Primers and kit for the detection of restricted materials obtained frompantholops hodgsonii

Abstract

The present invention relates to primers and kit for the identification of restricted materials of animal origin in Speciality Textile Samples. The present invention is more particularly directed towards a kit for the identification of Pantholops hodgsonii fibres in Speciality Textile Samples. The invention directs to novel primers and their applications in the identification of Pantholops hodgsonii Fibers in Speciality Textile Samples. It is also directed towards a novel process of qPCR based in vitro detection of Pantholops hodgsonii samples in Speciality Textile samples, especially, raw wool, yarn and woven shawls. This invention offers a process, primers and a detection kit to identify the presence of the fibres from Pantholops hodgsonii in textile samples with 100% accuracy. The present invention is also directed towards primers which are capable of amplifying the target DNA in very less concentrations, almost as low as 20 copies in SYBR Green-based qPCR assay.

Description

[0001] PT / 2025 / 13894

[0002] Primers and Kit for the Detection of Restricted Materials obtained from

[0003] Pantholops hodgsonii

[0004] FIELD OF THE INVENTION

[0005] The present invention relates to primers and kit for the detection of restricted materials obtained from Pantholops hodgsonii especially in textile samples. In particular, the present invention relates to a process and a kit for the identification of fiber samples of Pantholops hodgsonii from raw wool, yarn and woven shawls. More particularly, the present invention provides a quantitative PCR detection kit for identification of DNA from fibers (hair shaft) of Pantholops hodgsonii species comprising specifically designed primers according to mitochondrial genome sequences of closely related species. This method can identify even a few fibers without guard hair belonging to Shahtoosh. The primers amplified Shahtoosh DNA are as low as 10 copies in SYBR Green-based assay. The developed invention shall find immense application in the detection of fibers of Pantholops hodgsonii in speciality textile samples like raw wool, yarn and woven shawls. It shall help attain the 8th[decent work and economic growth] and 15th[life on land] sustainable development goals.

[0006] BACKGROUND OF THE INVENTION AND DESCRIPTION OF PRIOR ART The Tibetan antelope or Chiru Pantholops hodgsonii) belongs to the Genus Pantholops and subfamily Caprinae. It is endemic to the Tibetan plateau in China, but a small population migrated to Changthang Wildlife Sanctuary located in Ladakh, Jammu and Kashmir, India. The Tibetan antelope, also known as chiru, has been classified as near threatened by the IUCN (International Union for Conservation of Nature). It is also listed in Appendix I of the Convention on International Trade in Endangered Species (CITES). It is protected because of the exploitation of the species for their finest quality wool, known as Shahtoosh, that is used to make the warmest and the most expensive fabric.

[0007] Speciality Fibers refer to Animal fibres that include cashmere, mohair, shahtoosh and cameland the likes throughout this patent specification. These fibres are important in the textile industry, and they are used for exclusive and high-priced textiles like shawls and scarves. The use of the fiber or sale of products made from this fiber is illegal. A breed of goat called Pashmina {Capra hircus) is raised in high-altitude pastures in trans-Himalayas to harvest a special fiber that is used to weave a fabric that is referred to as “Cashmere” or “Pashmina”. Because of the difference in the cost of fabric woven using Shahtoosh and Pashmina, sometimes they are PT / 2025 / 13894 wrongly passed off as those made of Shahtoosh. This has created a situation where the product identity is uncertain. On several occasions, Cashmere shawls made using Pashmina goat’s hair have been confiscated at the ports of exit and entry in different national and international destinations.

[0008] Since India is a major exporter of woven speciality animal fibre products, it has brought focus on the monitoring mechanism and the practices of the industry. It has also caused fear among traders about the legality of the raw material used in the business and the actions that might be taken for using fibers. The available methods for the identification of chiru fibers, such as bum test or microscopic identification, are not reliable because of the similarities in morphological characteristics in the fibers of chiru and pashmina.

[0009] Reference may be made to the article Mountain Migrants: Survey of Tibetan Antelope Pantholops hodgsonii and Wild Yak (Bos grunniens) in Ladakh, Jammu & Kashmir, India. In India: Wildlife Trust of India by Sarkar, P., Takpa, J., Ahmed, R., et al in 2008, which recites the rampant trade of Tibetan antelope fur, but no clear method to identify the fibers was there.

[0010] Reference may be made to the article titled A Novel Method for Identifying Shahtoosh by Fei, J., Yang, J., Zhou, et al in 2014, published in the Journal of Forensic Sciences, which recites that the primers reliably amplify Shahtoosh, but it is TaqMan based qPCR assay and the 12S rRNA primers amplified other bovid species.

[0011] Reference may be made to the article by Sievers, F., Wilm, A., Dineen, et altitled Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega published in Molecular systems biology, which recites a method solely meant to align multiple nucleotide sequences to check for polymorphism.

[0012] Reference may be made to the article by Waterhouse, A., Procter, J., Martin, et al titled Jalview: visualization and analysis of molecular sequences, alignments, and structures, which recitesa tool that only helps in alignment and visualization of nucleotide sequences.

[0013] Reference may be made to the article titled Primer-BLAST: a tool to design target- specific primers for polymerase chain reaction byYe, J., Coulouris, G., Zaretskaya, I., Cutcutache, et al, which recites a tool that only helps in designing primers along with oligonucleotide. PT / 2025 / 13894

[0014] Reference may be made to the article titled Reporting the limits of detection and quantification for environmental DNA assays by Klymus, K. E., Merkes, C. M., Allison, et al. In Environmental DNA, 2(3), 271-282, which only recites the method for calculating the Limit of Detection and Limit of Quantification.

[0015] Reference may be made to the article by Xu, S. Q., Yang, Y. Z., Zhou, et al titled A mitochondrial genome sequence of the Tibetan antelope (Panlholops hodgsonii). Genomics, proteomics & bioinformatics, 3(1), 5-17, which only discloses the mitochondrial genome sequence of Tibetan antelope.

[0016] Reference may be made to CN101187635A titled Method for identifying textile fibers based on Raman spectra qualitative identification, which recitesthe method of differentiating acrylic, silk, wool, nylon and polyester fibers, but it does not include Tibetan antelope.

[0017] Reference may be made to CN107340282 titled A Fast identification method of cashmere and wool., which recites the method for identification of cashmere and woollens, but it does not include Tibetan antelope.

[0018] Reference may be made to JP4679596B2 titled To provide a method for measuring the moisture content in hair which can easily and accurately measure the moisture content in a local area of the hair, which discloses the method to measure moisture content in hair, but it does not include Tibetan antelope.

[0019] Reference may be made toEP3481280Bl Method for establishing a user-specific hair care treatment., which discloses a method for determining the hair treatment instructions, but it does not help in identifying the fiber involved.

[0020] Reference may be made toCN102634583A which recites fluorescent quantitative polymerase chain reaction (PCR) based qualitative detection method for Pantholops hodgsonii cashmere and products thereof, which discloses that the primers reliably amplify Shahtoosh, but it is TaqMan based qPCR assay and the 12S rRNA primers amplified other bovid species.

[0021] Thus, it may be noted that till date there are no specific or precise methods available for the detection of Shahtoosh fibers; especially which can distinguish Shahtoosh from Pashmina fibers. PT / 2025 / 13894

[0022] Accordingly, keeping in view the drawbacks of the hitherto reported prior art, the inventors of the present invention realized that there exists a dire need to provide a highly accurate kit and process for the identification of restricted materials like Chiru Fibers [Shahtoosh fibers] in textile samples which include raw wool, yam and woven shawls; which involves designing sensitive and species-specific primers for detection of materials originating from Chiru, by way of amplifying a small region of the DNA obtained from the fiber samples to be tested, as well as a detection kit for identification of Chiru (P. hodgsonii) based items / fibers.

[0023] OBJECTIVES OF THE INVENTION

[0024] The main objective of the present invention is to provide primers and kit for the identification of fiber samples of Pantholops hodgsonii from raw wool, yarn and woven shawls which obviates the drawbacks of the hitherto reported prior art.

[0025] Another objective of the present invention is to provide a process for detecting the presence of restricted materials of animal origin in textile samples.

[0026] Still another objective of the present invention is to provide a process wherein the samples are acquired non-destructively.

[0027] Yet another objective of the invention is to provide primers and kit which can identify P. Hodgsonii mitochondrial DNA at concentrations as low as 20 copies in SYBR Green-based qPCR assay.

[0028] Still another objective of the invention is to provide primers and kit which can identify P. Hodgsonii mitochondrial DNA with 100 % accuracy and thereby help in discouraging the use of Shahtoosh fibers.

[0029] Yet another objective of the invention is to provide primers, kit and process that shall help identify the use of restricted fibers isolated from endangered species such as P. hodgsonii.

[0030] SUMMARY OF THE INVENTION

[0031] There is a pressing need to control the illegal trade of Shahtoosh as it is obtained from an endangered species Pantholops hodgsonii (Chiru). Empowering the authorities by providing PT / 2025 / 13894 them with a kit and process to identity these fibers, including raw fibers to finished product, shall be an effective approach to control the problem.

[0032] Currently, the microscopic techniques used for the purpose, are unable to distinguish fibers and identify Shahtoosh based on the diameter and cuticular pattern of the guard hair. This approach is inexpensive but prone to errors, as it depends on the experts performing the examination.

[0033] To address this problem, the present invention provides an efficient DNA based method involving PCR, whereby the DNA from fibers could be used to identify the species of animal and quantitative PCR might be an appropriate method to amplify small fragments of DNA extracted from the animal fibers. The need is to design sensitive and species-specific primers that target mitochondrial DNA of Shahtoosh that will amplify a small region as the DNA present in the fiber samples to impart accuracy to the detection method.

[0034] In accordance with the above objectives, the present invention provides a process for the identification of restricted materials of animal origin in speciality textiles, i.e. Pantholops hodgsonii (Chiru) fibers in textile samples, comprising the following steps:

[0035] (a) collecting, storing and transporting the sample in fresh zip-lock bags in dry form and free from any cross-contaminations from the collection centre to the testing centre,

[0036] (b) extracting the sample of step [a] with tissue and hair DNA extraction kit and DNA IQ system using the manufacturer’s instructions,

[0037] (c) adding 200 pl of the lysis buffer and homogenizing the sample using a beadbeater for 4 minutes at 25 Hz,

[0038] (d) digesting the fibers with a serine protease (final concentration of 1-5 mg / mL) at 56°C for 2-4 hours,

[0039] (e) washing and eluting the DNA obtained after lysis step in 30 pl elution buffer,

[0040] (f) assessing the quantity of DNA obtained using a Nanodrop spectrophotometer and storing until use at -20 °C, PT / 2025 / 13894

[0041] (g) diluting the DNA up to 20ng / p 1 before performing PCR and qPCR,

[0042] (h) centrifuging the eluted DNA obtained in step (e) at 20000 g at 4 °C for 15 minutes,

[0043] (i) collecting the supernatant DNA obtained after this additional centrifugation step and using the same for further steps of the process;

[0044] (j) Performing PCR and SYBR Green-based qPCR using this DNA from step (i) as template and primers of SEQ ID NO. 1 and SEQ ID NO. 2 as per the manufacturer’s protocol.

[0045] (k) interpreting the qPCR results as positive, negative or inconclusive as per the qPCR kit recommendations.

[0046] In an embodiment, the present invention provides process of qPCR based in vitro detection of Pantholops hodgsonii samples, in speciality textile samples like raw wool, yarn and woven shawls, comprising the following steps:

[0047] (a) collecting, storing and transporting the sample in fresh zip-lock bags in dry form and free from any cross-contaminations from the collection centre to the testing centre,

[0048] (b) extracting the sample of step [a] with tissue and hair DNA extraction kit and DNA IQ system using the manufacturer’s instructions,

[0049] (c) adding 200 pl of the lysis buffer and homogenizing the sample using a beadbeater for 4 minutes at 25 Hz,

[0050] (d) digesting the fibers with a serine protease (final concentration of 1-5 mg / mL)at 56°C for 2-4 hours,

[0051] (e) washing and eluting the DNA obtained after lysis step in 30 pl elution buffer,

[0052] (f) assessing the quantity of DNA obtained using a Nanodrop spectrophotometer and storing until use at -20 °C, PT / 2025 / 13894

[0053] (g) diluting the DNA up to 20ng / p 1 before performing PCR and qPCR,

[0054] (h) Centrifuging the eluted DNA @ 20000 g at 12-15 °C for 15 minutes,

[0055] (i) Collecting the supernatant DNA obtained after this additional centrifugation step and using the same for further steps of the process,

[0056] (j) Performing PCR and SYBR Green-based qPCR using this DNA from step (i) as template and primers of SEQ ID NO. 1 and SEQ ID NO. 2 as per the manufacturer’s protocol,

[0057] (k) interpreting the qPCR results as positive, negative or inconclusive as per the qPCR kit recommendations.

[0058] In another embodiment, the present invention provides novel primers capable of amplifying the target mitochondrial DNA in concentrations as low as 20 copies in SYBR Green-based qPCR assay.

[0059] In yet another embodiment, the present invention provides a detection kit comprising: a. collection packet, b. the reagents for extracting the biological material from the textile samples with the DNA extraction reagents, forward and reverse primers and qPCR reagents.

[0060] In still another embodiment, the present invention provides a detection kit to identify the presence of the fibres from Pantholops hodgsonii in textile samples with 100% accuracy.

[0061] In another embodiment, the present invention provides a set of primer pair for the detection of Pantholops hodgsonii and other restricted animal materials in a speciality textile sample, wherein the said primer pair comprising:

[0062] SEQ ID No.l representing the Forward primer “ACACAACGCAAACTTCCCAC”; and SEQ ID No. 2 representing the Reverse primer “ACTGCGTATATGTTATGTTGCCA”.

[0063] In still another embodiment, the present invention provides a set of primer pair, to amplify the mitochondrial DNA sequence of Pantholops hodgsonii, represented by SEQ ID No. 7. PT / 2025 / 13894

[0064] In yet another embodiment, the present invention provides a set of primer pair, wherein the restricted animal material is chiru fibre obtained from Shahtoosh and the speciality textile samples are selected from the group comprising of raw wool, yarn and woven shawls.

[0065] In still another embodiment, the present invention provides a set of primer pair, wherein the primers can identify the presence of fibres from Pantholops hodgsonii in textile samples with 100% accuracy.

[0066] In yet another embodiment, the present invention provides a set of primer pair, wherein it is capable of amplifying the target DNA in very less concentrations, almost as low as 10 to 20 copies in SYBR Green-based qPCR assay.

[0067] In another embodiment, the present invention provides a kit for the detection of Pantholops hodgsonii and other restricted animal materials in a speciality textile sample using the primer pair, wherein the said kit comprising: a. a collection packet; b. the reagents for extracting the biological material from the textile samples comprising of DNA extraction reagents; c. forward and reverse primers represented by SEQ ID No. 1 and 2 and qPCR reagents.

[0068] In still another embodiment, the present invention provides a detection kit, wherein the reagents comprising serine protease buffer, lysis buffer and other reagents and controls for qPCR.

[0069] In yet another embodiment, the present invention provides a kit, wherein the serine protease in protein K buffer is used at a concentration range of 1 to 5 mg / ml.

[0070] In still another embodiment, the present invention provides a set of primer pair, for in-vitro detection of Pantholops hodgsonii and other restricted animal materials.

[0071] In a further embodiment, the present invention provides an in-vitro process for the detection of Pantholops hodgsonii and other restricted animal materials in a speciality textile sample, wherein the said process comprising the steps of: PT / 2025 / 13894

[0072] (a) collecting, storing and transporting the sample in fresh zip-lock bags in dry form and free from any cross-contaminations from the collection centre to the testing centre;

[0073] (b) extracting the fibers from the sample of step [a] with the tissue and hair DNA extraction kit and DNA IQ system using the manufacturer’s instructions;

[0074] (c) adding 200 pl of the lysis buffer to the fibers extracted in step (b) and homogenizing using a beadbeater for 4 minutes at 25 Hz;

[0075] (d) digesting the homogenized fibers obtained in step [c] with a serine protease of concentration 1 to 5 mg / mL at 56°C for 2 to 4 hours;

[0076] (e) washing and eluting the DNA from the digested samples obtained in step (d) in 30 pl elution buffer;

[0077] (f) assessing the quantity of DNA obtained in step (e) using a Nanodrop spectrophotometer and storing until use at minus 20 degree C followed by diluting the DNA up to 20ng / pl before performing PCR and qPCR;

[0078] (g) re-centrifuging the eluted DNA obtained in step (e) @ 20000 g at 4 °C for 15 minutes,

[0079] (h) collecting the supernatant DNA obtained after step (g) and using the same in further process;

[0080] (i) performing PCR and SYBR Green-based qPCR using the DNA obtained in step (h) as template and amplifying with primers of SEQ ID NO. 1 and SEQ ID NO. 2 as per the manufacturer’s protocol;

[0081] (j) interpreting the results obtained in step (i) as positive, negative or inconclusive as per the qPCR kit recommendations.

[0082] BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS

[0083] Figure 1 illustrates a schematic representation to explain the design of Primers and amplification of Pantholops hodgsonii mitochondrial DNA (SEQ ID NO. 7) using these unique primers. PT / 2025 / 13894

[0084] Figure 2 illustrates the Agarose gel electrophoresis gel images of the result from gradient PCR using primer set 1 (SEQ ID NO. 1 and SEQ ID NO. 2) with temperatures ranging from 50 to 60 degrees C with increments of 2°C (a) Chiru DNA, (b) Negative Control.

[0085] Figure 3(a) illustrates the specificity of primers against contaminants - chiru, yak, pashmina, merino, camel and angora.

[0086] Figure 3(b) illustrates the standard curve for qPCR with SYBR Green. The standard curve constructed using SYBR Green assay gave an R2= 0.99 (Fig.3.B). The Limit of Detection (LoD) was 20 copies, thereby the target DNA was detected.

[0087] Figure3(c) illustrates the limit of quantification. The Limit of Quantification (LoQ) was 668 copies, thereby the target DNA was quantified.

[0088] Figure 3(d) illustrates the melting curve during PCR for all the standard concentrations.

[0089] DETAILS OF BIOLOGICAL RESOURCES USED IN THE INVENTION

[0090] Samples from different sources belonging to different regions and different animals were obtained and used for the purposes of the present invention.

[0091] A. Pantholops hodgsonii (Chiru antelope):

[0092] • Fibers from Wildlife Institute of India repository - Wildlife Institute of India, P.O. box 18, Chandrabani, Dehradun 248001, Uttarakhand.

[0093] • Piece of woven shawl from Pashmina Exporters & Manufacturers Association (PEMA), A-39, FIEE Complex, Okhla Industrial Area, Phase-2, New Delhi - 20 P.Reg No: 2124

[0094] • Fibers of two woven shawls from Pashmina Exporters & Manufacturers Association (PEMA), A-39, FIEE Complex, Okhla Industrial Area, Phase-2, New Delhi - 20 P.Reg No: 2124

[0095] • Fibers from Department of Wildlife Protection, Jammu and Kashmir - Regional Wildlife Warden, Department of Wildlife Protection, Near Environmental Park Police Golf Course, Boulevard Road, Srinagar, J&K PT / 2025 / 13894

[0096] Woven threads from Department of Wildlife Protection, Jammu and Kashmir - Regional Wildlife Warden, Department of Wildlife Protection, Near Environmental Park Police Golf Course, Boulevard Road, Srinagar, J&K

[0097] B. Capra hircus (Pashmina goat): pashmina fibers from goats reared at Upshi goat farm and Zimskhang family grazing land, Ladakh, fiber and multiple weavers of Srinagar, Kashmir - Pashmina Goat Farm, Upshi, Ladakh 194201

[0098] C. Ovisaries(Merino sheep): Merino wool fibers from Fleece Testing Laboratory, Ladakh - Chief Animal Husbandary Officer, Leh, Ladakh - 194101

[0099] D. Bos grunniens (Yak): Yak hair from a yak grazing in Zemskyang family grazing land - Chief Animal Husbandary Officer, Leh, Ladakh - 194101

[0100] E. Camelus baclrianus(Doub\c humped Camel): Camel hair from Fleece Testing Laboratory, Ladakh - Chief Animal Husbandary Officer, Leh, Ladakh - 194101

[0101] F. Oryctolagus cunicidus (Angora rabbit): Wool fibers (used only for qPCR assay) from a farm in Himachal Pradesh - The Manali Valley Livestock and Other Allied Production- cum-sale Cooperative Society Ltd. Nangabagh, P.O. Bandrole, Tehsil Kullu, Himachal Pradesh

[0102] DETAILED DESCRIPTION OF THE INVENTION

[0103] The terms Chiru, Pantholops hodgsonii and P. hodgsonii and Shahtoosh have been used interchangeably in this invention and they all bear the same meaning.

[0104] The export of Pashmina shawls from India has reduced by 60% mainly due to the presence of guard hairs of Pantholops hodgsonii (Shahtoosh), a protected species, in the products. This has raised concerns about the mixing of fibers and the legal issues concerning the possible trade of the banned fiber. It has brought the Indian products under suspicion and concerns have been raised internationally on the stringency of tests and screening done in the country. Hence, techniques for identifying fiber samples of Pantholops hodgsonii would help in addressing these issues and also increase the share of genuine Indian Pashmina in the international market. PT / 2025 / 13894

[0105] Isolation of DNA from hair shaft is challenging, since the hair shaft without the root of the hair does not contain live cells. However, during the growth of the hair, mitochondria from the hair root migrate into the shaft and remain there. Knowing this, the instant invention targets mitochondrial genes and designs primers that are specific to Shahtoosh.

[0106] The new primers developed in the present invention for qPCR assay, are specific against all the vertebrata in silica and all the possible contaminants in vitro. They have been tested on samples from Pashmina, Camel, Angora, Merino and Yak. The primers invented in the instant invention amplified Shahtoosh DNA at concentrations as low as 10 to 20 copies in SYBR Green -based assay. The developed primer set comprising both the forward and reverse primers for amplifying the mitochondrial DNA of Pantholops hodgsonii can identify even a few fibers without guard hair belonging to Shahtoosh using protocol developed, using the species-specific qPCR primers.

[0107] The present invention therefore encompasses novel primer pair, a novel process and a kit for the identification of restricted materials of animal origin in speciality textiles. In particular, the present invention offers a kit for the identification of Pantholops hodgsonii fibres in textile samples.

[0108] In an aspect, the present invention provides novel primers and their applications in the identification of Pantholops hodgsonii fibres in Speciality Textile Samples.

[0109] In another aspect, the present invention provides a novel process of qPCR based in vitro detection of Pantholops hodgsonii samples in speciality textile samples like raw wool, yarn and woven shawls.

[0110] In yet another aspect, the present invention provides a kit comprising: a. collection packet, b. the reagents for extracting the biological material from the textile samples with the

[0111] DNA extraction reagents, forward and reverse primers and qPCR reagents. PT / 2025 / 13894

[0112] In still another aspect, the present invention provides a kit for the identification of restricted materials of animal origin in textile samples to ensure detection of restricted materials of animal origin in speciality textile samples.

[0113] In yet another aspect of the invention, the serine protease used is proteinase K.

[0114] In another important aspect of the invention, the concentration of proteinase K used to digest the textile fibres is in the range of 1 to 5 mg / ml.

[0115] In yet another aspect of the invention, the effective concentration of proteinase K used to digest the textile fibres was 3mg / ml.

[0116] In still another aspect, the present invention provides a highly accurate and time -efficient and cost-efficient process and method of detecting Chiru fibres in textile samples by conducting qPCR based detection.

[0117] In a further aspect of the invention, the strokes made on the textile sample to collect the fibres from each quadrant were horizontal.

[0118] In another aspect of the invention, the strokes made on the textile sample to collect the fibres from each quadrant were circular.

[0119] In yet another aspect of the invention, the primer sequences of SEQ ID NO. 1 and SEQ ID NO. 2 were used in the detection of restricted fibers of the present invention.

[0120] In still another aspect of the invention, the mitochondrial DNA of Pantholops hodgsonii species is represented by SEQ ID No. 7.

[0121] In yet another aspect of the invention, the primer sequences of SEQ ID NO. 1 and SEQ ID NO. 2 are used to amplify and obtain the mitochondrial DNA product of SEQ ID NO. 7.

[0122] In still another aspect, the present invention provides a Quantitative PCR detection kit for identification of DNA from fibers (hair shaft) of Pantholops hodgsonii species comprising specifically design primers according to mitochondrial genome sequences of closely related species. PT / 2025 / 13894

[0123] In yet another aspect, the present invention provides a Primer set comprising the forward and reverse primers that are 20 bp and 23 bp respectively. The sequence details of the primer pair are as below:

[0124] Forward 5’ ACACAACGCAAACTTCCCAC 3’ Reverse 5 ’ ACTGCGT AT ATGTTATGTTGCC A 3 ’

[0125] In still another aspect, the present invention provides a primer pair specifically designed according to mitochondrial genome sequences of species closely related to Pantholops hodgsonii. Distinct regions across chiru mitochondria are used to design this primer.

[0126] In yet another aspect, the present invention provides qPCR assay that were performed to quantify the copy numbers of the PCR amplicons. The analytical sensitivity and specificity were calculated using a Limit of Detection / Limit of Quantification (LoD / LoQ) Assay.

[0127] Details of Sequence listings for primers and Chiru DNA amplified by Primers of SEQ ID

[0128] NO. 1 and SEQ ID NO. 2 are given below: PT / 2025 / 13894

[0129] The developed primers for qPCR assay, were specific against all the vertebrata in silica and all the possible contaminants in vitro. We have tested the primers on samples from Pashmina, Camel, Angora, Merino, Yak and Human. The primers amplified Shahtoosh DNA as low as 10 to 20 copies in SYBR Green-based assay. They can identify even a few fibers without guard hair belonging to Shahtoosh using protocol developed, using the species-specific qPCR primers.

[0130] EXAMPLES

[0131] The following examples are given by way of illustration only and therefore should not be construed to limit the scope of the present invention in any manner.

[0132] Example 1: Detection of Pantholops hodgsonii fibres from woven shawls

[0133] Samples (~ 1 gm) from raw fibre or yam were collected directly. DNA was isolated from these samples and the remainder of the samples was archived at 4°C for future analysis. Using the new chiru- specific qPCR technique described here provides robust conclusions on the identity of samples. Therefore, confirmation of whether the sample of fibres belongs to chiru can be done unambiguously using the new chiru -specific qPCR technique.

[0134] As shawls have a mixture of fibres, possibly pashmina, chiru, or other fine fibres, appropriate sampling was necessary. Sampling coveredall portions of the shawl for complete representation of the material used and to avoid any erroneous identification.

[0135] Accordingly, the shawl was divided into four quadrants. The shawl was held firmly on a flat surface and scraped gently using a toothbrush that was freshly opened. Sterile gloves were worn throughout to avoid contamination.Five strokes in horizontal or circular pattern in each quadrant were made to collect ample amount of fibre without damaging the shawl after the gaps between the bristles of toothbrush accumulated the fragments of protruding fibres from warp and weft. The brush was carefully transferred into a fresh ziplock pouch without spilling PT / 2025 / 13894 the fibres. The samples were bagged and tagged properly with sample ID, location, and other necessary details to be sent for testing at the lab.

[0136] A minimum of Igram of fiber was collected as required for all the experimental analyses.

[0137] Necessary precautions like wiping the surface on which the shawl would be placed with rectified spirit before opening to avoid cross-contamination, changing gloves for every new sample that would be handled, always wearing a mask to avoid dissipation of fibre due to exhalation, which could cross -contaminate samples as the fibres remain suspended in the air for some time, using separate set of sterile forceps, scissors, and other lab-ware for each sample etc. were exercised throughout the collection and DNA isolation procedures.

[0138] All fibre samples were weighed, and DNA was extracted using tissue and hair DNA extraction kit and DNA IQ system (PromegaTM) following the manufacturer’s protocol. The fibres were subjected to bead beating after the addition of lysis buffer for 3-6 minutes at 20-30 s1frequency and digested with proteinase K along with lysis buffer at 56°C for 2-4 hours. DNA was subsequently washed and eluted in a 30 pL elution buffer. The supernatant containing DNA was analysed using a Nanodrop spectrophotometer. Once the DNA was isolated and checked for quality and quantity, it was stored at -20°C till required for further analyses. The DNA was diluted up to 20 ng / pL and an additional centrifugation was performed at 20,000 g for 15 minutes at 4 °C to remove possible inhibitors of PCR before performing PCR or qPCR.

[0139] After DNA was isolated from the sample, the remainder of the sample was stored at 4°C for future analysis.

[0140] Depending on the fibre sample amount used, the DNA obtained ranged from 0.9 ng / pl to 106.5 ng / pl (Table 2). The absorbance ratio obtained at 260 / 280 nm was low as most of the samples used were ancient specimens and processed fibers.

[0141] Using the new chiru- specific qPCR method described here provides robust conclusions on the identity of samples. Therefore, confirmation of whether the sample of fibers belongs to chiru was done unambiguously using the novel chiru- specific qPCR method.

[0142] Example 2 PT / 2025 / 13894

[0143] Mitochondrial genome sequences of species closely related to Pantholops hodgsonii from the subfamily Caprinae were retrieved from the NCBI GenBank database. All mitochondrial genomes were aligned with Clustal Omega v 1.2.4 3, and regions that are conserved across P. hodgsonii mitochondria while distinct from related species were selected for primer and oligo designing using Jalview visualization tool 4. Amplicon size was chosen as not more than 100 bps, as processed shawls might not yield good quality or quantity of DNA. Three primer sets were designed using Primer BLAST 5 with melting temperature (Tm) in the range of 55°C to 65°C and with at least 5 mismatches, including a minimum of 3 mismatches in the last 5 bps against unwanted sequences. The primer-dimer formation and specificity of primers were analysed using Primer-BLAST.

[0144] The Roche Lightcycler® 480-11 real-time PCR machine was used for these experiments. A reaction volume of 15 pl contained IX Takara master mix (TB GreenPremix Ex Taq II, RR820A), 200 nM forward and reverse primer, 1 pl DNA and the remaining volume was made up by adding nuclease-free water. The qPCR conditions were: 95°C for 30s for initial denaturation at 4.40°C / sec ramp rate, 95°C for 5s (ramp rate: 4.4°C / s) and 58°C for 30s (2.2°C / s ramp rate) for 35 cycles, and a final melt curve program of 95°C (hold:5s, ramp rate 4.4°C / s), 58°C (hold: 1 min, 2.2°C / s) and 95°C (continuous acquisition mode, 0.11°C / s, and 5 acquisitions).

[0145] Two mitochondrial genomes of Chiru (accession ID: NC_007441.1) were used as the reference sequence. Thirty-one mitogenomes belonging to the subfamily Antilopinae were downloaded from the NCBI GenBank database. Primers designed in protein-coding regions did not have specificity in Antilopinae. A conserved sequence from the control region was chosen, and three sets of primers were designed with no primer-dimer conformation (Table 1). In-silico PCR showed only Chiru as the product against the non-redundant (nr) nucleotide database of Vertebrata. Primer set 1 was chosen for further experiments.

[0146] Table 1: List of candidate primers designed in silico for chiru in qPCR. PT / 2025 / 13894

[0147] The above table 1 presents the three different sets of primer pairs used to arrive at the instant invention.

[0148] Example 3: Analytical Sensitivity and Specificity of qPCR primer pair

[0149] The synthesized gBlock™ dsDNA of the D-loop (99 bp) region was used as a template to amplify this stretch using conventional PCR with the newly designed primer set (primer set 1). The amplicon was eluted using the QIAquick Gel Extraction Kit. The DNA concentration was quantified in ng / pL using NanoDrop™ Spectrophotometer. The amplicon copy numbers present per pL were calculated using an average base pair weight of 650 Da and Avogadro's number (6.022 x 1023). The following equation was used: copy number = (DNA (in ng) x (6.022 x 1023molecule s / mol)) / (length of DNA in base pairs x 1 x 109 ng / g x 650 g / mol). A 10X dilution was performed from this copy number (in this case, 108copies) up to 1 copy per pL and used in triplicates as standards to quantify copy numbers using SYBR-Green-based qPCR assays. The quantification cycle number (Cp) was plotted against the logarithm of the DNA copy numbers of the standards used. Regression was used to compute R2in program R's Base R package 6.

[0150] The analytical sensitivity and specificity were calculated using a Limit of Detection / Limit of Quantification (LoD / LoQ) Assay. The discrete LoD / LoQ thresholds were arrived at, which represent the lowest standard that amplifies 95% of the times (LoD) and the lowest standard that accurately amplifies the copies of DNA (LoQ), with a coefficient of variance less than 35% in all replicates. For this, 24 replicates of 4X dilutions of the lower copy numbers were made, starting from 6000 copies to 1 copy per pL, along with standards starting from 108copies per reaction to 1 copy per reaction. R packages drc and ggplot2 were used to derive the standard curve plots and plots for LoD and LoQ. No template controls (NTC) were included in the assay. The melt curve plots were checked during the SYBR Green assay to ensure no non-specific amplicons were in the standards. PT / 2025 / 13894

[0151] Example 4: Evaluation of the Specificity and sensitivity of the primer pairs

[0152] The primer pair that qualified experimental validations in-silico, was the first set of primer pairs as detailed elsewhere in this patent specification. The primers of this pair were identified and listed as SEQ ID NO. 1 and SEQ ID NO. 2 throughout this patent specification. The optimum temperature for this primer set was found to be 58 °C from the temperature gradient PCR (Fig. 1, 2a, 2b). Using this temperature, the specificity assays were set up and it was found that primers of SEQ ID NO. 1 and SEQ ID NO. 2 (Primer set 1) were specific against Yak, Camel, Angora, Merino, and Pashmina (Fig. 3A). The standard curve constructed using SYBR Green assay gave an R2= 0.99 (Fig.3.B). The LoD was determined to be 20 copies, and the LoQ was 668 copies (Fig.3C). The melting curve assay showed one prominent peak for each of the standards at approximately 79 °C (Fig.3D).

[0153] The validation of SYBR green qPCR was done by running all the samples in triplicates and samples were considered positive for Chiru only when at least two replicates out of three were positive. Else, the qPCR was repeated. If Cp value was called by qPCR and the melting point of the sample matches that of the positive, only then the sample was considered positive (Table 3).

[0154] The standard curve constructed using SYBR Green assay gave an R2= 0.99 (Fig.3.B). The LoD was 20 copies, and the LoQ was 668 copies (Fig.3C).

[0155] Results obtained by us showed positive amplification for 11 authentic samples of chiru (Table. 3) And in these experiments the negative and the positive controls are clear. With ancient and degraded samples, poor yields of DNA that were of poor quality were pooled together (Table 2). However, the primer set 1 amplified the product successfully.

[0156] Table 2.The yield and quality of DNA extracted from samples of Chiru fibers. PT / 2025 / 13894 PT / 2025 / 13894

[0157] Table3.Details of samples used for validation of the primer sets of the novel process PT / 2025 / 13894

[0158] ADVANTAGES OF THE INVENTION

[0159] • Identification: The kit of the instant invention and the process thereof can identify even a few fibers with or without guard hair belonging to Shahtoosh, using the species- specific qPCR primers of the kit.

[0160] • Amplification from low copies of Shahtoosh DNA: The qPCR primers of this invention amplify Shahtoosh DNA from as low as 20 copies in SYBR Green-based assay.

Claims

1. PT / 2025 / 13894WE CLAIM:

1. A set of primer pair for the detection of Pantholops hodgsonii and other restricted animal materials in a speciality textile sample, wherein the said primer pair comprising:SEQ ID No.1 representing the Forward primer “ACACAACGCAAACTTCCCAC”; andSEQ ID No. 2 representing the Reverse primer “ ACTGCGT ATATGTT ATGTTGCC A” .

2. The set of primer pair as claimed in claim 1, wherein it amplifies the mitochondrial DNA sequence of Pantholops hodgsonii, represented by SEQ ID No. 7.

3. The set of primer pair as claimed in claim 1, wherein the restricted animal material is chiru fibre obtained from Shahtoosh and the speciality textile samples are selected from the group comprising of raw wool, yam and woven shawls.

4. The set of primer pair as claimed in claim 1 , wherein the primers can identify the presence of fibres from Pantholops hodgsonii in textile samples with 100% accuracy.

5. The set of primer pair as claimed in claim 1, wherein it is capable of amplifying the target DNA in very less concentrations, almost as low as 10 to 20 copies in SYBR Green-based qPCR assay.

6. A kit for the detection of Pantholops hodgsonii and other restricted animal materials in a speciality textile sample using the primer pair as claimed in claim 1, wherein the said kit comprising: a. a collection packet; b. the reagents for extracting the biological material from the textile samples comprising of DNA extraction reagents; c. forward and reverse primers represented by SEQ ID No. 1 and 2 and qPCR reagents.PT / 2025 / 138947. The detection kit as claimed in claim 4, wherein the reagents comprising serine protease buffer, lysis buffer and other reagents and controls for qPCR.

8. The kit as claimed in claim 4, wherein the serine protease in protein K buffer is used at a concentration range of 1 to 5 mg / ml.

9. Use of the kit as claimed in claim 4, for in-vitro detection of Pantholops hodgsonii and other restricted animal materials.

10. An in-vitro process for the detection of Pantholops hodgsonii and other restricted animal materials in a speciality textile sample, wherein the said process comprising the steps of:(a) collecting, storing and transporting the sample in fresh zip-lock bags in dry form and free from any cross-contaminations from the collection centre to the testing centre;(b) extracting the fibers from the sample of step [a] with the tissue and hair DNA extraction kit and DNA IQ system using the manufacturer’s instructions;(c) adding 200 pl of the lysis buffer to the fibers extracted in step (b) and homogenizing using a beadbeater for 4 minutes at 25 Hz;(d) digesting the homogenized fibers obtained in step [c] with a serine protease of concentration 1 to 5 mg / mL at 56°C for 2 to 4 hours;(e) washing and eluting the DNA from the digested samples obtained in step (d) in 30 pl elution buffer;(f) assessing the quantity of DNA obtained in step (e) using a Nanodrop spectrophotometer and storing until use at minus 20 degree C followed by diluting the DNA up to 20ng / pl before performing PCR and qPCR;(g) re-centrifuging the eluted DNA obtained in step (e) @ 20000 g at 4 °C for 15 minutes,(h) collecting the supernatant DNA obtained after step (g) and using the same in further process;PT / 2025 / 13894(i) performing PCR and SYBR Green-based qPCR using the DNA obtained in step (h) as template and amplifying with primers of SEQ ID NO. 1 and SEQ ID NO. 2 as per the manufacturer’s protocol;(j) interpreting the results obtained in step (i) as positive, negative or inconclusive as per the qPCR kit recommendations.

Images