the ALT markers (Telomere FISH, C-Circles, TERT expression), we generated constitutive Cas9-ex pressing cell lines with the lentiviral Cas9 vector (lentiCas9-Blast Plasmid #52962 Addgene) Figure 2G. Cas9 cutting efficiency was assessed using the BFP / GFP Cas9 Reporter assay (pKLV2-U6gRNA5(gGFP)-PGK-BFP-PA-GFP-W Plasmid #67980 Addgene.Method: Cas9 stable cell line generation:

[0207] BFor each cell lines was performed a Blasticidin and a Puromycin Kill to find the minimum concentration to eliminate non-transduced cells after Cas9 infection and non-transduced cells after CRISPR library infection respectively.

[0208] 1-0.5 x 105cells per well were transduced with lentiCas9-Blast virus ready to infect (lentiCas9- Blast Plasmid #52962 Addgene) and incubate overnight at 37°C in a humidified 5% CO2 incubator. On day 1 , the medium was replaced the medium in the wells with 100uL complete growth medium containing 8 ug / mL Polybrene and 50uL to 10 uL of Cas9 lentivirus particles per well to achieve a single copy of the lentiviral Cas9 proviral sequence in the cell genome with the less MOI and incubated for 6- 24 h at 37°C overnight in a humidified 5% CO2 incubator. Then the media was replaced with selection medium containing the appropriate amount of blasticidin. The selection media was replaced every 3-4 days and monitor the presence of dead cells daily. To allow proper blasticidin selection, split the cells into a larger dish if the cells become confluent. When all the cells were selected, we proceed to clonal isolation and expansion.

[0209] Cas9 activity reporter was measured using the BFP and GFP reporter pKLV2- U6gRNA5(gGFP)-PGKBFP2AGFP-W and analyzed by Flow cytometer (FACS) in a gated population of BFP+ cells. The data were subsequently analysed using FlowJo.Example 3 - A CRISPR dropout screen targeting the “ALT-telomere proteome” in patient-derived cell lines.

[0210] Based on our proteomic data we decided to design two custom Human CRISPR Knockout Pooled Libraries:ALT target library - Pool 1 : designed on factors enriched at ALT telomeres identified by PICh (data integration of U2OS, SACS vs Hela 121 1 proteomics data sets and Bjab - KSHV infected cells vs Bjab cells) (minus the DDR factors) (Figure 2F).DDR library - Pool 2: a curated list designed based on the Horizon DDR library and the DDR factors identified by PICh (Figure 2F)

[0211] The libraries were ordered from Merck Sigma-Aldrich Company with the following characteristics: Product name: MISSION Lentiviral Transduction Particles, two vectors system. Lot: 04032013MN.Format: 5 x 200uL each pool, 2 pools, 4 gRNA / target gene, Vector: LV17 U6-gRNA:EF1 a-Puro- 2a-BFP.Pool 1 : 1115 target genes + 100 Non target (gRNA identified by Deep Seq 100%)- titer:3.0 x 109 VP / mLPool 2: 290 target genes + 100 Non target (gRNA identified by Deep Seq 99.92%) -titer:3.4 x 109 VP / mL

[0212] DNA backups: Product name: Custom CRISPR pool Lot: 04032012MNPool 1 : 21 1 ng / ul x 500 ul (gRNA 4631)Pool 2: 258ng / ul x 400 ul. (gRNA 1258)Screen Parameters: Fold representation: 500 - MOI: 0.4 - Replicate:3 - time points: DT0, DT8, DT14. (Figure 3B)Library virus Titration Method:

[0213] The total number of cells was calculated using the following equation:- cells with lentiviral integrations = sgRNAs x Fold representation- cell required at transduction = cells with lentiviral integrations proportion of cells with integration (based on MOI). The virus titration was performed in exactly the same way the screen was performed.

[0214] On Day 1 , 1.23 106cells / well were seed in 6 wells plate in duplicate with 1 ml of medium with no P / S (2x 5 infected wells + 1 no-infected well). On the Day 2 (less than 1 DT) the cells were counted and transduced with: 2 pl, 1 pl, 10-1(DF10), 10-2(DF100), 103(DF1000) pl of virus in 1000pl of fresh media and spin-infected at 1500 rpm for 90 min at 37 °C (slow acceleration ('3') and deceleration ('O' or '1 ')).

[0215] After 12-24h (depending on the cell lines) of incubation, the cells were washed and reseeded in 10cm plates. On Day 4 (48 h post wash) the cells were analysed for BFP expression using FACS, starting with Not-lnfected cells to subtract BFP autofluorescence. To calculate the functional titer and uL of the virus needed, the following equations was used:Consider dilutions yielding between 1 % to 20% of BFP-positive cells.Functional Titer (TU / mL) = (n cells at starting time) * (Dilution factor)* (% BFP+ cells / 100) I virus volumeRequired number of lentiviral particles (TU) = MOI x cell required at the transduction= mL lentiviral particles= Required number of lentiviral particles (TU) Functional Titer (TU / mL) mL lentiviral particle per pool = mL lentiviral particles x biological replicates.

[0216] The amount of virus needed was double-checked, building a Titration curve: Y= % BFP positive cells X= ul. The volume: uL / well was extrapolated according to the MOI 0.4.Screen Method:

[0217] The screen was performed with the two libraries using the exact infection protocol of titration, after calculating the total number of wells (cells) needed at the transduction time (for each cell line).

[0218] The day after infections, cells were trypsinized and re-seed in 15 cm plates (10cm for library 2), let to recover for 12 hours and then selected with puromycin for ~72h. Cell pellet samples were collected at TO after selection, DT8 and DT14, washed with PBS and freezed at -80 °C. Cells were counted and split every 3 days. The exact number of cells was re-seeded every time to maintain the fold representation.

[0219] Genomic DNA extraction (PureLink™ Genomic DNA Mini Kit Catalog number: K182002) was performed following the manufacture protocol. DNA was eluted in Qiagen elution buffer (1 OmM T ris pH8) and stored at 4°C for immediate use. DNA concentration and quality were measured using nanodrop.

[0220] PCR of sgRNAs for Illumina sequencing

[0221] Primers were designed following the ‘PCR of sgRNA for illumine sequencing’ protocol of the Broad Institute, using the following LV17 vector primer binding sequences:Vector_LV17_CRSR_F_P5 CTTGGCTTTATATATCTTGTGGVector_LV17_CRSR_F_P7 CCTTATTTAAACTTGCTATGCTGA PCR reaction was set up using the following volume:10 pL 10x reaction buffer8 pL dNTP0.5 pL P5 primer mix, 100 pM1.5 pL ExTaq polymerase up to 10 pg of genomic DNA or 200 ng of plasmid DNA10 pL of P7 primer 5 pM up to 100 pL with water10ug DNAAnd the following Thermal cycler parameters:1. 95°C, 1 minute2. 95°C 30 seconds (denaturation)3. 53°C 30 seconds (annealing)4. 72°C 30 seconds (extension)Back to step 2, total of 30 cycles5. 72°C 10 minutes6. 4°C forever

[0222] PCR amplification was followed by two steps AMPure XP-PCR purification following AMPure manufacting protocol (0.6x and 0.8x volume AMPure beads / sample). The PCR cleaned product was eluted in 50 pL of TE buffer 10 mM Tris-HCI pH 8.0.

[0223] The concentration was calculated using Qubit dsDNA HS Assay. 25ul (4nM) were submitted to the Crick NGS facility for QC (includes Premade Libraries) and HiSeq 4000 100bp SR Sequencing.Example 4 - Bioinformatic Analysis

[0224] After sequencing, raw data were analyzed with MagekFlute by the BABS facility at the Crick.

[0225] Screen quality was assessed after aligning reads to a sgRNA library file, counting the read number for each sgRNA and outputting a set of QC statistics:-The numbers of mapped reads and percentage of reads mapped-The Gini index (measures the evenness of sgRNA read counts)-The number of sgRNAs to which zero reads are mapped.

[0226] We first review sample clustering and principal component analysis metrics and then examine QC metrics for sgRNAs. The data from each single cell line were analyzed and presented across Library1 and 2 in terms of a beta score and adjusted p-value. The comparisons of interest for each cell line were:T14 vs TO or plasmid; T8 vs TO or plasmid.

[0227] The ‘beta score’ for each gene, given a comparison TA vs TO, indicates the type of selection a gene is undergoing: a positive beta score indicates that cells proliferated at time TA thanks to gene KO; and a negative beta score indicates that cells died due to gene KO.

[0228] All adjusted p-values were further corrected for multiple testing across cell-lines for false discovery rate using Benjamini & Hochberg (“BH”) formula (see reference [6]): aBonferroni=a / Ncell-lines=0.007 a=0.1 , Ncell-lines=14.

[0229] For each cell line, were performed the following analysis:Genes essential to ALT+ but not TEL+ (shared >7 ALT+ cells and 0 TEL+, shared 8 ALT+ cells and 1 TEL+)Top 30-100 hits shared between more than 5 ALT+ cell lines sPLS-DA results (sparse Partial-least-squares discriminant analysis). A form of supervised machine learning technique that aims to classify samples into known groups (ALT+ or TEL+), and identify the key variables that best drive the separation between the two groups (ALT+ and TEL+ cell lines)Combining p-values. A form of meta-analysis combines the results of multiple tests to address the general hypothesis of which genes are differentially lost / gained for ALT or TEL+ cell-line categories. We used Fisher’s method asses against the significant threshold of 0.1.

[0230] The data combined were then ranked in an Excel file, considering hits essentiality, the number of methods highlighting the hits, hits strongest phenotype in ALT+ cell lines, and the number of ALT+ or TEL+ cells where the hits scored (Figure 3C - E).Example 5 - In-Silico screen: ALT dependency analysis (Figure 3D)

[0231] The analysis of the primary screen was then integrated with an in-silico screen performed using CRISPR (DepMap 21 Q3 Public+Score, CERES) data downloaded from the DepMap portal website (https: / / depmap.org / portal / ). The file contains cell-line meta-data as well as the CERES scores, representative of the gene effect. A lower score means that a gene is more likely to be dependent in each cell line. A score of 0 is equivalent to a gene that is not essential, whereas a score of-1 corresponds to the median of all common essential genes.”

[0232] The ALT+ and TEL+ cell lines were identified and split into panels based on the tissue of origin. The ALT cell lines are further subdivided based on ATRX status. Only cell lines present in DepMap with corresponding CERES data are taken forward for analysis. A Principal Component Analysis (PCA) based on the CERES scores was run.

[0233] To evaluate ALT dependency, the following parameters were considered:TEL (Telomerase positive cell lines) dependent genes are defined as those with a gene-effect score consistently below zero for all TEL+ cell lines from a given panel.ALT.WT (ALT positive cell lines with wt ATRX) dependent genes are defined as those with a gene-effect score below -1 in at least 1 ALT.WT cell line from a given panel, that is also not TEL dependent.ALT. NF (ALT positive cell lines with non-functional ATRX, i.e., loss of ATRX, ATRX mutation) dependent genes are defined as those with a gene-effect score below -1 in at least 1 ALT. NF cell line from a given panel that is also not TEL dependent.ALT.in_frame_fusion = ALT positive cell lines with an ATRX in-frame fusion, neuroblastoma only.

[0234] The following analysis was performed:Heatmaps: The heatmap shows a combined view of all genes. Data are scaled as per gene z- scores based on the CERES gene-effect data for the purposes of visualisation. This helps to accentuate the differences in gene-effect scores between samples.Volcano plot: Wilcoxon ranked-sum tests were used to highlight genes with “global” discriminatory gene-effect scores between TEL / ALT status groups. Genes highlighted show: * p-value <= 0.01 # unadjusted for multiple testing * effect-size <= -0.2 # difference in median gene-effect scores between populations, e.g. median(ALT) - median(TEL).Example 6 - Validation: II screen

[0235] The top hits selected from the primary screen evaluation were then validated using an arrayed secondary screen (Figure 4).

[0236] The constitutitive Cas9 cell lines were reverse transfected in 96 well format using the following assay condition: crRNA and tracrRNA (Dharmacon) were diluted to 200nM in HBSS and 10ul / well gRNA were transferred to a 96 well plate using a multichannel pipette. The transfection reagent was diluted in OptiMEM (to 0.1 ul reagent per 10ul OptiMEM)and 10ul / well diluted transfection reagent added to the assay plate using a multichannel pipette. After gently tap, the plate was incubated at RT for 20 mins and 80ul of cell suspension in media were added and incubated 5 or 7 Doubling time at 37C days before fixing, scanned and analysed by PerkinElmer Opera Phenix Plus High-Content Screening System (Crick HTS facility). Before performing the assay, transfection efficiency was optimized for each cell line.Example 7 - ATRX whole genome CRISPR-Cas9 dropout screenCell lines

[0237] A diploid eHAP cell line was used for the generation of ATRX knockouts. This cell line is a diploidized eHAP cell line (haploid originally purchased from Horizon Discovery), derived from KBM- 7 / HAP1 cell line (a male patient with a chronic myeloid leukemia). All eHAP cell lines were grown in IMDM media with 10% Tet-free FBS and 1% penicillin / streptomycin, at 37°C in 5% CO2. This cell line was then modified by a lentiviral integration of inducible Cas9, (iCas9) with an Edit-R inducible lentiviral Cas9 vector (Horizon Discovery), see reference [7], Cell line eHAP iCas9 was derived as a single clone from the pool of transduced cells after blasticidin selection, and was chosen based on a high cutting efficiency and negligible leakiness using a BFP / GFP reporter assay (Addgene #67980) [7].

[0238] Knockout of ATRX were made by transfection of the eHAP iCas9 cell line with synthetic tracrRNA / crRNA -targeting sequence GTTGTTATTGGACACTTGGT, exon 16 (clone 3). Upon transfection cells were incubated with doxycycline to induce the Cas9 expression for 72 hours, then cells were seeded in 96-well plates in order to derive single cell clones. The knockout clones were validated by immunoblotting for the levels of ATRX protein, sequencing the genomic DNA mutation and screened for iCas9 cutting efficiency (with the BFP / GFP reporter assay).Example 8 - Whole genome CRISPR-Cas9 dropout screen

[0239] Whole genome CRISPR-Cas9 dropout screen was performed as described [4]. eHAP iCas9 wild type or ATRX knockout cells were transduced with the lentiviral Brunello library (Addgene #73179- LV, sgRNA only vector). 100 million cells were transduced to achieve a multiplicity of infection (MOI) of 0.4 in three biologically independent transductions, selecting for a coverage of 500 cells per sgRNA. Transduced cells were selected with puromycin (0.4 pg / ml) for 48 hours, after which Cas9 expression was induced with doxycycline (1 pg / ml). Cells were subcultured in doxycycline for the initial 6 days and later subcultured without doxycycline, with representation of 40 million cells maintained at every step by passaging every two days. Cells were collected both at an early timepoint (Day 6 after Dox) and a late timepoint (Day 16 after Dox) with the rationale of identifying different sets of genes for which mechanisms of lethality may differ in timings. Samples for sequencing were harvested by washing 60 million cells in PBS, freezing cell pellets and storing at -80°C.

[0240] Genomic DNA was isolated with PureLink Genomic DNA Mini Kit (Invitrogen). Quantity of genomic DNA was measured by Nanodrop and Qubit (Invitrogen). From each sample 200pg of genomic DNA was then used for library preparation, with one-step amplification of genome-integrated sgRNAs by using P5 mix and P7 barcoded oligonucleotides in a PCR reaction with Ex Taq polymerase (TaKaRa) (Table 1). PCR products were purified by agarose gel extraction method using QIAquick Gel Extraction Kit (QIAGEN) and additionally purified using MinElute PCR Purification Kit (QIAGEN). Concentration of each PCR product was quantified with Qubit and 25 ng of PCR product at 4 nM was submitted for sequencing, before which samples went through quality control with Bioanalyzer. Libraries were sequenced using HiSeq 4000 with 100 bp reads (30 million reads per sample).

[0241] Table 1 : Oligonucleotides used for amplification of integrated sgRNAsExample 9 - Bioinformatic analysis of CRISPR-Cas9 screen

[0242] Raw data was trimmed by obtaining 20 bp after the first occurrence of “CACCG” in the read sequence. Trimmed reads were then mapped with BWA (version 0.5.9-r16) [8]. to a database of guide sequences for the human CRISPR Brunello lentiviral pooled library downloaded from Addgene (https: / / www.addgene.org / pooled-library / broaclgpp-human-knockout-brunello / ) with the parameters “-I 20 -k 2 -n 2.” sgRNA counts were obtained after filtering the mapped reads for those that had zero mismatches, and mapped to the forward strand of the guide sequence. The MAGeCK ‘test’ command (version 0.5.7) [9] was used to perform the sgRNA ranking analysis between the relevant conditions with parameters “-norm-method total-remove-zero both”. Two pairwise comparisons of samples were done: WT ‘day 6’ vs ATRX KO ‘day 6’ and WT ‘day 16’ vs ATRX KO ‘day 16’.Example 10 - Making inducible knockout cell lines for validation of ATRX KO CRISPR screen

[0243] Inducible CRISPR knockout cell lines were generated by transducing wild type and ATRX knockout iCas9 cells with lentivirus produced from either the lenti-sgRNA puro construct (Addgene #104990) or the lenti-sgRNA hygro construct (Addgene #104991), target sequences of sgRNAs are listed in Table 2. Transductants were selected a after one day of recovery using puromycin (0.4 pg / ml) or hygromycin (0.4 mg / ml) for 48-72 hours. Inducible knockout of target proteins was confirmed by immunoblotting following 96 h 1 pg / ml doxycycline, or where antibodies were unavailable, genomic DNA sequencing of the pooled edited population. To produce lentivirus, 900,000 293 FT cells in a 6 well plate were transfected with packaging plasmids (566 ng of pLP1 , 266 ng of pLP2, 370 ng of pLPA / SVG) along with 1 pg of lenti-sgRNA plasmid using 4 pL Lipofectamine 2000 (Life Technologies / Thermo Fisher) as per the manufacturer’s instructions. Medium was refreshed 18 hours later. Virus-containing supernatant was collected 72 hours post transfection, cleared through a 0.45-pm filter, supplemented with 8 pg / ml polybrene (Sigma) and used for infection of target cells.

[0244] Table 2: sgRNA target sequencesExample 11 - Generation of inducible knockout cell lines complemented with UBA5-wt or C250A mutant

[0245] Wild type and ATRX knockout iCas9 cells containing integrated NTC / UBA5 sgRNA were complemented with UBA5-wt or C250A mutant. Cells were generated by co-transfecting with transposase vector and a piggybac-EF1a-puro vector using Lipofectamine 2000 (Life Technologies / Thermo Fisher). The piggybac vector was either an empty vector, or contained the UBA5 cDNA with a C-terminal 3xFlag tag and with a silent mutation making it sgRNA resistant either in its wild type form (UBA5-3xFlag WT) or with the Cys250Ala mutation (UBA5-C250A-3xFlag). Integrants were selected a after one day of recovery using puromycin (0.4 pg / ml) for 72 hours. Cells were validated by immunoblotting based on Flag / UBA5-expression and UFM1 -conjugated protein levels.Example 12 - Validation of synthetic lethal hits from ATRX KO CRISPR screen

[0246] To investigate synthetic lethality due to the loss of the respective gene in ATRX KO background, viability of cells was assessed using two independent methods: clonogenic survival assay and cell viability assay with CellTiter-Glo (Promega). Each eHAP iCas9 cell line was grown in the presence of doxycycline (1 pg / ml) for 96 hours to induce Cas9 expression in cells with integrated sgRNAs (nontargeting sgRNA or sgRNA for the identified hit from the screen). Cells were then counted and seeded for viability assays (described in detail below). In addition, cells were harvested for immunoblotting to assess the loss of protein upon inducible knockout induction. Viability of each cell line was assessed in three independent biological experiments.

[0247] For clonogenic survival assays, 200 cells per well were seeded in 24 well plates for (in technical triplicate for each dilution). Colonies were grown for 6 days when they were fixed and stained with 0.5% crystal violet solution with 20% methanol. Plates were then scanned and analysed using GelCount (Oxford Optronics). Images and mean value for technical replicates of wells with 200 cells seeded were used for the subsequent analysis. Value for eHAP iCas9 wild type cell line with an integrated NTC sgRNA was used for the normalisation.

[0248] For cell viability assay with Cell Titer Gio, 200 cells per well were seeded in opaque 96 well plates in technical triplicates. They were grown for 6 days before cell lysis with CellTiter-Glo reagent and luminescence readout on CLARIOStar microplate reader (BMG Labtech). For each cell line a mean value was calculated from a technical triplicate. Mean value for eHAP iCas9 wild type cell line with an integrated NTC sgRNA was used for the normalisation.Example 13 - Immunoblotting

[0249] Immunoblotting analyses of whole cell lysates were performed using standard immunoblotting techniques with commercially available primary antibodies (Table 3), subsequently incubated with appropriate secondary antibodies conjugated to a horseradish peroxidase (HRP). Chemiluminescence was acquired using GelDoc system (Bio-Rad) and Clarity and Clarity Max reagents (Bio-Rad).

[0250] Table 3: AntibodiesExample 14 - ssTELOC screen materials and methods

[0251] 384-well plates containing pooled crRNA guides (4 guides per gene) against unique individual genes covering -20,000 genes (Horizon crRNA whole-genome library) within the human genome were aliquoted out with 2 full columns of wells on either side kept blank for crRNA controls. crRNA pools against non-targeting control, FANCM, SMARCAL1 , PML, POLD3 were used as controls in the control columns. All crRNAs were aliquoted from a 200nM stock in Hank’s Balanced Salt Solution with 2.5ul added to each well. 5ul of DharmafectDuo reagent (stock: 3.5ml DharmafectDuo in 434 ml of Opti- MEM™) were added to each well and left for at least 20 mins before 80ul of Cal72 cells (stock: 9375 cells per 1 ml) were added for reverse transfection. After addition of cells, plates were incubated at 37 degrees Celsius and 5% CO2. After 6 days, cells were fixed in 20ul of 20% formaldehyde for 30mins, this was followed by 3 washes with PBS. Plates were then blocked in antibody dilution buffer (recipe below) along with 100ug / ml RNASE A at 37 degrees Celsius for 1 hour. Plates were washed 3 times with PBS followed by incubation with 20ul of pRPA p33 antibody (Catalog # A300-246A Santa Cruz) at 1 :8000 dilution in ADB for 1 hour at room temperature then with 20ul of goat anti-rabbit AlexaFluor-647 secondary antibody (Cat # A-21244) at 1 :1000 dilution in ADB for 1 hour at room temperature, with 3 washes of PBS before and after secondary antibody. Plates were then washed / dehydrated with 10Oul per well of 70% ethanol then 90% ethanol then 99% ethanol. Plates were then made dry as possible before being left to dry completely for around 20mins. When plates are dry, 20ul of TELOG TAMRA PNA probe in hybridisation buffer (recipe below) at 1 :10,000 dilution were added to each well. Plates were left in the dark at room temperature for 2 hours. Plates were then washed 2 times with PBS and 20ul of DAPI (1 :10,000 in PBS) was added for 5mins at least. Plates were then washed 3 times with PBS with 10Oul PBS left in each plate after which plates were sealed and stored at 4 degrees Celsius. Plates were scanned and analysed by PerkinElmer Opera Phenix Plus High-Content Screening System.ADB - antibody dilution buffer0.1 % Triton X-1000.1 % Saponin 10% goat serum 1x PBSHybridisation Buffer:70% Formamide1 mg / ml blocking reagent (Roche - stocks in -20)10 mM Tris-HCI pH 7.5 (pH 7-8 all fine) H2OExample 15 - ssTELOC hit validation screenTo identify novel regulators of ALT, the top 417 hits which contained both repressors and drivers of ALT found in the whole genome ssTELOC screen (Example 14) were chosen for further validation, a display of hit selection is shown in Figure 8. A cherry-picked library containing crRNA pools (4 unique crRNA guides) against these hits were then used in the following cell lines (which all constitutively expressed Cas9) to generate KO of our targets. The same ssTELOC assay as Example 15 was then carried out which provided measurements of change in ssTELOC activity and nuclei count representing cell viability changes. This was done in 6 cell lines in total to validate our initial hits, 4 validated ALT positive - Cal72 (same as primary screen), NY, U2OS, G292 and 2 validated ALT negative - HT1080, SJSA-1. The validation screen was carried out in identical fashion to Example 14, bar the following modifications per cell line:• Cal72 - conditions were kept identical• G292 - 0.08ul of Lullaby transfection reagent was used in 5ul of Opti-MEM™ per well in 384- well plates. 1000 cells in 90ul of cell culture media were added to the transfection reagent and crRNA / tracrRNA mixture. Plates were fixed after 4 days.• NY - 0.05ul of DharmaFECT 2 transfection reagent was used in 5ul of Opti-MEM™ per well in 384-well plates. 1200 cells in 90ul of cell culture media were added to the transfection reagent and crRNA / tracrRNA mixture. Plates were fixed after 5 days.U2OS - 0.06ul of Lipofectamine™ RNAiMAX transfection reagent was used in 5ul Opti- MEM™ per well in 384-well plates. 600 cells in 90ul of cell culture media were added to the transfection reagent and crRNA / tracrRNA mixture. Plates were fixed after 5 days.HT1080 - 0.06ul Lipofectamine™ CRISPRMAX™ transfection reagent was used in 5ul Opti- MEM™ per well in 384-well plates. 1000 cells in 90ul of cell culture media were added to the transfection reagent and crRNA / tracrRNA mixture. Plates were fixed after 4 days.• SJSA-1 - 0.04ul Dharmafect 3 transfection reagent was used in 5ul of Opti-MEM™ per well in 384-well plates. 1200 cells in 90ul of cell culture media were added to the transfection reagent and crRNA / tracrRNA mixture. Plates were fixed after 5 days.After staining and quantification, we found several novel targetable protein regulators of ALT, In addition to measuring changes in ssTELOC (regulation of ALT activity), to determine whether these hits could cause differential toxicity in and ALT positive background, two parameters were calculated for each hit from the validation screen. All parameters were quantified as percentage of change (POC) to transfection of the non-targeted control crRNA.1 . Differential rank nuclei count - each gene KO was ranked based on their effect on nuclei count (cellular viability) in each individual cell line. Then the differential mean rank between the ALT positive cell lines and the ALT negative cell lines were calculated with a negative rank suggesting that crRNA KO of that particular gene caused increased toxicity in ALT positive cell lines versus ALT negative cell lines.2. Differential mean POC nuclei count - each gene KO and their differential effect on nuclei count in ALT positive cell lines was compared to their effect on ALT negative cell lines, the means of their effects were taken.From these results, we prioritised overlap with our other screening approaches (Telomere-proteome, bioinformatics screening, ATRX KO whole genome dropout screening) as bona fide novel targetable regulators of the ALT process. Furthermore, it has previously been shown that gene deficiencies (FANCM and its binding partners) of ALT repressors which cause “Hyper-ALT” cause differential cell death in ALT positive cell lines, however genes which drive the ALT process (PML, BLM, TOP3A, RMI2) or genes which show no perturbation of ALT activity have not been shown to be vulnerabilities for ALT cancers. We show here that in addition to novel vulnerabilities which represent ALT repressors and cause “Hyper-ALT” upon knock out, we also identify novel vulnerabilities which when knocked out either reduce ALT activity or show no effect on ALT activity as measured by ssTELOC, representing a new class of ALT genetic vulnerabilities.Vulnerabilities in the mevalonate synthesis pathway:The mevalonate synthesis pathway is a metabolic pathway which synthesises sterol isoprenoids such as cholesterol. From the approaches above, we independently found 3 members of the pathway which act in sequence of each other to use pyrophosphate intermediates to produce squalene (Figure 9, 10, 11).The hits we found from the screening approaches are the following:• IDI-1 - Isopentenyl-Diphosphate Delta Isomerase 1 - an enzyme that catalyses the reversible conversion of DMAPP (dimethylallyl pyrophosphate) to IPP (isopentenyl pyrophosphate) (Figure 11)• FDPS - Farnesyl Diphosphate Synthase - an enzyme that produces (FPP) farnesyl pyrophosphate through the addition of IPP• FDFT-1 - Farnesyl-Diphosphate Farnesyltransferase 1 - an enzyme that produces squalene using IPP and FPP as substrates (Figure 10)To validate these three hits, stable inducible Cas9 cell lines were generated which constitutively expressed sgRNA against IDI-1 , FDPS, FDFT-1 in the ALT positive U2OS cell line and ALT negative SJSA-1 and HT1080 cell lines. Knockdown of each protein was achieved and their effect on cell growth was assessed by Incucyte. These results show that both IDI-1 and FDPS are bona fide vulnerabilities in cell lines which rely on ALT as they caused a strong loss in cellular viability in ALT positive cell lines only. IDI-1 knockout causes minor changes in ssTELOC in Cal72 and U2OS cell lines suggesting it has ALT specific effects.Targeting ALT driversIt has previously been shown that repressors of ALT are possible genetic vulnerabilities, we identify genes which when knocked out cause universal loss of ALT activity and causes differential sensitivity in ALT positive cancer cell lines. In addition, these hits show overlap with our ALT-telomere-proteome screening approach (Figure 12B).• CPSF6 - Cleavage And Polyadenylation Specific Factor 6, a regulator of mRNA polyadenylation and forms a complex with CPSF1. CPSF1 was a genetic vulnerability found in the ALT- telomere-proteome screening approach and showed strong differential sensitivity against ALT positive cancer cell lines (Figure 13). This gives confidence that CPSF1 and CPSF6 and other members of the CPSF complex are vulnerabilities in ALT positive cancers. CPSF6 also caused universal loss of ssTELOC ALT activity in the ssTELOC validation screen which confirms it is a driver of ALT. We will use a molecular inhibitor against the catalytic member of the CPSF complex, cleavage and polyadenylation specificity factor subunit 3 (CPSF3), (JTE-607) against a panel of ALT positive and ALT negative cancer cell lines to identify if the CPSF complex is a molecularly targetable vulnerability in ALT cancers (Figure 1 1 , 12B).• ZNF207 - Zinc finger protein 207, a transcription factor which has no previously identified roles in ALT. ZNF207 was found to be a genetic vulnerability which was identified in the ALT- telomere-proteome screening approach. It also caused differential sensitivity in the ssTELOC validation screen and caused universal loss of ssTELOC ALT acitvity in all 4 ALT positive cell lines in the ssTELOC validations screen (Figure 1 1 , 12B).Novel ALT repressor genetic vulnerabi ItiiesSimilar to FANCM which causes “Hyper-ALT”, we identified novel genetic vulnerabilities which caused hyper-activation of ALT activity and associated toxicity in ALT positive cancer cell lines.• NRF1 - Nuclear Respiratory Factor 1 , a transcription factor which was identified in both the ALT-telomere-proteome and ssTELOC screening approaches as a genetic vulnerability in ALT positive cancer cell lines. NRF1 KO causes a “Hyper-ALT” phenotype (ssTELOC validation screen) which validates it as specific ALT regulator suggesting its toxicity is also specific to ALT positive cancers (Figure 11 , 12A).• XPO1 - Exportin-1 , a protein involved in the nuclear export of proteins and mRNA. XPO1 KO causes a “Hyper-ALT” phenotype in ALT positive cancer cell lines suggesting it has a novel role in regulating ALT activity. It also causes strong toxicity in ALT positive cancer cell lines. The XPO1 inhibitor, Selinexor can be used to determine whether small molecular inhibitors can recapitulate the genetic vulnerability in ALT positive cancers (Figure 1 1 , 12A).Example 16 - Drugging ALT cell line panelMaterials and methods10 ALT-positive patient derived cell lines (CAL72, CHLA90, G292, GBM2, HUO9, NY, SAOS2, SJCHR30, SKLU1 and U2OS) and 10 ALT-negative patient derived cell lines (143B, CHLA200, H460, HELA, HT1080, KNS42, RD, SH-Sy5Y and SJSA1) were seeded for 24 hours then treated with alendronate (Figures 14 and 15), risedronate (Figures 16 and 17) or JTE-607 (Figures 18 and 19), separately at the doses indicated in Figures 14 to 19. After 4-5 days, cells were fixed in 4% PFA and then nuclei were stained with DAPL Cells were then counted using Celigo plate scanner at the wholewell level. Mean of the cell count was taken with standard deviation plotted as error bars.Summary of resultsUsing inhibitors against FDPS, risedronate and alendronate, we were able to cause ALT-specific cell killing. By generating dose response curves using risedronate and alendronate, we obtained IC50 values in the 20 different cell lines. When we compared the IC50S of ALT-positive versus ALT-negative, we see a statistically significant decrease in IC50 for both risedronate (median ALT-negative IC50 91 .5 uM vs median ALT-positive IC50 15.1 uM) and alendronate (median ALT-negative IC5035.2 uM vs median ALT- positive IC50 6.7uM). Using JTE-607, an inhibitor against CPSF3, the catalytic subunit of the CPSF complex, we were able to also cause statistically significant selective ALT-positive cell killing in the cell line panel (median ALT-negative IC50 2.8 uM vs median ALT-positive IC50 0.5 uM).Significance of resultsUsing a panel of patient-derived ALT positive cancer cell lines against a panel of patient derived ALT negative cancer cell lines, we were able to show differential toxicity against ALT positive cancers using inhibitors against FDPS (risedronate and alendronate) and CPSF3 (JTE-607) showing they are validated protein targets for the treatment of ALT cancers.

[0252] Further embodiments of the present invention are described below:1. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an inhibitor for one or more genes selected from the list consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor 11 IC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl- Diphosphate Delta Isomerase 1 (ID11 ), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L11 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate-binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1) to the subject.2. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of one or more genes selected from the list consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor 11 IC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl- Diphosphate Delta Isomerase 1 (IDI1), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L11 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate-binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1). A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an inhibitor for one or more genes selected from the list consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor 11 IC subunit 3 (GTF3C3) and tRNA methyltransferase 6 (TRMT6) to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of one or more genes selected from the list consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signalrecognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor 11 IC subunit 3 (GTF3C3) and tRNA methyltransferase 6 (TRMT6). A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an inhibitor for one or more genes selected from the list consisting of: growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl-Diphosphate Delta Isomerase 1 (ID11), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L11 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate-binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1) to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of one or more genes selected from the list consisting of: growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), Isopentenyl-Diphosphate Delta Isomerase 1 (ID11), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L11 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate-binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1).The method according to any one of embodiments 1 to 6, wherein the one or more genes are chaperone proteins.The method according to embodiment 7, wherein the one or more genes are selected from the list consisting of heat shock protein family D (Hsp60) member 1 (HSPD1). The method according to any one of embodiments 1 to 6, wherein the one or more genes are enzymes. The method according to embodiment 9, wherein the one or more genes are selected from the list consisting of lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), transketolase (TKT), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), DNA methyltransferase 1 (DNMT1), tRNA methyltransferase 6 (TRMT6), ubiquitin like modifier activating enzyme 5 (UBA5), Isopentenyl-Diphosphate Delta Isomerase 1 (IDI1), RuvB-like 1 (RUVBL1), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), polyadenylate-binding protein 2 (PABPN1) and aldolase A (ALDOA). The method according to any one of embodiments 1 to 6, wherein the one or more genes are scaffold proteins. The method according to embodiment 11 , wherein the one or more genes are selected from the list consisting of COP9 signalosome subunit 4 (COPS4), proteasome subunit beta type-1 (PSMB1), IK cytokine (IK), SDS3 homolog SIN3A corepressor complex component (SUDS3), proteasome activator complex subunit 3 (PSME3), growth factor receptor bound protein 2) (GRB2), RING-box protein 1 (RBX1), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), ring finger protein 113A (RNF113A) and pre-mRNA processing factor 8 (PRPF8). The method according to any one of embodiments 1 to 6, wherein the one or more genes are transcription factors. The method according to embodiment 13, wherein the one or more genes are selected from the list consisting of zinc finger protein 207 (ZNF207), general transcription factor I IIC subunit 3 (GTF3C3) and nuclear respiratory factor 1 (NRF1). The method according to any one of embodiments 1 to 6, wherein the one or more genes are transporter proteins.The method according to embodiment 15, wherein the one or more genes are selected from the list consisting of nucleoporin 155 (NUP155), complement C1Q binding protein (C1QBP), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1) and mRNA export factor (RAE1). The method according to any one of embodiments 1 to 6, wherein the one or more genes are part of the SUMO activating enzyme complex. The method according to embodiment 17, wherein the one or more genes are selected from the list consisting of ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9) and RAN binding protein 2 (RANBP2). The method according to any one of embodiments 1 to 6, wherein the one or more genes are part of the SUMO activating enzyme complex (G0:0031510). The method according to embodiment 19, wherein the one or more genes are selected from the list consisting of ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), and RAN binding protein 2 (RANBP2). The method according to any one of embodiments 1 to 6, wherein the one or more genes have Ubiquitin-like modifier activating enzyme activity (G0:0008641). The method according to embodiment 21 , wherein the one or more genes are selected from the list consisting of ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), ubiquitin like modifier activating enzyme 5 (UBA5), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9) and RAN binding protein 2 (RANBP2). The method according to any one of embodiments 1 to 6, wherein the one or more genes are part of the proteosome complex (G0:0000502). The method according to embodiment 23, wherein the one or more genes are selected from the list consisting of proteasome 20S subunit beta 1 (PSMB1), proteasome activator complex subunit 3 (PSME3), proteasome 20S subunit alpha 4 (PSMA4) and proteasome 20S subunit alpha 5 (PSMA5). The method according to any one of embodiments 1 to 6, wherein the one or more genes are involved in the regulation of mRNA metabolic processes (GO:1903311).The method according to embodiment 25, wherein the one or more genes are selected from the list consisting of proteasome 20S subunit beta 1 (PSMB1), proteasome activator complex subunit 3 (PSME3), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), complement C1Q binding protein (C1QBP), 60S ribosomal protein L11 (RPL11) and 60S ribosomal protein L10a (RPL10A). The method according to any one of embodiments 1 to 6, wherein the one or more genes are involved in mRNA splicing (G0:0000398). The method according to embodiment 27, wherein the one or more genes are selected from the list consisting of cleavage and polyadenylation specific factor 1 (CPSF1), IK cytokine (IK), proline rich mitotic checkpoint control factor (PRCC), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), cleavage and polyadenylation specificity factor subunit 6 (CPSF6) and polyadenylate-binding protein 2 (PABPN1). The method according to any one of embodiments 1 to 6, wherein the one or more genes are involved in tRNA processing (G0:0008033). The method according to embodiment 29, wherein the one or more genes are selected from the list consisting of cleavage and polyadenylation specific factor 1 (CPSF1), tRNA methyltransferase 6 (TRMT6), cleavage and polyadenylation specificity factor subunit 6 (CPSF6) and polyadenylate-binding protein 2 (PABPN1). The method according to any one of embodiments 1 to 6, wherein the one or more genes are involved in RNA export from the nucleus (G0:0006405). The method according to embodiment 31 , wherein the one or more genes are selected from the list consisting of cleavage and polyadenylation specific factor 1 (CPSF1), nucleoporin 155 (NUP155), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), cleavage and polyadenylation specificity factor subunit 6 (CPSF6) and polyadenylate-binding protein 2 (PABPN1). The method according to any one of embodiments 1 to 6, wherein the one or more genes are involved in chromatin regulation. The method according to embodiment 33, wherein the one or more genes are selected from the list consisting of lysine acetyltransferase 5 (KAT5), corepressor complex component (SUDS3), DNA methyltransferase 1 (DNMT1) and RuvB-like 1 (RUVBL1).The method according to any one of embodiments 1 to 6, wherein the one or more genes are involved in negative regulation of the mitotic cell cycle (G0:0045930). The method according to embodiment 35, wherein the one or more genes are selected from the list consisting of zinc finger protein 207 (ZNF207), IK cytokine (IK), proline rich mitotic checkpoint control factor (PRCC), ring finger protein 113A (RNF113A) and pre- mRNA processing factor 8 (PRPF8). The method according to any one of embodiments 1 to 6, wherein the one or more genes are involved in positive regulation of apoptotic processes (G0:0043065). The method according to embodiment 37, wherein the one or more genes are selected from the list consisting of ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SI N3A corepressor complex component (SUDS3), complement C1Q binding protein (C1QBP), heat shock protein family D (Hsp60) member 1 (HSPD1), 60S ribosomal protein L11 (RPL11) and 60S ribosomal protein L10a (RPL10A). The method according to any one of embodiments 1 to 6, wherein the one or more genes are involved in the MyD88-dependent toll-like receptor signalling pathway (G0:0002755). The method according to embodiment 39, wherein the one or more genes are selected from the list consisting of ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), heat shock protein family D (Hsp60) member 1 (HSPD1), 60S ribosomal protein L11 (RPL11) and 60S ribosomal protein L10a (RPL10A). The method according to any one of embodiments 1 to 6, wherein the one or more genes are involved in intracellular protein transmembrane transport (G0:0065002). The method according to embodiment 41 , wherein the one or more genes are selected from the list consisting of signal recognition particle 54 (SRP54) and heat shock protein family D (Hsp60) member 1 (HSPD1). The method according to any one of embodiments 1 to 6, wherein the one or more genes are ALT repressors. The method according to embodiment 43, wherein the one or more genes are selected from the list consisting of nuclear respiratory factor 1 (NRF1), nucleoporin GLE1 (GLE1), polyadenylate-binding protein 2 (PABPN1), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), mRNA export factor (RAE1), RAN bindingprotein 2 (RANBP2), RING-box protein 1 (RBX1), ring finger protein 113A (RNF113A), RU RuvB-like 1 (RUVBL1) and enhanced exportin 1 (XPO1). The method according to any one of embodiments 1 to 6, wherein the one or more genes are ALT drivers. The method according to embodiment 45, wherein the one or more genes are selected from the list consisting of aldolase A (ALDOA), cleavage and polyadenylation specificity factor subunit 6 (CPSF6), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9) and zinc finger protein 207 (ZNF207). A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an inhibitor for one or more genes selected from the list consisting of: Isopentenyl-Diphosphate Delta Isomerase 1 (ID11 ) and farnesyl diphosphate synthase (FDPS) to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of one or more genes selected from the list consisting of: Isopentenyl-Diphosphate Delta Isomerase 1 (ID11 ) and farnesyl diphosphate synthase (FDPS). A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an inhibitor for one or more genes selected from the list consisting of: cleavage and polyadenylation specificity factor subunit 6 (CPSF6) and zinc finger protein 207 (ZNF207) to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of one or more genes selected from the list consisting of: cleavage and polyadenylation specificity factor subunit 6 (CPSF6) and zinc finger protein 207 (ZNF207). A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an inhibitor for one or more genes selected from the list consisting of: nuclear respiratory factor 1 (NRF1) and enhanced exportin 1 (XPO1) to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of one or more genes selected from the list consisting of: nuclear respiratory factor 1 (NRF1) and enhanced exportin 1 (XPO1).A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a lysine acetyltransferase 5 (KAT5) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of lysine acetyltransferase 5 (KAT5). A lysine acetyltransferase 5 (KAT5) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a lysine acetyltransferase 5 (KAT5) inhibitor to the subject. The method or KAT5 inhibitor for use according to any one of embodiments 1-6 or 53-55, wherein the KAT5 protein comprises the sequence of SEQ ID NO:1 (PDB reference:20 U2). A KAT5 inhibitor that specifically inhibits a KAT5 protein having a structure defined by PDB reference 2OU2. The method or KAT5 inhibitor for use according to any one of embodiments 1-6 or 53-57, wherein the KAT5 inhibitor is selected from the list consisting of: MG 149 (CAS: 1243583- 85-8), Nu9056 (CAS: 1450644-28-6) and NVP-2 (CAS: 1263373-43-8). A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a cleavage and polyadenylation specific factor 1 (CPSF1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of cleavage and polyadenylation specific factor 1 (CPSF1). A cleavage and polyadenylation specific factor 1 (CPSF1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a cleavage and polyadenylation specific factor 1 (CPSF1) inhibitor to the subject. The method or CPSF1 inhibitor for use according to any one of embodiments 1-6 or 59- 61 , wherein the CPSF1 protein comprises the sequence of SEQ ID NO:2 (PDB reference 6BM0). A CPSF1 inhibitor that specifically inhibits a CPSF1 protein having a structure defined by PDB reference 6BM0.A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a B-TFIID TATA-box binding protein associated factor 1 (BTAF1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of B-TFIID TATA-box binding protein associated factor 1 (BTAF1). A B-TFIID TATA-box binding protein associated factor 1 (BTAF1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a B-TFIID TATA-box binding protein associated factor 1 (BTAF1) inhibitor to the subject. The method or BTAF1 inhibitor for use according to any one of embodiments 1-6 or 64-66, wherein the BTAF1 protein comprises a sequence of SEQ ID NO: 3 (AlphaFold reference: 014981) A BTAF1 inhibitor that specifically inhibits a BTAF1 protein having a structure defined by AlphaFold reference: 014981. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a signal recognition particle 54 (SRP54) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of signal recognition particle 54 (SRP54). A signal recognition particle 54 (SRP54) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a signal recognition particle 54 (SRP54) inhibitor to the subject. The method or SRP54 inhibitor for use according to any one of embodiments 1-6 or 69- 71 , wherein the SRP54 protein comprises the sequence of SEQ ID N0:4 (PDB reference 6Y2Z). An SRP54 inhibitor that specifically inhibits an SRP54 protein having a structure defined by PDB reference 6Y2Z. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a COP9 signalosome subunit 4 (COPS4) inhibitor to the subject.A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of COP9 signalosome subunit 4 (COPS4). A COP9 signalosome subunit 4 (COPS4) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a COP9 signalosome subunit 4 (COPS4) inhibitor to the subject. The method or COPS4 inhibitor for use according to any one of embodiments 1-6 or 74- 76, wherein the COPS4 protein comprises the sequence of SEQ ID NO:5 (PDB reference 4D09). A COPS4 inhibitor that specifically inhibits a COPS4 protein having a structure defined by PDB reference 4D09. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome 20S subunit beta 1 (PSMB1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of proteasome 20S subunit beta 1 (PSMB1). A proteasome 20S subunit beta 1 (PSMB1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome 20S subunit beta 1 (PSMB1) inhibitor to the subject. The method or PSMB1 inhibitor for use according to any one of embodiments 1-6 or 79- 81 , wherein the PSMB1 protein comprises the sequence of SEQ ID NO:6 (PDB reference 7NHT). A PSMB1 inhibitor that specifically inhibits a PSMB1 protein having a structure defined by PDB reference 7NHT. The method or PSMB1 inhibitor for use according to any one of embodiments 1-6 or 81- 83, wherein the PSMB1 inhibitor is selected from the list consisting of: bortezomib (CAS: 179324-69-7), carfilzomib (CAS: 868540-17-4) and ixazomib (1072833-77-2). A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a zinc finger protein 207 (ZNF207) inhibitor to the subject.A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of zinc finger protein 207 (ZNF207). Azinc finger protein 207 (ZNF207) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a zinc finger protein 207 (ZNF207) inhibitor to the subject. The method or ZNF207 inhibitor for use according to any one of embodiments 1-6 or 85- 87, wherein the ZNF207 protein comprises the sequence of SEQ ID NO:7 (AlphaFold reference: 043670). AZNF207 inhibitor that specifically inhibits a ZNF207 protein having a structure defined by AlphaFold reference 043670. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an IK cytokine (IK) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of IK cytokine (IK). An IK cytokine (IK) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an IK cytokine (IK) inhibitor to the subject. The method or IK inhibitor for use according to any one of embodiments 1-6 or 90-92, wherein the IK protein comprises the sequence of SEQ ID NO:8 (PDB reference 6Q8I). An IK inhibitor that specifically inhibits an IK protein having a structure defined by PDB reference 6Q8I. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nucleoporin 155 (NUP155) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of nucleoporin 155 (NUP155). A nucleoporin 155 (NUP155) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nucleoporin 155 (NUP155) inhibitor to the subject.The method or NUP155 inhibitor for use according to any one of embodiments 1-6 or 95- 97, wherein the NUP155 protein comprises the sequence of SEQ ID NO:9 (PDB reference 7R1Y). A NUP155 inhibitor that specifically inhibits a NUP155 protein having a structure defined by PDB reference 7R1Y. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin A- 52 residue ribosomal protein fusion product 1 (UBA52) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52). A ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52) inhibitor to the subject. The method or UBA52 inhibitor for use according to any one of embodiments 1-6 or 100- 102, wherein the UBA52 protein comprises the sequence of SEQ ID NO:10 (AlphaFold reference P62987). A UBA52 inhibitor that specifically inhibits a UBA52 protein having a structure defined by AlphaFold reference P62987. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a SDS3 homolog, SIN3A corepressor complex component (SUDS3) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of SDS3 homolog, SI N3A corepressor complex component (SUDS3). A SDS3 homolog, SIN3A corepressor complex component (SUDS3) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a SDS3 homolog, SIN3A corepressor complex component (SUDS3) inhibitor to the subject.The method or SUDS3 inhibitor for use according to any one of embodiments 1-6 or 105- 107, wherein the SUDS3 protein comprises the sequence of SEQ ID NO:11 (AlphaFold reference Q9H7L9). A SUDS3 inhibitor that specifically inhibits a SUDS3 protein having a structure defined by AlphaFold reference Q9H7L9. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a complement C1Q binding protein (C1QBP) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of complement C1Q binding protein (C1QBP). A complement C1Q binding protein (C1QBP) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a complement C1Q binding protein (C1QBP) inhibitor to the subject. The method or C1QBP inhibitor for use according to any one of embodiments 1-6 or 11Q- 112, wherein the C1QBP protein comprises the sequence of SEQ ID NO:12 (PDB reference 3RPX). A C1QBP inhibitor that specifically inhibits a C1QBP protein having a structure defined by PDB reference 3RPX. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a transketolase (TKT) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of transketolase (TKT). A transketolase (TKT) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a transketolase (TKT) inhibitor to the subject. The method or TKT inhibitor for use according to any one of embodiments 1-6 or 115-117, wherein the TKT protein comprises the sequence of SEQ ID NO: 13 (PDB reference 3OOY).A TKT inhibitor that specifically inhibits a TKT protein having a structure defined by PDB reference 3OOY. The method or TKT inhibitor for use according to any one of embodiments 1-6 or 115-119, wherein the TKT inhibitor is N3PT. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a heat shock protein family D (Hsp60) member 1 (HSPD1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of heat shock protein family D (Hsp60) member 1 (HSPD1). A heat shock protein family D (Hsp60) member 1 (HSPD1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a heat shock protein family D (Hsp60) member 1 (HSPD1) inhibitor to the subject. The method or HSPD1 inhibitor for use according to any one of embodiments 1-6 or 121- 123, wherein the HSPD1 protein comprises the sequence of SEQ ID NO:14 (PDB reference 7AZP). A HSPD1 inhibitor that specifically inhibits a HSPD1 protein having a structure defined by PDB reference 7AZP. The method or HSPD1 inhibitor for use according to any one of embodiments 11-6 or 121- 125, wherein the HSPD1 inhibitor is KHS101 . A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome activator complex subunit 3 (PSME3) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of proteasome activator complex subunit 3 (PSME3). A proteasome activator complex subunit 3 (PSME3) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome activator complex subunit 3 (PSME3) inhibitor to the subject.The method or PSME3 inhibitor for use according to any one of embodiments 1-6 or 127-129, wherein the PSME3 protein comprises the sequence of SEQ ID NO:15 (PDB reference 7YQC). A PSME3 inhibitor that specifically inhibits a PSME3 protein having a structure defined by PDB reference 7YQC. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin like modifier activating enzyme 5 (UBA5) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of ubiquitin like modifier activating enzyme 5 (UBA5). A ubiquitin like modifier activating enzyme 5 (UBA5) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin like modifier activating enzyme 5 (UBA5) inhibitor to the subject. The method or UBA5 inhibitor for use according to any one of embodiments 1-6 or 132- 134, wherein the UBA5 protein comprises the sequence of SEQ ID NO:16 (PDB reference 6H77). A UBA5 inhibitor that specifically inhibits a UBA5 protein having a structure defined by PDB reference 6H77. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a farnesyl diphosphate synthase (FDPS) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of farnesyl diphosphate synthase (FDPS). A farnesyl diphosphate synthase (FDPS) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a farnesyl diphosphate synthase (FDPS) inhibitor to the subject. The method or FDPS inhibitor for use according to any one of embodiments 1-6 or 137-139, wherein the FDPS protein comprises the sequence of SEQ ID NO:17 (PDB reference 3RYE).A FDPS inhibitor that specifically inhibits a FDPS protein having a structure defined by PDB reference 3RYE. The method or FDPS inhibitor for use according to any one of embodiments 1-6 or 137- 141 , wherein the FDPS inhibitor is selected from the list consisting of: risedronate, alendronate, minodronate and zoledronate. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin like modifier activating enzyme 2 (UBA2) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of ubiquitin like modifier activating enzyme 2 (UBA2). A ubiquitin like modifier activating enzyme 2 (UBA2) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin like modifier activating enzyme 2 (UBA2) inhibitor to the subject. The method or UBA2 inhibitor for use according to any one of embodiments 1-6 or MS- S, wherein the UBA2 protein comprises the sequence of SEQ ID NO:18 (PDB reference 1Y8Q). A UBA2 inhibitor that specifically inhibits a UBA2 protein having a structure defined by PDB reference 1Y8Q. The method or UBA2 inhibitor for use according to any one of embodiments 1-6 or 143- 147, wherein the UBA2 inhibitor is subasumstat (TAK-981). A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a SUM01 activating enzyme subunit 1 (SAE1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of SUMO1 activating enzyme subunit 1 (SAE1). A SUMO1 activating enzyme subunit 1 (SAE1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a SUMO1 activating enzyme subunit 1 (SAE1) inhibitor to the subject.The method or SAE1 inhibitor for use according to any one of embodiments 1-6 or 149-151 , wherein the SAE1 protein comprises the sequence of SEQ ID NO:19 (PDB reference 6X0G). A SAE1 inhibitor that specifically inhibits a SAE1 protein having a structure defined by PDB reference 6X0G. The method or SAE1 inhibitor for use according to any one of embodiments 1-6 or 149- 153, wherein the SAE1 inhibitor is subasumstat (TAK-981). A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proline rich mitotic checkpoint control factor (PRCC) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of proline rich mitotic checkpoint control factor (PRCC). A proline rich mitotic checkpoint control factor (PRCC) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proline rich mitotic checkpoint control factor (PRCC) inhibitor to the subject. The method or PRCC inhibitor for use according to any one of embodiments 1-6 or 155- 157, wherein the PRCC protein comprises the sequence of SEQ ID NO:20 (AlphaFold reference: H0YE12). A PRCC inhibitor that specifically inhibits a PRCC protein having a structure defined by AlphaFold reference H0YE12 . A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a DNA methyltransferase 1 (DNMT1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of DNA methyltransferase 1 (DNMT1). A DNA methyltransferase 1 (DNMT1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a DNA methyltransferase 1 (DNMT1) inhibitor to the subject.The method or DNMT1 inhibitor for use according to any one of embodiments 1-6 or 160- 162, wherein the DNMT1 protein comprises the sequence of SEQ ID NO:21 (PDB reference 4WXX). A DNMT1 inhibitor that specifically inhibits a DNMT1 protein having a structure defined by PDB reference 4WXX. The method or DNMT1 inhibitor for use according to any one of embodiments 1-6 or 160- 164, wherein the DNMT1 inhibitor is selected from the list consisting of: 5-Azacytidine and GSK-3484862. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a general transcription factor IIIC subunit 3 (GTF3C3) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of general transcription factor IIIC subunit 3 (GTF3C3). A general transcription factor IIIC subunit 3 (GTF3C3) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a general transcription factor IIIC subunit 3 (GTF3C3) inhibitor to the subject. The method or GTF3C3 inhibitor for use according to any one of embodiments 1-6 or 166- 168, wherein the GTF3C3 protein comprises the sequence of SEQ ID NO:22 (AlphaFold reference: H7C0C0). A GTF3C3 inhibitor that specifically inhibits a GTF3C3 protein having a structure defined by AlphaFold reference H7C0C0. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a tRNA methyltransferase 6 (TRMT6) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of tRNA methyltransferase 6 (TRMT6).AtRNA methyltransferase 6 (TRMT6) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a tRNA methyltransferase 6 (TRMT6) inhibitor to the subject. The method or TRMT6 inhibitor for use according to any one of embodiments 1-6 or 171- 173, wherein the TRMT6 protein comprises the sequence of SEQ ID NO:23 (PDB reference 5CCB). A TRMT6 inhibitor that specifically inhibits a TRMT6 protein having a structure defined by PDB reference 5CCB. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a growth factor receptor bound protein 2 (GRB2) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of growth factor receptor bound protein 2 (GRB2). A growth factor receptor bound protein 2 (GRB2) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a growth factor receptor bound protein 2 (GRB2) inhibitor to the subject. The method or GRB2 inhibitor for use according to any one of embodiments 1-6 or 176- 178, wherein the GRB2 protein comprises the sequence of SEQ ID NO:24 (PDB reference: 1JYQ). A GRB2 inhibitor that specifically inhibits a GRB2 protein having a structure defined by PDB reference 1JYQ. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a RING-box protein 1 (RBX1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of RING-box protein 1 (RBX1). A RING-box protein 1 (RBX1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a RING-box protein 1 (RBX1) inhibitor to the subject.The method or RBX1 inhibitor for use according to any one of embodiments 1-6 or 181- 183, wherein the RBX1 protein comprises the sequence of SEQ ID NO:25 (PDB reference: 2LGV). A RBX1 inhibitor that specifically inhibits a RBX1 protein having a structure defined by PDB reference 2LGV. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an Isopentenyl-Diphosphate Delta Isomerase 1 (IDI1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of Isopentenyl-Diphosphate Delta Isomerase 1 (IDI1). An Isopentenyl-Diphosphate Delta Isomerase 1 (ID11) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an Isopentenyl-Diphosphate Delta Isomerase 1 (ID11) inhibitor to the subject. The method or I D11 inhibitor for use according to any one of embodiments 1-6 or 186-188, wherein the IDI1 protein comprises the sequence of SEQ ID NO:26 (PDB reference: 2ICJ). An I D11 inhibitor that specifically inhibits an I D11 protein having a structure defined by PDB reference 2ICJ. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome 20S subunit alpha 4 (PSMA4) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of proteasome 20S subunit alpha 4 (PSMA4). A proteasome 20S subunit alpha 4 (PSMA4) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome 20S subunit alpha 4 (PSMA4) inhibitor to the subject.The method or PSMA4 inhibitor for use according to any one of embodiments 1-6 or 191-193, wherein the PSMA4 protein comprises the sequence of SEQ ID NO:27 (PDB reference: 4R3O). A PSMA4 inhibitor that specifically inhibits a PSMA4 protein having a structure defined by PDB reference 4R3O. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome 20S subunit alpha 5 (PSMA5) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of proteasome 20S subunit alpha 5 (PSMA5). A proteasome 20S subunit alpha 5 (PSMA5) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a proteasome 20S subunit alpha 5 (PSMA5) inhibitor to the subject. The method or PSMA5 inhibitor for use according to any one of embodiments 1-6 or 196- 198, wherein the PSMA5 protein comprises the sequence of SEQ ID NO:28 (PDB reference: 4R3O). A PSMA5 inhibitor that specifically inhibits a PSMA5 protein having a structure defined by PDB reference 4R3O. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a RuvB-like 1 (RUVBL1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of RuvB-like 1 (RUVBL1). A RuvB-like 1 (RUVBL1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a RuvB-like 1 (RUVBL1) inhibitor to the subject. The method or RUVBL1 inhibitor for use according to any one of embodiments 1-6 or 201- 203, wherein the RUVBL1 protein comprises the sequence of SEQ ID NO:29 (PDB reference: 2C9O).A RUVBL1 inhibitor that specifically inhibits a RUVBL1 protein having a structure defined by PDB reference 2C9O. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ring finger protein 113A (RNF113A) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of ring finger protein 113A (RNF113A). A ring finger protein 113A (RNF113A) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ring finger protein 113A (RNF113A) inhibitor to the subject. The method or RNF113A inhibitor for use according to any one of embodiments 1-6 or 206-208, wherein the RNF113A protein comprises the sequence of SEQ ID NO:30 (Alphafold reference: 015541). A RNF113A inhibitor that specifically inhibits a RNF113A protein having a structure defined by Alphafold reference 015541 . A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a pre-mRNA processing factor 8 (PRPF8) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of pre-mRNA processing factor 8 (PRPF8). A pre-mRNA processing factor 8 (PRPF8) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a pre-mRNA processing factor 8 (PRPF8) inhibitor to the subject. The method or PRPF8 inhibitor for use according to any one of embodiments 1-6 or 211- 213, wherein the PRPF8 protein comprises the sequence of SEQ ID NO:31 (PDB reference: 3E9L). A PRPF8 inhibitor that specifically inhibits a PRPF8 protein having a structure defined by PDB reference 3E9L. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an enhanced exportin 1 (XPO1) inhibitor to the subject.A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of enhanced exportin 1 (XPO1). An enhanced exportin 1 (XPO1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an enhanced exportin 1 (XPO1) inhibitor to the subject. The method or XPOl inhibitor for use according to any one of embodiments 1-6 or 216- 218, wherein the XPO1 protein comprises the sequence of SEQ ID NO:32 (PDB reference: 1W9C). A XPO1 inhibitor that specifically inhibits a XPO1 protein having a structure defined by PDB reference 1W9C. The method or XPOl inhibitor for use according to any one of embodiments 1-6 or 216- 220, wherein the XPO1 inhibitor is Selinexor. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nucleoporin GLE1 (GLE1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of nucleoporin GLE1 (GLE1). A nucleoporin GLE1 (GLE1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nucleoporin GLE1 (GLE1) inhibitor to the subject. The method or GLE1 inhibitor for use according to any one of embodiments 1-6 or 222- 224, wherein the GLE1 protein comprises the sequence of SEQ ID NO:33 (Alphafold reference: Q53GS7). A GLE1 inhibitor that specifically inhibits a GLE1 protein having a structure defined by Alphafold reference Q53GS7. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nuclear RNA export factor 1 (NXF1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of nuclear RNA export factor 1 (NXF1).A nuclear RNA export factor 1 (NXF1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nuclear RNA export factor 1 (NXF1) inhibitor to the subject. The method or NXF1 inhibitor for use according to any one of embodiments 1-6 or 227- 229, wherein the NXF1 protein comprises the sequence of SEQ ID NO:34 (PDB reference: 4WYK). A NXF1 inhibitor that specifically inhibits a NXF1 protein having a structure defined by PDB reference 4WYK. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a mRNA export factor (RAE1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of mRNA export factor (RAE1). A mRNA export factor (RAE1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a mRNA export factor (RAE1) inhibitor to the subject. The method or RAE1 inhibitor for use according to any one of embodiments 1-6 or 232- 234, wherein the RAE1 protein comprises the sequence of SEQ ID NO:35 (PDB reference: 3MMY). A RAE1 inhibitor that specifically inhibits a RAE1 protein having a structure defined by PDB reference 3MMY. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a 60S ribosomal protein L11 (RPL11) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of 60S ribosomal protein L11 (RPL11). A 60S ribosomal protein L11 (RPL11) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a 60S ribosomal protein L11 (RPL11) inhibitor to the subject.The method or RPL11 inhibitor for use according to any one of embodiments 1-6 or 237- 239, wherein the RPL11 protein comprises the sequence of SEQ ID NO:36 (PDB reference: 4UG0). A RPL11 inhibitor that specifically inhibits a RPL11 protein having a structure defined by PDB reference 4UG0. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a 60S ribosomal protein L10a (RPL10A) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of 60S ribosomal protein L10a (RPL10A). A 60S ribosomal protein L10a (RPL10A) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a 60S ribosomal protein L10a (RPL10A) inhibitor to the subject. The method or RPL10A inhibitor for use according to any one of embodiments 1-6 or 242- 244, wherein the RPL10A protein comprises the sequence of SEQ ID NO:37 (PDB reference: 4UG0). A RPL10A inhibitor that specifically inhibits a RPL10A protein having a structure defined by PDB reference 4UG0. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin-conjugating enzyme E2I (UBE2I / UBC9) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of ubiquitin-conjugating enzyme E2I (UBE2I / UBC9). A ubiquitin-conjugating enzyme E2I (UBE2I / UBC9) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a ubiquitin-conjugating enzyme E2I (UBE2I / UBC9) inhibitor to the subject. The method or UBE2I / UBC9 inhibitor for use according to any one of embodiments 1-6 or 247-249, wherein the UBE2I / UBC9 protein comprises the sequence of SEQ ID NO:38 (PDB reference: 1A3S).A UBE2I (UBC9) inhibitor that specifically inhibits a UBE2I (UBC9) protein having a structure defined by PDB reference 1A3S. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a RAN binding protein 2 (RANBP2) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of RAN binding protein 2 (RANBP2). A RAN binding protein 2 (RANBP2) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a RAN binding protein 2 (RANBP2) inhibitor to the subject. The method or RANBP2 inhibitor for use according to any one of embodiments 1-6 or 252-254, wherein the RANBP2 protein comprises the sequence of SEQ ID NO:39 (PDB reference: 1 RRP). A RANBP2 inhibitor that specifically inhibits a RANBP2 protein having a structure defined by PDB reference 1 RRP. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a cleavage and polyadenylation specificity factor subunit 6 (CPSF6) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of cleavage and polyadenylation specificity factor subunit 6 (CPSF6). A cleavage and polyadenylation specificity factor subunit 6 (CPSF6) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a cleavage and polyadenylation specificity factor subunit 6 (CPSF6) inhibitor to the subject. The method or CPSF6 inhibitor for use according to any one of embodiments 1-6 or 257- 259, wherein the CPSF6 protein comprises the sequence of SEQ ID NO:40 (PDB reference: 3P5T). A CPSF6 inhibitor that specifically inhibits a CPSF6 protein having a structure defined by PDB reference 3P5T.A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a polyadenylate-binding protein 2 (PABPN1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of polyadenylate-binding protein 2 (PABPN1). A polyadenylate-binding protein 2 (PABPN1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a polyadenylate-binding protein 2 (PABPN1) inhibitor to the subject. The method or PABPN1 inhibitor for use according to any one of embodiments 1-6 or 262- 264, wherein the PABPN1 protein comprises the sequence of SEQ ID NO:41 (PDB reference: 3B4D). A PABPN1 inhibitor that specifically inhibits a PABPN1 protein having a structure defined by PDB reference 3B4D. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an aldolase A (ALDOA) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of aldolase A (ALDOA). An aldolase A (ALDOA) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an aldolase A (ALDOA) inhibitor to the subject. The method or ALDOA inhibitor for use according to any one of embodiments 1-6 or 267- 269, wherein the ALDOA protein comprises the sequence of SEQ ID NO:42 (PDB reference: 1ALD). An ALDOA inhibitor that specifically inhibits an ALDOA protein having a structure defined by PDB reference 1ALD. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nuclear respiratory factor 1 (NRF1) inhibitor to the subject. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of nuclear respiratory factor 1 (NRF1).A nuclear respiratory factor 1 (NRF1) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a nuclear respiratory factor 1 (NRF1) inhibitor to the subject. The method or NRF1 inhibitor for use according to any one of embodiments 1-6 or 272- 274, wherein the NRF1 protein comprises the sequence of SEQ ID NO:43 (Alphafold reference: Q16656). A NRF1 inhibitor that specifically inhibits a NRF1 protein having a structure defined by Alphafold reference Q16656. The method or inhibitor for use according to any one of embodiments 1-276, wherein the ALT positive cancer is selected from the group consisting of glioma, breast carcinoma (including HER2+ breast carcinoma), angiosarcoma, pancreatic neuroendocrine tumour, neuroblastoma, liposarcoma, leiomyosarcoma, osteosarcoma, rhabdomyosarcoma, fibrosarcoma, astrocytoma and neuroblastoma. The method or inhibitor for use according to any one of embodiments 1-277, wherein the ALT positive cancer is selected from the group consisting of Acute Lymphoblastic Leukemia (ALL), Acute Myeloid Leukemia (AML), Adrenocortical Carcinoma, AIDS- Related cancer, Kaposi Sarcoma, Primary CNS Lymphoma, Anal cancer, Appendix cancer , Astrocytoma, Atypical Teratoid / Rhabdoid tumor, Basal Cell Carcinoma, Bile Duct cancer, Bladder cancer, Bone cancer, Brain cancer, Breast cancer, Lung cancer, Burkitt Lymphoma, Carcinoid tumor, Cardiac cancer, Medulloblastoma, Primary CNS Lymphoma, Cervical cancer, Cholangiocarcinoma, Chordoma, Chronic Lymphocytic Leukemia (CLL), Chronic Myelogenous Leukemia (CML), Chronic Myeloproliferative Neoplasms, Colorectal cancer, Craniopharyngioma, Cutaneous T-Cell Lymphoma, Endometrial cancer, Esophageal cancer, Esthesioneuroblastoma, Extracranial Germ Cell tumor, Eye cancer, Intraocular melanoma, Retinoblastoma, Fallopian tube cancer, Gallbladder cancer, Stomach cancer, Germ cell tumors, Ovarian cancer, Testicular cancer, Hairy Cell Leukemia, Liver cancer, Hodgkin Lymphoma, Hypopharyngeal cancer, Intraocular melanoma, Pancreatic neuroendocrine tumors, Kaposi Sarcoma (Soft Tissue Sarcoma), Kidney cancer, Langerhans Cell Histiocytosis, Laryngeal cancer, Leukemia, Liver cancer, Lung cancer, Lymphoma, Melanoma, Mesothelioma, Mouth cancer, Nasopharyngeal cancer, Neuroblastoma, Non-Hodgkin Lymphoma, Non-Small Cell Lung cancer, Ovarian cancer, Pancreatic cancer, Papillomatosis, Paraganglioma, Parathyroid cancer, Penile cancer, Pheochromocytoma, Pituitary tumor, Prostate cancer, Rectal cancer, Retinoblastoma, Sarcoma, Skin cancer, Small Cell Lung cancer, Small Intestine cancer, Soft Tissue Sarcoma, Testicular cancer, Throat cancer, Nasopharyngeal cancer,Oropharyngeal cancer, Hypopharyngeal cancer, Thymoma and Thymic Carcinoma, Thyroid cancer, Urethral cancer, Uterine cancer, Uterine Sarcoma, Vaginal cancer and Vulvar cancer. The method of providing a diagnosis or prognosis of an ALT positive cancer according to any one of embodiments 2, 4, 6-42, 54, 60, 65, 70, 75, 80, 86, 91 , 96, 101 , 106, 111 , 116, 122, 128, 133, 138, 144, 150, 156, 161 , 167 or 172 wherein determining the activity or expression status of the one or more genes comprises the use of one or more techniques selected from the group consisting of: telomeric fluorescent in situ hybridization (telomeric FISH), C-circle assay, spectroscopy, quantitative sequencing, quantitative PCR (qPCR), RT-PCT, ddPCR, Southern blotting, northern blotting, immunohistochemistry (IHC), spectroscopy, colorimetric detection, Western blotting, mass spectrometry and ELISA. The method or inhibitor for use according to any one of embodiments 1 to 279, wherein the inhibitor comprises an antisense nucleic acid molecule, a small interfering RNA (siRNA), or a short hairpin RNA (shRNA). The method or inhibitor for use according to any one of embodiments 1 to 279, wherein the inhibitor comprises a small molecule. The method or inhibitor for use according to embodiment 280, wherein the inhibitor is an antisense nucleic acid molecule comprising a sense strand. The method or inhibitor for use according to embodiment 282, wherein the sense strand consists of 15 to 25 linked nucleosides. The method or inhibitor for use according to any one of embodiments 280, 282 or 283, wherein the sense strand comprises a sequence having at least 95% identity to an equal length portion of a pregenomic RNA and / or an mRNA encoding one or more genes selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1Q binding protein (C1QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1),proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor I II C subunit 3 (GTF3C3) and tRNA methyltransferase 6 (TRMT6). The method or inhibitor for use according to any one of embodiments 280 or 282-284, wherein the sense strand comprises a sequence having 100% identity to an equal length portion of a pregenomic RNA and / or an mRNA encoding one or more genes selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A- 52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SI N3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor 11 IC subunit 3 (GTF3C3) and tRNA methyltransferase 6 (TRMT6). The method or inhibitor for use according to any one of embodiments 280 or 282-285, wherein the antisense strand is at least 80% complementary to the sense strand. The method or inhibitor for use according to any one of embodiments 280 or 282-286, wherein the antisense strand is at least 90% complementary to the sense strand. The method or inhibitor for use according to any one of embodiments 280 or 282-287, wherein the antisense strand is at least 95% complementary to the sense strand. The method or inhibitor for use according to any one of embodiments 280 or 282-288, wherein the antisense strand is fully complementary to the sense strand. The method or inhibitor for use according to any one of embodiments 280 or 282-289, wherein the antisense strand is longer than the sense strand. The method or inhibitor for use according to any one of embodiments 280 or 282-290, wherein the inhibitor has an overhang at the 3’ end of the antisense strand of 1 , 2, 3, 4, 5 or more nucleosides.The method or inhibitor for use according to any one of embodiments 280 or 282-291 , wherein the inhibitor has an overhang at the 5’ end of the antisense strand of 1 , 2, 3, 4, 5 or more nucleosides. The method or inhibitor for use according to any one of embodiments 280 or 282-289, wherein the sense strand is longer than the antisense strand. The method or inhibitor for use according to any one of embodiments 280 or 282-289 or 293, wherein the inhibitor has an overhang at the 3’ end of the sense strand of 1 , 2, 3, 4, 5 or more nucleosides. The method or inhibitor for use according to any one of embodiments 280 or 282-289 or 293-294, wherein the inhibitor has an overhang at the 5’ end of the sense strand of 1 , 2, 3, 4, 5 or more nucleosides. The method or inhibitor for use according to any one of embodiments 280 or 282-295, wherein the inhibitor comprises a compound comprising a double-stranded ribonucleic acid molecule and a conjugate group. The method or inhibitor for use according to embodiment 296, wherein the conjugate group comprises one or more carbohydrates. The method or inhibitor for use according to embodiment 296 or 297, wherein the conjugate group comprises a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide, modified polysaccharide, mannose, galactose, a mannose derivative, a galactose derivative, D-mannopyranose, L- Mannopyranose, D-Arabinose, L-Galactose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-Galactose, L-Galactose, a-D-Mannofuranose, p-D-Mannofuranose, a-D- Mannopyranose, p-D-Mannopyranose, a-D-Glucopyranose, p-D-Glucopyranose, a-D- Glucofuranose, p-D-Glucofuranose, a-D-fructofuranose, a-D-fructopyranose, a-D- Galactopyranose, p -D-Galactopyranose, a-D-Galactofuranose, p -D-Galactofuranose, glucosamine, sialic acid, a-D-galactosamine, N-Acetylgalactosamine, 2-Amino-3-O-[(R)-1- carboxyethyl]-2-deoxy-p-D-glucopyranose, 2-Deoxy-2-methylamino-L-glucopyranose, 4,6- Dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-Deoxy-2-sulfoamino-D- glucopyranose, N-Glycoloyl-a-neuraminic acid, 5-thio-p-D-glucopyranose, methyl 2,3, 4-tri- O-acetyl-1-thio-6-O-trityl-a-D-glucopyranoside, 4-Thio-p-D-galactopyranose, ethyl 3, 4,6,7- tetra-O-acetyl-2-deoxy-1 ,5-dithio-a-D-gluco-heptopyranoside, 2,5-Anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose or L-4-th io ribose.The method or inhibitor for use according to any one of embodiments 296 to 298, wherein the conjugate group comprises one or more galactose moieties, one or more lactose moieties, one or more N-Acetyl-Galactosamine moieties, and / or one or more mannose moieties. The method or inhibitor for use according to any one of embodiments 296 to 299, wherein the conjugate group is linked to the 3’ end of the sense strand. The method or inhibitor for use according to any one of embodiments 296 to 299, wherein the conjugate group is linked to the 5’ end of the sense strand. The method or inhibitor for use according to any one of embodiments 296 to 299, wherein the conjugate group is linked to the 5’ end of the antisense strand. The method or inhibitor for use according to any one of embodiments 296 to 299, wherein the conjugate group is linked to the 3’ end of the antisense strand. The method or inhibitor for use according to any one of embodiments 280 or 282-303, wherein the inhibitor is a nucleic acid comprising at least one nucleoside comprising a modified sugar. The method or inhibitor for use according to any one of embodiments 280 or 282-304, wherein the inhibitor is a nucleic acid and wherein at least one internucleoside linkage is a modified internucleoside linkage. The method or inhibitor for use according to embodiment 305, wherein the modified internucleoside linkage is a phosphorothioate or phosphorodithioate internucleoside linkage. The method or inhibitor for use according to any one of embodiments 1 to 279, wherein the inhibitor comprises a CRISPR nuclease system comprising a CRISPR-associated protein (Cas protein) and a guide RNA (gRNA) that binds to a genomic nucleic acid sequence of the target gene. The method or inhibitor for use according to any one of embodiments 280-307, wherein the inhibitor is capable of inhibiting the expression of the target gene in vitro by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or preferably at least 98% or at least 99%.A method of predicting the response of an ALT positive cancer to an agent, wherein the method comprises determining the activity or expression status of one or more genes selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1Q binding protein (C1QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor I II C subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), GRB2 (growth factor receptor bound protein 2), RBX1 (RING-box protein 1), I D11 (Isopentenyl-Diphosphate Delta Isomerase 1), PSMA4 (proteasome 20S subunit alpha 4), PSMA5 (proteasome 20S subunit alpha 5), RUVBL1 (RuvB-like 1), RNF113A (ring finger protein 113A), PRPF8 (pre-mRNA processing factor 8), XPO1 (enhanced exportin 1), GLE1 (nucleoporin GLE1), NXF1 (nuclear RNA export factor 1), RAE 1 (mRNA export factor), RPL11 (60S ribosomal protein L11), RPL10A (60S ribosomal protein L10a), UBE2I / UBC9 (ubiquitin-conjugating enzyme E2I), RANBP2 (RAN binding protein 2), CPSF6 (cleavage and polyadenylation specificity factor subunit 6), PABPN1 (polyadenylate-binding protein 2), ALDOA (aldolase A) and NRF1 (nuclear respiratory factor 1) in a cancer, wherein a decrease in activity or expression status of the one or more genes in the cancer cells relative to control cells is indicative that the cancer would be responsive to the agent. A method of predicting the response of an ALT positive cancer to an agent, wherein the method comprises determining the activity or expression status of one or more genes selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1Q binding protein (C1QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin likemodifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor I II C subunit 3 (GTF3C3) and tRNA methyltransferase 6 (TRMT6) in a cancer, wherein a decrease in activity or expression status of the one or more genes in the cancer cells relative to control cells is indicative that the cancer would be responsive to the agent. A method of predicting the response of an ALT positive cancer to an agent, wherein the method comprises determining the activity or expression status of one or more genes selected from the group consisting of: GRB2 (growth factor receptor bound protein 2), RBX1 (RING-box protein 1), ID11 (Isopentenyl-Diphosphate Delta Isomerase 1), PSMA4 (proteasome 20S subunit alpha 4), PSMA5 (proteasome 20S subunit alpha 5), RUVBL1 (RuvB-like 1), RNF113A (ring finger protein 113A), PRPF8 (pre-mRNA processing factor 8), XPO1 (enhanced exportin 1), GLE1 (nucleoporin GLE1), NXF1 (nuclear RNA export factor 1), RAE1 (mRNA export factor), RPL11 (60S ribosomal protein L11), RPL10A (60S ribosomal protein L10a), UBE2I / UBC9 (ubiquitin-conjugating enzyme E2I), RANBP2 (RAN binding protein 2), CPSF6 (cleavage and polyadenylation specificity factor subunit 6), PABPN1 (polyadenylate-binding protein 2), ALDOA (aldolase A) and NRF1 (nuclear respiratory factor 1) in a cancer, wherein a decrease in activity or expression status of the one or more genes in the cancer cells relative to control cells is indicative that the cancer would be responsive to the agent. The method of any one of embodiments 309-311 , wherein the method is performed on a sample taken from a subject. The method of embodiment 312, wherein the sample is selected from the group consisting of whole blood, plasma, serum, tissue, tumour, semen, urine, hair, faeces, tumour biopsies (for example frozen tumour biopsies) and formalin fixed, paraffin-embedded (FFPE) tissue. The method of any one of embodiments 309-313, wherein determining the activity or expression status of the one or more genes comprises the use of one or more techniques selected from the group consisting of: telomeric fluorescent in situ hybridization (telomeric FISH), C-circle assay, spectroscopy, quantitative sequencing, quantitative PCR (qPCR), RT-PCT, ddPCR, Southern blotting, northern blotting, immunohistochemistry (IHC), spectroscopy, colorimetric detection, Western blotting, mass spectrometry and ELISA. The method of any one of embodiments 309-314, wherein the control cells are ALT- negative cells derived from the same cancer.316. The method of any one of embodiments 309-315, wherein a decrease in activity or expression status of the one or more genes of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% is indicative that the cancer would be responsive to the agent.317. A method of providing an ALT positive cancer diagnosis or prognosis for a patient suspected of having cancer, the method comprising:(a) providing a patient expression profile comprising the expression status of one or more genes in at least one biological sample obtained from the patient;(b) comparing the patient expression profile to an average expression status of one or more corresponding genes in a reference population;(c) providing a cancer diagnosis or prognosis based on the variance between the patient expression profile and the expression status of one or more corresponding reference genes; wherein the one or more genes are selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A- 52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SI N3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor 11 IC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), GRB2 (growth factor receptor bound protein 2), RBX1 (RING-box protein 1), IDI1 (Isopentenyl-Diphosphate Delta Isomerase 1), PSMA4 (proteasome 20S subunit alpha 4), PSMA5 (proteasome 20S subunit alpha 5), RUVBL1 (RuvB-like 1), RNF113A (ring finger protein 113A), PRPF8 (pre-mRNA processing factor 8), XPO1 (enhanced exportin 1), GLE1 (nucleoporin GLE1), NXF1 (nuclear RNA export factor 1), RAE1 (mRNA export factor), RPL11 (60S ribosomal protein L11), RPL10A (60S ribosomal protein L10a), UBE2I / UBC9 (ubiquitin-conjugating enzyme E2I), RANBP2 (RAN binding protein 2), CPSF6 (cleavage and polyadenylation specificity factor subunit 6), PABPN1 (polyadenylate-binding protein 2), ALDOA (aldolase A) and NRF1 (nuclear respiratory factor 1).318. A method of providing an ALT positive cancer diagnosis or prognosis for a patient suspected of having cancer, the method comprising:(a) providing a patient expression profile comprising the expression status of one or more genes in at least one biological sample obtained from the patient;(b) comparing the patient expression profile to an average expression status of one or more corresponding genes in a reference population;(c) providing a cancer diagnosis or prognosis based on the variance between the patient expression profile and the expression status of one or more corresponding reference genes; wherein the one or more genes are selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A- 52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SI N3A corepressor complex component (SUDS3), complement C1Q binding protein (C1QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor 11 IC subunit 3 (GTF3C3) and tRNA methyltransferase 6 (TRMT6).319. A method of providing an ALT positive cancer diagnosis or prognosis for a patient suspected of having cancer, the method comprising:(a) providing a patient expression profile comprising the expression status of one or more genes in at least one biological sample obtained from the patient;(b) comparing the patient expression profile to an average expression status of one or more corresponding genes in a reference population;(c) providing a cancer diagnosis or prognosis based on the variance between the patient expression profile and the expression status of one or more corresponding reference genes; wherein the one or more genes are selected from the group consisting of: GRB2 (growth factor receptor bound protein 2), RBX1 (RING-box protein 1), IDI1 (Isopentenyl-Diphosphate Delta Isomerase 1), PSMA4 (proteasome 20S subunit alpha 4), PSMA5 (proteasome 20S subunit alpha 5), RUVBL1 (RuvB-like 1), RNF113A (ring finger protein 113A), PRPF8 (pre-mRNA processing factor 8), XPO1 (enhanced exportin 1), GLE1 (nucleoporin GLE1), NXF1 (nuclear RNA export factor 1), RAE1 (mRNA export factor), RPL11 (60S ribosomal protein L11), RPL10A (60S ribosomal protein L10a), UBE2I / UBC9 (ubiquitin-conjugating enzyme E2I), RANBP2 (RAN binding protein 2), CPSF6 (cleavage and polyadenylation specificity factor subunit 6), PABPN1 (polyadenylate-binding protein 2), ALDOA (aldolase A) and NRF1 (nuclear respiratory factor 1).320. The method of any one of embodiments 317-319, wherein the patient is further diagnosed as having one or more characteristics selected from the following list: telomere repeat variants, ALT-associated promyelocytic leukaemia bodies (PML bodies / APBs), telomeresister chromatid exchanges (TSCE), RPA foci at telomeres, DNA damage at telomeres, telomeric DNA damage induced foci (TIFs), single stranded telomeric regions and extrachromosomal telomeric repeats. The method of any one of embodiments 317-320, wherein the expression status comprises sequencing one or more polynucleotides encoding the one or more genes. The method of any one of embodiments 317-321 , wherein the variance between the patient expression profile and the expression status of one or more corresponding reference genes comprises identifying one or more nucleotide mutations, insertions or deletions in the sequence of the patient gene. The method of embodiment 322, wherein the presence of a mutation, insertion or deletion indicates the presence of a cancer. The method of any one of embodiments 317 to 323, wherein the expression status comprises quantifying, in a patient biological sample, the amount of one or more polynucleotides encoding the one or more genes. The method of any one of embodiments 317 to 324, where in the one or more polynucleotides encoding the one or more genes are DNA polynucleotides or RNA polynucleotides. The method of embodiment 324 or embodiment 325, wherein quantifying the amount of one or more polynucleotides is performed using telomeric fluorescent in situ hybridization (telomeric FISH), C-circle assay, spectroscopy, quantitative sequencing, quantitative PCR (qPCR), RT-PCT, ddPCR, Southern blotting or northern blotting. The method of any one of embodiments 317-320, wherein the expression status consists of quantifying in a patient biological sample, the amount of one or more polypeptides encoded by the one or more genes. The method of embodiment 327 wherein quantifying the amount of one or more polypeptides is performed using immunohistochemistry (IHC), spectroscopy, colorimetric detection, Western blotting, mass spectrometry or ELISA. A method of treating an ALT positive cancer in a patient in need thereof, the method comprising providing an ALT positive cancer diagnosis or prognosis using a method of any one of embodiments 317 to 328 and administering to the patient a chemotherapeutic composition.A kit for testing for providing a cancer diagnosis or prognosis for a patient suspected of having cancer comprising a means for measuring the expression status of one or more genes selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SI N3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor 11 IC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), GRB2 (growth factor receptor bound protein 2), RBX1 (RING-box protein 1),ID11 (Isopentenyl-Diphosphate Delta Isomerase 1), PSMA4 (proteasome 20S subunit alpha 4), PSMA5 (proteasome 20S subunit alpha 5), RUVBL1 (RuvB-like 1), RNF113A (ring finger protein 113A), PRPF8 (pre-mRNA processing factor 8), XPO1 (enhanced exportin 1), GLE1 (nucleoporin GLE1), NXF1 (nuclear RNA export factor 1), RAE1 (mRNA export factor), RPL11 (60S ribosomal protein L11), RPL10A (60S ribosomal protein L10a), UBE2I / UBC9 (ubiquitin-conjugating enzyme E2I), RANBP2 (RAN binding protein 2), CPSF6 (cleavage and polyadenylation specificity factor subunit 6), PABPN1 (polyadenylate-binding protein 2), ALDOA (aldolase A) and NRF1 (nuclear respiratory factor 1). A kit for testing for providing a cancer diagnosis or prognosis for a patient suspected of having cancer comprising a means for measuring the expression status of one or more genes selected from the group consisting of: lysine acetyltransferase 5 (KAT5), cleavage and polyadenylation specific factor 1 (CPSF1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), zinc finger protein 207 (ZNF207), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SI N3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), farnesyl diphosphate synthase (FDPS), cleavage and polyadenylation specificity factor subunit 3 (CPSF3), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1(SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor 11 IC subunit 3 (GTF3C3) and tRNA methyltransferase 6 (TRMT6). A kit for testing for providing a cancer diagnosis or prognosis for a patient suspected of having cancer comprising a means for measuring the expression status of one or more genes selected from the group consisting of: GRB2 (growth factor receptor bound protein 2), RBX1 (RING-box protein 1), ID11 (Isopentenyl-Diphosphate Delta Isomerase 1), PSMA4 (proteasome 20S subunit alpha 4), PSMA5 (proteasome 20S subunit alpha 5), RUVBL1 (RuvB-like 1), RNF113A (ring finger protein 113A), PRPF8 (pre-mRNA processing factor 8), XPO1 (enhanced exportin 1), GLE1 (nucleoporin GLE1), NXF1 (nuclear RNA export factor 1), RAE1 (mRNA export factor), RPL11 (60S ribosomal protein L11), RPL10A (60S ribosomal protein L10a), UBE2I / UBC9 (ubiquitin-conjugating enzyme E2I), RANBP2 (RAN binding protein 2), CPSF6 (cleavage and polyadenylation specificity factor subunit 6), PABPN1 (polyadenylate-binding protein 2), ALDOA (aldolase A) and NRF1 (nuclear respiratory factor 1). The kit according to any one of embodiments 330-332, comprising a means for measuring the expression status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28. 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42 or 43 of the genes. The kit according to any one of embodiments 330-333, comprising a means for measuring the expression status of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22 or 23 of the genes. The kit according to any one of embodiments 330-334, wherein the means for detecting is a biosensor or specific binding molecule. The kit according to any one of embodiments 330-335, wherein the biosensor is an electrochemical, electronic, piezoelectric, gravimetric, pyroelectric biosensor, a sequencer, ion channel switch, evanescent wave, surface plasmon resonance or biological biosensor. The kit according to any one of embodiments 330-336, wherein the means for detecting the expression status of the one or more genes is nucleotide sequencing. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a cleavage and polyadenylation specificity factor subunit 3 (CPSF3) inhibitor to the subject.339. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of polyadenylation specificity factor subunit 3 (CPSF3) inhibitor.340. A polyadenylation specificity factor subunit 3 (CPSF3) inhibitor for use in a method of treating or preventing an ALT positive cancer in a subject, the method comprising administering a polyadenylation specificity factor subunit 3 (CPSF3) inhibitor to the subject.341 . The method or CPSF3 inhibitor for use according to any one of embodiments 1-6 or 338-340, wherein the CPSF3 protein comprises the sequence of SEQ ID NO:44 (AlphaFold reference: Q9UKF6).342. A FDPS inhibitor that specifically inhibits a CPSF3 protein having a structure defined by AlphaFold reference Q9UKF6.343. The method or CPSF3 inhibitor for use according to any one of embodiments 1-6 or 338-342, wherein the CPSF3 inhibitor is JTE-607.References[1] Lippert, T.P., Marzec, P., Idilli, A.I. et al. Oncogenic herpesvirus KSHV triggers hallmarks of alternative lengthening of telomeres. Nat Commun 12, 512 (2021 ).[2] Blanc, M., Hsieh, W.Y., Robertson, K.A., Watterson, S., Shui, G., Lacaze, P., Khondoker, M., Dickinson, P., Sing, G., Rodrfguez-Martfn, S. and Phelan, P., 2011. Host defense against viral infection involves interferon mediated down-regulation of sterol biosynthesis. PLoS biology, 9(3), p.e1000598.[3] Aurora I. Idilli, Sandra Segura-Bayona, Timothy P. Lippert, Simon J. Boulton, A C-circle assay for detection of alternative lengthening of telomere activity in FFPE tissue, STAR Protocols, Volume 2, Issue 2, 2021.[4] Doench, J. G., N. Fusi, M. Sullender, M. Hegde, E. W. Vaimberg, K. F. Donovan, I. Smith, Z. Tothova, C. Wilen, R. Orchard, H. W. Virgin, J. Listgarten, and D. E. Root. 2016. 'Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9', Nat Biotechnol, 34: 184-91.[5] Han HA, Pang JKS, Soh BS. Mitigating off-target effects in CRISPR / Cas9-mediated in vivo gene editing. J Mol Med (Berl). 2020 May;98(5):615-632[6] Yoav Benjamin! and Yosef Hochberg, Journal of the Royal Statistical Society. Series B (Methodological) Vol. 57, No. 1 (1995), pp. 289-300[7] Hewitt, G., V. Borel, S. Segura-Bayona, T. Takaki, P. Ruis, R. Bellelli, L. C. Lehmann, L. Sommerova, A. Vancevska, A. Tomas-Loba, K. Zhu, C. Cooper, K. Fugger, H. Patel, R. Goldstone, D. Schneider- Luftman, E. Herbert, G. Stamp, R. Brough, S. Pettitt, C. J. Lord, S. C. West, I. Ahel, D. Ahel, J. R. Chapman, S. Deindl, and S. J. Boulton. 2021. 'Defective ALC1 nucleosome remodeling confers PARPi sensitization and synthetic lethality with HRD', Mol Cell, 81 : 767-83 e11.[8] Heng Li , Richard Durbin, Fast and accurate short read alignment with Burrows-Wheeler transform, Bioinformatics, Volume 25, Issue 14, July 2009, Pages 1754-1760.[9] Li, W., H. Xu, T. Xiao, L. Cong, M. I. Love, F. Zhang, R. A. Irizarry, J. S. Liu, M. Brown, and X. S. Liu. 2014. 'MAGeCK enables robust identification of essential genes from genome-scale CRISPR / Cas9 knockout screens', Genome Biol, 15: 554.

Claims

CLAIMS1. A method of treating or preventing an ALT positive cancer in a subject, the method comprising administering an inhibitor for one or more genes selected from the list consisting of: farnesyl diphosphate synthase (FDPS), a cleavage and polyadenylation specificity factor (CPSF) subunit selected from the list consisting of i) 3 (CPSF3), ii) 1 (CPSF1) and iii) 6 (CPSF6), Isopentenyl-Diphosphate Delta Isomerase 1 (IDI1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), zinc finger protein 207 (ZNF207), lysine acetyltransferase 5 (KAT5), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor I IIC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor (RAE1), 60S ribosomal protein L11 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), polyadenylate-binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1) to the subject.

2. A method of providing a diagnosis or prognosis of an ALT positive cancer in a subject based on the expression status or activity of one or more genes selected from the list consisting of: farnesyl diphosphate synthase (FDPS), a cleavage and polyadenylation specificity factor (CPSF) subunit selected from the list consisting of i) 3 (CPSF3), ii) 1 (CPSF1) and iii) 6 (CPSF6), Isopentenyl-Diphosphate Delta Isomerase 1 (I D11 ) , B-TFIID TATA-box binding protein associated factor 1 (BTAF1), zinc finger protein 207 (ZNF207), lysine acetyltransferase 5 (KAT5), signal recognition particle 54 (SRP54), COP9 signalosome subunit 4 (COPS4), proteasome 20S subunit beta 1 (PSMB1), IK cytokine (IK), nucleoporin 155 (NUP155), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), SDS3 homolog SIN3A corepressor complex component (SUDS3), complement C1 Q binding protein (C1 QBP), transketolase (TKT), heat shock protein family D (Hsp60) member 1 (HSPD1), proteasome activator complex subunit 3 (PSME3), ubiquitin like modifier activating enzyme 5 (UBA5), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), proline rich mitotic checkpoint control factor (PRCC), DNA methyltransferase 1 (DNMT1), general transcription factor IIIC subunit 3 (GTF3C3), tRNA methyltransferase 6 (TRMT6), growth factor receptor bound protein 2 (GRB2), RING-box protein 1 (RBX1), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), RuvB-like 1 (RUVBL1), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8 (PRPF8), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1), mRNA export factor(RAE1), 60S ribosomal protein L11 (RPL11), 60S ribosomal protein L10a (RPL10A), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), polyadenylate-binding protein 2 (PABPN1), aldolase A (ALDOA) and nuclear respiratory factor 1 (NRF1) to the subject.

3. The method according to claim 1 or claim 2, wherein the one or more genes are chaperone proteins.

4. The method according to claim 3, wherein the one or more genes are selected from the list consisting of heat shock protein family D (Hsp60) member 1 (HSPD1).

5. The method according to claim 1 or claim 2, wherein the one or more genes are enzymes.

6. The method according to claim 5, wherein the one or more genes are selected from the list consisting of farnesyl diphosphate synthase (FDPS), a cleavage and polyadenylation specificity factor (CPSF) subunit selected from the list consisting of i) 3 (CPSF3), ii) 1 (CPSF1) and iii) 6 (CPSF6), Isopentenyl-Diphosphate Delta Isomerase 1 (IDI1), B-TFIID TATA-box binding protein associated factor 1 (BTAF1), lysine acetyltransferase 5 (KAT5), signal recognition particle 54 (SRP54), transketolase (TKT), ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), DNA methyltransferase 1 (DNMT1), tRNA methyltransferase 6 (TRMT6), ubiquitin like modifier activating enzyme 5 (UBA5), RuvB-like 1 (RUVBL1), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9), RAN binding protein 2 (RANBP2), polyadenylate-binding protein 2 (PABPN1) and aldolase A (ALDOA).

7. The method according to claim 1 or claim 2, wherein the one or more genes are scaffold proteins.

8. The method according to claim 7, wherein the one or more genes are selected from the list consisting of COP9 signalosome subunit 4 (COPS4), proteasome subunit beta type-1 (PSMB1), IK cytokine (IK), SDS3 homolog SIN3A corepressor complex component (SUDS3), proteasome activator complex subunit 3 (PSME3), growth factor receptor bound protein 2) (GRB2), RING-box protein 1 (RBX1), proteasome 20S subunit alpha 4 (PSMA4), proteasome 20S subunit alpha 5 (PSMA5), ring finger protein 113A (RNF1 13A) and pre-mRNA processing factor 8 (PRPF8).

9. The method according to claim 1 or claim 2, wherein the one or more genes are transcription factors.

10. The method according to claim 9, wherein the one or more genes are selected from the list consisting of zinc finger protein 207 (ZNF207), general transcription factor IIIC subunit 3 (GTF3C3) and nuclear respiratory factor 1 (NRF1).

11. The method according to claim 1 or claim 2, wherein the one or more genes are transporter proteins.

12. The method according to claim 1 1 , wherein the one or more genes are selected from the list consisting of nucleoporin 155 (NUP155), complement C1 Q binding protein (C1QBP), enhanced exportin 1 (XPO1), nucleoporin GLE1 (GLE1), nuclear RNA export factor 1 (NXF1) and mRNA export factor (RAE1).

13. The method according to claim 1 or claim 2, wherein the one or more genes are part of the SUMO activating enzyme complex.

14. The method according to claim 13, wherein the one or more genes are selected from the list consisting of ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9) and RAN binding protein 2 (RANBP2).

15. The method according to claim 1 or claim 2, wherein the one or more genes have Ubiquitin-like modifier activating enzyme activity (G0:0008641).

16. The method according to claim 15, wherein the one or more genes are selected from the list consisting of ubiquitin like modifier activating enzyme 2 (UBA2), SUMO1 activating enzyme subunit 1 (SAE1), ubiquitin like modifier activating enzyme 5 (UBA5), ubiquitin-conjugating enzyme E2I (UBE2I / UBC9) and RAN binding protein 2 (RANBP2).

17. The method according to claim 1 or claim 2, wherein the one or more genes are part of the proteosome complex (G0:0000502).

18. The method according to claim 17, wherein the one or more genes are selected from the list consisting of proteasome 20S subunit beta 1 (PSMB1), proteasome activator complex subunit 3 (PSME3), proteasome 20S subunit alpha 4 (PSMA4) and proteasome 20S subunit alpha 5 (PSMA5).

19. The method according to claim 1 or claim 2, wherein the one or more genes are involved in the regulation of mRNA metabolic processes (GO:190331 1).

20. The method according to claim 19, wherein the one or more genes are selected from the list consisting of proteasome 20S subunit beta 1 (PSMB1), proteasome activator complex subunit 3 (PSME3), ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), complement C1Q binding protein (C1QBP), 60S ribosomal protein L11 (RPL11) and 60S ribosomal protein L10a (RPL10A).21 . The method according to claim 1 or claim 2, wherein the one or more genes are involved in mRNA splicing (G0:0000398).

22. The method according to claim 21 , wherein the one or more genes are selected from the list consisting of cleavage and polyadenylation specific factor 1 (CPSF1), IK cytokine (IK), proline rich mitotic checkpoint control factor (PRCC), ring finger protein 113A (RNF113A), pre-mRNA processing factor 8(PRPF8), cleavage and polyadenylation specificity factor subunit 6 (CPSF6) and polyadenylate-binding protein 2 (PABPN1).

23. The method according to claim 1 or claim 2, wherein the one or more genes are involved in tRNA processing (G0:0008033).

24. The method according to claim 23, wherein the one or more genes are selected from the list consisting of cleavage and polyadenylation specific factor 1 (CPSF1), tRNA methyltransferase 6 (TRMT6), cleavage and polyadenylation specificity factor subunit 6 (CPSF6) and polyadenylate-binding protein 2 (PABPN1).

25. The method according to claim 1 or claim 2, wherein the one or more genes are involved in RNA export from the nucleus (G0:0006405).

Images