Transgenic pig comprising a transgene for xenotransplantation

Abstract

The present invention relates to a transgenic pig comprising at least one transgene for xenotransplantation within its genome, wherein said at least one transgene is incorporated and expressed at a single locus 10448 (NCBI Reference Sequence: NC_010448.4). Further, the present invention relates to an organ, an organ fragment, a tissue, a scaffold or a cell obtained from said transgenic pig as defined in the present invention. The present invention also relates to the organ, the organ fragment, the tissue, the scaffold or the cell for use in a method of treating a disease in a subject comprising replacing a diseased or failed organ, organ fragment, tissue or cell in a subject by implanting into said subject at least one organ, organ fragment, tissue, scaffold or cell as defined by the present invention and an in vitro method of producing such transgenic pig of the present invention.

Description

TRANSGENIC PIG COMPRISING A TRANSGENE FOR XENOTRANSPLANTATIONCROSS-REFERENCE TO RELATED APPLICATIONSThe present application claims the benefit of priority of EP Patent Application No. 23184107.3 filed 07 July 2023, the content of which is hereby incorporated by reference in its entirety for all purposes.TECHNICAL FIELD OF THE INVENTION

[0001] The present invention relates to a transgenic pig comprising at least one transgene for xenotransplantation within its genome, wherein said at least one transgene is incorporated and expressed at a single locus 10448 (NCBI Reference Sequence: NC_010448.4). Further, the present invention relates to an organ, an organ fragment, a tissue, a scaffold or a cell obtained from said transgenic pig as defined in the present invention. The present invention also relates to the organ, the organ fragment, the tissue, the scaffold or the cell for use in a method of treating a disease in a subject comprising replacing a diseased or failed organ, organ fragment, tissue or cell in a subject by implanting into said subject at least one organ, organ fragment, tissue, scaffold or cell as defined by the present invention and an in vitro method of producing such transgenic pig of the present invention.BACKGROUND OF THE INVENTION

[0002] Xenotransplantation which describes the transfer of cells, tissues or organs between different species could effectively address the shortage of human donors. While advantageous in many ways, xenotransplantation creates a more complex immunological scenario than allotransplantation. The most profound barrier to xenotransplantation is the rejection of the grafted organ by a cascade of immune mechanisms, divided into three phases: hyperacute rejection (HAR), acute vascular rejection (AVR), and cellular rejection.

[0003] Considerable effort has been directed at addressing the immune barrier posed by xenotransplantation through genetic modification of the donor animal. The most commonly used donor animals are pigs. Pigs have been the focus of most research in xenotransplantation because pigs share many anatomical and physiological characteristics with human. Furthermore, pigs have relatively short gestation periods and can be bred in pathogen-free environments. Pigs also do not present the same ethical issues associated with most animalresearch (e.g., primates) because pigs are commonly used as a food source by human. Due to the phylogenetic distance and the faster and more severe interspecies rejection reaction compared to allogeneic transplantation, genetically modified pigs are used to obtain organs for xenotransplantation. Transplantation of porcine organs into recipients such as human recipients however leads to severe immunological rejection, which can be classified as antibody-mediated rejection including HAR and AVR as mentioned above and immune-cell-mediated rejection mechanisms. HAR is a very rapid event that results in irreversible graft damage and loss within minutes to hours following graft reperfusion. If HAR is overcome, a xenograft is then subjected to AVR which is initiated days to weeks after xenotransplantation and is caused by binding of preformed and elicited antibodies to xenoreactive non-Gal antigens on the graft endothelium. Cellular rejection mechanisms are another obstacle to the function and survival of porcine xenografts in human recipients. Particularly, in acute cellular xenograft rejection (ACXR) circulating mononuclear cells recognise the xenograft vascular endothelium and migrate into the xenogeneic tissue. This rejection process is thus characterised by cellular infiltrates of T- and B- lymphocytes, macrophages and natural killer (NK) cells and is associated with direct tissue damage.

[0004] Effective inhibition of xenograft rejection requires a number of genetic modifications that make porcine organs suitable for such transplantation and enable graft acceptance.

[0005] Therefore, there is a need to provide new transgenic pigs comprising genetic modifications exhibiting a stable expression pattern to protect xenografts against the powerful rejection mechanisms mounted by the recipient.

[0006] The solution of the present invention is described in the following, exemplified in the appended examples, illustrated in the figures and reflected in the claims.SUMMARY OF THE INVENTION

[0007] As outlined above, genetically modified pigs are thought to be a potential organ source for patients in end-stage organ failures unable to receive a timely allograft. However, in recent years, many failures in xenograft transplants have been linked to high rejection responses and therefore did not support long-term survival of the transplant due to antibody-mediated rejection including HAR and AVR as well as immune-cell-mediated rejection mechanisms.

[0008] Now, the inventors found out that by incorporating and expressing at least one transgene which is important in xenotransplantation such as a complement inhibitor, a cytoprotectant, an anticoagulant, an immunomodulator, a regulator protein of at least any one of ROS formation, superoxide formation or of caspase activity or an alpha 1 ,2 fucosyltransferaseas defined further below and placed at a particular locus within the porcine genome, the immune response in the recipient receiving the porcine organ, fragment thereof, tissue, scaffold or cell can be modulated which results in prolonging transplant survival and further no segregation of such transgene(s) occurs over multiple generations. Additionally, it was discovered that the transgenic pig of the invention comprising said at least one transgene as defined herein at said particular locus within its genome exhibit a stable expression pattern. The particular locus within the porcine genome the inventors identified is the single locus 10448 (NCBI Reference Sequence: NC_010448.4).

[0009] Thus, in a first aspect the present invention comprises a transgenic pig comprising at least one transgene for xenotransplantation within its genome, wherein said at least one transgene is incorporated and expressed at a single locus 10448 (NCBI Reference Sequence: NC_010448.4).

[0010] In a second aspect, the present invention envisages an organ, an organ fragment, a tissue, a scaffold or a cell obtained from said transgenic pig as defined in the present invention.

[0011] In a third aspect, the present invention comprises the organ, the organ fragment, the tissue, the scaffold or the cell for use in a method of treating a disease in a subject, the method comprising replacing a diseased or failed organ, organ fragment, tissue or cell in a subject by implanting into said subject at least one organ, organ fragment, tissue, scaffold or cell as defined by the present invention.

[0012] In a fourth aspect, the present invention encompasses a method of producing the transgenic pig of the present invention, the method comprising i) incorporating at least one transgene at a single locus 10448 (NCBI Reference Sequence: NC_010448.4) within a pig genome to provide a polygenic pig genome in vitro', ii) permitting a cell comprising the polygenic pig genome to mature into the transgenic pig.FIGURE LEGENDS

[0013] Figure 1 : Detailed integration site at 57MB within the novel locus 10448 (see SEQ ID NO: 6). Short sequences below indicate primer combinations for PCR verification of the Nanopore Data (see SEQ ID NOs: 7 and 8).

[0014] Figure 2: Blast analysis of the boundary sequence against the pig genome revealed the novel locus 10448.

[0015] Figure 3: The precise integration site at 57MB within the novel locus 10448; alignmentperformed via Blast analysis.DETAILED DESCRIPTION OF THE INVENTION

[0016] Although the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodologies, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

[0017] In the following, the elements of the present invention will be described. These elements are listed with specific embodiments. However, it should be understood that they may be combined in any manner and in any number to create additional embodiments. The variously described examples and preferred embodiments described throughout the specification should not be construed to limit the present invention to only the explicitly described embodiments. This description should be understood to support and encompass embodiments which combine the explicitly described embodiments with any number of the disclosed and / or preferred elements. Furthermore, any permutations and combinations of all elements described herein should be considered disclosed by the description of the present specification unless the context indicates otherwise.

[0018] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated member, integer or step or group of members, integers or steps but not the exclusion of any other member, integer or step or group of members, integers or steps although in some embodiments such other member, integer or step or group of members, integers or steps may be excluded, i.e. the subject-matter consists in the inclusion of a stated member, integer or step or group of members, integers or steps. When used herein the term “comprising” can be substituted with the term “containing” or “including” or sometimes when used herein with the term “having”. When used herein “consisting of' excludes any element, step, or ingredient not specified.

[0019] The terms "a" and "an" and "the" and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.

[0020] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as"), provided herein is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.

[0021] Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. The term “at least one” refers to one or more such as one, two, three, four, five, six, seven, eight, nine, ten and more. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

[0022] The term "and / or" wherever used herein includes the meaning of "and", "or" and "all or any other combination of the elements connected by said term".

[0023] When used herein “consisting of' excludes any element, step, or ingredient not specified in the claim element. When used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.

[0024] The term “including” means “including but not limited to”. “Including” and “including but not limited to” are used interchangeably.

[0025] The term “about” means plus or minus 20%, preferably plus or minus 10%, more preferably plus or minus 5%, most preferably plus or minus 1%.

[0026] Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

[0027] It should be understood that this invention is not limited to the particular methodology, protocols, material, reagents, and substances, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.

[0028] Several documents are cited throughout the text of this specification. Each of thedocuments cited herein (including all patents, patent specifications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material.

[0029] The content of all documents and patent documents cited herein is incorporated by reference in their entirety.

[0030] A better understanding of the present invention and of its advantages will be gained from the examples, offered for illustrative purposes only. The examples are not intended to limit the scope of the present invention in any way.

[0031] Locus

[0032] As used herein, the term "genomic locus" or "locus" broadly to refer to any segment of DNA associated with a certain location on the chromosome, including the specific location of a gene, coding and / or non coding sequences or a DNA sequence on a chromosome, and can include non-coding, intron and / or exon sequences of a particular gene. Within the present invention, such locus refers to the single locus 10448 having the NCBI Reference Sequence: NC_010448.4 which is located on chromosome 6q22 within the porcine genome. The first number used to describe a gene's location represents the chromosome, here chromosome 6 of the pig genome. The second letter describes the arm of the chromosome, which is here the long arm of chromosome 6 - the q-arm. The last number refers to the position of the gene on the p or q arm of the chromosome. The position of a gene is based on a distinctive pattern of light and dark bands that appear when the chromosome is stained in a certain way. The position is usually designated by two digits (representing a region and a band). The position here refers to position 22 on the q-arm of porcine chromosome 6.

[0033] The term “single locus” makes it clear that said at least one transgene for xenotransplantation as defined herein below is incorporated and expressed at only this particular location within the porcine genome. The sequence of said locus can e.g. be found under “Sus scrofa isolate TJ Tabasco breed Duroc chromosome 6, Sscrofa 11.1”, as annotated in the sus scrofa annotation release 106. The locus, as annotated, refers to the region which spans from porcine Chromosome 6: 29Mb to porcine Chromosome 6: 164Mb (see Figure 2).

[0034] Incorporating at least one transgene as defined herein into said particular locus of the invention avoids segregation of said at least one transgene over several generations. The locusalso enables the incorporation of more than one transgene. Such locus is a “safe harbour” which does not interfere with gene function necessary for development and animal health, supports high levels of transgene expression, proves stable expression pattern over several generations, without having negative health effects in heterozygous animals.

[0035] The precise locus was identified by Oxford Nanopore sequencing as known to the person skilled, followed by an alignment of the obtained sequence with the porcine genome via Blast analysis, and further confirmed by PCR analysis (see Example section).Transgenic pig and transgene

[0036] The pig of the invention is "genetically modified" or "transgenic" which means in general that it has a transgene, or other foreign DNA, incorporated, or an endogenous gene modified, including, targeted, recombined, interrupted, deleted, disrupted, replaced, suppressed, enhanced, or otherwise altered, to mediate a genotypic or phenotypic effect in at least one cell of the pig and typically into at least one germ line cell of the pig. The transgenic pig of the invention has a transgene for xenotransplantation as defined herein below incorporated at the defined locus of the invention within the porcine genome. In some embodiments, the transgenic pig may has the transgene for xenotransplantation as defined herein integrated on one allele of its genome (heterozygous transgenic). In other embodiments, the transgenic pig may has the transgene for xenotransplantation as defined herein integrated on the two alleles (homozygous transgenic). The term “genome” refers to all hereditary information present in a cell. In pigs, the nuclear genome is stored in the form of DNA on 38 chromosomes (diploid chromosome set) in the cell nucleus (“porcine I pig genome”).

[0037] As used herein, the terms "porcine" and “pig" are generic terms referring to the same type of animal without regard to gender, size, or breed. The transgenic pig of the invention refers to a “donor” used in xenotransplantation as described herein. As used herein, the term "donor" means to include any transgenic pig that may serve as a source of a donor organ, organ fragment, tissue, scaffold or cells for xenotransplantation. The donor may be in any stage of development, including, but not limited to fetal, neonatal, young and adult. In certain embodiments, the transgenic pig is past weaning age or survives to reach breeding age.

[0038] A "transgene" is a gene or genetic material that has been transferred from one subject to another. When a transgene is transferred into a subject, the subject can then be referred to as a transgenic subject, such as the transgenic pig of the invention. Typically, the term describes a segment of DNA containing a gene sequence that has been isolated from one subject and is introduced into a different subject. This non-native segment of DNA may retain the ability to produce RNA or protein in the transgenic subject, such as the transgenic pig of theinvention, or it may alter the normal function of the transgenic subject's genetic code. In general, the DNA is incorporated into the subject’s germ line. For example and also comprised by the invention, in higher vertebrates this can be accomplished by injecting the foreign DNA into the nucleus of a fertilized oocyte (which is called pronuclear microinjection) or preferably via somatic cell nuclear transfer (SCNT) where a somatic cell, with the desired transgene(s) incorporated into the host genome (transgenic pig genome), is transferred to an enucleated oocyte and results in live offspring after transplantation into a surrogate mother.

[0039] In this context and throughout the whole specification, a “transgene for xenotransplantation” or a “xenotransplantation transgene” which is incorporated and expressed at the particular locus of the invention and thus being comprised by the genome of the transgenic pig is any transgene suitable for use in modifying a pig (which then refers to a transgenic pig) as defined herein for use in xenotransplantation. Thus, such transgene plays a role in xenotransplantation, thus being able to modulate the immune response in the recipient, such as inhibiting HAR, AVR, ACXR and / or chronic rejection after xenotransplantation, thereby prolonging the survival of the transplant in the recipient.

[0040] Transgene "expression" in the context of the present specification, unless otherwise specified, means that a peptide sequence from a non-native DNA segment is expressed in at least one cell in the host, the transgenic pig of the invention. A protein as defined herein can be expressed from said at least one transgene that is incorporated in the host genome (transgenic pig genome). The transgene can comprise a polynucleotide encoding the protein or a fragment (e.g., a functional fragment) thereof, such protein which is encoded by said transgene and defined elsewhere herein (e.g. complement inhibitor, cytoprotectant, anticoagulant, immunomodulator, regulator protein, an alpha 1 ,2 fucosyltransferase). A fragment (e.g., a functional fragment) of said protein can comprise at least or at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the amino acid sequence of said protein. A fragment of said protein can be a functional fragment of said protein as defined herein. A functional fragment of said protein can retain part or all of the function of the protein as defined herein.

[0041] Additionally, the present invention may also encompass the transgenic pig as defined herein, wherein said at least one transgene is a gene sequence, a minigene or a cDNA (complementary DNA) construct, preferably said at least one transgene is a gene sequence.A “gene sequence” refers to the gene itself residing in its original region of genomic DNA, meaning the transgene of the invention refers to the whole native gene and all control regions necessary for the gene to express itself, within the genome of the subject (such as a human) the transgene is derived from. A “minigene” can be characterized by a gene fragment, such as afragment of a native gene sequence, comprising an exon and / or intron sequence, the endogenous or synthetic / semisynthetic control regions necessary for the gene to express itself and a cDNA sequence of several exons. A “cDNA construct” can be characterized by an endogenous or synthetic / semisynthetic promoter, several exons and all control regions necessary for the gene to express itself. Often, cDNA expresses only a single isoform of a protein, a minigene expresses only a limited number of isoforms of a protein, whereas a gene sequence expresses all isoform of a protein, including membrane bound and the soluble. Due to the size of said particular locus of the invention, a targeting vector comprising a gene sequence, minigene or cDNA construct, preferably a gene sequence of said at least one transgene for xenotransplantation as defined herein may be used herein. The sequence of said at least one transgene as defined herein is preferably human or porcine. Even more preferably, the present invention encompasses the transgenic pig as defined herein, wherein said at least one transgene is a human or porcine gene sequence, a human or porcine minigene or a human or porcine cDNA construct, most preferably said at least one transgene is a human or porcine gene sequence. In this context, the subject said at least one transgene is derived from as defined herein which is then comprised by the targeting vector as defined herein is a human or a pig.

[0042] The sequence of said at least one transgene can be single or double stranded, linear or circular, relaxed or supercoiled DNA. The transgene can further be a gene sequence, in particular when introduced as large clones in BACs (bacterial artificial chromosomes), phage artificial chromosome (PAG) or cosmid, or could be a “minigene” or a “cDNA construct” as mentioned above. BAG, PAG, human artificial chromosome (HAG), and yeast artificial chromosome (YAC) all refer to large targeting vectors for eukaryotic cells that are derived from fragments of cloned genomic DNA larger than those typically used by other approaches intended to perform gene targeting by homologous recombination or any gene editing methods in eukaryotic cells. Such targeting vector used for incorporating said at least on transgene of the invention at the particular locus refers to recombinant DNA construct comprising said transgene of the invention and optionally a 5’ and / or 3’ DNA arm homologous to genomic DNA that flanks said transgene (homology arm). Such vector may be used to transfer such transgene from one subject (such as human) where the transgene is derived from to the other subject’s germ line (pig germ line) as defined above and elsewhere herein. When introduced into a cell of a pig as defined elsewhere herein, the targeting vector integrates into the pig cell genome via homologous recombination or via any gene editing methods as defined herein at the particular locus, thereby incorporating said at least one transgene as defined herein at said particular locus within the porcine genome.

[0043] Additionally, such targeting vector may comprise one or more recognition sequences fora polynucleotide modification enzyme. In some embodiments, the polynucleotide modification enzyme is selected from the group of a prokaryotic or an eukaryotic nuclease consisting of an engineered endonuclease, a site specific recombinase, an integrase, or combinations thereof. In one embodiment, the engineered endonuclease is selected from the group consisting of zinc finger nucleases, transcription activator-like effector nucleases, and CRISPR / Cas nucleases, preferably CRISPR / Cas9. In one embodiment, the site specific recombinase is selected from the group consisting of lambda integrase, Cre recombinase, FLP recombinase, gamma-delta resolvase, Tn3 resolvase, OC31 integrase, Bxbl -integrase, R4 integrase or combinations thereof. Further comprised by said targeting vector may be a selectable marker available to confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, blasticidin, zeocin, methotrexate, phosphinothricin, puromycin, and tetracycline.

[0044] Such vector may further comprise at least one promoter so that said at least one transgene is incorporated and expressed at said single locus 10448 under the control of at least one promoter. A promoter being used herein may be any one of an exogenous promoter, endogenous promoter, a constitutive promoter such as GAG, CMV, SV40 and the like, a regulatable promoter such as an inducible promoter or a tissue-specific promoter. When two or more transgenes as defined herein are comprised within the transgenic pig genome, such transgenes may be incorporated and expressed at said single locus 10448 under the control of two or more promoters which can be the same or different depending on the transgenes. In alternative embodiments, one promoter may control expression of more than one transgene, e.g., one promoter controls expression of two transgenes. For example, where the transgenic pig incorporates and expresses two or more transgenes as defined herein, said two or more transgenes may be expressed as a polycistron controlled by a promoter.

[0045] Additionally, such vector may comprise an extended 5’ and / or 3’ flanking region, wherein such flanking region may also include such promoter sequence as defined herein which may also include control regions and be involved in creating open chromatin, thus ensuring ubiquitous expression. Said at least one transgene as defined herein may also be comprised within said vector with a copy number of 1 or more than 1 such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or even more. Such copy number may be analyzed by digital drop PGR. Having one copy number of said at least one transgene of the invention is however already sufficient to result in an expression of said at least one of the underlying proteins as defined herein (e.g. complement inhibitor, cytoprotectant, anticoagulant, immunomodulator, regulator protein, an alpha 1 ,2 fucosyltransferase) encoded by said at least one transgene that is above the corresponding expression of said at least one protein as defined herein in a subject from which said at least one transgene encoding said at least one protein as defined herein is derived from.

[0046] The present invention may also comprise a vector that may be used for random integration in combination with molecular scissors or a targeting vector as defined also herein comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes GPX4 or a regulator thereof. The present invention may also comprise a vector that may be used for random integration in combination with molecular scissors or a targeting vector as defined also herein comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes I LIRA or a regulator thereof. The present invention may also comprise a vector that may be used for random integration in combination with molecular scissors or a targeting vector as defined also herein comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes IL27alpha (IL27a) or a regulator thereof. The present invention may also comprise a vector that may be used for random integration in combination with molecular scissors or a targeting vector as defined also herein comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes AKIP1 or a regulator thereof. Each vector may be used for incorporating such transgene at a single locus within a mammal genome, preferably a pig genome. Thus, the present invention may also comprise the use of each vector as defined in this paragraph for the incorporation and the expression of said at least one transgene as defined in this paragraph at a single locus within a mammal genome, preferably a pig genome. In this context, the term “a regulator thereof” may refer to a different gene which encodes an activator of the signal cascade of the corresponding GPX4, IL1 RA, IL27a or AKIP1 which may be used as said at least one transgene and which is then expressed, thereby enhancing the expression of the corresponding GPX4, IL1 RA, IL27a or AKIP1. Alternatively, a “regulator thereof” may refer to a deleted or inactivated (as defined herein, see e.g. paragraphs 96-98) repressor of the signal cascade of the corresponding GPX4, IL1 RA, IL27a or AKIP1 which may be used as said at least one transgene and which is then not expressed, thereby enhancing the expression of the corresponding GPX4, I LI RA, IL27a or AKIP1.

[0047] A targeting vector as defined herein may comprise homology arms, whereas the vector that may be used for random integration does not. By applying the latter vector in combination with molecular scissors as known to the person skilled a targeted integration may also be possible. Each of the abovementioned vector may comprise a polycistronic structure when comprising more than the abovementioned transgenes encoding such as GPX4 or a regulator thereof in the first exemplarily embodiment, encoding IL1 RA or a regulator thereof in the second exemplarily embodiment, encoding IL27a or a regulator thereof in the third exemplarily embodiment and encoding AKIP1 or a regulator thereof in the fourth exemplarily embodiment, expressing said two or more transgenes as a polycistron controlled by a promoter as defined herein. The vector comprising said transgene encoding GPX4 or a regulator thereof may furthercomprise at least another transgene for xenotransplantation, said at least another transgene encoding a complement inhibitor as defined herein. The vector comprising said transgene encoding GPX4 or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding a cytoprotectant as defined herein. The vector comprising said transgene encoding GPX4 or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding an anticoagulant as defined herein. The vector comprising said transgene encoding GPX4 or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding an immunomodulator as defined herein. The vector comprising said transgene encoding GPX4 or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity as defined herein. The vector comprising said transgene encoding GPX4 or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding an alpha 1 ,2 fucosyltransferase as defined herein. The vector comprising said transgene encoding I LIRA or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding a complement inhibitor as defined herein. The vector comprising said transgene encoding I LIRA or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding a cytoprotectant as defined herein. The vector comprising said transgene encoding IL1 RA or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding an anticoagulant as defined herein. The vector comprising said transgene encoding I LIRA or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding an immunomodulator as defined herein. The vector comprising said transgene encoding IL1 RA or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity as defined herein. The vector comprising said transgene encoding IL1RA or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding an alpha 1 ,2 fucosyltransferase as defined herein. The vector comprising said transgene encoding IL27a or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding a complement inhibitor as defined herein. The vector comprising said transgene encoding IL27a or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding a cytoprotectant as defined herein. The targeting vector comprising said transgene encoding IL27a or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at leastanother transgene encoding an anticoagulant as defined herein. The targeting vector comprising said transgene encoding IL27a or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding an immunomodulator as defined herein. The vector comprising said transgene encoding IL27a or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity as defined herein. The vector comprising said transgene encoding IL27a or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding an alpha 1 ,2 fucosyltransferase as defined herein. The vector comprising said transgene encoding AKIP1 or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding a complement inhibitor as defined herein. The vector comprising said transgene encoding AKIP1 or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding a cytoprotectant as defined herein. The targeting vector comprising said transgene encoding AKIP1 or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding an anticoagulant as defined herein. The targeting vector comprising said transgene encoding AKIP1 or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding an immunomodulator as defined herein. The vector comprising said transgene encoding AKIP1 or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity as defined herein. The vector comprising said transgene encoding AKIP1 or a regulator thereof may further comprise at least another transgene for xenotransplantation, said at least another transgene encoding an alpha 1,2 fucosyltransferase as defined herein.

[0048] Such vector may be used to target different loci within a mammalian genome, preferably a pig genome. Such a locus as defined further below may be a native locus. Alternatively, such locus as defined further below may be a modified native locus. The modified native locus may be modified by any suitable technique, for example by homologous recombination, application of gene editing or recombinase technology, including, but not limited to, CRISPR-induced insertion or deletion (indel), introduction of a selectable marker gene (e.g., neo) or introduction of a large genomic insert (e.g., a landing pad) intended to facilitate incorporation of said transgene. The modified native locus may comprise a gene editing-mediated insertion, deletion or substitution; or a transgenic DNA. The transgenic DNA may comprise a selectable maker gene or a landing pad as it is known to a person skilled in the art.

[0049] Such a locus includes, but is not limited to, locus 10448 as it is defined by the invention, ROSA26, CMAH, B4GalNT2, AAVS1, GGTA1, GRH etc. The sequence of said at least one particular transgene encoding any one of GPX4, IL1 RA, IL27a, or AKIP1 or a regulator thereof is a gene sequence, a minigene or a cDNA construct as defined herein, preferably a gene sequence. Even more preferably, the sequence of said at least one particular transgene encoding any one of GPX4, IL1RA, IL27a, or AKIPI or a regulator thereof is a human or porcine gene sequence, a human or porcine minigene or a human or porcine cDNA construct as defined herein, most preferably a human or porcine gene sequence. The sequence of said at least one transgene encoding any one of GPX4, IL1 RA, IL27a, or AKIP1 or a regulator thereof can be single or double stranded, linear or circular, relaxed or supercoiled DNA. The transgene can be flanked on one or both sides by homologous DNA sequences, a 3' homology arm and / or a 5' homology arm. Methods for the construction of targeting vectors have been described in the art, see, for example, Dai et al. (2002) Nature Biotechnology 20: 251-255; WO 00 / 51424, FIG. 6; and Gene Targeting: A Practical Approach. Joyner, A. Oxford University Press, USA; 2. sup. nd ed. Feb. 15, 2000.

[0050] Such vectors include chromosomal-, episomal- and virus-derived vectors, vectors derived from bacterial plasmids or bacteriophages, and vectors derived from combinations thereof, such as cosmids and phagemids or virus-based vectors such as adenovirus, AAV, lentiviruses. Such vectors include, but is not limited to, PAG, BAC, YAC, HAC, in particular when a gene sequence of said transgene is used which is preferred.

[0051] Additionally, such vector may comprise one or more recognition sequences for a polynucleotide modification enzyme. In some embodiments, the polynucleotide modification enzyme is selected from the group consisting of engineered endonucleases, site specific recombinases, integrases, or combinations thereof. In one embodiment, the engineered endonuclease is selected from the group consisting of zinc finger nucleases, transcription activator-like effector nucleases, and CRISPR / Cas9 nucleases, preferably CRISPR / Cas9. In one embodiment, the site specific recombinase is selected from the group consisting of lambda integrase, Cre recombinase, FLP recombinase, gamma-delta resolvase, Tn3 resolvase, OC31 integrase, Bxbl -integrase, R4 integrase or combinations thereof. Further comprised by said vector may be a selectable marker available to confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, blasticidin, zeocin, methotrexate, phosphinothricin, puromycin, and tetracycline.

[0052] The present invention may also comprise a kit comprising said vector comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes GPX4 or a regulator thereof. Thus, the present invention may comprise a kitcomprising said vector comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes IL1 RA or a regulator thereof. Thus, the present invention may comprise a kit comprising said vector comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes IL27a or a regulator thereof. Thus, the present invention may comprise a kit comprising said vector comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes AKIP1 or a regulator thereof. In a further embodiment, said kits may comprise a manual comprising instructions for performing a method of incorporating and expressing said at least one transgene for xenotransplantation encoding any one of GPX4, IL1 RA, IL27a, or AKIP1 or a regulator thereof at a single locus within a mammal genome, preferably a pig genome. Meaning the present invention may comprise a kit comprising said vector as defined above comprising at least one transgene for xenotransplantation, wherein said at least one transgene encodes GPX4 or a regulator thereof, further comprising a manual comprising instructions for performing a method of incorporating and expressing said at least one transgene for xenotransplantation (GPX4) at a single locus within a mammal genome, preferably a pig genome. This may be applicable - with regard to the manual - to a kit comprising said vector as defined above comprising at least one transgene for xenotransplantation, wherein said transgene encodes IL1 RA or a regulator thereof. The same is applicable to a kit comprising said vector as defined above comprising at least one transgene for xenotransplantation, wherein said transgene encodes IL27a or a regulator thereof. And also to a kit comprising said vector as defined above comprising at least one transgene for xenotransplantation, wherein said transgene encodes AKIP1 or a regulator thereof.

[0053] The present invention may also comprise a kit comprising said vector comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes GPX4 or a regulator thereof and further comprising another vector comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes any one of I LI RA, IL27a or AKIP1 or a regulator thereof. The present invention may also comprise a kit comprising said vector comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes I LIRA or a regulator thereof and further comprising another vector comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes any one of GPX4, IL27a or AKIP1 or a regulator thereof. The present invention may also comprise a kit comprising said vector comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes IL27a or a regulator thereof and further comprising another vector comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes any one of GPX4, I LIRA or AKIP1 or a regulator thereof. The present invention may also comprise a kit comprising said vectorcomprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes AKIP1 or a regulator thereof and further comprising another vector comprising at least one transgene for xenotransplantation as defined herein, wherein said at least one transgene encodes any one of GPX4, I LI RA or IL27a or a regulator thereof. Each of these combination kits optionally comprise said manual.

[0054] Each definition used within the present invention with regard the transgenic pig and the incorporation of said at least one transgene at single locus 10448 within the pig genome may also be applicable to the vectors comprising at least one transgene encoding any one of GPX4, IL1 RA, IL27a, or AKIP1 or a regulator thereof as mentioned herein. The abovementioned vectors comprising at least one transgene encoding any one of GPX4, IL1 RA, IL27a, or AKIP1 or a regulator thereof as exemplarily embodiments may also be applied within the method of the invention, for incorporating said particular transgenes at the single locus of the invention within the porcine genome.

[0055] Such at least one transgene as defined herein may be incorporated at said single locus 10448 by any suitable technique, including for example homologous recombination (gene targeting by homologous recombination) or gene editing methods or recombinase technology using site-specific recombinase as known to the person skilled. As used herein, the term “gene editing method” refers to a type of genetic engineering in which DNA is inserted, replaced, or removed from a genome using gene editing tools. Examples of gene editing tools include, without limitation, zinc finger nucleases, TALEN and CRISPR. Preferably, such at least one transgene as defined herein may be incorporated at said single locus 10448 by CRISPR / Cas9.

[0056] As used herein, the term "CRISPR" or “Clustered Regularly Interspaced Short Palindromic Repeats” refers to a family of DNA loci that are usually specific to a particular bacterial species. The CRISPR locus comprises a distinct class of interspersed short sequence repeats (SSRs) that were recognized in E. coli (Ishino et al., J. Bacteriol., 169:5429-5433

[1987] ; and Nakata et al., J. Bacteriol., 171 :3553-3556

[1989] ), and associated genes. CRISPR / Cas molecules are components of a prokaryotic adaptive immune system that is functionally analogous to eukaryotic RNA interference, using RNA base pairing to direct DNA or RNA cleavage. Directing DNA DSBs requires two components: the Cas9 protein, which functions as an endonuclease (locating and cleaving target DNA), and CRISPR RNA (crRNA) and tracer RNA (tracrRNA) sequences that aid in directing the Cas9 / RNA complex to target DNA sequence (Makarova et al., Nat Rev Microbiol, 9(6):467-477, 2011).

[0057] The present invention may encompass said transgenic pig as defined herein, wherein said at least one transgene encodes a complement inhibitor, a cytoprotectant, an anticoagulant,an immunomodulator, or a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity, or an alpha 1 ,2 fucosyltransferase; or a combination thereof. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene encodes a complement inhibitor as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene encodes a cytoprotectant as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene encodes an anticoagulant. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene encodes an immunomodulator as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene encodes an immunosuppressant as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene encodes a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene encodes an alpha 1 ,2 fucosyltransferase as defined elsewhere herein.

[0058] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a complement inhibitor and a cytoprotectant as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a complement inhibitor and an anticoagulant as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a complement inhibitor and an immunomodulator as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a complement inhibitor and an immunosuppressant as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a complement inhibitor and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a complement inhibitor and an alpha 1 ,2 fucosyltransferase as defined elsewhere herein.

[0059] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a cytoprotectant and ananticoagulant as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a cytoprotectant and an immunomodulator as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a cytoprotectant and an immunosuppressant as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a cytoprotectant and a regulator protein as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a cytoprotectant and an alpha 1 ,2 fucosyltransferase as defined elsewhere herein.

[0060] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding an anticoagulant and an immunomodulator as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding an anticoagulant and an immunosuppressant as defined elsewhere herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding an anticoagulant and a regulator protein as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding an anticoagulant and an alpha 1,2 fucosyltransferase as defined elsewhere herein.

[0061] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding an immunomodulator and a regulator protein as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding an immunosuppressant and a regulator protein as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding an immunomodulator and an alpha 1 ,2 fucosyltransferase as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding an immunosuppressant and an alpha 1 ,2 fucosyltransferase as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a regulator protein and an alpha 1 ,2 fucosyltransferase as defined herein.

[0062] A “complement inhibitor” as used herein refers to a complement pathway inhibitor proteinwhich inhibits the immune response of the recipient. The present invention may also comprise said transgenic pig as defined herein, wherein said at least one transgene for xenotransplantation is a complement inhibitor which is any one of Cluster of Differentiation 55 (CD55), Cluster of Differentiation 46 (CD46) or Cluster of Differentiation (CD59), or a combination thereof. Activation of the complement system being part of the innate immune system leads to the formation of the C3 and C5 convertases and ultimately the membrane attack complex (MAC) that initiates cell lysis. Each of CD46, CD55 and CD59 inhibit complement activation at the levels of C3 convertase, C5 convertase and the MAC, resulting in blocking HAR. Such inhibition prevents cross-activation of the complement system at stages later than C3 convertase, for example by coagulation factors that interact with the complement system.

[0063] Thus, said at least one transgene of the invention encodes CD55. Said at least one transgene of the invention encodes CD46. Said at least one transgene of the invention encodes CD59. Said at least one transgene of the invention encodes CD55 and CD46. Said at least one transgene of the invention encodes CD55 and CD59. Said at least one transgene of the invention encodes CD46, CD55 and CD59. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding CD46 and the second one encoding a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD46 and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD46 and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD46 and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD46 and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD46 and an alpha 1 ,2 fucosyltransferase as defined herein.

[0064] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding CD55 and the second one encoding a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD55 and an anticoagulant as defined herein. The presentinvention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD55 and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD55 and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD55 and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD55 and an alpha 1,2 fucosyltransferase as defined herein.

[0065] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding CD59 and the second one encoding a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD59 and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD59 and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD59 and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD59 and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a CD59 and an alpha 1,2 fucosyltransferase as defined herein.

[0066] The same applies to the combination of CD55 and CD46 and any one of a cytoprotectant, an anticoagulant, an immunomodulator (preferably an immunosuppressant), a regulator protein or an alpha 1 ,2 fucosyltransferase as defined herein, if said at least one transgene is at least three transgenes. The same also applies to the combination of CD55 and CD59 and any one of a cytoprotectant, an anticoagulant, an immunomodulator (preferably an immunosuppressant), a regulator protein or an alpha 1 ,2 fucosyltransferase as defined herein, if said at least one transgene is at least three transgenes. The same also applies to the combination of CD46, CD55 and CD59 and any one of a cytoprotectant, an anticoagulant, an immunomodulator (preferably an immunosuppressant), a regulator protein or an alpha 1 ,2 fucosyltransferase as defined herein, if said at least one transgene is at least four transgenes.

[0067] As used herein, the term “cytoprotectant” refers to a cryoprotective protein which isconsidered to include anti-apoptotics such as A20 or GPX4 (which inhibit apoptosis, necrosis and / or ferroptosis), anti-oxidants and / or anti-inflammatories such as HO-1. The present invention may also comprise said transgenic pig as defined herein, wherein said at least one transgene for xenotransplantation is a cytoprotectant which is any one of Tumor necrosis factoralpha induced protein 3 (A20 / TNFAIP3), Heme oxygenase 1 (HO-1) or Gluthatione peroxidase 4 (GPX4), or a combination thereof. A20 for example inhibits NFkB-activation and thus upregulation of pro-inflammatory and pro-apoptotic cytokines including TNFa and interleukin-1 p (IL-1 P). Further, A20 protects porcine aortic endothelial cells against TNFa-induced apoptosis and confers partial protection against ischemia / reperfusion injury. A20 and HO-1 both have anti- apoptotic effects via inhibition of caspase activity and both inhibit endothelial activation and AVR, thus providing vascular protection. GPX4 acts as a central regulator of ferroptosis and ROS formation. This is especially important for kidney xenotransplantation as kidney tubules undergo mainly ferroptosis during rejection.

[0068] Thus, said at least one transgene of the invention encodes A20. Said at least one transgene of the invention encodes HO-1. Said at least one transgene of the invention encodes GPX4. Said at least one transgene of the invention encodes A20 and HO-1. Said at least one transgene of the invention encodes A20 and GPX4. Said at least one transgene of the invention encodes HO-1 and GPX4. Said at least one transgene of the invention encodes A20, HO-1 and GPX4. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding A20 and the second one encoding a complement inhibitor as defined herein, preferably any one of CD46, CD55 or CD59; or CD46, CD55 and CD59. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding A20 and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding A20 and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding A20 and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding A20 and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding A20 and an alpha 1,2 fucosyltransferase as defined herein.

[0069] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding HO-1 andthe second one encoding a complement inhibitor, preferably any one of CD46, CD55 or CD59; or CD46, CD55 and CD59. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a HO-1 and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a HO-1 and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a HO-1 and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding a HO-1 and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding HO-1 and an alpha 1 ,2 fucosyltransferase as defined herein.

[0070] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding GPX4 and the second one encoding a complement inhibitor, preferably any one of CD46, CD55 or CD59; or CD46, CD55 and CD59. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding GPX4 and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding GPX4 and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding GPX4 and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding GPX4 and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding GPX4 and an alpha 1 ,2 fucosyltransferase as defined herein.

[0071] The same applies to the combination of A20 and HO-1 and any one of a complement inhibitor (preferably CD46, CD55 and CD59), an anticoagulant, an immunomodulator (preferably an immunosuppressant), a regulator protein or an alpha 1 ,2 fucosyltransferase as defined herein, if said at least one transgene is at least three transgenes. The same applies to the combination of A20 and GPX4 and any one of a complement inhibitor (preferably CD46, CD55 and CD59), an anticoagulant, an immunomodulator (preferably an immunosuppressant),a regulator protein or an alpha 1 ,2 fucosyltransferase as defined herein, if said at least one transgene is at least three transgenes. The same applies to the combination of HO-1 and GPX4 and any one of a complement inhibitor (preferably CD46, CD55 and CD59), an anticoagulant, an immunomodulator (preferably an immunosuppressant), a regulator protein or an alpha 1,2 fucosyltransferase as defined herein, if said at least one transgene is at least three transgenes.

[0072] As used herein, the term “anticoagulant” refers to a protein that prevents or reduces coagulation of blood. Such coagulation is considered a major problem in xenotransplantation. A critical regulator of coagulation is for example the protein C / thrombomodulin pathway. Thrombomodulin is a transmembrane glycoprotein expressed on endothelial cells and encoded by the THBD gene. By binding to thrombin, thrombomodulin inhibits the procoagulant activity of thrombin, blocking conversion of fibrinogen to fibrin. Thrombin now becomes an anticoagulant, increasing protein C activation. The activated protein C protease inactivates factor Va and Villa and thereby inhibits the enzymatic cascade responsible for clot formation. Pigs transgenic for human thrombomodulin revealed increased activated protein C production in an in vitro coactivity assay, but no disturbance of the porcine coagulation system (Petersen, B., et al,. Xenotransplantation, 2009. 16(6): p. 486-95). Another important molecule in such pathway is EPCR which binds protein C and presents it to the thrombomodulin / thrombin complex. Overexpression of human EPCR in porcine cells is for example considered beneficial, as endogenous EPCR is mainly expressed on the endothelium of larger vessels. EPCR expression is poor or completely absent on small vessels, such as capillaries, which are subject to microvascular thrombosis (Laszik, Z., et al., Circulation, 1997.96(10): p. 3633-40). Thus, the present invention may also comprise said transgenic pig as defined herein, wherein said at least one transgene for xenotransplantation is an anticoagulant which is any one of endothelial protein C receptor (EPCR), Thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), Cluster of Differentiation 39 (CD39), Van Willebrand factor, or Cobra Venom factor or a combination thereof.

[0073] Thus, said at least one transgene of the invention encodes EPCR. Said at least one transgene of the invention encodes THBD. Said at least one transgene of the invention encodes TFPI. Said at least one transgene of the invention encodes CD39. Said at least one transgene of the invention encodes Van Willebrand factor. Said at least one transgene of the invention encodes Cobra Venom factor.

[0074] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding EPCR and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is atleast two transgenes encoding EPCR and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding EPCR and an anticoagulant, preferably one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding EPCR and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding EPCR and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding EPCR and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding EPCR and an alpha 1 ,2 fucosyltransferase as defined herein.

[0075] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding THBD and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding THBD and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding THBD and an anticoagulant, preferably one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding THBD and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding THBD and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding THBD and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding THBD and an alpha 1 ,2 fucosyltransferase as defined herein.

[0076] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding TFPI and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is atleast two transgenes encoding TFPI and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding TFPI and an anticoagulant, preferably one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding TFPI and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding TFPI and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding TFPI and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding TFPI and an alpha 1,2 fucosyltransferase as defined herein.

[0077] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding CD39 and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CD39 and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CD39 and an anticoagulant, preferably one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CD39 and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CD39 and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CD39 and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CD39 and an alpha 1 ,2 fucosyltransferase as defined herein.

[0078] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding Cobra Venom factor and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding Cobra Venom factor and acytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding Cobra Venom factor and an anticoagulant, preferably one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding Cobra Venom factor and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding Cobra Venom factor and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding Cobra Venom factor and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding Cobra Venom factor and an alpha 1 ,2 fucosyltransferase as defined herein.

[0079] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding Van Willebrand factor and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding Van Willebrand factor and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding Van Willebrand factor and an anticoagulant, preferably one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding Van Willebrand factor and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding Van Willebrand factor and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding Van Willebrand factor and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding Van Willebrand factor and an alpha 1 ,2 fucosyltransferase as defined herein.

[0080] As used herein, the term “immunomodulator” refers to a protein with the ability to modulate the immune responses, particularly preventing xenograft rejection in the recipient. Porcine SLA class II expression can be modulated by class II transactivator (CIITA), the masterregulator of MHC class II expression (Reith, W., S. LeibundGut-Landmann, and J.M. Waldburger, Nat Rev Immunol, 2005. 5(10): p. 793-806). Expression of a human dominantnegative variant of CIITA (CIITA-DN) for example was associated with significantly reduced SLA class II expression on porcine APCs and complete suppression on porcine endothelial cells. In addition, a reduced human CD4+ T cell response to CIITA-DN transgenic porcine endothelial cells was observed (Hara, H., et al., Immunology, 2013. 140(1): p. 39-46).Besides direct interaction between APCs and T cells, T cell activation also requires a costimulatory signal. A potent co-stimulation inhibitor is e.g. the cytotoxic T lymphocyte- associated antigen 4 (CTLA4) as another example of an immunomodulator, playing an important role in immune cell regulation. An alternative means of inhibiting T cell activation is to enhance the inhibitory signals. The programmed cell death-1 (PD-1) / PD- ligand 1 (PD-L1) signal pathway is crucial for suppressive immunoregulation and the maintenance of self-tolerance. PD- L1 expression plays thus an important role in both allo- and xenotransplantation (Plege, A., et aL, Transplantation, 2009. 87(7): p. 975-82). Further, inhibitory signals can also supress the activation of macrophages and NK cells. The signal regulatory protein a (SIRPa) is an inhibitory receptor on macrophages that recognises the ubiquitously expressed surface molecule CD47. The SIRPa-CD47 interaction mediates inhibitory signals and prevents autologous phagocytosis by macrophages (Seiffert, M., et al., Blood, 1999. 94(11): p. 3633-43). In vitro experiments have revealed that human CD47 transfected pig cells lead to reduced phagocytosis by human macrophages (Ide, K., et al., Proc Natl Acad Sci U S A, 2007. 104(12): p. 5062-6). Thus, the present invention may also comprise said transgenic pig as defined herein, wherein said at least one transgene for xenotransplantation encodes an immunomodulator which is an immunosuppressant. Such immunosuppressant suppresses or downregulates the immune response of the recipient. The present invention may also comprise said transgenic pig as defined herein, wherein said at least one transgene for xenotransplantation encodes an immunosuppressant selected from the group consisting of Cluster of Differentiation 47 (CD47), dominant-negative class II transactivator (CIITA-DN), a programmed cell death 1 ligand 1 (PD- L1), cytotoxic t-lymphocyte-associated antigen (CTLA4), IL-1 receptor antagonist (IL1RA), and IL-27 alpha (IL27a), or a combination thereof.

[0081] Said at least one transgene of the invention encodes CD47. Said at least one transgene of the invention encodes CIITA-DN. Said at least one transgene of the invention encodes PD- L1. Said at least one transgene of the invention encodes CTLA4. Said at least one transgene of the invention encodes LEA29Y - which is a high-affinity variant of CTLA4 with potent immunosuppressive properties. Said at least one transgene of the invention encodes IL1 RA. Said at least one transgene of the invention encodes IL27a, preferably porcine IL27a. I LIRA as well as IL27a are needed in the long term to prevent chronic rejection. Both prevent the constant, subacute inflammation in the graft and immune cell infiltration.

[0082] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding CD47 and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CD47 and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CD47 and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CD47 and an immunomodulator, preferably any one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CD47 and an immunosuppressant, preferably one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CD47 and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CD47 and an alpha 1 ,2 fucosyltransferase as defined herein.

[0083] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding CIITA-DN and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CIITA-DN and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CIITA-DN and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CIITA-DN and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CIITA-DN and an immunosuppressant, preferably one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CIITA-DN and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CIITA-DN and an alpha 1 ,2 fucosyltransferase as defined herein.

[0084] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding PD-L1 and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding PD-L1 and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding PD-L1 and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding PD-L1 and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding PD-L1 and an immunosuppressant, preferably one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding PD-L1 and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding PD-L1 and an alpha 1 ,2 fucosyltransferase as defined herein.

[0085] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding CTLA4 or LEA29Y and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CTLA4 or LEA29Y and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CTLA4 or LEA29Y and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CTLA4 or LEA29Y and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CTLA4 or LEA29Y and an immunosuppressant, preferably one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CTLA4 or LEA29Y and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding CTLA4 or LEA29Y and an alpha 1 ,2 fucosyltransferase as defined herein.

[0086] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding I LIRA and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding I LIRA and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding I LI RA and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding I LIRA and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding IL1 RA and an immunosuppressant, preferably one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding I LIRA and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding IL1 RA and an alpha 1 ,2 fucosyltransferase as defined herein.

[0087] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding IL27a and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding IL27a and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding IL27a and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding IL27a and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding IL27a and an immunosuppressant, preferably one of the abovementioned. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding IL27a and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding IL27a and an alpha 1,2 fucosyltransferase as defined herein.

[0088] As used herein, the term “regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity” refers to any kind of protein which regulates ROS and / or superoxide formation, and / or caspase activity which play an important role in xenotransplantation. Preferably, said regulator protein of ROS formation is AKIP1. Thus, the present invention may encompass said transgenic pig as defined herein, wherein said at least one transgene encodes AKIP1. AKIP1 prevents ROS and superoxide formation. Thus, the mitochondria survive stress and are much more active in ensuring the energy supply of the cells. This prevents apoptosis and the graft stays alive longer.

[0089] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding AKIP1 and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding AKIP1 and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding AKIP1 and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding AKIP1 and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding AKIP1 and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding AKIP1 and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding AKIP1 and an alpha 1,2 fucosyltransferase as defined herein.

[0090] As used herein the term “alpha 1 ,2 fucosyltransferase” or “H-transferase” refers to a transferase which uses sugar molecules and catalyzes the fucose transfer to galactose of the N-acetyl(iso)lactosamine chain, thereby preventing the generation of new antigens by these sugars. H-transferase may also generate a human blood group 0 glycosylation pattern. Thus, the present invention may encompass said transgenic pig as defined herein, wherein said at least one transgene encodes an alpha 1 ,2 fucosyltransferase.

[0091] The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes the first one encoding an alpha 1 ,2 fucosyltransferase and the second one encoding a complement inhibitor as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein saidat least one transgene is at least two transgenes encoding an alpha 1 ,2 fucosyltransferase and a cytoprotectant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding an alpha 1 ,2 fucosyltransferase and an anticoagulant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding an alpha 1 ,2 fucosyltransferase and an immunomodulator as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding an alpha 1 ,2 fucosyltransferase and an immunosuppressant as defined herein. The present invention may thus encompass said transgenic pig as defined herein, wherein said at least one transgene is at least two transgenes encoding an alpha 1 ,2 fucosyltransferase and a regulator protein of at least any one of ROS formation, superoxide formation, or of caspase activity as defined herein.

[0092] The present invention may also comprise the transgenic pig as defined herein, wherein said pig expresses at least any one of a complement inhibitor, a cytoprotectant, an anticoagulant, an immunomodulator, a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity, or an alpha 1 ,2 fucosyltransferase; or a combination thereof, which is encoded by said at least one transgene. Thus, the transgenic pig as defined herein may express a complement inhibitor as defined herein which is encoded by said at least one transgene as defined elsewhere herein (which encodes said complement inhibitor). The transgenic pig as defined herein may express a cytoprotectant as defined herein which is encoded by said at least one transgene as defined elsewhere herein (which encodes said cytoprotectant). The transgenic pig as defined herein may express an anticoagulant as defined herein which is encoded by said at least one transgene as defined elsewhere herein (which encodes said anticoagulant). The transgenic pig as defined herein may express an immunomodulator as defined herein which is encoded by said at least one transgene as defined elsewhere herein (which encodes said immunomodulator). The transgenic pig as defined herein may express a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity as defined herein which is encoded by said at least one transgene as defined elsewhere herein (which encodes said regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity). Thus, the transgenic pig as defined herein may express an alpha 1 ,2 fucosyltransferase as defined herein which is encoded by said at least one transgene as defined elsewhere herein (which encodes said alpha 1,2 fucosyltransferase). The abovementioned disclosure in paragraphs 57-91 may be applicable mutatis mutandis in this context as well.

[0093] Preferably, the present invention comprises that the expression of said at least any oneof a complement inhibitor, a cytoprotectant, an anticoagulant, an immunomodulator, a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity, or an alpha 1,2 fucosyltransferase; or a combination thereof as defined herein is above the corresponding expression of complement inhibitor, a cytoprotectant, an anticoagulant, an immunomodulator, a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity, or an alpha 1 ,2 fucosyltransferase; or a combination thereof as defined herein in a subject from which said at least one transgene encoding at least any one of a complement inhibitor, a cytoprotectant, an anticoagulant, an immunomodulator, a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity, or an alpha 1 ,2 fucosyltransferase; or a combination thereof is derived from. By “derived from a subject” means that said at least one transgene of the invention refers to a gene sequence from (which belongs to) the genome of a subject (preferably from a human genome, thus a human gene sequence) the transgene is taken from, or a cDNA construct comprising cDNA which is a copy of mRNA, whereas the mRNA is made from a DNA template which is again from (which belongs to) the genome of a subject (preferably from a human genome, thus a human DNA which was transcribed to human mRNA which was then reverse transcribed to human cDNA) the transgene is taken from, or a minigene as defined elsewhere herein also comprising a fragment of a gene from (which belongs to) the genome of a subject (preferably from a human genome, thus a human minigene) the transgene is taken from.

[0094] The term “above” means that the expression of said abovementioned protein(s) encoded by said at least one transgene in said transgenic pig is higher compared to the corresponding expression of said protein(s) it would have had in said subject the transgene(s) encoding said protein(s) is derived from and then transferred as defined elsewhere herein to a pig genome. Particularly, “above” may refer to an expression which is at least above 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, or at least 10x higher compared to the expression of said protein(s) it would have had in the subject as defined above. In this context, the term “subject” refers to any animal (e.g. a mammal, preferably not a pig). In a preferred embodiment, said subject the transgene encoding said protein is derived from and transferred as defined elsewhere herein to a pig genome is a human. As an example, if said at least one transgene as defined by the invention encodes CD55 as complement inhibitor, such expression of CD55 within the transgenic pig is above the expression of CD55 (meaning “the corresponding expression”) it would have had in said subject as defined herein (preferably a human) from which said transgene had been obtained from. Such expression, such as 2x - 5x higher compared to the expression of said protein(s) it would have had in the subject as defined above, may be achieved by using strong promoters within the vectors (e.g. CAG). Finally, such increased expression may be detected by using for example a human cell line (SCP1) as a reference cell where the expression level ismeasured and compared to. If such transgene for example is derived from another subject other than human (e.g. pig), tissue from such wildtype subject may be isolated and the expression level of the corresponding protein(s) may then be compared to the expression level of such protein(s) in the transgenic pig of the invention.Additional genetic modifications

[0095] The present invention may also comprise the transgenic pig as defined herein, further comprising at least one additional genetic modification. The genetic modification within the porcine genome may be mediated by any suitable technique, including for example homologous recombination, gene editing methods or recombinase technology as defined herein. The term "genetic modification" as used herein generally refers to one or more alterations of a nucleic acid (DNA or RNA), e.g., the nucleic acid within a subject's genome. For example, genetic modification can refer to alterations, insertions (e., gene knock-ins), and / or deletion of genes (e.g., gene knock-outs). This one or more genetic modification may result in incorporation and expression of one or more additional transgenes at the same locus of the invention or at a different locus as defined herein (see e.g. the definitions regarding a single locus in paragraphs 47 and 48 which may be applicable here). This one or more genetic modification may also or alternatively result in a lack of the expression of a protein normally encoded by a gene which was now e.g. knocked-out by applying suitable techniques as defined herein.

[0096] The present invention may also comprise the transgenic pig as defined herein, wherein said at least one additional genetic modification is preferably selected from the group consisting of a gene knock-out, a gene knock-in, a gene replacement, a point mutation, and a deletion, insertion or substitution of a gene, a gene fragment or a nucleotide, or a combination thereof. As used herein, the term "gene knock-out (deletion or inactivation)" refers to a genetic modification resulting from the deletion of the genetic information encoded in a chromosomal locus within the transgenic pig genome of the invention or resulting from a gene inactivation wherein the genetic information encoded in a chromosomal locus is altered, thereby affecting transcription and / or translation of the gene. As used herein, the term "gene knock-in (insertion)" is a genetic modification resulting in the insertion of a gene into a specific locus within the transgenic pig genome of the invention that was not previously present in said pig genome. As used herein, the term "gene replacement (substitution)" is a genetic modification resulting in the replacement of the genetic information encoded in a chromosomal locus within the transgenic pig genome of the invention with the corresponding gene from another subject. The term "gene" is used herein broadly to refer to any segment of DNA containing a gene sequence associated with a biological function. Thus, genes include coding and / or non-coding sequences and / or the regulatory and control sequences required for their expression. A functional gene fragment may also include such sequences in order for the required expression.

[0097] Said at least one additional genetic modification is a gene knock-out, meaning a KO of a gene of said transgenic pig genome of the invention. Said at least one additional genetic modification is a gene knock-in, meaning a KI of a gene from a different subject into said transgenic pig genome of the invention. Said at least one additional genetic modification is a gene replacement, meaning replacing a gene of said transgenic pig of the invention with the corresponding gene of another subject (preferably human). Said at least one additional genetic modification is a point mutation. Said at least one additional genetic modification is a deletion of a gene fragment (a functional gene fragment) or a nucleotide. Said at least one additional genetic modification is an insertion of a gene fragment (a functional gene fragment) or a nucleotide. Said at least one additional genetic modification is a substitution of a gene fragment (a functional gene fragment) or a nucleotide.

[0098] Preferably, said at least one additional genetic modification is a gene knock-out. Such gene knock-out may result in the transgenic pig of the invention lacking expression of a protein which is encoded by a gene being knocked-out, preferably by a gene as defined below. The lack of expression of a protein encoded by a gene may be achieved by any suitable means. Said transgenic pig may be provided in which one allele of the gene as defined below is deleted or inactivated via a gene targeting event. In another embodiment, said transgenic pig may be provided in which both alleles of the gene as defined below are deleted or inactivated via a gene targeting event. In one embodiment, the gene as defined below can be deleted or inactivated via homologous recombination or gene editing methods (preferably CRISPR / Cas9) as examples of gene targeting events. In other embodiments, the gene can be disrupted to be inactivated. A disruption can be positioned at many sites in the endogenous porcine nucleic acid sequence. Examples of disruptions include, but are not limited to, an insertion of a heterologous nucleic acid sequence into the native gene sequence. Examples of insertions can include, but are not limited to, artificial splice acceptors coupled to stop codons or splice donors coupled to fusion partners such as GFP or a selectable marker gene (e.g., neo) that interrupts the coding region of the gene. Thus, said gene preferably as defined herein below can be deleted or inactivated in such a way that no transcription of the gene occurs. This results in a lack of expression of said underlying protein encoded by said gene. Deletion or inactivation of such gene as defined herein may also result in a modified or truncated protein in comparison to the native protein which however does not exhibit any biological activity.

[0099] A knock-out construct as used in a gene targeting event can contain sequences that are homologous to the endogenous nucleic acid sequence or to sequences that are adjacent to the endogenous nucleic acid sequence. In some cases, a knock-out construct can contain a nucleic acid sequence encoding a selection marker (e.g., antibiotic resistance, a fluorescent reporter(e.g., GFP or YFP), or an enzyme (e.g., Cas9) operatively linked to a regulatory sequence (e.g., a promoter). A knock-out construct can include other nucleic acid sequences such as recombination sequences (e.g., loxP sequences, splice acceptor sequences, splice donor sequences, transcription start sequences, and transcription stop sequences.

[0100] Even more preferably, the present invention comprises said transgenic pig as defined herein, wherein said gene knock-out comprises the knock-out of at least one gene selected from the group consisting of a gene encoding i) alpha 1 ,3 galactosyltransferase 1 (GGTA1); ii) alpha 1,3 galactosyltransferase 2 (GGTA2); iii) cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH); iv) p- ,4-N-acetylgalactosaminyl transferase 2 (B4GALNT2); v) swine leucocyte antigen I (SLAI); vi) LIL16 binding protein 1 (ULBP1); vii) class II major histocompatibility complex transactivator (CIITA); viii) growth hormone receptor (GHR); ix) asialoglycoprotein receptor 1 (ASGR1); x) toll-like receptor-4 (TLR4), xi) swine leucocyte antigen II (SLAI I); xii) MHC class I polypeptide-related sequence A (MICA); xiii) MHC class I polypeptide-related sequence B (MICB); xiv) CC-chemokine ligand 2 (CCL2); xv) CC-motif-chemokine receptor 5 (CCR5); xvi) CX3C-motif chemokine receptor 1 (CX3CR1), and xvii) isoglobotriosylceramide synthase (iGB3), or a combination thereof.

[0101] The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding alpha 1,3 galactosyltransferase 1 (GGTA1). Hyperacute rejection is initiated by pre-formed antibodies against endothelial a1,3-galactosyl- galactose (aGal) epitopes, resulting in complement activation and rapid graft destruction. It can be overcome by genetic inactivation of the GGTA1 gene. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding GGTA2. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding CMAH. Porcine cells express cytidine monophosphate-N- acetylneuraminic acid hydroxylase (CMAH), which are not found in human cells. CMAH converts the sialic acid N-acetylneuraminic acid (Neu5Ac) to N- glycolylneuraminic acid (Neu5Gc). As such, when porcine tissue is transplanted into a human, this epitopes elicit an antibody-mediated rejection from the human patient immediately followingimplantation. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding B4GALNT2. B4GALNT2 is also involved in AVR and catalyses in human the transfer of N-acetyl-D-galactosamine (GalNac) to a sialic acid modified lactosamine and thereby produces Sda antigens. As most human serum samples contain antibodies directed against the products of porcine B4GALNT2 activity, it is currently thought that porcine B4GALNT2 generates a pattern of Sda-bearing epitopes different to that in humans, and recognised as foreign.

[0102] The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding SLAI. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding SLAII. SLA (Swine Leucocyte Antigen) is the porcine homologue to HLA in humans and acts as a xenoreactive antigen as well, whereby humans have antibodies against this epitope. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding ULBP1. Within the cellular rejection NK cells can be activated by cytokines released from xenoreactive T cells, by Fey receptor-mediated signals upon interaction of xenoreactive-antibody-targeted porcine cells with the Fey receptor on e.g. human NK cells or by binding of ULBP1 on donor cells to the activating receptor natural killer group 2D (NKG2D) on recipient NK cells. Thus, porcine ULBP1 is able to bind for example human NKG2D and thus activates human NK cells.

[0103] Additionally, the present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding CIITA. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding GHR. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding ASGR1. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding TLR4. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding MICA. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding MICB. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding CCL2. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding CCR5. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding CX3CR1. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-out of the gene encoding iGB3. The present invention may also comprise said transgenic pig as defined herein, further comprising a gene knock-outof the gene encoding TLR4 and further comprising another gene knock-out of at least one gene selected from the group consisting of a gene encoding GGTA1, GGTA2, CMAH, B4GALNT2, SLAI, ULBP1, CIITA, GHR, ASGR1, TLR4, SLAII, MICA, MICB, CCL2, CCR5, CX3CR1, and iGB3. TLR4 KO prevents immune cell migration into inflamed areas. This additionally protects the graft from inflammation.

[0104] Therefore, the present invention may also encompass the transgenic pig as defined herein, wherein said pig additionally lacks expression of at least any one of GGTA1, GGTA2, CMAH, B4GALNT2, SLAI, ULBP1, CIITA, GHR, ASGR1, TLR4, SLAII, MICA, MICB, CCL2, CCR5, CX3CR1, or iGB3, or a combination thereof. The abovementioned disclosure in paragraphs 100-103 can also be applied to the lack of expression of at least any one of the abovementioned genes.

[0105] In a further embodiment, the present invention may also comprise a transgenic pig - independent from at least one transgene for xenotransplantation within its genome, wherein said at least one transgene is incorporated and expressed at a single locus 10448 - the transgenic pig lacking expression of at least any one of TLR4, MICA, MICB, CCL2, CCR5, or CX3CR1, or a combination thereof. Additionally, the present invention may also comprise said transgenic pig comprising a gene knock-out of the gene encoding TLR4. Thus, such transgenic pig may lack expression of TLR4. Additionally, the present invention may also comprise said transgenic pig comprising a gene knock-out of the gene encoding MICA. Additionally, the present invention may also comprise said transgenic pig comprising a gene knock-out of the gene encoding MICB. Additionally, the present invention may also comprise said transgenic pig comprising a gene knock-out of the gene encoding CCL2. Additionally, the present invention may also comprise said transgenic pig comprising a gene knock-out of the gene encoding CCR5. Additionally, the present invention may also comprise said transgenic pig comprising a gene knock-out of the gene encoding CX3CR1. In another embodiment, the present invention may also comprise said transgenic pig comprising a gene knock-out of the gene encoding TLR4 and further comprising another gene knock-out of at least one gene selected from the group consisting of MICA, MICB, CCL2, CCR5 and CX3CR1. The present invention may also comprise said transgenic pig comprising a gene knock-out of the gene encoding MICA and further comprising another gene knock-out of at least one gene selected from the group consisting of TLR4, MICB, CCL2, CCR5 and CX3CR1. The present invention may also comprise said transgenic pig comprising a gene knock-out of the gene encoding MICB and further comprising another gene knock-out of at least one gene selected from the group consisting of TLR4, MICA, CCL2, CCR5 and CX3CR1. The present invention may also comprise said transgenic pig comprising a gene knock-out of the gene encoding CCL2 and further comprising another gene knock-out of at least one gene selected from the group consisting of TLR4, MICA, MICB, CCR5 and CX3CR1. The present invention may alsocomprise said transgenic pig comprising a gene knock-out of the gene encoding CCR5 and further comprising another gene knock-out of at least one gene selected from the group consisting of TLR4, MICA, MICB, CCL2, and CX3CR1. The present invention may also comprise said transgenic pig comprising a gene knock-out of the gene encoding CX3CR1 and further comprising another gene knock-out of at least one gene selected from the group consisting of TLR4, MICA, MICB, CCL2, and CCR5. Further, additional genetic modifications as defined herein may also be comprised within said transgenic pig as defined in this paragraph. The abovementioned definitions in paragraphs 95-99 may also be applicable hereto.

[0106] The present invention may also comprise the transgenic pig(s) as defined elsewhere herein, wherein said pig is free of porcine endogenous retrovirus C (PERV-C) and / or free of porcine Cytomegalovirus (pCMV). Xenografts should pose minimal infectious risk to the recipient, meaning effective xenotransplantation requires that the donor pig does not transmit zoonotic pathogens. PERV-C and pCMV refer to such specified pathogens, which are then released from pig cells and are infectious. Thus, such pig being free of either of said pathogens or a combination of both is a major advance towards clinical porcine xenotransplantation. To generate PERV and pCMV free pigs, in vitro and / or in vivo approaches may be performed for example with PERV and / or the pCMV receptor-specific CRISPR / Cas or other molecular scissors. Treated primary cells may then be used for SCNT as defined elsewhere herein. Such modification of the pig genome in primary cells such as somatic cells may also refer to the at least one additional genetic modification as defined herein. Also other gene editing methods or homologous recombination may be applied to generate PERV and pCMV free pigs. In this context and throughout the whole specification, the term “free” means that said transgenic pig of the invention lacks the endogenous integration of PERV-C into the porcine genome and / or lacks acute / latent infection with pCMV which is due to the deletion or inactivation of the underlying gene(s) of PERV-C via gene editing methods or homologous recombination known to a person skilled and / or of pCMV due to free breeding conditions / inactivation of the pCMV receptor by molecular scissors.

[0107] Additionally, the present invention may also comprise the transgenic pig(s) as defined elsewhere herein, wherein said pig has a weight in the range between 1kg and 450 kg, such as between 1kg and 350kg, 1kg and 250kg, 1kg and 150kg or even between 1kg and 50kg. Such pig having a weight in the range between 1kg and 150kg, such as 1 , 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150kg, or below such as between 1kg and 50kg refers to a so called “minipig”. Here, the size and the weight of said organs of the transgenic pig(s) are even more structurally similar to humans which is again important for xenotransplantation, if the subject receiving the donor organ, fragment, tissue, scaffold or cell obtained from said transgenic pig is a human.

[0108] Preferably, the present invention may comprise the transgenic pig(s) as defined elsewhere herein, wherein said pig is free of PERV-C and free of pCMV and additionally having a weight in the range between 1kg and 150kg, such as 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or even 150kg, or between 1kg and 50kg. Also preferably, the present invention may comprise the transgenic pig(s) as defined elsewhere herein, wherein said pig is free of PERV-C and additionally having a weight in the range between 1kg and 150kg, such as 1 , 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or even 150kg, or between 1kg and 50kg. Also preferably, the present invention may comprise the transgenic pig(s) as defined elsewhere herein, wherein said pig is free of pCMV and additionally having a weight in the range between 1kg and 150kg, such as 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or even 150kg, or between 1kg and 50kg.

[0109] The present invention may also comprise a pig having a weight in the range between 1kg and 450kg, wherein said pig is free of porcine endogenous retrovirus C (PERV-C) and / or free of porcine Cytomegalovirus (pCMV). In this context and throughout the whole specification, the “pig” refers to a transgenic pig as defined elsewhere herein or a wildtype pig not being transgenic. Particularly, said pig being free of PERV-C and / or free of pCMV has a weight in the range between 1kg and 350kg, 1kg and 250kg, 1kg and 150kg or even between 1kg and 50kg. Preferably, the present invention comprises a transgenic pig having a weight in the range between 1kg and 150kg, such as 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130,140 or 150kg, or between 1kg and 50kg, wherein said transgenic pig is free of PERV-C. Also preferably, the present invention comprises a transgenic pig having a weight in the range between 1kg and 150kg, such as 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130,140 or 150kg, or between 1kg and 50kg, wherein said transgenic pig is free of pCMV. Also preferably, the present invention comprises a transgenic pig having a weight in the range between 1kg and 150kg, such as 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150kg, or between 1kg and 50kg, wherein said transgenic pig is free of PERV-C and pCMV.

[0110] Alternatively or additionally, the present invention may also comprise a wildtype pig having a weight in the range between 1kg and 150kg, such as 1 , 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150kg, or between 1kg and 50kg, wherein said pig is free of PERV-C. Also preferably, the present invention comprises a wildtype pig having a weight in the range between 1kg and 150kg, such as 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150kg, or between 1kg and 50kg, wherein said pig is free of pCMV. Also preferably, the present invention comprises a wildtype pig having a weight in the range between 1kg and 150kg, such as 1 , 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150kg, orbetween 1kg and 50kg, wherein said transgenic pig is free of PERV-C and pCMV.Organs

[0111] The invention is also directed to transgenic pigs that are particularly useful as a source of organs, organ fragments, tissues, scaffolds or cells for xenotransplantation. Thus, the present invention comprises an organ, an organ fragment, a tissue, a scaffold or a cell obtained or obtainable from said transgenic pig as defined herein. The donor transgenic pig of the present invention may be at any stage of development including, but not limited to, fetal, neonatal, young and adult. In some embodiments, the organ, organ fragment, tissue, scaffold or cell as defined herein is obtained from an adult transgenic pig. In alternate embodiments, the organ, organ fragment, tissue, scaffold or cell as defined herein is obtained from fetal or neonatal transgenic pig. The organ, organ fragment, tissue, scaffold or cell as defined herein has surgically been / can surgically be removed which is meant by “obtained from” or “obtainable from”. Following surgical removal, the organ, organ fragment, tissue, scaffold or cell as defined herein may further be processed or evaluated prior to xenotransplantation as known to the person skilled.

[0112] The term “organ” as used herein refers to a collection of tissues joined in a structural unit to serve a common function. The organ or organ fragment may be any suitable organ or fragment thereof. The organ may be a solid organ. A solid organ is an internal organ that has a firm tissue consistency and is neither hollow (such as the organs of the gastrointestinal tract) nor liquid (such as blood). Preferably, said organ is any one of a lung, a heart, a kidney, a liver, a pancreas, or a spleen. Most preferably, said organ is a kidney or a liver. The organ fragment is therefore a fragment of such a particular organ as defined herein, preferably a fragment of a kidney or a liver.

[0113] As used herein, the term “tissue” refers to cellular organizational level intermediate between cells and a complete organ. In particular, a tissue is an ensemble of similar cells from the same origin that together carry out a specific function within an extracellular matrix (ECM). Organs are then formed by the functional grouping together of multiple tissues. Examples of tissues contemplated by the present invention include, without limitation, connective tissue, muscle tissue, nervous tissue, epithelial tissue and mineralized tissue. Blood, bone, tendon, ligament, adipose and areolar tissues are examples of connective tissues. Muscle tissue is separated into three distinct categories: visceral or smooth muscle, found in the inner linings of organs; skeletal muscle, typically attached to bones and which generates gross movement; and cardiac muscle, found in the heart where it contracts to pump blood throughout the body. Cells comprising the central nervous system and peripheral nervous system are classified as nervous (or neural) tissue. In the central nervous system, neural tissues form the brain and spinal cord.In the peripheral nervous system, neural tissues form the cranial nerves and spinal nerves, inclusive of the motor neurons. A “scaffold” refers to a decellularized tissue, meaning a scaffold refers to the ECM without any cells comprised therein. The “cell” may be any suitable cell, for example, a pancreatic islet cell.

[0114] All definitions regarding the transgenic pig can also be applied to the organ, organ fragment, tissue, scaffold and cell derived therefrom as defined herein.

[0115] The present invention also comprises the abovementioned organ, organ fragment, tissue, scaffold or cell for use in a method of treating a disease in a subject, the method comprising replacing a diseased or failed organ, organ fragment, tissue or cell in a subject by implanting into said subject at least one organ, organ fragment, tissue, scaffold or cell as defined herein. As used herein, the term "subject" refers to any animal (e.g., a mammal), including, but not limited to, humans, non-human primates, rodents, and the like that is to be the recipient of a particular treatment (e.g., associated with receiving a transplant). Such subject suffers from a disease that may be impacted therapeutically after receiving said organ, organ fragment, tissue, scaffold or cell as defined herein which refers to a transplant as defined below. The terms "subject" and "patient" are used interchangeably in reference to a human subject, unless indicated otherwise herein. Such subject who receives by implantation said organ, fragment, tissue, scaffold or cell as defined herein refers to the recipient. If the transgene being comprised within the porcine genome is a human sequence such as a human gene sequence, a human minigene, or a human cDNA construct, the subject being treated with the organ, fragment, tissue, scaffold or cell obtained from said transgenic pig is then also a human. The same applies to other animals, e.g. mammals other than human.

[0116] The disease in said subject to be treated refers to any kind of disease that is associated with an organ, organ fragment, tissue or a cell which is diseased in said subject or is failed in said subject. An organ, organ fragment, tissue or cell that is diseased does not provide the usual function anymore, thus having a reduced function compared to a healthy organ, organ fragment, tissue or cell and therefore being associated with a shortened survivability. An organ, organ fragment, tissue or cell that is failed has completely given up its function. Particularly, said disease to be treated is any lung, heart, kidney, liver, pancreas, or spleen disease, which is associated with the failed or diseased organ, fragment, tissue or cell in said subject to be treated, preferably any liver disease (such as hepatitis with liver failure) or kidney disease (such as partial or complete kidney failure). A disease is “treated” if at least one symptom of the disease as defined herein which is associated with the failed or diseased organ, fragment, tissue or cell in said subject is expected to be or is alleviated, terminated, slowed, or prevented. As used herein, a disease is also “treated” if recurrence or severity of the disease is reduced,slowed, delayed, or prevented. For example, with regard to hepatitis with end-stage organ failure, such disease may be treated in that human hepatitis cannot infect the pig liver which has been transplanted into the subject (such as a human) as defined herein.

[0117] Said at least one organ, organ fragment, tissue, scaffold or cell being implanted into said subject to be treated as defined herein refers to said organ, organ fragment, tissue, scaffold or cell as defined herein which is obtained from said transgenic pig of the invention being the donor. Such organ, organ fragment, tissue, scaffold or cell obtained from said transgenic pig then refers to a transplant. The term "transplant” or "implant" or “xenograft (graft)” as used herein is understood to refer to the act of inserting the organ, organ fragment, tissue, scaffold or cell as defined herein into said subject as defined herein under conditions that allow the organ, organ fragment, tissue, scaffold or cell as defined herein to become vascularized; and shall also refer to the so-inserted (i.e. "implanted" or "transplanted") organ, organ fragment, tissue, scaffold or cell as defined herein. Conditions favoring vascularization of a transplant in a mammal comprise a localized tissue bed at the site of the transplant having an extensive blood supply network. The implanting procedure depends on the location of the organ, fragment, tissue, or cell which is diseased or failed, generally comprising making an incision at the particular site of said diseased or failed organ, tissue, then removing the diseased or failed organ, organ fragment thereof, tissue, or cell, and replacing it with the donor organ, fragment, tissue, scaffold or cell as defined herein which refers to the transplant. In certain embodiments, the donor organ, fragment, tissue, scaffold or cell is surgically removed as known to the person skilled.

[0118] The transgenic organ, fragment, tissue, scaffold or cell may be implanted using any means known in the art. Sufficient time to allow for engraftment (for example 1 week, 3 weeks, and the like) is provided and successful engraftment is determined using any technique known to one skilled in the art. These techniques may include, but are not limited to, assessment of donor C-peptide levels including life supporting function with added immunosuppression, histological studies, intravenous glucose tolerance testing, exogenous insulin requirement testing, arginine stimulation testing, glucagon stimulation testing, testing of lEQ / kg (pancreatic islet equivalents / kg) requirements, testing for persistence of normoglycemia in recipient, testing of immunosuppression requirements, testing for functionality of transplanted islets, assessment of kidney function including fluid balance, regulation of electrolytes including sodium, potassium, and other electrolytes, clearing of toxins and regulation of blood pressure (See Rood et al., Cell Transplantation, 15:89-104. 2006; Rood et al., Transplantation, 83:202-210. 2007; Dufrane and Gianello, Transplantation, 86:753-760. 2008; van der Windt et al., 2009, Am. J. Transplantation, 9(12):2716-2726. 2009).

[0119] If the organ is for example a liver, the surgeon makes for example an incision at the abdomen or in the side of the abdomen (flank area). The surgeon begins by removing the ureter and the blood vessels away from the liver, finally also removing the diseased or failed liver. Once the liver is removed, a donor liver obtained from such transgenic pig as defined herein will be attached by attaching the ureter and the blood vessels to the donor liver. Once the liver is completely connected, blood flow is restored.

[0120] In a further embodiment, said organ, organ fragment, tissue, scaffold or cell obtained from said transgenic pig as defined herein is for I is used in a perfusion approach (without transplantation as mentioned elsewhere herein into a subject as defined herein), such as the extracorporeal liver perfusion if a subject suffers from poisoning. Particularly, such organ has previously been obtained (explanted) from the transgenic pig as known to the person skilled in the art and may be located in a perfusion device for such approach. The porcine organ, such as the liver for example, then takes over the function of the subject’s organ (e.g. liver) for a few days until the subject’s organ is regenerated. Here, only the subject’s blood supply to the porcine organ is established via vein catheters.Method of producing the transgenic pig

[0121] Transgenic animals can be produced by any method known to one of skill in the art including, but not limited to, selective breeding, nuclear transfer, introduction of DNA into oocytes, sperm, zygotes, or blastomeres, or via the use of embryonic stem cells. Genetic editing tools may also be utilized, as described further herein.

[0122] Cells useful for genetic modification of pigs (via, for example, but not limited to, homologous recombination, random integration, nuclease editing, zinc finger plus TALEN nucleases, CRISPR / Cas 9 nucleases) are porcine somatic cells which include, by way of example, epithelial cells, neural cells, epidermal cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, lymphocytes (B and T lymphocytes), erythrocytes, macrophages, monocytes, mononuclear cells, fibroblasts, cardiac muscle cells, and other muscle cells, etc. Thus, cells can be obtained from any cell or organ of the body of a pig, including all somatic or even germ cells. Moreover, the cells used for producing the genetically modified pig (via, for example, but not limited to, nuclear transfer) can be obtained from different organs and tissues of the pig, e.g., skin, lung, pancreas, liver, stomach, intestine, heart, reproductive organs, bladder, kidney, urethra and other urinary organs, etc. The porcine cells can be mature or immature and either differentiated or non-differentiated.

[0123] When incorporating said at least one transgene as defined herein at said single locus of the invention within a pig genome in step i) of the method of the invention, the pig genomemay refer to a somatic cell pig genome (porcine DNA within the nucleus of a porcine somatic cell) as defined above. In some embodiments, the pig genome is selected from the group consisting of a gamete pig genome such as an oocyte pig genome, zygote pig genome, an embryo pig genome and a blastocyst pig genome. Such pig genome may comprise besides said at least one transgene as defined herein at said single locus at least one additional genetic modification as defined herein. Thus, the method of producing said transgenic pig as defined herein may also comprise an additional step of introducing at least one additional genetic modification as defined herein into the polygenic pig genome.

[0124] Techniques which can be used to allow the vector as defined elsewhere herein to enter into the cell as defined herein include calcium phosphate / DNA coprecipitation, microinjection of DNA into the nucleus, electroporation, bacterial protoplast fusion with intact cells, transfection, lipofection, infection, particle bombardment, or any other in vitro and / or in vivo technique known by one skilled in the art. Homologous recombination or gene editing methods as defined herein (preferably CRISPR / Cas9) or integration via site-specific recombinase may then be used to incorporate such transgene into said pig genome as defined herein whereby a vector as defined elsewhere herein comprising said at least one transgene is integrated into the pig genome. For such entry and incorporation of said transgene (“targeting DNA”) at said single locus 10448 within the pig genome (“target DNA”) a targeting vector as defined herein may be used. Such steps are performed in vitro and / or in vivo, providing a polygenic pig genome. A “polygenic pig genome” refers to a pig genome as defined elsewhere herein comprising multiple genes inter alia comprising such transgene as defined herein.

[0125] The lack of fully functional ES cells for livestock species motivated the development of SCNT as an alternative approach to generate genetically modified animals; to overcome the inefficiency of transgene microinjection and to enable more sophisticated modifications, notably gene targeting. SCNT involves placement of a genetically modified somatic cell into the perivitelline space of an enucleated MH oocyte. After being inserted into the ooctye, the somatic cell nucleus is reprogrammed by its host oocyte. The oocyte now containing the somatic cell's nucleus, is stimulated with a shock and will begin to divide. After embryo activation, the embryos is then transferred into a surrogate mother for further development. Preferably, the invention comprises the method of producing said transgenic pig as defined herein, wherein the pig genome is a somatic cell in step i) and the cell in step ii) is a pig zygote, wherein the pig zygote is provided by SCNT. The zygote has been developed from said oocyte after SCNT as defined above. It comprises the polygenic pig genome, such as the somatic cell pig genome which has at least one transgene of the invention at said particular locus of the invention incorporated. Genome editing can be carried out in combination with SCNT.

[0126] In an alternative embodiment, the present invention may also comprise an in vivo method of producing a transgenic pig as defined elsewhere herein, the method comprising i) inserting a vector as defined herein comprising said at least one transgene as defined elsewhere herein into a fallopian tube of a pig; ii) incorporating said at least one transgene comprised by said vector at the single locus of the invention within a pig genome to provide a polygenic pig genome in vivo, iii) permitting a cell comprising the polygenic pig genome to mature into the transgenic pig.

[0127] The inserting step may comprise applying a gene editing tool or a recombinase technology as defined elsewhere herein, such gene editing tool preferably being a CRISPR / Cas nuclease, even more preferably being CRISPR / Cas9. Such tools which are used for the incorporation of said at least one transgene at the particular locus of the invention as defined herein. Within this context, the term “inserting” may refer to an injection of said vector into the fallopian tube of said pig.

[0128] The step of incorporation may then comprise allowing the vector as defined elsewhere herein to enter into the pig genome via electroporation or any other in vivo technique known by one skilled in the art. Hereby, the fallopian tube may be pinched with clamps to induce the electric field for the electroporation. Said vector may then enter from the fallopian tube via electroporation the pig genome as defined herein. Said pig genome may be selected from the group consisting of a gamete pig genome such as an oocyte pig genome, zygote pig genome, an embryo pig genome and a blastocyst pig genome. Such cell in step iii) may then refer to a pig zygote, a pig embryo or a pig blastocyst. All definitions provided above under paragraphs 122-124 or somewhere else in the specification may be applicable, where necessary, to the in vivo method as defined herein.

[0129] All definitions regarding the transgenic pig and the organ, organ fragment, tissue, scaffold and cell derived therefrom as defined herein can also be applied to the method(s) of the invention.EXAMPLES OF THE INVENTION

[0130] The following Examples illustrate the invention, but are not to be construed as limiting the scope of the invention.

[0131] Material and Methods

[0132] Example 1 : Precise locus determined by sequencing: Locus 10448 at chromosome 6 arm q position 22.

[0133] The locus 10448 (NCBI Reference Sequence: NC_010448.4) at chromosome 6q22 was identified by Oxford Nanopore sequencing and alignment of the obtained sequence against the porcine genome via Blast analysis. Such site could then also be confirmed by PCR analysis and Sanger sequencing. The 10448.4 locus ranges from 29MB to 164MB on chromosome 6 with the porcine genome.

[0134] Example 2: Generation of a transgenic pig.Design of one or more gRNAs for locus 10448 via CRISPOR (www.crispor.tefor.net), followed by cloning of the gRNAs on plasmid PX330. Possible guide RNA sequences for targeting of locus 10448 which cut at the integration site (about 2.3 to about 2.5 MB) at 57MB within the defined locus 10448 on chromosome 6 within the porcine genome (see Figure 1 and 3) are (5'- 3'; PAM not shown):CAGAGGCGACTCGATCCACG (SEQ ID NO: 1);GTTAACCGCTACAAACCTGC (SEQ ID NO: 2); CTGGCAGCCGTAGTCTACCT (SEQ ID NO: 3); TTTGGAGGCCATCCGGCATG (SEQ ID NO: 4); or ACAGAGTCCAAGGTAGACTA (SEQ ID NO: 5).The efficiency of each guide may be tested by transfection of porcine kidney fibroblasts and a selection with puromycin for 2 days. Pools may recover for 2 weeks and are individually analyzed by DNA isolation and sequencing by TIDE (Tracking of indels by decomposition; shinyapps.datacurators.nl) using wildtype cells as controls. The most-efficient guide may be used for following approaches. Co-transfection of said plasmid PX330 with one or more gRNAs, with one or more (linear or circular) (targeting) vectors comprising a transgene as defined which may comprise homology arms or not. Applying a targeting vector with homology arms increases the accuracy of the transgene incorporation at the particular locus. The gRNAs then bind to locus 10448 and Cas9 which is also encoded on plasmid PX330 performs double-strand breaks at such locus. Either a local double-strand break is generated or a larger area is deleted when applying several gRNAs specific for said locus. Then, a transient selection of said clones over 2 days with puromycin follows, wherein the resistance to puromycin is also included on plasmid PX330. Single-clones may be isolated after 4 weeks and are separated on individual cell culture plates. Identification of said clones may be done via DNA (Sequencing), RNA and proteinanalyses. Finally, such clones are used for somatic cell nuclear transfer (SCNT) as known to a skilled person and the generation of the transgenic pig.ITEMS1. A transgenic pig comprising at least one transgene for xenotransplantation within its genome, wherein said at least one transgene is incorporated and expressed at a single locus 10448 (NCBI Reference Sequence: NC_010448.4).2. The transgenic pig of item 1 , wherein said at least one transgene encodes: i) a complement inhibitor; ii) a cytoprotectant; iii) an anticoagulant; iv) an immunomodulator; v) a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity; or vi) an alpha 1 ,2 fucosyltransferase, or a combination thereof.3. The transgenic pig of item 2, wherein i) said complement inhibitor is any one of Cluster of Differentiation 55 (CD55), Cluster of Differentiation 46 (CD46) or Cluster of Differentiation (CD59), or a combination thereof; ii) said cytoprotectant is any one of Tumor necrosis factor-alpha induced protein 3 (A20 / TNFAIP3), Heme oxygenase 1 (HO-1) or Gluthatione peroxidase 4 (GPX4), or a combination thereof; iii) said anticoagulant is any one of endothelial protein C receptor (EPCR), Thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), or Cluster of Differentiation 39 (CD39), Van Willebrand factor, or Cobra Venom factor, or a combination thereof; iv) said immunomodulator is an immunosuppressant; v) said immunomodulator is an immunosuppressant selected from the group consisting of Cluster of Differentiation 47 (CD47), dominant-negative class II transactivator (CIITA- DN), a programmed cell death 1 ligand 1 (PD-L1), cytotoxic t-lymphocyte-associated antigen (CTLA4 / LEA29Y), IL-1 receptor antagonist (IL1RA), and IL-27 alpha (IL27a), or a combination thereof; and / or vi) said regulator protein is A Kinase interacting Protein 1 (AKIP1).4. The transgenic pig of any one of the preceding items, wherein said pig expresses at least any one of: i) a complement inhibitor; ii) a cytoprotectant; iii) an anticoagulant; iv) an immunomodulator;v) a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity; or vi) an alpha 1,2 fucosyltransferase; or a combination thereof which is encoded by said at least one transgene.5. The transgenic pig of item 4, wherein the expression of at least any one of i)-vi) as defined by item 4 is above the corresponding expression of at least any one of i)-vi) as defined by item 4 in a subject from which said at least one transgene encoding at least any one of i)-vi) as defined by item 4 is derived from.6. The transgenic pig of any one of the preceding items, further comprising at least one additional genetic modification.7. The transgenic pig of item 6, wherein said at least one additional genetic modification is selected from the group consisting of a gene knock-out, a gene knock-in, a gene replacement, a point mutation, and a deletion, insertion or substitution of a gene, a gene fragment or a nucleotide, or a combination thereof.8. The transgenic pig of item 7, wherein said gene knock-out comprises the knock-out of at least one gene selected from the group consisting of a gene encoding: i) alpha 1,3 galactosyltransferase 1 (GGTA1); ii) alpha 1,3 galactosyltransferase 2 (GGTA2); iii) cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH); iv) p-1 ,4-N-acetylgalactosaminyl transferase 2 (B4GALNT2); v) swine leucocyte antigen I (SLAI); vi) LIL16 binding protein 1 (LILBP1); vii) class II major histocompatibility complex transactivator (CIITA); viii) growth hormone receptor (GHR); ix) asialoglycoprotein receptor 1 (ASGR1); x) toll-like receptor-4 (TLR4), xi) swine leucocyte antigen II (SLAII); xii) MHC class I polypeptide-related sequence A (MICA); xiii) MHC class I polypeptide-related sequence B (MICB); xiv) CC-chemokine ligand 2 (CCL2); xv) CC-motif-chemokine receptor 5 (CCR5); xvi) CX3C-motif chemokine receptor 1 (CX3CR1), and xvii) isoglobotriosylceramide synthase (iGB3), or a combination thereof.9. The transgenic pig of any one of the preceding items, wherein said pig additionally lacks expression of at least any one of GGTA1, GGTA2, CMAH, B4GALNT2, SLAI, ULBP1 , CIITA, GHR, ASGR1, TLR4, SLAII, MICA, MICB, CCL2, CCR5, CX3CR1, or iGB3, or a combination thereof.10. The transgenic pig of any one of the preceding items, wherein said at least one transgene is a gene sequence, a minigene or a cDNA construct, preferably a gene sequence.11. The transgenic pig of any one of the preceding items, wherein said at least one transgene is a human or porcine gene sequence, a human or porcine minigene or a human or porcine cDNA construct, preferably a human or porcine gene sequence.12. The transgenic pig of any one of the preceding items, wherein said pig is free of porcine endogenous retrovirus C (PERV-C) and / or free of porcine Cytomegalovirus (pCMV).13. The transgenic pig of any one of the preceding items, wherein said pig has a weight in the range between 1kg and 450 kg.14. The transgenic pig of item 13, wherein said pig has a weight in the range between 1kg and 150kg.15. An organ, an organ fragment, a tissue, a scaffold or a cell obtained from said transgenic pig of any one of items 1-14.16. The organ of item 15, wherein said organ is any one of a lung, a heart, a kidney, a liver, a pancreas, or a spleen.17. The organ of item 16, wherein said organ is a liver or a kidney.18. The organ, the organ fragment, the tissue, the scaffold or the cell of any one of items 15 to 17 for use in a method of treating a disease in a subject, the method comprising replacing a diseased or failed organ, organ fragment, tissue or cell in a subject by implanting into said subject at least one organ, organ fragment, tissue, scaffold or cell of any one of items 15 to 17.19. A method of producing a transgenic pig of any one of items 1-14, the method comprising i) incorporating at least one transgene at a single locus 10448 (NCBI Reference Sequence: NC_010448.4) within a pig genome to provide a polygenic pig genome in vitro', ii) permitting a cell comprising the polygenic pig genome to mature into the transgenic pig.20. The method of item 19, wherein the pig genome is a somatic cell and the cell is a pig zygote, wherein the pig zygote is provided by somatic cell nuclear transfer (SCNT).

Claims

CLAIMS1. A transgenic pig comprising at least one transgene for xenotransplantation within its genome, wherein said at least one transgene is incorporated and expressed at a single locus 10448 having the NCBI Reference Sequence: NC_010448.4.

2. The transgenic pig of claim 1, wherein said at least one transgene encodes: i a complement inhibitor; ii a cytoprotectant; iii an anticoagulant; iv an immunomodulator; v a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity; or vi an alpha 1 ,2 fucosyltransferase, or a combination thereof.3 The transgenic pig of claim 2, wherein i said complement inhibitor is any one of Cluster of Differentiation 55 (CD55), Cluster of Differentiation 46 (CD46) or Cluster of Differentiation (CD59), or a combination thereof; ii said cytoprotectant is any one of Tumor necrosis factor-alpha induced protein 3 (A20 / TNFAIP3), Heme oxygenase 1 (HO-1) or Gluthatione peroxidase 4 (GPX4), or a combination thereof; iii said anticoagulant is any one of endothelial protein C receptor (EPCR), Thrombomodulin (THBD), tissue factor pathway inhibitor (TFPI), or Cluster of Differentiation 39 (CD39), Van Willebrand factor, or Cobra Venom factor, or a combination thereof; iv said immunomodulator is an immunosuppressant; v said immunomodulator is an immunosuppressant selected from the group consisting of Cluster of Differentiation 47 (CD47), dominant-negative class II transactivator (CIITA- DN), a programmed cell death 1 ligand 1 (PD-L1), cytotoxic t-lymphocyte-associated antigen (CTLA4 / LEA29Y), IL-1 receptor antagonist (IL1RA), and IL-27 alpha (IL27a), or a combination thereof; and / or vi said regulator protein is A Kinase interacting Protein 1 (AKIP1).4 The transgenic pig of any one of the preceding claims, wherein said pig expresses at least any one of: i a complement inhibitor; ii a cytoprotectant; iii an anticoagulant; iv an immunomodulator;v) a regulator protein of at least any one of reactive oxygen (ROS) formation, superoxide formation, or of caspase activity; or vi) an alpha 1,2 fucosyltransferase; or a combination thereof which is encoded by said at least one transgene.

5. The transgenic pig of claim 4, wherein the expression of at least any one of i)-vi) as defined by claim 4 is above the corresponding expression of at least any one of i)-vi) as defined by claim 4 in a subject from which said at least one transgene encoding at least any one of i)-vi) as defined by claim 4 is derived from.

6. The transgenic pig of any one of the preceding claims, further comprising at least one additional genetic modification.

7. The transgenic pig of claim 6, wherein said at least one additional genetic modification is selected from the group consisting of a gene knock-out, a gene knock-in, a gene replacement, a point mutation, and a deletion, insertion or substitution of a gene, a gene fragment or a nucleotide, or a combination thereof.

8. The transgenic pig of claim 7, wherein said gene knock-out comprises the knock-out of at least one gene selected from the group consisting of a gene encoding: i alpha 1,3 galactosyltransferase 1 (GGTA1); ii alpha 1,3 galactosyltransferase 2 (GGTA2); iii cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH); iv p-1 ,4-N-acetylgalactosaminyl transferase 2 (B4GALNT2); v swine leucocyte antigen I (SLAI); vi UL16 binding protein 1 (LILBP1); vii class II major histocompatibility complex transactivator (CIITA); viii growth hormone receptor (GHR); ix asialoglycoprotein receptor 1 (ASGR1); x toll-like receptor-4 (TLR4), xi swine leucocyte antigen II (SLAII); xii MHC class I polypeptide-related sequence A (MICA); xiii MHC class I polypeptide-related sequence B (MICB); xiv CC-chemokine ligand 2 (CCL2); xv CC-motif-chemokine receptor 5 (CCR5); xvi CX3C-motif chemokine receptor 1 (CX3CR1), and xvii isoglobotriosylceramide synthase (iGB3), or a combination thereof.

9. The transgenic pig of any one of the preceding claims, wherein said pig additionally lacks expression of at least any one of GGTA1, GGTA2, CMAH, B4GALNT2, SLAI, LILBP1, CIITA, GHR, ASGR1, TLR4, SLAII, MICA, MICB, CCL2, CCR5, CX3CR1, or iGB3, or a combination thereof.

10. The transgenic pig of any one of the preceding claims, wherein said at least one transgene is a gene sequence, a minigene or a cDNA construct, preferably a gene sequence.

11. The transgenic pig of any one of the preceding claims, wherein said at least one transgene is a human or porcine gene sequence, a human or porcine minigene or a human or porcine cDNA construct, preferably a human or porcine gene sequence.

12. The transgenic pig of any one of the preceding claims, wherein said pig is free of porcine endogenous retrovirus C (PERV-C) and / or free of porcine Cytomegalovirus (pCMV).

13. The transgenic pig of any one of the preceding claims, wherein said pig has a weight in the range between 1kg and 450 kg.

14. The transgenic pig of claim 13, wherein said pig has a weight in the range between 1kg and 150kg.

15. An organ, an organ fragment, a tissue, a scaffold or a cell obtained from said transgenic pig of any one of claims 1-14.

16. The organ of claim 15, wherein said organ is any one of a lung, a heart, a kidney, a liver, a pancreas, or a spleen.

17. The organ of claim 16, wherein said organ is a liver or a kidney.

18. The organ, the organ fragment, the tissue, the scaffold or the cell of any one of claims 15 to 17 for use in a method of treating a disease in a subject, the method comprising replacing a diseased or failed organ, organ fragment, tissue or cell in a subject by implanting into said subject at least one organ, organ fragment, tissue, scaffold or cell of any one of claims 15 to 17.

19. A method of producing a transgenic pig of any one of claims 1-14, the method comprising i incorporating at least one transgene at a single locus 10448 having the NCBI Reference Sequence: NC_010448.4 within a pig genome to provide a polygenic pig genome in vitro',ii) permitting a cell comprising the polygenic pig genome to mature into the transgenic pig.

20. The method of claim 19, wherein the pig genome is a somatic cell and the cell is a pig zygote, wherein the pig zygote is provided by somatic cell nuclear transfer (SCNT).

Images