4-amino-2,6-bis(phenylmethylene)cyclohexanones and their use
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- USTAV ORGANICKE CHEM A BIOCHEM AV CR
- Filing Date
- 2024-07-12
- Publication Date
- 2026-05-27
AI Technical Summary
Current compounds that enhance ubiquitin-proteasome system (UPS) activity are limited in effectiveness at the cellular level and often cause oxidative stress or other adverse effects.
Development of novel 4-amino-2,6-bis(phenylmethylene)cyclohexanone compounds that specifically activate the NRF1 pathway, increasing proteasomal activity, heat shock protein synthesis, and autophagy while minimizing cytotoxicity and oxidative stress.
These compounds effectively reduce proteotoxic stress and inhibit ferroptosis, preventing the formation of toxic protein aggregates and maintaining cellular homeostasis with low toxicity.
Smart Images

Figure CZ2024050045_30012025_PF_FP_ABST
Abstract
Description
[0001] 4-Amino-2,6-bis(phenylmethylene)cyclohexanones and their use Field of Art The present invention relates to novel compounds derived from 4-amino-2,6- bis(phenylmethylene)cyclohexanone and the use of these compounds to reduce proteotoxic stress and inhibit ferroptosis in cells and tissues. Background Art Protein degradation in the cell is a tightly regulated process that is essential to maintain cellular homeostasis. More than 90 per cent of cytosolic proteins are degraded by the so-called ubiquitin- proteasome system (UPS), which removes defectively synthesised or misfolded proteins and regulates the amount of proteins in the cell, which is directly related to the regulation of their activity. Central of the UPS system is the 26S proteasome, which degrades proteins covalently labelled with a polyubiquitin chain (Lys48) into a mixture of peptides. The 26S proteasome consists of a 20S catalytic subunit with three catalytic sites exhibiting chymotrypsin-like, trypsin-like or caspase-like activity, and one or two regulatory subunits, designated 19S. The aging process and the development of neurodegenerative diseases are closely linked to the accumulation of misfolded or damaged proteins, which can be toxic to cells or even directly induce apoptosis. Both aging and the onset and development of neurodegenerative diseases are accompanied by a decrease in UPS activity, which is very often accompanied by the formation of intracellular protein aggregates. For these reasons, modulation or enhancement of UPS activity is considered a very promising approach to delay the onset or to treat diseases associated with the accumulation of toxic protein forms, such as amyotrophic lateral sclerosis (ALS), Parkinson’s, Alzheimer’s, Kennedy’s or Huntington’s disease and many others (Kleiger et al.: Trends in cell biology, 2014, 24, 6, 352-359; Ciechanover et al.: Experimental & molecular medicine, 2015, 47, 3, e147-e147; Calamini et al.: Nature chemical biology, 2012, 8.2, 185-196). Increasing the activity of the UPS can be achieved, for example, by stimulating its catalytic activity with low molecular weight compounds. Unfortunately, the compounds known so far to exhibit this activity are only very limitedly effective at the in cellulo level (Trader et al.: Biochimica et Biophysica Acta (BBA)- General Subjects, 2017, 1861.4, 892-899; Leestemakeret al.: Cell chemical biology, 2017, 24.6, 725-736). The most promising way to increase UPS capacity is to increase the synthesis of the proteasome itself, ideally with simultaneous activation of the synthesis of heat shock proteins (HSPs). Both can be done by activating the stress transcription factors NRF1 (NFE2L1) and NRF2 (NFE2L2) from the so-called Cap-n- Collar (CNC) family of transcription factors (Huryn et al.: J Med Chem, 2019, 63.5, 1892-1907; Bott et al.: Human molecular genetics, 2016, 25.10, 1979-1989). Recently, activation of the transcription factor NRF1, which is responsible for triggering coordinated expression of all genes for proteasome subunits in response to proteotoxic stress, seems to be more appropriate. An important finding is that the active NRF1 pathway prevents the formation of toxic protein aggregates compared to gene knock-down. Therefore, low molecular weight compounds that selectively activate this signalling pathway while not interacting with the UPS and not causing oxidative stress are considered the most promising approach in the future therapy of proteinopathies, including neurodegenerative diseases whose development is associated with the formation of protein aggregates and proteotoxic stress (Njomen et al.: J Med Chem, 2019, 62.14, 6469-6481). Transcription factor NRF1 preferentially provides induction of synthesis of all proteasome subunits when proteasome activity is inhibited (Kleiger et al.: Trends in cell biology, 2014, 24, 6, 352-359; Koizumi et al.: Proceedings of the Japan Academy. Series B, 2018, 325-336). NRF1 also increases the expression of the transcription factor HSF1, which is responsible for inducing the expression of heat shock proteins that ensure the cellular response to exposure to stressful conditions. Heat shock proteins help misfolded or stress-damaged proteins to achieve the correct conformation, which is currently considered to be one of the essential defence mechanisms against the formation of aggregates or toxic protein forms, both at the cell culture level and in mouse models (Bose et al.: Ageing research reviews, 2017, 35, 155-175). Recently, it was found that the NRF1-controlled transcriptional pathway protects cells and tissues from ferroptosis. Ferroptosis is a newly discovered type of regulated cell death that is morphologically, biochemically and genetically distinct from other cell death types described so far. The main characteristic of ferroptosis is iron dependence and is characterised by the accumulation of peroxidised lipids and reactive oxygen species derived from iron metabolism. In degenerative and ischemic diseases, ferroptosis is involved in their development and pathogenesis, and its inhibition represents an interesting strategy to slow or directly prevent the progression of these chronic diseases (Liu et al.: Annals of translational medicine, 2022,10(6); Ryan et al.: Trends in Pharmacological Sciences, 2023; Pan et al.: Antioxidants, 11(11), 2196). NRF1 protects against ferroptosis by inducing the expression of glutathione peroxidase 4 (GPX4), a key protein that prevents lethal lipid peroxidation, and by maintaining proteasomal activity (Forcina et al.: Proceedings of the National Academy of Sciences, 119(11), e2118646119). Currently, the most discussed compound, able to increase proteasomal activity and at the same time the expression of heat shock proteins regulated by the transcription factor HSF1, is the curcumin derivative ASC-JM17 ((1E,6E)-4-(cyclobutylmethyl)-1,7-bis(3,4-dimethoxyphenyl)hepta-1,6-dien-3,5-dion), which has been shown to be a dual activator of both of the aforementioned signalling pathways (Koizumi et al.: Proceedings of the Japan Academy. Series B, 2018, 325-336; Bott et al.: Human molecular genetics, 2016, 25.10, 1979-1989). This compound has been approved by the European Medicines Agency (EMA) for the treatment of spinal and bulbar muscular atrophy (called Kennedy’s disease). However, its low solubility under physiological conditions and the associated bioavailability and relatively rapid degradation in tissues, which is a general characteristic of curcumin and its derivatives, are problematic. Since very few compounds capable of targeted enhancement of the cellular response against proteotoxic stress - despite their enormous therapeutic potential - have reached the stage of clinical use, it is essential to develop new agents with higher efficacy, more narrowly targeted mechanism of action, fewer side effects, and the lowest in vivo toxicity. Disclosure of the Invention The present invention addresses the undesirable effects of proteotoxic stress and ferroptosis in cells and tissues by their controlled reduction, with the aim of preventing and / or reducing the formation and deposition of metastable proteins in cells and tissues using novel compounds derived from 4-amino-2,6- bis(phenylmethylen)cyclohexanones. We found, surprisingly, that the new compounds described herein derived from 4-amino-2,6-bis(phenylmethylen)cyclohexanones specifically activate pathways controlled by the transcription factor NRF1 (encoded by the NFE2L1 gene). These pathways are then directly linked to increased proteasomal activity in the cell, increased synthesis of heat shock proteins directly involved in targeted protein degradation, and activation of autophagy. Increased NRF1 activity further inhibits ferroptosis. At the same time, these compounds exhibit extremely low cytotoxicity and toxicity in vivo at relevant doses. An important and surprising finding was that these compounds at relevant concentrations do not increase reactive oxygen radical (ROS) production and do not affect the cell cycle, which reduces the risk of adverse side effects. The object of the present invention are 4-amino-2,6-bis(phenylmethylen)cyclohexanones of general formula I wherein R1, R2, R3and R4are independently selected from the group comprising a hydrogen atom, a hydroxy group, a C1-C3 alkoxy group, a trifluoromethoxy group, and a difluoromethoxy group; and R5and R6are independently selected from the group consisting of a C1-C3 alkyl and a hydrogen atom, or R5is a hydrogen atom and R6is an acyl or thioacyl group of general formula II or a sulfonic group of general formula III wherein X is O or S; R7is selected from a group consisting of R8and NH-R8, wherein R8is selected from a group consisting of C1–C6 alkyl, C3–C8 cycloalkyl, three- to eight-membered heterocycloalkyl, (CH2CH2O)n-(C1-C3 alkyl), CH2O(CH2CH2O)n-(C1-C3 alkyl), C6-C12 aryl, five- to nine-membered heteroaryl, (C6- C12)aryl-(C1-C3)alkyl-, five- to seven-membered heteroaryl-(C1-C3)alkyl-, five- to seven-membered heteroaryl-O-(C1-C3)alkyl-, (C1-C3 alkyl)O-C(O)-(C1-C3)alkyl-, wherein n is 1, 2, 3, 4 or 5, wherein substituent R8is optionally substituted with at least one substituent selected from the group consisting of C1-C3 alkyl, C1-C3 alkoxy, OH, halogen, =O, NH2, NH2C(=O)-(C1-C3 alkoxy), NHR9, wherein R9is selected from C1–C3 alkyl and NR102, wherein R10are independently selected from C1-C3 alkyl or both R10together are formed by C2-C5 alkylene, with the proviso that at least one of the substituents R1and R2is not a hydrogen atom, and at least one of the substituents R3and R4is not a hydrogen atom; and their pharmaceutically acceptable salts, addition salts and solvates. An alkyl is a saturated linear or branched hydrocarbon. Alkyls may include, but are not limited to, methyl, ethyl, propyl, isopropyl. Cycloalkyl is a saturated cyclic hydrocarbon residue. In some embodiments, all carbon atoms of the cycloalkyl are part of the cycle. In some embodiments, some of the carbon atoms of the cycloalkyl are part of the cycle, and some of the carbon atoms of the cycloalkyl form a linear or branched chain attached to the cycle. The cycloalkyl may comprise one or more cycles. A heterocycloalkyl is a saturated cyclic hydrocarbon residue comprising at least one heteroatom selected from O, S, and N. In some embodiments, all carbon atoms and heteroatoms of the heterocycle are part of the cycle. In some embodiments, some of the carbon atoms and heteroatoms of the heterocycle are part of the cycle, and some of the carbon atoms, and optionally some of the heteroatoms, of the heterocycloalkyl form a linear or branched chain linked to the cycle. The heterocycloalkyl may contain one or more cycles. Preferably, the heterocycloalkyl comprises one to two heteroatoms. Examples of heterocycloalkyl include morpholinyl, piperazinyl, and morpholinyl ethyl. Alkoxy is a group of -O-alkyl. An example of an alkoxy group is methoxy or ethoxy. An aryl is an aromatic cyclic hydrocarbon containing one or two cycles. In particular, the aryl may be phenyl, naphthyl, biphenyl, preferably phenyl. A heteroaryl is an aromatic cyclic or bicyclic hydrocarbon containing one or more heteroatoms selected from O, S, and N, preferably one, two or three heteroatoms. The heteroatoms are preferably nitrogen atoms. Examples of heteroaryl are pyridyl, imidazolyl, pyrazolopyrimidinyl. The halogen is selected from the group consisting of fluorine, chlorine, bromine, iodine. In one embodiment, R1, R2, R3and R4are independently selected from the group comprising a hydroxy group, a C1-C3 alkoxy group, a trifluoromethoxy group and a difluoromethoxy group, preferably R1, R2, R3and R4are independently selected from the group comprising methoxy and ethoxy groups. In some embodiments, both R5and R6are hydrogen atoms. In some embodiments, R5is a hydrogen atom, R6is an acyl or thioacyl group of general formula II or a sulfonic group of general formula III, and R7is selected from the group consisting of: . In some preferred embodiments, R1, R2, R3and R4are methoxy or ethoxy groups, R5is a hydrogen atom, R6is an acyl or thioacyl group of general formula II or a sulfonic group of general formula III, and R7is C1-C6 alkyl, preferably methyl or ethyl. In some embodiments, R5is a hydrogen atom and R6is an acyl or thioacyl group of general formula II. In some embodiments, R5is a hydrogen atom, R6is a group of general formula II, and R7is selected from the group comprising R8and -NH-R8, wherein R8is selected from the group consisting of C1-C6 alkyl, C3- C8 cycloalkyl, piperazinyl, pyrrolidinyl, quinuclidinyl, phenyl, naphthyl, pyridyl, imidazolyl, thiazolyl, oxazolyl, pyrazolopyrimidinyl, (C6-C12)aryl-(C1-C3)alkyl-, (CH2CH2O)n-(C1-C3 alkyl), CH2O(CH2CH2O)n-(C1-C3 alkyl), five- to seven-membered heteroaryl-(C1-C3)alkyl-, (C1-C3 alkyl)O- C(O)-(C1-C3)alkyl-, wherein n is 1, 2, 3, 4 or 5, wherein the substituent R8is optionally substituted with at least one substituent selected from the group C1-C3 alkyl, C1-C3 alkoxy, OH, halogen, =O, NH2, NHR9, wherein R9is selected from C1–C3 alkyl, and NR102, wherein R10are independently selected from C1-C3 alkyl or both R10together are formed by C2-C5 alkylene. Preferably, R7is selected from the group comprising methyl, ethyl, propyl, cyclopropyl, azepanyl, morpholinyl, piperazinyl, phenyl, naphthyl, pyridyl, imidazolyl, pyrrolidinyl, quinuclidinyl, thiazolyl, oxazolyl, aminomethyl, aminoethyl, aminopropyl, N,N-dimethylaminopropyl, N,N-dimethylaminoethyl, N,N-dimethylaminomethyl, aminophenyl, diaminophenyl, N,N-dimethylaminophenyl, N,N- diethylaminomethyl, N-methylimidazolyl, (fluoro)pyrrolidinyl, (methoxymethyl)pyrrolidinyl, isopropylamino, N-methylpiperazinyl, aminocarbonylmethoxyphenyl, hydroxypyridyl, methylpyridyl, 6- hydroxy-4-methylpyridin-3-yl, (morpholin-4-yl)ethyl, difluoropyridyl, (methoxyethoxy)ethoxymethyl, pyrazolo[1,5-a]pyrimidinyl, piperidinylpyridine. In one preferred embodiment, R5is a hydrogen atom and R6is an acyl or thioacyl group of general formula II and R7is selected from the group consisting of:
[0002] . In some embodiments, R5is a hydrogen atom and R6is a group of general formula II, wherein R7is methyl, cyclopentyl, pyridine, or imidazole. In some embodiments, R5is a hydrogen atom and R6is a sulfonic group of the general formula III. In some embodiments, R5is a hydrogen atom, R6is a sulfonic group of the general formula III, and R7is selected from the group comprising methyl, ethyl, propyl, cyclopropyl, azepanyl, morpholinyl, piperazinyl, phenyl, pyridyl, imidazolyl, pyrrolidinyl, aminopropyl, aminoethyl, aminophenyl, diaminophenyl, N- methylimidazolyl, (fluoro)pyrrolidinyl, (methoxymethyl)pyrrolidinyl, isopropylamino, N- methylpiperazinyl, aminocarbonylmethoxyphenyl, hydroxypyridyl, methylpyridyl, 6-hydroxy-4- methylpyridin-3-yl, (morpholin-4-yl)ethyl. In one preferred embodiment, R5is a hydrogen atom, R6is a sulfonic group of the general formula III and R7is selected from the group consisting of: . In the case where the compound of general formula I has a positive charge (is in the form of a cation), the compound includes a counterion, which may be a pharmaceutically acceptable anion of an organic or inorganic acid, thereby forming a pharmaceutically acceptable salt. Such an anion may be selected, for example, from the group comprising acetate, aspartate, benzenesulfonate, benzoate, besylate, bicarbonate, bitartrate, bromide, camsylate, carbonate, chloride, citrate, decanoate, edetate, esylate, fumarate, gluceptate, gluconate, glutamate, glycolate, hexanoate, iodide, lactate, malate, maleate, mandelate, mesylate, methansulphate, napsylate, nitrate, octanoate, oleate, palmoate, pantothenate, phosphate, polygalacturonate, propionate, salicylate, stearate, succinate, sulphate, tartarate, tosylate, trifluoroacetate. If a compound of formula I contains chiral centres, then formula I includes pure enantiomers and mixtures of enantiomers including racemate. Formula I includes compounds of formula I in its free form and in the form of salts, addition salts (with acids or bases) and / or solvates, including hydrates or alcohol solvates. Another object of the present invention relates to the compounds of general formula I for use as medicaments. Compounds of general formula I are particularly suitable for use in the treatment or prevention of proteinopathies, especially neurodegenerative diseases such as polyglutamine diseases, tauopathies, synucleinopathies, or amyotrophic lateral sclerosis; furthermore, the treatment or prevention of amyloidosis, cystic fibrosis and diabetes. Compounds of general formula I are also suitable for the treatment of viral diseases. Here, it is assumed that the ability to induce autophagy by compounds of general formula I is subsequently manifested by increased degradation of viral particles, especially during viral entry. Furthermore, compounds of general formula I are suitable for the treatment of diseases directly related to elevated levels of ferroptosis. In particular, stroke, rhabdomyolysis - severe skeletal muscle damage, non- alcoholic steatohepatitis, acute pancreatitis or psoriasis. The polyglutamine diseases produce proteins that accumulate in the nuclei of neurons, form intracellular inclusions and cause neuronal death. All polyglutamine diseases are progressive fatal disorders that usually begin in adulthood and develop over a period of 10 to 30 years. For a review of polyglutamine diseases, see Journal of Molecular Cell Biology (2010), 2, 180-191. The polyglutamine diseases include Huntington’s disease, spinobulbar muscular atrophy, spinocerebellar ataxia, and dentatorubral- pallidoluysian atrophy. Tauopathies and synucleinopathies arise from the presence of characteristic plaques. The synucleinopathies are a diverse group of neurodegenerative diseases that share common pathological lesions composed of aggregates of the insoluble protein α-synuclein in neurons and glia. This group includes Parkinson’s disease and dementia associated with Lewy bodies. Fibrous inclusions of tau protein and degeneration of brain tissue in the absence of β-amyloid plaques are typical hallmarks of neurodegenerative tauopathies. Diseases belonging to this group are Pick’s disease, progressive supranuclear palsy (PSP), Parkinson’s disease (accumulation of Tau bodies), Steele-Richardson-Olszewski disease, Guam disease (Guam Parkinsonism- dementia complex), post-traumatic Parkinsonism, Alzheimer’s disease. PSP is characterised microscopically by the presence of neurofibrillary tangles (NFTs) with specific characteristics. They are globose in character (unlike NFTs in Alzheimer’s disease), composed of about l5nm long straight filaments. NFTs are probably formed from abnormal protein formations called tau- proteins. Clinically, PSP is characterised by a parkinsonian syndrome with predominant axial rigidity, postural instability with frequent falls, oculomotor disturbances, cognitive deficit and dementia of the subcortical type, with a characteristic onset and course, together with a number of other typical symptoms. Post-traumatic Parkinsonism: After the Second World War, the deaths of boxers revealed that the brain tissue of the athletes bore the signs of numerous and quite pronounced traumas. Neurofibrillary changes in cortical neurons are very common. Of utmost importance, however, was the finding of pathological tau proteins in neurons, very similar to those found in PSP and other tauopathies, suggesting a more complex pathophysiology of the disease than a simple consequence of repeated microtrauma (Neurol 2000; 20: 179- 185). Alzheimer’s disease: in Alzheimer’s disease patients, excessive phosphorylation of tau protein and the formation of neurofibrillary tangles occur in brain tissue, as well as aggregation of β-amyloid, which forms specific formations in the brain called ‘senile plaques’. The neuropathological hallmarks of AD are ‘positive’ lesions such as amyloid plaques, cerebral amyloid angiopathies and neurofibrillary tangles and ‘negative’ lesions such as neuronal and synaptic loss. A form of AD in which Lewy bodies characteristic of idiopathic Parkinson’s disease are found in various brain structures, including the cortex, is termed ‘the Lewy body variant’. Amyloidoses include systemic and organ-specific amyloidoses. These include familial amyloidosis without neuropathy, familial neuropathic amyloidosis, familial nervous system amyloidosis, secondary systemic amyloidosis and organ-limited amyloidosis. An object of the present invention also relates to compounds of general formula I for use in the treatment of neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), Parkinson’s disease (PD), Alzheimer’s disease (AD), Kennedy’s disease (KD), Huntington’s disease (HD), Creutzfeldt-Jakob disease (CJD), spinocerebellar ataxia (SCA), dentatorubral-pallidoluysian atrophy, transthyretin familial amyloid polyneuropathy, as well as systemic amyloidoses or organ-limited amyloidoses, and / or cystic fibrosis or diabetes. In another aspect, the present invention provides a compound of general formula I, for use in preventing genetically based forms of neurodegenerative diseases, such as familial amyotrophic lateral sclerosis (ALS), familial Parkinson’s disease (PD), familial Alzheimer’s disease (AD), Kennedy’s disease (KD), Huntington’s disease (HD), familial Creutzfeldt-Jakob disease (CJD), familial spinocerebellar ataxia (SCA), transthyretin familial amyloid polyneuropathy, familial dentatorubral-pallidoluysian atrophy, familial systemic amyloidoses or familial organ-specific amyloidoses, and / or cystic fibrosis. Furthermore, compounds of general formula I are suitable for the treatment of viral diseases. Viral diseases include in particular diseases caused by the HBV virus, i.e. in particular hepatitis B. Furthermore, compounds of general formula I are suitable for the treatment of diseases directly related to elevated levels of ferroptosis. In stroke, the serine protease thrombin participates in ferroptosis by facilitating the mobilisation of arachidonic acid through its esterification by acyl-CoA synthase (ACSL4). Inhibition of this pathway then reduces ischemic neuronal damage in stroke (Tuo et al.: Signal Transduct Target Ther. 2022;7(1):59). Rhabdomyolysis is a relatively common syndrome of severe skeletal muscle damage. Ferroptosis can exacerbate the development of rhabdomyolysis. Increased expression of GPX4 in combination with ACSL4 in muscle cells is able to reduce lipid peroxidation and inhibit the progression of this syndrome (Yuan et al.: 2016.03.016). In non-alcoholic steatohepatitis, RSL-3 significantly increases levels of hepatitis-related inflammatory factors. Inhibition of ferroptosis is a novel approach for the treatment of this disease (Qi et al.: Am J Pathol. 2020;190(1):68–81). Ferroptosis is also associated with pancreatic disease: administration of liproxstatin-1, a ferroptosis inhibitor, alleviates acute pancreatitis (Li et al.: Chin Med J (Engl). 2022;135(17):2026-2034). Ferroptosis is also associated with psoriasis. Ferrostatin-1, a ferroptosis inhibitor, suppressed ferroptosis-related changes in keratinocytes treated with erastin (a ferroptosis inducer) and ameliorated psoriasiform dermatitis in imiquimod-induced models (Shou et al.: Cell Death Dis.2021;12(11):1009). In another aspect, an object of the present invention is the compound of general formula I for use in the treatment of diseases directly related to elevated levels of ferroptosis, preferably selected from the group comprising stroke, rhabdomyolysis, non-alcoholic steatohepatitis, acute pancreatitis, and psoriasis. In one embodiment, the compound of general formula I, wherein R5is a hydrogen atom and R6is a sulfonic group of general formula III as defined above, is used for the treatment of diseases directly related to elevated levels of ferroptosis, preferably selected from the group consisting of stroke, rhabdomyolysis, non- alcoholic steatohepatitis, acute pancreatitis, and psoriasis. Compounds of general formula I can be administered to an animal or human to activate a cellular response to proteotoxic stress caused by the presence or increased levels of metastable proteins in the cell and imbalances in protein homeostasis (proteostasis), for example due to aging. Compounds of general formula I can be administered to an animal or human to activate a cellular response to elevated levels of ferroptosis in cells or tissue due to, for example, degenerative disease, stroke, severe skeletal muscle damage, non-alcoholic steatohepatitis, acute pancreatitis or psoriasis. Compounds of general formula I can be formulated into pharmaceutical preparations with pharmaceutically acceptable excipients. The preparations may be in liquid form or solid form, or in other forms such as aerosol. Liquid forms include solutions, suspensions, dispersions, emulsions formulated, for example, for injection or oral administration, gels, ointments. Solid forms include, for example, capsules, tablets, coated tablets, powders, suppositories, and other forms, known in the art. Pharmaceutically acceptable excipients include solvents, solubility controlling agents, pH controlling agents, carriers, fillers, binders, glidants, disintegrants, preservatives, sorbents, viscosity controlling agents, agents affecting sensory properties such as taste, odour or colour of the product. In one aspect, the present invention relates to a method of treatment of diseases directly related to elevated levels of ferroptosis, preferably selected from the group comprising stroke, rhabdomyolysis, non-alcoholic steatohepatitis, acute pancreatitis, and psoriasis, comprising the step of aministering a medicament comprising at least one compound of general formula I as defined above, to a subject in need of such treatment. In one aspect, the present invention relates to a method of treatment or prevention of proteinopathies, especially neurodegenerative diseases such as polyglutamine diseases (such as Huntington’s disease, spinobulbar muscular atrophy, spinocerebellar ataxia, and dentatorubral-pallidoluysian atrophy), tauopathies (such as Pick’s disease, progressive supranuclear palsy (PSP), Parkinson’s disease (accumulation of Tau bodies), Steele-Richardson-Olszewski disease, Guam disease (Guam Parkinsonism- dementia complex), post-traumatic Parkinsonism, Alzheimer’s disease), synucleinopathies (such as Parkinson’s disease and dementia associated with Lewy bodies), or amyotrophic lateral sclerosis; comprising the step of aministering a medicament comprising at least one compound of general formula I as defined above, to a subject in need of such treatment. In one aspect, the present invention relates to a method of treatment or prevention of amyloidosis (such as familial amyloidosis without neuropathy, familial neuropathic amyloidosis, familial nervous system amyloidosis, secondary systemic amyloidosis and organ-limited amyloidosis), cystic fibrosis and diabetes, comprising the step of aministering a medicament comprising at least one compound of general formula I as defined above, to a subject in need of such treatment. In one aspect, the present invention relates to a method of treatment of viral diseases (such as diseases caused by the HBV virus), comprising the step of aministering a medicament comprising at least one compound of general formula I as defined above, to a subject in need of such treatment. Examples Abbreviations: fmoc: fluorenylmethyloxycarbonyl ACN: acetonitrile Fmoc-Cl: fluorenylmethyloxycarbonyl chloride bs: broad singlet (NMR) HRMS: high-resolution mass spectrometry d: doublet (NMR) J: coupling constant (NMR) dd: doublet of doublets (NMR) m: multiplet (NMR) ddd: doublet of doublet of doublets (NMR) m / z: mass-to-charge ratio (MS) dt: doublet of triplets (NMR) MeOH: methanol DCM: dichloromethane NMR: nuclear magnetic resonance DIPEA: N,N-diisopropylethylamine p: pentet (NMR) DMF: dimethylformamide q: quartet (NMR) DMSO: dimethyl sulfoxide s: singlet (NMR) ESI: electrospray ionization SOCl2: thionyl chloride Et3N: triethylamine t: triplet (NMR) EtOAc: ethyl acetate td: triplet of doublets (NMR) EtOH: ethanol TFA: trifluoroacetic acid TLC: thin-layer chromatography NRF1: nuclear respiratory factor 1 TMSOTf: trimethylsilyl triflate NRF2: nuclear factor (erythroid-derived 2)-like 2 δ: chemical shift (NMR) [δ] – ppm PBS: phosphate-buffered saline ALS: amyotrophic lateral sclerosis PCR: polymerase chain reaction AMC: 7-amino-4-methylcoumarin PC12: pheochromocytoma cell line derived from BSA: bovine serum albumin rat adrenal medulla Da: Dalton PI: propidium iodide DMEM: Dulbecco's Modified Eagle Medium ROS: reactive oxygen species DMSO: dimethyl sulfoxide RT: reverse transcription DTT: dithiothreitol Ub: ubiquitin EDTA: ethylenediaminetetraacetic acid UPS: ubiquitin-proteasome system ESI: electrospray ionization GFP: green fluorescent protein Enzymes: HRMS: high-resolution mass spectrometry Renilla luciferase: enzyme from the sea pansy, HSF1: heat shock factor 1 Renilla reniformis HSPs: heat shock proteins Firefly luciferase: enzyme obtained from NMR: nuclear magnetic resonance fireflies, Photinus pyralis Example 1: Preparation of compounds All reactions were carried out under argon in dry solvents. Revers-phase chromatography was performed using the flash chromatography Teledyne ISCO Combi Flash Rf+ system with RediSep Rf Gold C18 reversed-phase columns. All starting materials were used as purchased from Sigma Aldrich, Combi-Blocks and Fluorochem. The purity of compounds and the composition of the reaction mixtures were tested on a Waters UPLC-MS Acquity with QDa Mass Detector (the flow rate of 0.5 mL / min, the gradient of 0–100% MeCN / H2O (0.1% formic acid) in 7 min) with an ACQUITY UPLC BEH C18 Column, 130Å, 1.7 µm, 2.1 mm × 100 mm with a 2.1 mm × 5 mm pre-column. ESI high-resolution mass spectra were recorded using a Thermo Scientific LTQ Orbitrap XL (Thermo Fisher Scientific) controlled by MassLynx software. NMR spectra were recorded using NMR spectrometer Bruker Avance IIITMHD 400 MHz Prodigy. List of compounds Tert-butyl (3,5-bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamate mmol) was added. Reaction mixture was stirred at ambient temperature overnight. Formed suspension was filtered off, the filter cake was wash with water and cold EtOH and dried. The reaction provided 3.449 g of the title compound in 72% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.89 – 7.83 (m, 2H), 7.12 – 7.05 (m, 2H), 7.00 (d, J = 2.0 Hz, 2H), 6.90 (d, J = 8.4 Hz, 2H), 4.14 – 4.01 (m, 1H), 3.92 (s, 6H), 3.91 (s, 6H), 3.23 – 3.13 (m, 2H), 3.08 – 3.04 (m, 2H), 1.35 (s, 9H). HRMS (ESI+): m / z calculated for C29H35O7NNa = 532.2306; found = 523.2302 [M+Na]+. 2,6-Bis(3,4-dimethoxybenzyliden)-4-(acetamido)cyklohexanon (1) Solution was diluted with water (20 mL) and extracted with EtOAc (2x10 mL). Organic phases were combined, washed with brine and water. The solvent was evaporated under reduced pressure and the residue was purified by column chromatography (eluent EtOAc:MeOH, 10:1) followed by recrystallization from hot MeOH. The reaction provided 0.320 g of the title compound in 14% yield.1H NMR (400 MHz, CDCl3) δ 7.91 (s, 2H), 7.12 (dd, J = 8.4, 1.9 Hz, 2H), 7.01 (d, J = 2.0 Hz, 2H), 6.93 (d, J = 8.4 Hz, 2H), 5.60 (d, J = 7.6 Hz, 1H), 4.76 – 4.28 (m, 1H), 3.95 (s, 3H), 3.93 (s,31H), 3.17 (m, 4H), 1.91 (s, 3H). HRMS (ESI+): m / z calculated for C26H30O6N = 452.2073; found 452.2077 [M+H]+. 3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexan-1-aminium trifluoroacetate (2) temperature for 1.5 hour. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.867 g of the title compound in 84% yield.1H NMR (401 MHz, DMSO-d6) δ 8.11 (s, 3H), 7.74 (d, J = 2.3 Hz, 2H), 7.18 – 7.11 (m, 4H), 7.08 (d, J = 8.3 Hz, 2H), 3.82 (s, 6H), 3.81 (s, 6H), 3.54 – 3.40 (m, 1H), 3.41 – 3.32 (m, 2H), 3.03 – 2.92 (m, 2H). HRMS (ESI+): m / z calculated for C24H28O5N = 410.1962; found = 410.1961 [M+H]+. 2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)amino)-N,N-dimethyl-2-oxoethan-1- aminium trifluoroacetate (3) was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.053 g of the title compound in 46% yield.1H NMR (401 MHz, Chloroform-d) δ 8.47 (d, J = 7.2 Hz, 1H), 7.82 (s, 2H), 7.05 (dd, J = 8.4, 2.0 Hz, 2H), 6.95 (d, J = 2.0 Hz, 2H), 6.88 (d, J = 8.3 Hz, 2H), 4.21 – 4.13 (m, 1H), 3.90 (s, 6H), 3.88 (s, 6H), 3.71 (s, 2H), 3.23 (dd, J = 15.9, 4.0 Hz, 2H), 3.00 – 2.85 (m, 2H), 2.82 (s, 6H). HRMS (ESI+): m / z calculated for C28H35O6N2 =495.2490; found = 495.2487 [M+H]+. 3-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)quinuclidin-1-ium trifluoroacatate (4) TFA):ACN, gradient elution). The reaction provided 0.071 g of the title compound in 56% yield.1H NMR (401 MHz, Chloroform-d) δ 11.87 (bs, 1H), 7.87 – 7.78 (m, 2H), 7.10 – 7.02 (m, 2H), 6.98 – 6.92 (m, 2H), 6.89 (d, J = 8.5 Hz, 2H), 6.53 (d, J = 7.2 Hz, 1H), 4.40 – 4.31 (m, 1H), 3.91 (s, 3H), 3.90 (s, 3H), 3.89 (s, 3H), 3.88 (s, 3H), 3.69 – 3.59 (m, 1H), 3.30 – 3.16 (m, 6H), 3.16 – 3.03 (m, 3H), 2.83 – 2.73 (m, 1H), 2.16 – 2.08 (m, 1H), 1.95 – 1.72 (m, 3H), 1.59 – 1.43 (m, 1H). HRMS (ESI+): m / z calculated for C32H39O6N2= 547.2803; found = 547.2801 [M+H]+. N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)-2-(2-(2-methoxyethoxy)ethoxy)acetamide (5) reaction mixture was stirred over night at ambient temperature. The solvent was evaporated under reduced pressure and the residue was purified by reverse- phase flash chromatography (eluent H2O:ACN, gradient elution). The reaction provided 0.080 g of the title compound in 74% yield.1H NMR (401 MHz, DMSO-d6) δ 7.79 (d, J = 7.5 Hz, 1H), 7.67 (s, 2H), 7.13 (d, J = 8.2 Hz, 4H), 7.05 (d, J = 8.2 Hz, 2H), 4.04 – 3.92 (m, 1H), 3.87 (s, 2H), 3.81 (s, 6H), 3.80 (s, 6H), 3.59 – 3.49 (m, 6H), 3.46 – 3.39 (m, 2H), 3.21 (s, 3H), 3.19 – 3.10 (m, 2H), 3.03 – 2.91 (m, 2H). HRMS (ESI+): m / z calculated for C31H39O9NNa = 592.2517; found = 592.2513 [M+Na]+. N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)cyclopentanecarboxamide (6) temperature. The solvent was evaporated under reduced pressure and the residue was purified by reverse- phase flash chromatography (eluent H2O:ACN, gradient elution). The reaction provided 0.085 g of the title compound in 88% yield.1H NMR (401 MHz, Chloroform-d) δ 7.88 (s, 2H), 7.09 (dd, J = 8.6, 1.8 Hz, 2H), 6.99 (d, J = 2.0 Hz, 2H), 6.90 (d, J = 8.4 Hz, 2H), 4.45 – 4.27 (m, 1H), 3.92 (s, 6H), 3.91 (s, 6H), 3.21 – 2.99 (m, 4H), 2.51 – 2.32 (m, 1H), 1.85 – 1.56 (m, 6H), 1.56 – 1.45 (m, 2H). HRMS (ESI+): m / z calculated for C30H35O6NNa = 528.2357; found = 528.2353 [M+Na]+. 1-(2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)amino)-2-oxoethyl)-4-methylpiperazine- 1,4-diium di(trifluoroacetate) (7) pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.102 g of the title compound in 67% yield.1H NMR (401 MHz, Chloroform-d) δ 7.88 (s, 2H), 7.11 (dd, J = 8.5, 2.0 Hz, 2H), 7.03 – 6.97 (m, 3H), 6.93 (d, J = 8.4 Hz, 2H), 4.55 – 4.46 (m, 1H), 3.93 (s, 6H), 3.92 (s, 6H), 3.34 – 3.24 (m, 2H), 3.16 – 3.07 (m, 2H), 3.07 (s, 2H), 2.82 (s, 3H), 2.79 (bs, 8H). HRMS (ESI+): m / z calculated for C31H40O6N3 =550.2912; found = 550.2910 [M+H]+. 4-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)amino)-N,N-dimethyl-4-oxobutan-1- aminium trifluoroacetate (8) pressure was reverse- phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.065 g of the title compound in 53% yield.1H NMR (401 MHz, Chloroform-d) δ 12.40 (s, 1H), 7.84 (s, 2H), 7.09 (dd, J = 8.5, 2.0 Hz, 2H), 6.98 (d, J = 2.0 Hz, 2H), 6.94 – 6.87 (m, 3H), 4.30 – 4.18 (m, 1H), 3.91 (s, 6H), 3.90 (s, 6H), 3.26 – 3.16 (m, 2H), 3.07 – 2.93 (m, 4H), 2.78 – 2.73 (m, 6H), 2.38 – 2.30 (m, 2H), 2.01 (p, J = 6.9 Hz, 2H). HRMS (ESI+): m / z calculated for C30H39O6N2 =523.2803; found = 523.2800 [M+H]+. 2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)amino)-2-oxoethan-1-aminium trifluoroacetate (9) was over solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The obtained solid was dissolved in DCM (0.5 mL), cooled down with ice bath and TFA (0.5 mL) was added dropwise. The solution was stirred at ambient temperature for 1 hour. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.080 g of the title compound in 73% yield.1H NMR (401 MHz, DMSO-d6) δ 8.60 (d, J = 6.7 Hz, 1H), 7.95 (bs, 3H), 7.71 (s, 2H), 7.17 – 7.09 (m, 4H), 7.04 (d, J = 8.2 Hz, 2H), 4.05 – 3.93 (m, 1H), 3.81 (s, 6H), 3.80 (s, 6H), 3.52 (s, 2H), 3.25 – 3.15 (m, 2H), 3.01 – 2.86 (m, 2H). HRMS (ESI+): m / z calculated for C26H31O6N2 =467.2177; found = 467.2175 [M+H]+. 2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)-3-methylpyridin-1-ium under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.098 g of the title compound in 80% yield.1H NMR (401 MHz, Chloroform-d) δ 8.44 – 8.36 (m, 2H), 7.90 (s, 2H), 7.75 – 7.68 (m, 1H), 7.42 (dd, J = 7.8, 4.9 Hz, 1H), 7.11 (dd, J = 8.4, 2.0 Hz, 2H), 7.01 (d, J = 2.0 Hz, 2H), 6.90 (d, J = 8.4 Hz, 2H), 4.54 – 4.41 (m, 1H), 3.91 (s, 6H), 3.90 (s, 6H), 3.40 – 3.30 (m, 2H), 3.17 – 3.06 (m, 2H), 2.63 (s, 3H). HRMS (ESI+): m / z calculated for C31H32O6N2Na = 551.2153; found = 551.2151 [M+Na]+. 2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)pyridin-1-ium trifluoroacetate (11) under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.099 g of the title compound in 82% yield.1H NMR (401 MHz, Chloroform-d) δ 8.57 – 8.51 (m, 1H), 8.33 (d, J = 8.1 Hz, 1H), 8.14 (dt, J = 7.9, 1.1 Hz, 1H), 7.93 (s, 2H), 7.86 (td, J = 7.7, 1.7 Hz, 1H), 7.50 – 7.42 (m, 1H), 7.23 (s, 1H), 7.12 (dd, J = 8.4, 1.8 Hz, 2H), 7.01 (d, J = 2.0 Hz, 2H), 6.90 (d, J = 8.4 Hz, 2H), 4.62 – 4.49 (m, 1H), 3.91 (s, 6H), 3.90 (s, 6H), 3.40 – 3.30 (m, 2H), 3.22 – 3.11 (m, 2H). HRMS (ESI+): m / z calculated for C30H30O6N2Na = 537.1996; found = 537.1994 [M+Na]+. 4-(2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)amino)-2-oxoethyl)-1H-imidazol-3-ium trifluoroacetate (12) evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.079 g of the title compound in 66% yield.1H NMR (401 MHz, Chloroform-d) δ 8.29 – 8.25 (m, 1H), 7.79 (d, J = 7.1 Hz, 1H), 7.75 (s, 2H), 7.06 – 7.01 (m, 1H), 6.99 (dd, J = 8.6, 1.9 Hz, 2H), 6.89 (d, J = 1.9 Hz, 2H), 6.82 (d, J = 8.5 Hz, 2H), 4.16 (s, 1H), 3.84 (s, 6H), 3.82 (s, 6H), 3.57 (s, 2H), 3.21 – 3.12 (m, 2H), 3.05 – 2.95 (m, 2H). HRMS (ESI+): m / z calculated for C29H32O6N3 = 518.2286; found = 518.2284 [M+H]+. (S)-2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)pyrrolidin-1-ium trifluoroacetate (13) solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The obtained solid was dissolved in DCM (0.5 mL), cooled down with ice bath and TFA (0.5 mL) was added dropwise. The solution was stirred at ambient temperature for 1.5 hour. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.068 g of the title compound in 58% yield.1H NMR (401 MHz, Chloroform-d) δ 11.65 (s, 1H), 8.22 (d, J = 6.7 Hz, 1H), 7.84 – 7.77 (m, 2H), 7.08 – 7.00 (m, 2H), 6.94 (dd, J = 8.9, 1.9 Hz, 2H), 6.91 – 6.84 (m, 2H), 4.51 (s, 1H), 4.19 – 4.07 (m, 1H), 3.91 (s, 3H), 3.89 (s, 3H), 3.87 (s, 3H), 3.86 (s, 3H), 3.36 – 3.21 (m, 2H), 3.19 – 2.90 (m, 4H), 2.35 – 2.28 (m, 1H), 1.97 – 1.75 (m, 3H). HRMS (ESI+): m / z calculated for C29H32O6N3 = 507.2490; found = 507.2488 [M+H]+. (S)-N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)-5-oxopyrrolidine-2-carboxamide (14) and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.084 g of the title compound in 85% yield.1H NMR (401 MHz, Chloroform-d) δ 7.85 – 7.76 (m, 2H), 7.10 – 7.00 (m, 2H), 7.00 – 6.88 (m, 4H), 6.90 – 6.81 (m, 2H), 4.47 – 4.38 (m, 1H), 4.14 – 4.06 (m, 1H), 3.89 (s, 6H), 3.88 (s, 6H), 3.28 – 3.17 (m, 2H), 3.20 – 3.06 (m, 2H), 2.47 – 2.32 (m, 1H), 2.21 (t, J = 8.0 Hz, 2H), 2.09 – 1.97 (m, 1H). HRMS (ESI+): m / z calculated for C29H32O7N2Na = 543.2102; found = 543.2100 [M+Na]+. 1-(2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)amino)-2-oxoethyl)-1H-imidazol-1-ium trifluoroacetate (15) purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.097 g of the title compound in 80% yield.1H NMR (401 MHz, Chloroform-d) δ 9.17 (s, 1H), 8.41 (d, J = 7.0 Hz, 1H), 7.79 (s, 2H), 7.40 – 7.35 (m, 1H), 7.27 – 7.18 (m, 1H), 7.03 (dd, J = 8.5, 2.0 Hz, 2H), 6.94 (d, J = 2.0 Hz, 2H), 6.86 (d, J = 8.4 Hz, 2H), 4.97 (s, 2H), 4.29 – 4.20 (m, 1H), 3.90 (s, 6H), 3.87 (s, 6H), 3.26 – 3.17 (m, 2H), 3.11 – 3.01 (m, 2H). HRMS (ESI+): m / z calculated for C29H32O6N3 = 518.2286; found = 518.2284 [M+H]+. 4-(2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)amino)-2-oxoethyl)morpholin-4-ium trifluoroacetate (16) solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.095 g of the title compound in 76% yield.1H NMR (401 MHz, Chloroform-d) δ 8.30 (d, J = 7.2 Hz, 1H), 7.84 (s, 2H), 7.07 (dd, J = 8.4, 2.0 Hz, 2H), 6.97 (d, J = 2.1 Hz, 2H), 6.90 (d, J = 8.4 Hz, 2H), 4.25 – 4.14 (m, 1H), 3.91 (s, 6H), 3.90 (s, 6H), 3.90 – 3.86 (m, 4H), 3.57 (s, 2H), 3.22 (dd, J = 15.8, 3.9 Hz, 2H), 3.15 – 3.08 (m, 4H), 3.04 – 2.92 (m, 2H). HRMS (ESI+): m / z calculated for C30H37O7N2 = 537.2595; found = 537.2593 [M+H]+. 4-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)amino)-4-oxobutan-1-aminium trifluoroacetate (17) and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The obtained solid was dissolved in DCM (0.5 mL), cooled down with ice bath and TFA (0.5 mL) was added dropwise. The solution was stirred at ambient temperature for 1.5 hour. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.049 g of the title compound in 43% yield.1H NMR (401 MHz, DMSO-d6) δ 8.17 (d, J = 6.6 Hz, 1H), 7.70 (bs, 3H), 7.67 (s, 2H), 7.17 – 7.08 (m, 4H), 7.04 (d, J = 8.2 Hz, 2H), 3.93 – 3.83 (m, 1H), 3.81 (s, 6H), 3.80 (s, 6H), 3.15 (dd, J = 15.9, 3.9 Hz, 2H), 2.95 – 2.80 (m, 2H), 2.78 – 2.70 (m, 2H), 2.21 – 2.13 (m, 2H), 1.80 – 1.64 (m, 2H). HRMS (ESI+): m / z calculated for C28H35O6N2 = 495.2490; found = 495.2487 [M+H]+. 3-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)amino)-N,N-dimethyl-3-oxopropan-1- aminium trifluoroacetate (18) reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.093 g of the title compound in 78% yield.1H NMR (401 MHz, Chloroform-d) δ 12.55 (s, 1H), 7.84 (s, 2H), 7.14 (d, J = 7.3 Hz, 1H), 7.07 (dd, J = 8.5, 2.0 Hz, 2H), 6.97 (d, J = 2.0 Hz, 2H), 6.89 (d, J = 8.4 Hz, 2H), 4.28 – 4.17 (m, 1H), 3.91 (s, 6H), 3.90 (s, 6H), 3.30 (t, J = 6.8 Hz, 2H), 3.26 – 3.16 (m, 2H), 3.06 – 2.95 (m, 2H), 2.72 (s, 6H), 2.71 (t, J = 6.8 Hz, 2H). HRMS (ESI+): m / z calculated for C29H37O6N2 = 509.2646; found = 509.2643 [M+H]+. 2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)amino)-N,N-diethyl-2-oxoethan-1-aminium trifluoroacetate (19) under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.096 g of the title compound in 79% yield.1H NMR (401 MHz, Chloroform-d) δ 12.15 (s, 1H), 8.96 (d, J = 7.2 Hz, 1H), 7.86 (s, 2H), 7.09 (dd, J = 8.4, 1.9 Hz, 2H), 7.00 (d, J = 2.0 Hz, 2H), 6.92 (d, J = 8.4 Hz, 2H), 4.25 – 4.12 (m, 1H), 3.93 (s, 6H), 3.92 (s, 6H), 3.73 (s, 2H), 3.29 (dd, J = 15.5, 3.9 Hz, 2H), 3.22 – 3.19 (m, 4H), 3.00 – 2.89 (m, 2H), 1.32 (t, J = 7.3 Hz, 6H). HRMS (ESI+): m / z calculated for C30H39O6N2 = 523.2803; found = 523.2799 [M+H]+. 3-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)amino)-3-oxopropan-1-aminium trifluoroacetate (20) 2 hour. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The obtained solid was dissolved in DCM (0.5 mL), cooled down with ice bath and TFA (0.5 mL) was added dropwise. The solution was stirred at ambient temperature for 1.5 hour. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.059 g of the title compound in 52% yield.1H NMR (401 MHz, DMSO-d6) δ 8.39 (d, J = 6.8 Hz, 1H), 7.70 (s, 3H), 7.68 (s, 2H), 7.16 – 7.09 (m, 4H), 7.05 (d, J = 8.2 Hz, 2H), 3.97 – 3.87 (m, 1H), 3.81 (s, 6H), 3.80 (s, 6H), 3.17 (dd, J = 16.2, 4.0 Hz, 2H), 2.98 – 2.83 (m, 4H), 2.44 (t, J = 6.9 Hz, 2H). HRMS (ESI+): m / z calculated for C27H33O6N2 = 481.2333; found = 481.2333 [M+H]+. 1-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)-3-(pyridin-3-yl)thiourea (21) in 72% yield.1H NMR (401 MHz, Chloroform-d) δ 8.90 (bs, 1H), 8.35 (d, J = 2.6 Hz, 1H), 8.32 – 8.26 (m, 1H), 8.03 (d, J = 8.3 Hz, 1H), 7.72 (s, 2H), 7.45 (bs, 1H), 7.21 (dd, J = 8.3, 4.8 Hz, 1H), 6.98 (dd, J = 8.5, 2.0 Hz, 2H), 6.86 – 6.72 (m, 4H), 5.22 – 5.11 (m, 1H), 3.89 (s, 6H), 3.80 (s, 6H), 3.54 (dd, J = 16.0, 4.4 Hz, 2H), 3.23 – 3.10 (m, 2H). HRMS (ESI+): m / z calculated for C30H31O5N3SNa = 568.1877; found = 568.1875 [M+Na]+. Ethyl ((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)glycinate (22) in 65% yield.1H NMR (401 MHz, Chloroform-d) δ 7.80 (s, 2H), 7.03 (dd, J = 8.6, 2.0 Hz, 2H), 6.93 (d, J = 1.9 Hz, 2H), 6.83 (d, J = 8.4 Hz, 2H), 5.28 (d, J = 7.7 Hz, 1H), 5.23 – 5.17 (m, 1H), 4.41 – 4.35 (m, 1H), 4.10 (q, J = 7.2 Hz, 2H), 3.90 (s, 8H), 3.86 (s, 6H), 3.24 – 3.05 (m, 4H), 1.19 (t, J = 7.1 Hz, 3H). HRMS (ESI+): m / z calculated for C29H34O8N2Na = 561.2207; found = 561.2207 [M+Na]+. Ethyl 3-(3-(3,5-bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)ureido)propanoate (23) in 67% yield.1H NMR (401 MHz, Chloroform-d) δ 7.78 (s, 2H), 7.03 (dd, J = 8.3, 2.0 Hz, 2H), 6.93 (d, J = 2.0 Hz, 2H), 6.84 (d, J = 8.3 Hz, 2H), 5.11 (bs, 1H), 5.07 – 5.00 (m, 1H), 4.35 – 4.29 (m, 1H), 3.99 (q, J = 7.1 Hz, 2H), 3.90 (s, 6H), 3.87 (s, 6H), 3.42 – 3.33 (m, 2H), 3.21 – 3.05 (m, 4H), 2.42 (t, J = 5.8 Hz, 2H), 1.15 (t, J = 7.1 Hz, 3H). HRMS (ESI+): m / z calculated for C30H36O8N2Na = 575.2364; found = 575.2361 [M+Na]+. 1-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)-3-(3-methoxyphenyl)urea (24) 1H NMR (401 MHz, Chloroform-d) δ 7.75 (s, 2H), 7.67 – 7.58 (m, 1H), 7.10 – 7.01 (m, 2H), 6.98 – 6.91 (m, 2H), 6.84 – 6.78 (m, 2H), 6.77 – 6.70 (m, 3H), 6.53 – 6.45 (m, 1H), 6.06 – 5.96 (m, 1H), 4.61 – 4.52 (m, 1H), 3.87 (s, 6H), 3.77 (s, 6H), 3.69 (s, 3H), 3.40 – 3.30 (m, 2H), 3.13 – 3.03 (m, 2H). HRMS (ESI+): m / z calculated for C32H34O7N2Na = 581.2258; found = 581.2257 [M+Na]+. 1-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)-3-(2-morpholinoethyl)thiourea (25) 1H NMR (401 MHz, Chloroform-d) δ 7.72 (s, 2H), 7.05 – 6.98 (m, 2H), 6.86 – 6.77 (m, 4H), 4.98 (bs, 1H), 3.91 (s, 6H), 3.84 (s, 6H), 3.61 – 3.51 (m, 2H), 3.47 – 3.33 (m, 6H), 3.21 – 3.13 (m, 2H), 2.45 – 2.38 (m, 2H), 2.27 (bs, 4H). HRMS (ESI+): m / z calculated for C31H39O6N3SNa = 604.2452; found = 604.2451 [M+Na]+. 3-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)pyridin-1-ium trifluoroacetate (26) and the stirring continued for additional 30 minutes at ambient temperature. To the mixture was added nicotinoyl chloride hydrochloride (0.140 g, 0.79 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol). The reaction mixture was further stirred over night at ambient temperature. The reaction mixture was diluted with water (15 mL) and extracted with DCM (3x15 mL). Organic phases were combined, washed with brine, dried over Na2SO4 and filtrated. Solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.084 g of the title compound in 34% yield.1H NMR (401 MHz, DMSO-d6) δ: 9.04 (dd, J = 2.2, 0.9 Hz, 1H), 8.91 (d, J = 6.8 Hz, 1H), 8.77 (dd, J = 5.0, 1.6 Hz, 1H), 8.31 (dt, J = 8.0, 1.9 Hz, 1H), 7.69 (s, 2H), 7.63 (ddd, J = 8.0, 5.0, 0.8 Hz, 1H), 7.19 – 7.08 (m, 4H), 7.04 (d, J = 8.3 Hz, 2H), 4.19 – 4.07 (m, 1H), 3.80 (s, 12H), 3.29 (dd, J = 16.0, 4.1 Hz, 2H), 3.09 – 2.97 (m, 2H). HRMS (ESI+): m / z calculated for C30H30O6N2Na = 537.1996; found = 537.1992 [M+Na]+. 3-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)-N,N-dimethylbenzenaminium trifluoroacetate (27) temperature. The solvent was evaporated under reduced pressure and the residue was dissolved in DMF (5 mL). To the mixture was added 3-(dimethylamino)benzoic acid (0.097 g, 0.59 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol) and HBTU (0.223 g, 0.59 mmol). The reaction mixture was further stirred 2 hours at ambient temperature. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.231 g of the title compound in 88% yield.1H NMR (401 MHz, DMSO-d6) δ: 8.52 (d, J = 7.0 Hz, 1H), 7.68 (s, 2H), 7.29 (t, J = 8.1 Hz, 1H), 7.20 (d, J = 6.7 Hz, 2H), 7.15 (d, J = 8.7 Hz, 4H), 7.04 (d, J = 8.2 Hz, 2H), 6.99 – 6.92 (m, 1H), 4.14 – 4.02 (m, 1H), 3.80 (s, 12H), 3.26 (dd, J = 16.0, 4.1 Hz, 2H), 3.07 – 2.96 (m, 2H), 2.95 (s, 6H). HRMS (ESI+): m / z calculated for C33H36O6N2Na = 579.2466; found = 579.2462 [M+Na]+. 5-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)-2-(piperidin-1-ium-1- yl)pyridin-1-ium trifluoroacetate (28) . the mixture was added 6-(piperidin-1-yl)nicotinic acid (0.121 g, 0.59 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol) and HBTU (0.223 g, 0.59 mmol). The reaction mixture was further stirred 1.5 hour at ambient temperature. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.168 g of the title compound in 52% yield.1H NMR (401 MHz, DMSO-d6) δ: 8.54 – 8.46 (m, 2H), 8.04 (dd, J = 9.3, 2.5 Hz, 1H), 7.68 (s, 2H).7.19 – 7.11 (m, 4H), 7.07 – 7.00 (m, 3H), 4.15 – 4.02 (m, 1H), 3.80 (s, 12H), 3.64 (t, J = 5.4 Hz, 4H), 3.25 (dd, J = 16.0, 4.1 Hz, 2H), 3.05 – 2.93 (m, 2H), 1.70 – 1.60 (m, 2H), 1.60 – 1.51 (m, 4H). HRMS (ESI+): m / z calculated for C35H40O6N3 = 598.2912; found = 598.2908 [M+H]+. 4-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)pyridin-1-ium trifluoroacetate (29) hydrochloride (0.140 g, 0.79 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol). The reaction mixture was further stirred for 2 hours at ambient temperature. The reaction mixture was diluted with water (15 mL) and extracted with DCM (3x15 mL). Organic phases were combined, washed with brine, dried over Na2SO4 and filtrated. Solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.142 g of the title compound in 58% yield.1H NMR (401 MHz, Chloroform-d) δ: 8.79 – 8.73 (m, 2H), 7.99 – 7.93 (m, 2H), 7.83 (s, 2H), 7.30 (d, J = 7.3 Hz, 1H), 7.04 (dd, J = 8.6, 2.0 Hz, 2H), 6.93 (d, J = 2.0 Hz, 2H), 6.87 (d, J = 8.5 Hz, 2H), 4.68 – 4.59 (m, 1H), 3.90 (s, 6H), 3.87 (s, 6H), 3.36 – 3.21 (m, 4H). HRMS (ESI+): m / z calculated for C30H30O6N2Na = 537.1996; found = 537.1992 [M+Na]+. 4-(2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)amino)-2-oxoethoxy)pyridin-1-ium trifluoroacetate (30) mixture was added 2-(pyridin-4-yloxy)acetic acid (0.090 g, 0.59 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol) and HBTU (0.223 g, 0.59 mmol). The reaction mixture was further stirred 2 hours at ambient temperature. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.089 g of the title compound in 34% yield.1H NMR (401 MHz, DMSO-d6) δ: 8.86 (d, J = 6.7 Hz, 1H), 8.47 – 8.40 (m, 1H), 8.37 (dt, J = 5.9, 1.3 Hz, 1H), 8.03 – 7.93 (m, 1H), 7.97 – 7.85 (m, 1H), 7.71 (s, 2H), 7.19 – 7.07 (m, 4H), 7.04 (d, J = 8.2 Hz, 2H), 5.30 (s, 2H), 4.05 – 3.94 (m, 1H), 3.81 (s, 6H), 3.79 (s, 6H), 3.26 – 3.17 (m, 2H), 3.04 – 2.92 (m, 2H). HRMS (ESI+): m / z calculated for C31H33O7N2 = 545.2282; found = 545.2277 [M+H]+. 3-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)benzenaminium trifluoroacetate (31) temperature. The solvent was evaporated under reduced pressure and the residue was dissolved in DMF (5 mL). To the mixture was added 3-((tert-butoxycarbonyl)amino)benzoic acid (0.140 g, 0.59 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol) and HBTU (0.223 g, 0.59 mmol). The reaction mixture was further stirred 2 hours at ambient temperature. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The obtained solid was dissolved in DCM (0.5 mL), cooled down with ice bath and TFA (0.5 mL) was added dropwise. The solution was stirred at ambient temperature for 3 hours. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.124 g of the title compound in 49% yield.1H NMR (401 MHz, DMSO-d6) δ 8.52 (d, J = 6.9 Hz, 1H), 7.68 (s, 2H), 7.30 – 7.20 (m, 3H), 7.19 – 7.08 (m, 4H), 7.04 (d, J = 8.2 Hz, 2H), 6.98 – 6.89 (m, 1H), 4.13 – 4.01 (m, 1H), 3.80 (s, 12H), 3.25 (dd, J = 15.8, 4.0 Hz, 2H), 3.06 – 2.94 (m, 2H). HRMS (ESI+): m / z calculated for C31H32O6N2Na = 551.2153; found = 551.2150 [M+Na]+. 4-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)benzenaminium trifluoroacetate (32) butoxycarbonyl)amino)benzoic acid (0.140 g, 0.59 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol) and HBTU (0.223 g, 0.59 mmol). The reaction mixture was further stirred 2 hours at ambient temperature. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The obtained solid was dissolved in DCM (0.5 mL), cooled down with ice bath and TFA (0.5 mL) was added dropwise. The solution was stirred at ambient temperature for 3 hours. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.083 g of the title compound in 33% yield.1H NMR (401 MHz, DMSO-d6) δ 8.14 (d, J = 6.9 Hz, 1H), 7.67 (s, 2H), 7.64 – 7.56 (m, 2H), 7.19 – 7.08 (m, 4H), 7.04 (d, J = 8.2 Hz, 2H), 6.63 – 6.55 (m, 2H), 4.09 – 3.99 (m, 1H), 3.80 (s, 12H), 3.23 (dd, J = 16.1, 4.1 Hz, 2H), 3.03 – 2.91 (m, 2H). HRMS (ESI+): m / z calculated for C31H32O6N2Na = 551.2153; found = 551.2149 [M+Na]+. 2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)benzenaminium trifluoroacetate (33) at temperature. The solvent was evaporated under reduced pressure and the residue was dissolved in DMF (5 mL). To the mixture was added 2-((tert-butoxycarbonyl)amino)benzoic acid (0.140 g, 0.59 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol) and HBTU (0.223 g, 0.59 mmol). The reaction mixture was further stirred 2 hours at ambient temperature. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The obtained solid was dissolved in DCM (0.5 mL), cooled down with an ice bath and TFA (0.5 mL) was added dropwise. The solution was stirred at ambient temperature for 3 hours. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.093 g of the title compound in 37% yield.1H NMR (401 MHz, DMSO-d6) δ 8.42 (d, J = 6.8 Hz, 1H), 7.68 (s, 2H), 7.56 (dd, J = 8.0, 1.5 Hz, 1H), 7.24 – 7.12 (m, 5H), 7.08 – 7.01 (m, 2H), 6.76 (dd, J = 8.2, 1.2 Hz.1H), 6.69 – 6.60 (m, 1H), 4.12 – 3.99 (m, 1H), 3.80 (s, 12H), 3.26 (dd, J = 15.9, 4.0 Hz, 2H), 3.00 (ddd, J = 15.9, 11.0, 2.7 Hz, 2H). HRMS (ESI+): m / z calculated for C31H32O6N2Na = 551.2153; found = 551.2149 [M+Na]+. 2-((3,5-Bis((E)-4-ethoxy-3-methoxybenzylidene)-4-oxocyclohexyl)carbamoyl)pyridin-1-ium trifluoroacetate (34) mixture and the formed suspension was filtered off. Obtained filter cake was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.067 g of the title compound in 34% yield.1H NMR (401 MHz, DMSO-d6) δ 8.85 (d, J = 7.7 Hz, 1H), 8.65 (dt, J = 4.8, 1.4 Hz, 1H), 8.03 – 7.92 (m, 2H), 7.70 (s, 2H), 7.65 – 7.56 (m, 1H), 7.18 – 7.08 (m, 4H), 7.02 (d, J = 8.3 Hz, 2H), 4.23 – 4.12 (m, 1H), 4.05 (q, J = 7.0 Hz, 4H), 3.79 (s, 6H), 3.28 – 3.10 (m, 4H), 1.33 (t, J = 7.0 Hz, 6H). HRMS (ESI+): m / z calculated for C32H34O6N2Na = 565.2309; found = 565.2305 [M+Na]+. 2-((3,5-Bis((E)-3-ethoxy-4-methoxybenzylidene)-4-oxocyclohexyl)carbamoyl)pyridin-1-ium trifluoroacetate (35) pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.080 g of the title compound in 41% yield.1H NMR (401 MHz, DMSO-d6) δ 8.84 (d, J = 7.8 Hz, 1H), 8.66 (dt, J = 4.8, 1.4 Hz, 1H), 8.07 – 7.94 (m, 2H), 7.69 (s, 2H), 7.65 – 7.57 (m, 1H), 7.18 – 7.11 (m, 4H), 7.03 (d, J = 8.3 Hz, 2H), 4.23 – 4.11 (m, 1H), 4.05 (q, J = 7.0 Hz, 4H), 3.80 (s, 6H), 3.27 – 3.09 (m, 4H), 1.32 (t, J = 6.9 Hz, 6H). HRMS (ESI+): m / z calculated for C32H34O6N2Na = 565.2309; found = 565.2306 [M+Na]+. 2-((3,5-Bis((E)-4-hydroxy-3-methoxybenzylidene)-4-oxocyclohexyl)carbamoyl)pyridin-1-ium trifluoroacetate (36) temperature overnight. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.076 g of the title compound in 42% yield.1H NMR (401 MHz, DMSO-d6) δ 9.58 (s, 2H), 8.83 (d, J = 7.7 Hz, 1H), 8.65 (dt, J = 4.8, 1.4 Hz, 1H), 8.03 – 7.94 (m, 2H), 7.68 (s, 2H), 7.65 – 7.57 (m, 1H), 7.14 (d, J = 2.0 Hz, 2H), 7.05 (dd, J = 8.6, 2.0 Hz, 2H), 6.85 (d, J = 8.2 Hz, 2H), 4.27 – 4.09 (m, 1H), 3.80 (s, 6H), 3.27 – 3.07 (m, 4H). HRMS (ESI+): m / z calculated for C28H26O6N2Na = 509.1683; found = 509.1680 [M+Na]+. 2-((3,5-Bis((E)-4-methoxy-3-(trifluoromethoxy)benzylidene)-4-oxocyclohexyl)carbamoyl)pyridin-1-ium trifluoroacetate (37) under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.147 g of the title compound in 66% yield.1H NMR (401 MHz, DMSO-d6) δ 8.88 (d, J = 7.6 Hz, 1H), 8.66 (dt, J = 4.8, 1.4 Hz, 1H), 8.04 – 7.95 (m, 2H), 7.68 (s, 2H), 7.66 – 7.51 (m, 5H), 7.32 (d, J = 8.6 Hz, 2H), 4.24 – 4.11 (m, 1H), 3.90 (s, 6H), 3.21 – 3.10 (m, 4H). HRMS (ESI+): m / z calculated for C30H24O6N2F6Na = 645.1431; found = 645.1428 [M+Na]+. 2-((3,5-Bis((E)-4-hydroxy-3-(trifluoromethoxy)benzylidene)-4-oxocyclohexyl)carbamoyl)pyridin-1-ium trifluoroacetate (38) under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.145 g of the title compound in 68% yield.1H NMR (401 MHz, DMSO-d6) δ 10.77 (s, 2H), 8.87 (d, J = 7.6 Hz, 1H), 8.66 (dt, J = 4.8, 1.4 Hz, 1H), 8.04 – 7.94 (m, 2H), 7.67 – 7.57 (m, 3H), 7.52 – 7.42 (m, 4H), 7.10 (d, J = 8.5 Hz, 2H), 4.21 – 4.11 (m, 1H), 3.22 – 3.07 (m, 4H). HRMS (ESI+): m / z calculated for C28H20O6N2F6Na = 617.1118; found = 617.1114 [M+Na]+. 2-((3,5-Bis((E)-4-(difluoromethoxy)-3-hydroxybenzylidene)-4-oxocyclohexyl)carbamoyl)pyridin-1-ium trifluoroacetate (39) To a mixture of 2-((4-oxocyclohexyl)carbamoyl)pyridin-1-ium trifluoroacetate (0.100 g, 0.30 mmol) and 4-(difluoromethoxy)-3-hydroxybenzaldehyde (0.142 g, 0.75 mmol) in glacial acetic acid (1 mL) was added 4 M solution of hydrogen chloride in dioxane (0.15 mL), and the reaction mixture was stirred overnight. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash temperature. The solvent was evaporated under reduced pressure and the residue was dissolved in DMF (5 mL). To a mixture was added 3,5-difluoropicolinic acid (0.094 g, 0.59 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol) and HBTU (0.223 g, 0.59 mmol). The reaction mixture was further stirred 1.5 hours at ambient temperature. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.127 g of the title compound in 49% yield.1H NMR (401 MHz, DMSO-d6) δ 8.81 (d, J = 7.3 Hz, 1H), 8.57 (d, J = 2.3 Hz, 1H), 8.12 – 8.02 (m, 1H), 7.70 (s, 2H), 7.18 – 7.10 (m, 4H), 7.05 (d, J = 8.2 Hz, 2H), 4.18 – 4.06 (m, 1H), 3.80 (s, 6H), 3.80 (s, 6H), 3.24 (dd, J = 15.9, 4.1 Hz, 2H), 3.14 – 3.03 (m, 2H). HRMS (ESI+): m / z calculated for C30H28O6N2F2Na = 573.1808; found = 573.1805 [M+Na]+. 2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)-6-hydroxypyridin-1-ium trifluoroacetate (41) residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.051g of the title compound in 41% yield1H NMR (401 MHz, DMSO-d6) δ 8.47 (d, J = 6.3 Hz, 1H), 7.74 – 7.64 (m, 3H), 7.25 – 7.21 (m, 1H), 7.18 – 7.10 (m, 4H), 7.08 – 6.99 (m, 2H), 6.73 (d, J = 8.6 Hz, 1H), 4.19 – 4.08 (m, 1H), 3.80 (s, 6H), 3.80 (s, 6H), 3.29 – 3.20 (m, 2H), 3.14 – 3.03 (m, 2H). HRMS (ESI+): m / z calculated for C30H30O7N2Na = 553.1945; found = 553.1948 [M+Na]+. 2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)-1H-imidazol-3-ium trifluoroacetate (42) and the stirring continued for additional 30 minutes at ambient temperature. The solvent was evaporated under reduced pressure and the residue was dissolved in DMF (5 mL). To the mixture was added 1H- imidazole-2-carboxylic acid (0.066 g, 0.59 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol) and HBTU (0.223 g, 0.59 mmol). The reaction mixture was further stirred 1.5 hours at ambient temperature. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.122 g of the title compound in 50% yield.1H NMR (401 MHz, DMSO-d6) δ 8.60 (d, J = 7.5 Hz, 1H), 7.70 (s, 2H), 7.25 (s, 2H), 7.18 – 7.12 (m, 4H), 7.07 – 7.00 (m, 2H), 4.17 – 4.05 (m, 1H), 3.80 (s, 11H), 3.23 (dd, J = 16.0, 4.2 Hz, 2H), 3.16 – 3.05 (m, 2H). HRMS (ESI+): m / z calculated for C28H29O6N3Na = 526.1949; found = 526.1945 [M+Na]+. N-(3-((E)-3-Methoxybenzylidene)-5-((E)-4-methoxybenzylidene)-4-oxocyclohexyl)picolinamide hydrochloride (43) pressure and the residue was immediately purified by a column chromatography (eluent cHex:EtOAc, 2:1). The reaction provided 0.028 g of the title compound in 10% yield.1H NMR (400 MHz, Chloroform-d) δ 8.56 – 8.49 (m, 1H), 8.19 (d, J = 8.3 Hz, 1H), 8.12 (dt, J = 7.8, 1.1 Hz, 1H), 7.91 (s, 2H), 7.81 (td, J = 7.7, 1.7 Hz, 1H), 7.50 – 7.41 (m, 2H), 7.45 – 7.37 (m, 1H), 7.35 – 7.26 (m, 1H), 7.08 – 7.01 (m, 1H), 7.00 – 6.94 (m, 1H), 6.98 – 6.89 (m, 2H), 6.93 – 6.84 (m, 1H), 4.57 – 4.44 (m, 1H), 3.83 (s, 3H), 3.81 (s, 3H), 3.43 – 3.27 (m, 2H), 3.16 – 3.04 (m, 2H). HRMS (ESI+): m / z calculated for C28H26O4N2Na = 477.1785; found = 477.1782 [M+Na]+. 2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)pyridin-1-ium hydrogen sulfate (44) base (0.123 g, 0.24 mmol) was dissolved in Et2O (2 mL) and H2SO4 (0.12 mL, 2M solution in water) was added dropwise. Formed suspension was filtered off and dried. The reaction provided 0.143 g (0.23 mmol) of the title compound. 2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)pyridin-1-ium hydrochloride (45) base (0.123 g, 0.24 mmol) was dissolved in Et2O (2 mL) and HCl (0.06 mL, 4M solution in dioxane) was added dropwise. Formed suspension was filtered off and dried. The reaction provided 0.130 g (0.24 mmol) of the title compound. 2-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)pyridin-1-ium hydrobromide base (0.123 g, 0.24 mmol) was dissolved in Et2O (2 mL) and HBr (3.8M solution in water) was added dropwise. Formed suspension was filtered off and dried. The reaction provided 0.140 g (0.24 mmol) of the title compound. 4-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)thiazol-3-ium trifluoroacetate (47) temperature. The solvent was evaporated under reduced pressure and the residue was dissolved in DMF (5 mL). To the mixture was added thiazole-4-carboxylic acid (0.076 g, 0.59 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol) and HBTU (0.223 g, 0.59 mmol). The reaction mixture was further stirred 1.5 hours at ambient temperature. The solvent was evaporated and the solid residue was purified by reverse- phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.143 g of the title compound in 58% yield.1H NMR (401 MHz, DMSO-d6) δ: 9.19 (d, J = 2.0 Hz, 1H), 8.54 (d, J = 7.6 Hz, 1H), 8.30 (d, J = 2.0 Hz, 1H), 7.72 – 7.67 (m, 2H), 7.18 – 7.12 (m, 4H), 7.07 – 7.00 (m, 2H), 4.18 – 4.09 (m, 1H), 3.80 (s, 6H), 3.79 (s, 6H), 3.27 – 3.06 (m, 4H). HRMS (ESI+): m / z calculated for C28H28O6N2NaS = 543.1560; found = 543.1565 [M+Na]+. N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)-2-methyloxazole-4-carboxamide (48) temperature. The solvent was evaporated under reduced pressure and the residue was dissolved in DMF (5 mL). To the mixture was added 2-methyloxazole-4-carboxylic acid (0.075 g, 0.59 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol) and HBTU (0.223 g, 0.59 mmol). The reaction mixture was further stirred 2 hours at ambient temperature. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0,1% TFA):ACN, gradient elution). The reaction provided 0.092 g of the title compound in 45% yield.1H NMR (401 MHz, Chloroform-d) δ: 8.43 (s, 1H), 8.30 (d, J = 7.6 Hz, 1H), 7.71 – 7.65 (m, 2H), 7.18 – 7.07 (m, 4H), 7.07 – 6.99 (m, 2H), 4.11 – 4.03 (m, 1H), 3.80 (s, 6H), 3.80 (s, 6H), 3.23 – 3.13 (m, 2H), 3.13 – 3.02 (m, 2H), 2.46 (s, 3H). HRMS (ESI+): m / z calculated for C29H30O7N2Na = 541.1945; found = 541.1946 [M+Na]+. 3-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)carbamoyl)pyrrolidin-1-ium trifluoroacetate and the stirring continued for additional 30 minutes at ambient temperature. The solvent was evaporated under reduced pressure and the residue was dissolved in DMF (5 mL). To the mixture was added 1-(tert- butoxycarbonyl)pyrrolidine-3-carboxylic acid (0.066 g, 0.31 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol) and HBTU (0.223 g, 0.59 mmol). The Reaction mixture was further stirred 1.5 hour at ambient temperature. The solvent was evaporated under reduced pressure and the solid residue was purified by flash chromatography (eluent cHex:EtOAc, gradient elution 40 – 85%). The obtained solid was dissolved in DCM (0.5 mL), cooled down with ice bath and TFA (0.5 mL) was added dropwise. The solution was stirred at ambient temperature for 2 hours. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O(0,1% TFA):ACN, gradient elution). The reaction provided 0.123 g of the title compound in 65% yield.1H NMR (401 MHz, Chloroform-d) δ: 8.81 (bs, 2H), 8.43 (d, J = 6.6 Hz, 1H), 7.70 – 7.65 (m, 2H), 7.16 – 7.07 (m, 4H), 7.07 – 7.00 (m, 2H), 3.93 (s, 1H), 3.81 (s, 6H), 3.80 (s, 3H), 3.80 (s, 3H), 3.31 – 2.85 (m, 9H), 2.15 – 2.02 (m, 1H), 1.91 – 1.77 (m, 1H). HRMS (ESI+): m / z calculated for C29H35O6N2= 507.2490; found = 507.2488 [M+H]+. N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)pyrazolo[1,5-a]pyrimidine-3-carboxamide temperature. The solvent was evaporated under reduced pressure and the residue was dissolved in DMF (5 mL). To the mixture was added pyrazolo[1,5-a]pyrimidine-3-carboxylic acid (0.096 g, 0.59 mmol) followed by addition of DIPEA (0.21 mL, 1.18 mmol) and HBTU (0.223 g, 0.59 mmol). The reaction mixture was further stirred 2 hours at ambient temperature. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.108 g of the title compound in 50% yield.1H NMR (401 MHz, DMSO-d6) δ: 9.28 (dd, J = 7.0, 1.7 Hz, 1H), 8.75 (dd, J = 4.2, 1.7 Hz, 1H), 8.50 (s, 1H), 8.08 (d, J = 7.0 Hz, 1H), 7.79 – 7.73 (m, 2H), 7.24 (dd, J = 7.0, 4.2 Hz, 1H), 7.21 – 7.12 (m, 4H), 7.12 – 7.01 (m, 2H), 4.38 – 4.28 (m, 1H), 3.79 (s, 12H), 3.32 – 3.15 (m, 4H). HRMS (ESI+): m / z calculated for C31H30O6N4Na = 577.2058; found = 577.2062 [M+Na]+. N-(3,5-Bis((E)-3,4-dimethoxybenzyliden)-4-oxocyklohexyl)cyklopropansulfonamid (51) and the stirring continued for additional 30 minutes at ambient temperature. The reaction mixture was again cooled down with an ice bath and cyclopropanesulfonyl chloride (0.055 g, 0.39 mmol) was added followed by addition of Et3N (0.06 mL, 0.39 mmol). The solution was further stirred overnight at ambient temperature. The reaction was quenched with water and extracted with DCM. Organic phases were combined, dried over MgSO4and filtered. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.110 g of the title compound in 55% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.93 – 7.88 (m, 2H), 7.12 – 7.04 (m, 2H), 6.98 (d, J = 2.0 Hz, 2H), 6.91 (d, J = 8.4 Hz, 2H), 4.52 (bs, 1H), 4.01 – 3.94 (m, 1H), 3.92 (s, 6H), 3.91 (s, 6H), 3.32 – 3.23 (m, 2H), 3.19 – 3.11 (m, 2H), 2.17 (tt, J = 7.9, 4.8 Hz, 1H), 1.07 – 0.98 (m, 2H), 0.79 – 0.66 (m, 2H). HRMS (ESI+): m / z calculated for C27H31O7NNaS = 536.1713; found = 536.1711 [M+Na]+. N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)ethanesulfonamide (52) 1.5 hour. DIPEA (0.21 mL, 1.18 mmol) was added dropwise and the stirring continued for additional 30 minutes at ambient temperature. The reaction mixture was again cooled down with an ice bath and ethanesulfonyl chloride (0.050 g, 0.39 mmol) was added. The solution was further stirred overnight at ambient temperature. The reaction was quenched with water and extracted with DCM. Organic phases were combined, dried over MgSO4 and filtered. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.063 g of the title compound in 32% yield.1H NMR (401 MHz, Chloroform-d) δ: 7.93 – 7.88 (m, 2H), 7.11 – 7.04 (m, 2H), 6.98 (d, J = 2.0 Hz, 2H), 6.91 (d, J = 8.4 Hz, 2H), 4.40 (d, J = 6.6 Hz, 1H), 4.04 – 3.95 (m, 1H), 3.93 (s, 6H), 3.91 (s, 6H), 3.28 – 3.09 (m, 4H), 2.83 (q, J = 7.4 Hz, 2H), 1.18 (t, J = 7.4 Hz, 3H). HRMS (ESI+): m / z calculated for C26H31O7NNaS = 524.1713; found = 524.1711 [M+Na]+. 4-(N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)sulfamoyl)-1-methylpiperazin-1- trifluoroacetate (53) temperature. The reaction mixture was again cooled down with an ice bath and 4-methylpiperazine-1- sulfonyl chloride (0.234 g, 1.18 mmol) was added. The solution was further stirred over night at ambient temperature. The reaction was quenched with water and extracted with DCM. Organic phases were combined, dried over MgSO4and filtered. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.175 g of the title compound in 65% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.90 – 7.84 (m, 2H), 7.12 – 7.04 (m, 2H), 6.98 (d, J = 2.0 Hz, 2H), 6.93 (d, J = 8.5 Hz, 2H), 5.03 (d, J = 6.2 Hz, 1H), 3.95 – 3.91 (m, 7H), 3.90 (s, 6H), 3.60 (bs, 2H), 3.33 (bs, 2H), 3.26 – 3.11 (m, 6H), 2.70 – 2.60 (m, 5H). HRMS (ESI+): m / z calculated for C29H38O7N3S = 572.2425; found = 572.2422 [M+H]+. N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)morpholine-4-sulfonamide (54) and the stirring continued for additional 30 minutes at ambient temperature. The reaction mixture was again cooled down with an ice bath and morpholine-4-sulfonyl chloride (0.219 g, 1.18 mmol) was added. The solution was further stirred overnight at ambient temperature. The reaction was quenched with water and extracted with DCM. Organic phases were combined, dried over MgSO4 and filtered. The solvent was evaporated and the solid residue was purified by a reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.076 g of the title compound in 35% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.94 – 7.88 (m, 2H), 7.13 – 7.06 (m, 2H), 6.99 (d, J = 2.0 Hz, 2H), 6.92 (d, J = 8.4 Hz, 2H), 4.33 (bs, 1H), 4.00 – 3.93 (m, 1H), 3.93 (s, 6H), 3.92 (s, 6H), 3.50 – 3.43 (m, 4H), 3.19 (dd, J = 5.1, 1.8 Hz, 4H), 3.02 – 2.95 (m, 4H). HRMS (ESI+): m / z calculated for C28H34O8N2NaS = 581.1928; found = 581.1927 [M+Na]+. N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)-1-methyl-1H-imidazole-4-sulfonamide (55) and the stirring continued for additional 30 minutes at ambient temperature. The reaction mixture was again cooled down with an ice bath and 1-methyl-1H-imidazole-4-sulfonyl chloride (0.250 g, 1.38 mmol) was added. The solution was further stirred 1.5 hour at ambient temperature. Reaction was quenched with water and extracted with DCM. Organic phases were combined, dried over MgSO4 and filtered. The solvent was evaporated and the solid residue was purified by a reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.140 g of the title compound in 64% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.89 (d, J = 6.2 Hz, 1H), 7.63 (d, J = 1.4 Hz, 1H), 7.62 (d, J = 1.4 Hz, 1H), 7.61 – 7.59 (m, 2H), 7.12 – 7.08 (m, 2H), 7.07 – 7.04 (m, 4H), 3.83 (s, 6H), 3.80 (s, 6H), 3.50 (s, 3H), 3.35 – 3.31 (m, 1H), 3.15 – 3.06 (m, 2H), 2.87 – 2.75 (m, 2H). HRMS (ESI+): m / z calculated for C28H31O7N3NaS = 576.1775; found = 576.1771 [M+Na]+. N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)-2-(methoxymethyl)pyrrolidine-1- sulfonamide (56) temperature. The reaction mixture was again cooled down with an ice bath and 2- (methoxymethyl)pyrrolidine-1-sulfonyl chloride (0.250 g, 1.17 mmol) was added. The solution was further stirred overnight at ambient temperature. The reaction was quenched with water and extracted with DCM. Organic phases were combined, dried over MgSO4 and filtered. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.169 g of the title compound in 73% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.93 – 7.83 (m, 2H), 7.13 – 7.04 (m, 2H), 7.00 (dd, J = 4.5, 2.0 Hz, 2H), 6.90 (dd, J = 8.4, 2.2 Hz, 2H), 3.92 (s, 6H), 3.91 (s, 6H), 3.90 – 3.75 (m, 2H), 3.19 (s, 3H), 3.40 – 2.99 (m, 8H), 1.87 – 1.73 (m, 1H), 1.73 – 1.59 (m, 3H). HRMS (ESI+): m / z calculated for C30H38O8N2NaS = 609.2241; found = 609.2239 [M+Na]+. (R)-N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)-3-fluoropyrrolidine-1-sulfonamide (57) and the stirring continued for additional 30 minutes at ambient temperature. The reaction mixture was again cooled down with an ice bath and (R)-3-fluoropyrrolidine-1-sulfonyl chloride (0.250 g, 1.33 mmol) was added. The solution was further stirred overnight at ambient temperature. The reaction was quenched with water and extracted with DCM. Organic phases were combined, dried over MgSO4 and filtered. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.145 g of the title compound in 66% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.91 – 7.86 (m, 2H), 7.08 (dd, J = 8.5, 2.0 Hz, 2H), 6.99 (d, J = 2.0 Hz, 2H), 6.94 – 6.87 (m, 2H), 5.05 (dt, J = 53.0, 3.9 Hz, 1H), 4.44 (bs, 1H), 3.92 (s, 6H), 3.92 – 3.90 (m, 7H), 3.51 – 3.13 (m, 8H), 2.10 – 1.94 (m, 1H), 1.92 – 1.69 (m, 1H). HRMS (ESI+): m / z calculated for C28H33O7N2FNaS = 583.1885; found = 583.1882 [M+Na]+. N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)azepane-1-sulfonamide (58) and the stirring continued for additional 30 minutes at ambient temperature. The reaction mixture was again cooled down with an ice bath and azepane-1-sulfonyl chloride (0.100 g, 0.51 mmol) was added. The solution was further stirred 12 days at ambient temperature. The solvent was evaporated and the solid residue was purified by a reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution) followed by recrystallization from MeOH. The reaction provided 0.044 g of the title compound in 20% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.67 – 7.62 (m, 2H), 7.36 (d, J = 5.7 Hz, 1H), 7.17 – 7.09 (m, 4H), 7.06 (d, J = 8.2 Hz, 2H), 3.81 (s, 6H), 3.81 (s, 6H), 3.38 – 3.28 (m, 1H), 3.24 (dd, J = 16.1, 3.9 Hz, 2H), 3.07 (t, J = 5.8 Hz, 4H), 2.96 – 2.84 (m, 2H), 1.52 – 1.44 (m, 4H), 1.47 – 1.32 (m, 4H). HRMS (ESI+): m / z calculated for C30H38O7N2NaS = 593.2292; found = 593.2291 [M+Na]+. 3-(N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)sulfamoyl)pyridin-1-ium trifluoroacetate (59) and the stirring continued for additional 30 minutes at ambient temperature. The reaction mixture was again cooled down with an ice bath and pyridine-3-sulfonyl chloride hydrochloride (0.250 g, 1.17 mmol) was added. The solution was further stirred overnight at ambient temperature. The reaction was quenched with water and extracted with DCM. The solvent was evaporated and the solid residue was purified by reverse- phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.090 g of the title compound in 35% yield.1H NMR (401 MHz, DMSO-d6) δ: 9.00 (dd, J = 2.3, 0.8 Hz, 1H), 8.52 (dd, J = 5.0, 1.6 Hz, 1H), 8.03 (ddd, J = 8.1, 2.3, 1.6 Hz, 1H), 7.84 – 7.78 (m, 2H), 7.19 (ddd, J = 8.1, 5.0, 0.8 Hz, 1H), 6.92 (dd, J = 8.5, 2.0 Hz, 2H), 6.89 – 6.82 (m, 4H), 5.37 (d, J = 7.3 Hz, 1H), 4.05 – 3.97 (m, 1H), 3.94 (s, 6H), 3.88 (s, 6H), 3.10 – 2.95 (m, 4H). HRMS (ESI+): m / z calculated for C29H30O7N2NaS = 573.1666; found = 573.1664 [M+Na]+. 2-(4-(N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)sulfamoyl)phenoxy)acetamide (60) 30 minutes at ambient temperature. The reaction mixture was again cooled down with an ice bath and 4- (2-amino-2-oxoethoxy)benzenesulfonyl chloride (0.294 g, 1.18 mmol) was added. Solution was further stirred overnight at ambient temperature. The solvent was evaporated and the solid residue was purified by a reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.126 g of the title compound in 52% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.89 (d, J = 5.8 Hz, 1H), 7.71 – 7.63 (m, 2H), 7.62 – 7.57 (m, 2H), 7.54 (s, 1H), 7.42 (s, 1H), 7.07 – 6.93 (m, 8H), 4.43 (s, 2H), 3.82 (s, 6H), 3.78 (s, 6H), 3.34 – 3.23 (m, 1H), 3.02 (dd, J = 16.3, 3.9 Hz, 2H), 2.88 – 2.77 (m, 2H). HRMS (ESI+): m / z calculated for C32H34O9N2NaS = 645.1877; found = 645.1876 [M+Na]+. 3-((3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)-isopropylsulfamid (61) temperature. The reaction mixture was again cooled down with an ice bath and isopropylsulfamoyl chloride (0.250 g, 1.59 mmol) was added. The solution was further stirred over night at ambient temperature. The solvent was evaporated and the solid residue was purified by a reverse-phase flash chromatography (eluent H2O (01% TFA):ACN, gradient elution). The reaction provided 0.154 g of the title compound in 74% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.90 – 7.84 (m, 2H), 7.11 – 7.04 (m, 2H), 6.99 (d, J = 2.0 Hz, 2H), 6.89 (d, J = 8.4 Hz, 2H), 4.46 (bs, 2H), 3.91 (s, 6H), 3.90 (s, 6H), 3.88 – 3.77 (m, 1H), 3.38 (hept, J = 6.5 Hz, 1H), 3.32 – 3.23 (m, 2H), 3.13 – 3.03 (m, 2H), 1.03 (d, J = 6.5 Hz, 6H). HRMS (ESI+): m / z calculated for C27H34O7N2NaS = 553.1979; found = 553.1976 [M+Na]+. N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)-6-hydroxy-4-methylpyridine-3-sulfonamide (62) temperature. The reaction mixture was again cooled down with an ice bath and 6-hydroxy-4- methylpyridine-3-sulfonyl chloride (0.250 g, 1.59 mmol) was added. The solution was further stirred overnight at ambient temperature. The solvent was evaporated and the solid residue was purified by reverse- phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.036 g of the title compound in 16% yield.1H NMR (401 MHz, DMSO-d6) δ: 8.02 (d, J = 6.5 Hz, 1H), 7.66 (s, 1H), 7.63 – 7.58 (m, 2H), 7.10 – 7.06 (m, 2H), 7.04 – 6.97 (m, 4H), 6.18 (d, J = 1.3 Hz, 1H), 4.63 (bs, 1H), 3.83 (s, 6H), 3.80 (s, 6H), 3.51 – 3.42 (m, 1H), 3.09 (dd, J = 16.3, 4.0 Hz, 2H), 2.94 – 2.83 (m, 2H), 2.32 (d, J = 1.1 Hz, 3H). HRMS (ESI+): m / z calculated for C30H32O8N2NaS = 603.1772; found = 603.1770 [M+Na]+. 4-(2-(N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)sulfamoyl)ethyl)morpholin-4-ium trifluoroacetate (63) co-evaporated with toluene. The residue was suspended in DCM (3 mL) and 4-amino-2,6-bis((E)-3,4- dimethoxybenzylidene)cyclohexan-1-one (free base) (0.100 g, 0.24 mmol) and DIPEA (0.17 mL, 0.98 mmol) were added. The reaction mixture was stirred at ambient temperature overnight. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.060 g of the title compound in 35% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.83 (s, 2H), 7.08 (dd, J = 8.5, 2.0 Hz, 2H), 6.98 (d, J = 2.0 Hz, 2H), 6.90 (d, J = 8.4 Hz, 2H), 3.98 – 3.94 (m, 1H), 3.91 (s, 6H), 3.88 (s, 6H), 3.86 – 3.82 (m, 4H), 3.48 – 3.40 (m, 2H), 3.29 – 3.20 (m, 2H), 3.24 – 3.17 (m, 4H), 2.95 (bs, 4H). HRMS (ESI+): m / z calculated for C30H39O8N2S = 587.2422; found = 587.2420 [M+H]+. 3-(N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)sulfamoyl)propan-1-aminium trifluoroacetate (64) for further 10 minutes. Ambertile was filtered off and filtrate was diluted with water. The water phase was extracted with EtOAc (3x). Organic phases were combined and extracted with water (1x). Water phases from all extractions were combined and lyophilized. The reaction provided sodium 3- (fmoc-amino)propane-1-sulfonate in good yield.1H NMR (401 MHz, DMSO-d6) δ: 7.88 (d, J = 7.5 Hz, 2H), 7.69 (d, J = 7.4 Hz, 2H), 7.41 (td, J = 7.4, 1.2 Hz, 2H), 7.38 – 7.36 (m, 1H), 7.33 (td, J = 7.5, 1.2 Hz, 2H), 4.29 – 4.23 (m, 2H), 4.23 – 4.16 (m, 1H), 3.04 (q, J = 6.5 Hz, 2H), 2.49 – 2.41 (m, 2H), 1.78 – 1.66 (m, 2H). A solution of sodium 3-(fmoc-amino)propane-1-sulfonate (0.345 g, 0.90 mmol) and DMF (0.007 mL, 0.09 mmol) in SOCl2 (2 mL) was sealed in a tube and stirred at 80 °C for 1.5 hour; conversion was controlled by TLC. During the reaction, it was necessary to divert the resulting gas through the septum. The reaction mixture was cooled down and transferred to a round-bottom flask so it could be three-times co-evaporated with toluene. The residue was suspended in DCM (4.5 mL) and 4-amino-2,6-bis((E)-3,4- dimethoxybenzylidene)cyclohexan-1-one (free base) (0.123 g, 0.30 mmol) and DIPEA (0.16 mL, 0.90 mmol) were added. The reaction mixture was stirred at ambient temperature overnight. The solvent was evaporated and the solid residue was purified by a reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The obtained solid was dissolved in DCM (0.5 mL) and piperidine (0.09 mL, 0.91 mmol) was added. The reaction mixture was stirred for 1.5 hour at ambient temperature. The solvent was evaporated under reduced pressure and the residue was purified by a reverse- phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.040 g of the title compound in 21% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.73 (bs, 3H), 7.70 – 7.64 (m, 2H), 7.60 (d, J = 5.3 Hz, 1H), 7.19 – 7.09 (m, 4H), 7.09 – 7.02 (m, 2H), 3.82 (s, 6H), 3.81 (s, 6H), 3.62 – 3.51 (m, 1H), 3.33 – 3.24 (m, 2H), 3.16 – 3.08 (m, 2H), 3.01 – 2.86 (m, 2H), 2.89 – 2.79 (m, 2H), 1.87 (p, J = 7.6 Hz, 2H). HRMS (ESI+): m / z calculated for C27H35O7N2S = 531.2160; found = 531.2158 [M+H]+. 2-(N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)sulfamoyl)ethan-1-aminium trifluoroacetate (65) for further 10 minutes. Ambertile was filtered off and filtrate was diluted with water. The water phase was extracted with EtOAc (3x). Organic phases were combined and extracted with water (1x). Water phases from all extractions were combined and lyophilized. The reaction provided sodium 2-(fmoc-amino)ethane- 1-sulfonate in good yield.1H NMR (401 MHz, DMSO-d6) δ: 7.89 (dd, J = 7.5 Hz, 1.1 Hz 2H), 7.66 (dd, J = 7.5, 1.1 Hz, 2H), 7.41 (td, J = 7.5, 1.2 Hz, 2H), 7.33 (td, J = 7.5, 1.2 Hz, 2H), 7.12 (t, J = 5.6 Hz, 1H), 4.34 – 4.26 (m, 2H), 4.24 – 4.18 (m, 1H), 3.31 – 3.21 (m, 2H), 2.64 – 2.54 (m, 2H). A solution of sodium 2-(fmoc-amino)ethane-1-sulfonate (0.333 g, 0.90 mmol) and DMF (0.007 mL, 0.09 mmol) in SOCl2 (2 mL) was sealed in a tube and stirred at 80 °C for 1.5 hour, conversion was controlled by TLC. During the reaction, it was necessary to divert the resulting gas through the septum. The reaction mixture was cooled down and transferred to a round-bottom flask so it could be three-times co-evaporated with toluene. The residue was suspended in DCM (3.5 mL) and 4-amino-2,6-bis((E)-3,4- dimethoxybenzylidene)cyclohexan-1-one (free base) (0.123 g, 0.30 mmol) and DIPEA (0.16 mL, 0.90 mmol) were added. The reaction mixture was stirred at ambient temperature overnight. The solvent was evaporated and the solid residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The obtained solid was dissolved in DCM (1 mL) and piperidine (0.16 mL, 1.62 mmol) was added. The reaction mixture was stirred 30 minutes at ambient temperature. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.101 g of the title compound in 53% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.88 – 7.81 (m, 4H), 7.71 – 7.65 (m, 2H), 7.19 – 7.11 (m, 4H), 7.09 – 7.03 (m, 2H), 3.82 (s, 6H), 3.81 (s, 6H), 3.64 – 3.53 (m, 1H), 3.34 (t, J = 7.2 Hz, 2H), 3.34 – 3.24 (m, 2H), 3.14 – 3.04 (m, 2H), 3.04 – 2.92 (m, 2H). HRMS (ESI+): m / z calculated for C26H33O7N2S = 517.2003; found = 517.2000 [M+H]+. 2-(N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)sulfamoyl)benzenaminium trifluoroacetate (66) for further 10 minutes. Amberlite was filtered off and filtrate was lyophilized. The obtained solid was purified by a flash chromatography (eluent DCM:MeOH, 9:1). The reaction provided 0.529 g of sodium 2- (fmoc-amino)benzenesulfonate in 84% yield.1H NMR (401 MHz, DMSO-d6) δ: 10.03 (s, 1H), 7.95 (bs, 1H), 7.92 (dd, J = 7.7, 1.0 Hz, 2H), 7.69 (dd, J = 7.4, 1.0 Hz, 2H), 7.66 (dd, J = 7.8, 1.6 Hz, 1H), 7.43 (td, J = 7.5, 1.2 Hz, 2H), 7.35 (td, J = 7.4, 1.2 Hz, 2H), 7.30 (t, J = 7.8 Hz, 1H), 7.00 (td, J = 7.5, 1.2 Hz, 1H), 4.43 (d, J = 7.1 Hz, 2H), 4.34 (t, J = 7.0 Hz, 1H). A solution of sodium 2-(fmoc-amino)benzenesulfonate (0.376 g, 0.90 mmol) and DMF (0.007 mL, 0.09 mmol) in SOCl2 (2 mL) was sealed in a tube and stirred at 80 °C for 1.5 hour; conversion was controlled by TLC. During the reaction, it was necessary to divert the resulting gas through the septum. The reaction mixture was cooled down and transferred to a round-bottom flask so it could be three-times co-evaporated with toluene. The residue was suspended in DCM (3.5 mL) and 4-amino-2,6-bis((E)-3,4- dimethoxybenzylidene)cyclohexan-1-one (free base) (0.123 g, 0.30 mmol) and DIPEA (0.16 mL, 0.90 mmol) were added. The reaction mixture was stirred at ambient temperature overnight. The solvent was evaporated and the solid residue was purified by a reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The obtained solid was dissolved in DCM (0.5 mL) and piperidine (0.09 mL, 0.91 mmol) was added. The reaction mixture was stirred for 1 hour at ambient temperature. The solvent was evaporated under reduced pressure and the residue was purified by a reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.029 g of the title compound in 14% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.92 (d, J = 6.5 Hz, 1H), 7.62 – 7.56 (m, 2H), 7.40 (dd, J = 8.1, 1.6 Hz, 1H), 7.10 (ddd, J = 8.5, 7.1, 1.6 Hz, 1H), 7.07 – 7.04 (m, 2H), 7.03 – 6.96 (m, 4H), 6.68 (dd, J = 8.3, 1.1 Hz, 1H), 6.45 (ddd, J = 8.1, 7.1, 1.1 Hz, 1H), 3.83 (s, 6H), 3.79 (s, 6H), 3.27 – 3.18 (m, 1H), 3.08 – 2.98 (m, 2H), 2.88 – 2.77 (m, 2H). HRMS (ESI+): m / z calculated for C30H33O7N2S = 565.2003; found = 565.2000 [M+H]+. 3-(N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)sulfamoyl)benzenaminium trifluoroacetate (67) for further 10 minutes. Amberlite was filtered off and filtrate was lyophilized. The obtained solid was purified by flash chromatography (eluent DCM:MeOH, 9:1). The reaction provided sodium 3-(fmoc- amino)benzenesulfonate in good yield.1H NMR (401 MHz, DMSO-d6) δ: 9.78 (s, 1H), 7.91 (dt, J = 7.5, 1.1 Hz, 2H), 7.80 – 7.73 (m, 3H), 7.45 (bs, 1H), 7.47 – 7.40 (m, 3H), 7.35 (td, J = 7.4, 1.2 Hz, 2H), 7.28 – 7.17 (m, 2H), 4.45 (d, J = 6.9 Hz, 2H), 4.31 (t, J = 6.9 Hz, 1H). A solution of sodium 3-(fmoc-amino)benzenesulfonate (0.502 g, 1.2 mmol) and DMF (0.009 mL, 0.12 mmol) in SOCl2 (2 mL) was sealed in a tube and stirred at 80 °C for 2 hours; conversion was controlled by TLC. During the reaction, it was necessary to divert the resulting gas through the septum. The reaction mixture was cooled down and transferred to a round-bottom flask so it could be three-times co-evaporated with toluene. The residue was suspended in DCM (3.5 mL) and 4-amino-2,6-bis((E)-3,4- dimethoxybenzylidene)cyclohexan-1-one (free base) (0.123 g, 0.30 mmol) and DIPEA (0.21 mL, 1.20 mmol) were added. The reaction mixture was stirred at ambient temperature overnight. The solvent was evaporated and the solid residue was purified by a reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The obtained solid was dissolved in DCM (1 mL) and piperidine (0.18 mL, 1.82 mmol) was added. The reaction mixture was stirred for 1 hour at ambient temperature. The solvent was evaporated under reduced pressure and the residue was purified by reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.103 g of the title compound in 50% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.90 (d, J = 5.7 Hz, 1H), 7.63 – 7.57 (m, 2H), 7.12 (t, J = 7.9 Hz, 1H), 7.10 – 7.05 (m, 2H), 7.06 – 7.04 (m, 1H), 7.04 – 6.98 (m, 4H), 6.99 – 6.91 (m, 1H), 6.79 – 6.72 (m, 1H), 3.83 (s, 6H), 3.79 (s, 6H), 3.32 – 3.21 (m, 1H), 3.12 – 3.02 (m, 2H), 2.89 – 2.77 (m, 2H). HRMS (ESI+): m / z calculated for C30H32O7N2NaS = 587.1822; found = 587.1821 [M+Na]+. 4-(N-(3,5-Bis((E)-3,4-dimethoxybenzylidene)-4-oxocyclohexyl)sulfamoyl)benzene-1,2-diaminium bis(trifluoroacetate) (68) 9:1). The reaction provided 0.780 g of sodium 3,4-bis(fmoc-amino)benzenesulfonate in 75% yield.1H NMR (401 MHz, DMSO-d6) δ: 9.02 (s, 1H), 8.96 (s, 1H), 7.93 – 7.86 (m, 4H), 7.76 (d, J = 1.8 Hz, 1H), 7.75 – 7.68 (m, 4H), 7.46 – 7.37 (m, 5H), 7.37 – 7.27 (m, 5H), 4.48 – 4.40 (m, 4H), 4.30 (t, J = 6.8 Hz, 2H). A solution of sodium 3,4-bis(fmoc-amino)benzenesulfonate (0.750 g, 1.15 mmol) and DMF (0.009 mL, 0.12 mmol) in SOCl2 (2.2 mL) was sealed in a tube and stirred at 80 °C for 2 hours; conversion was controlled by TLC. During the reaction, it was necessary to divert the resulting gas through the septum. The reaction mixture was cooled down and transferred to a round-bottom flask so it could be three-times co-evaporated with toluene. The residue was suspended in DCM (5.5 mL) and 4-amino-2,6-bis((E)-3,4- dimethoxybenzylidene)cyclohexan-1-one (free base) (0.123 g, 0.30 mmol) and DIPEA (0.21 mL, 1.20 mmol) were added. The reaction mixture was stirred at ambient temperature overnight. The solvent was evaporated and the solid residue was purified by a reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The obtained solid was dissolved in DCM (1 mL) and piperidine (0.18 mL, 1.82 mmol) was added. The reaction mixture was stirred for 1 hour at ambient temperature. The solvent was evaporated under reduced pressure and the residue was purified by a reverse-phase flash chromatography (eluent H2O (0.1% TFA):ACN, gradient elution). The reaction provided 0.060 g of the title compound in 24% yield.1H NMR (401 MHz, DMSO-d6) δ: 7.64 (d, J = 5.2 Hz, 1H), 7.61 – 7.57 (m, 2H), 7.15 (d, J = 2.1 Hz, 1H), 7.12 – 7.09 (m, 2H), 7.08 – 6.98 (m, 5H), 6.64 (d, J = 8.3 Hz, 1H), 3.83 (s, 6H), 3.80 (s, 6H), 3.25 – 3.14 (m, 1H), 3.14 – 3.05 (m, 2H), 2.88 – 2.76 (m, 2H). HRMS (ESI+): m / z calculated for C30H33O7N3NaS = 602.1931; found = 602.1930 [M+Na]+. Example 2: Efficacy of compounds of general formula I in activation of NRF1 (NFE2L1) transcriptional pathway monitored by cell-based reporter assay A stable cell line derived from HEK293 cells, containing a 3xPSMA4-ARE / minP / luc2P / reporter derived from an ARE (antioxidant response element) response element from the promoter of the human PSMA4 gene that allows monitoring of NRF1 pathway activation, was cultured in DMEM (Dulbecco’s Modified Eagle Medium) containing 10% FBS, 2 mmol.l-1L-glutamine, and 50 μg / mL penicillin, and 50 μg / mL streptomycin. Cells were cultured in a CO2incubator at 37 °C in an atmosphere containing 5% CO2. This reporter line was transfected with the normalisation Renilla reporter pRL-TK (catalogue number E2241; Promega, Hercules, CA) at approximately 70% confluence. For the transfection itself, polyethylenimine (PEI) was used at a PEI / DNA ratio of 3:1 dissolved in OptiMEM medium. Cells were subsequently seeded in 384-well plates at a concentration of 10x103in a volume of 25 μL / well and treated with the test compounds dissolved in dimethyl sulfoxide (DMSO) at a concentration of 5 µmol.l-116 hours after equilibration. The experiment was repeated in technical quadruplicates and biological triplicate. After a 16- h incubation, the medium was removed and cells were lysed in 5 μL of 1X lysis buffer (25 mmol.l-1, Tris- phosphate pH 7.8; 2 mmol.l-1dithiothreitol (DTT); 2 mmol.l-12,2′,2′′,2′′′-(ethane-1,2- diyldinitrile)tetraacetic acid; 10% (henceforth, percent by volume is always given) glycerol and 1% Triton X-100). After a 10-minute incubation on a shaker, the substrate for Firefly / photinus luciferase (200 mM Tris-HCl; 15 mmol.l-1MgSO4; 0.1 mmol.l-1EDTA; 25 mmol.l-1DTT; 1 mmol.l-1ATP; 0.2 mmol.l-1coenzyme A; and 200 mmol.l-1D-luciferin, pH 8.0) was added at a volume of 20 μL per well and luminescence was measured. Firefly luciferase activity was measured, followed by the addition of buffer (25 mmol.l-1Na4P2O7; 10 mmol.l-1AcONa; 15 mmol.l-1EDTA; 500 mmol.l-1Na2SO4; 500 mmol. l-1NaCl; 25 μmol.l-1phenyl-benzothiazole; 4 μmol.l-1coelenterazine and 0.04% BSA, pH 5.0) in the same volume and, after shaking, Renilla luciferase activity was measured. The measurement results (Table 1) are the ratio of Renilla luciferase to Firefly luciferase activity and represent the mean values from three biological replicates with technical quadruplicates with standard deviations. The activation of the pathway controlled by the transcription factor NRF1 for the tested compounds ranged from 3.93 to 19.39, i.e. the maximum increase compared to the control was more than 19-fold, which was exhibited by compound 11 with statistical significance relative to DMSO-treated cells. Part B of Table 1 shows the results for the compounds of general formula I in direct comparison with the compound ASC- JM17. Table 1: Efficacy of NRF1 (NFE2L1) transcriptional pathway activation monitored by cell-based reporter assay. When compared with the results of DMSO controls, statistics were evaluated by one-sample Student’s t-test. In the case of comparison with ASC-JM17 results, a two-sample Student's t-test was used. Statistical calculations were performed using GraphPad Prism 9 software. The p-values are relative to DMSO-treated cells. Values p < 0.05 = ‘d’, < 0.01 = ‘c’, < 0.001 = ‘b’. The experiment was performed in biological triplicate. Emax; 5 μmol.l-1COMPOUND x̄ s p(DMSO)A) DMSO 1 ± 0 - 1 4.63 ± 2.53 5 3.93 ± 2.00 6 11.71 ± 1.23 c 10 11.91 ± 5.81 11 19.39 ± 1.38 c Emax; 5 μmol.l-1COMPOUND x̄ s p(DMSO) p(ASC-JM17)ASC-JM17 8.36 ± 3.37 - 1 8.60 ± 2.54 d 22 8.82 ± 2.74 d 23 10.61 ± 3.86 d 24 10.90 ± 4.26 25 11.77 ± 6.4726 9.96 ± 8.5627 14.96 ± 8.4928 15.29 ± 7.31 29 10.44 ± 5.9844 10.03 ± 5.70 B) 46 13.45 ± 6.9345 11.03 ± 8.10 31 8.66 ± 6.0432 10.44 ± 7.48 33 11.31 ± 6.7634 7.55 ± 3.6635 11.89 ± 4.68 c 36 8.82 ± 3.2037 9.06 ± 5.3338 5.55 ± 2.7539 7.44 ± 4.0240 15.09 ± 7.8541 10.96 ± 4.49 c Example 3: Validation of the target activity of compounds of general formula I A parental HCT116 cell line and an HCT116 cell line (two clones, KO 04 and KO 11) with a deletion of the gene encoding the DDI2 protease were transiently transfected with the 3xPSMA4-ARE-LUC reporter plasmid shown in Example 2, normalised to the pRL-TK co-reporter (25:1 ratio), and stabilised overnight. Cells were then treated with bortezomib (BTZ) at a concentration of 0.75 μmol.l-1and compound 1 at a concentration of 10 μmol.l-1for 16 hours. After a 16-h incubation, the medium was removed and cells were lysed in 5 μL of 1X lysis buffer (25 mmol.l-1, Tris-phosphate pH 7.8; 2 mmol.l-1dithiothreitol (DTT); 2 mmol.l-12,2′,2′′,2′′′-(ethane-1,2-diyldinitrile)tetraacetic acid; 10% (henceforth, percent by volume is always given) glycerol and 1% Triton X-100). After a 10-minute incubation on a shaker plate, the substrate for Firefly / photinus luciferase (200 mM Tris-HCl; 15 mmol.l-1MgSO4; 0.1 mmol.l-1EDTA; 25 mmol.l-1DTT; 1 mmol.l-1ATP; 0.2 mmol.l-1coenzyme A; and 200 mmol.l-1D-luciferin, pH 8.0) was added at a volume of 20 μL per well and luminescence was measured. The measurement of firefly luciferase activity was followed by the addition of buffer (25 mmol.l-1Na4P2O7; 10 mmol.l-1AcONa; 15 mmol.l-1EDTA; 500 mmol.l-1Na2SO4; 500 mmol. l-1NaCl; 25 μmol.l-1phenyl-benzothiazole; 4 μmol.l-1coelenterazine and 0.04% BSA, pH 5.0) in the same volume and, after shaking, Renilla luciferase activity was measured. The measurement results (Table 2) are the ratio of Renilla luciferase activity to firefly luciferase activity and represent the mean values from three biological replicates with technical quadruplicates with standard deviations. As can be seen from the results shown in Table 2, compound 1 at a given concentration shows almost no activity in the cell line with a non-functional pathway controlled by the NRF1 transcription factor, compared to the activity observed in the parental line (WT). In contrast, the control compound bortezomib (BTZ) slightly activates already at a concentration two orders of magnitude lower than compound 1. Based on this experiment, it can be concluded that our test compounds are novel activators of the NRF1 pathway. Table 2: Activity of the test compounds in the HCT116 parental line with a fully functional NRF1 transcription factor, in direct comparison with a non-functional NRF1 pathway after deletion of a key member of the pathway - protease DDI2, when compound 1 does not show activity. Experiments were performed in biological triplicate. CELLS COMPOUND x̄ s DMSO 1.00 ± 0.00 WT BTZ 73.27 ± 31.68 1 56.37 ± 29.31 DMSO 1.00 ± 0.00 KO 04 (DDI2- / -) BTZ 13.33 ± 9.99 1 5.26 ± 0.72 DMSO 1.00 ± 0.00 KO 11 (DDI2- / -) BTZ 9.24 ± 6.95 1 4.58 ± 0.80 Example 4: Influencing protein homeostasis (proteostasis) of the cell by compounds of general formula I U2OS cells stably expressing the Ub(G76V)-GFP reporter were cultured in DMEM medium containing 10% FBS, 2 mmol.l-1L-glutamine, 50 μg / mL penicillin, and 50 μg / mL streptomycin in a CO2incubator at 37 °C in an atmosphere containing 5% CO2. Cells were first seeded at 10x103cells / well in a 384-well plate in DMEM culture medium without the addition of phenol red. On the second day, compounds were added at a concentration of 5 µmol.l-1. The experiment was carried out in three measurements. After 8 hours, the GFP signal was measured (excitation λ = 400 nm, emission λ = 510 nm), followed by measurement of the cytotoxic effect of the compounds using the Resazurin / Almar blue assay according to the manufacturer’s protocol (ThermoFisher Scientific, catalogue number DAL1025). The GFP intensity was normalised to cell viability according to the formula: (GFP intensity of thecompound) / (basal GFP intensity). The basal GFP intensity corresponds to cells that were treated with DMSO. The results are shown in Table 3. The fluorescence in cells treated with the test compounds does not increase compared to the fluorescence in DMSO-treated cells, thus the degradation of endogenous proteins is not inhibited. Thus, it can be concluded that the new activators of the NRF1 pathway are not simultaneously inhibitors of the ubiquitin-proteasomal system, which is a desirable result. Table 3: Analysis of the effect of selected compounds on protein homeostasis (proteostasis) of a cell monitored by a GFP degron-based cell-based reporter assay. The experiment was performed in biological triplicate. GFP fluorescence normalised to cytotoxicity; 5 μmol.l-1COMPOUND x̄ s DMSO 1.00 ± 0.00 1 1.13 ± 0.05 2 1.28 ± 0.10 3 1.21 ± 0.13 5 0.97 ± 0.07 6 1.12 ± 0.03 7 1.02 ± 0.07 10 1.23 ± 0.18 11 1.17 ± 0.17 Example 5: Effect of compounds of general formula I on cell viability The human cell line HEK293 was cultured in a CO2incubator at 37 °C in an atmosphere containing 5% CO2. Measurement of the cytotoxic effect of the test compounds was performed using the Resazurin / Almar blue assay according to the manufacturer’s protocol (ThermoFisher Scientific, catalogue number DAL1025). None of the tested compounds showed significant cytotoxicity at a given concentration as shown in Table 4. Table 4: Cytotoxicity of the compounds of general formula I expressed as viability (%) of the HEK293 cell line after addition of the compounds at a concentration of 5 µmol.l-1for 16 hours. Statistics were evaluated by one-sample Student’s t-test in GraphPad Prism 9. The experiment was performed in biological triplicate. VIABILITY [%]; 5 μmol.l-1COMPOUND x̄ S p(DMSO) p(ASC-JM17)DMSO 100 ± 0 - - ASC-JM17 77 ± 15 - 1 78 ± 14 2 84 ± 13 396 ± 95 86 ± 12 6 81 ± 15 7 87 ± 13 10 75 ± 25 11 78 ± 21 21 95 ± 4 22 79 ± 13 23 79 ± 11 24 79 ± 14 25 76 ± 14 26 75 ± 18 27 71 ± 19 28 76 ± 14 29 66 ± 17 30 97 ± 3 44 59 ± 25 46 64 ± 24 45 70 ± 23 31 65 ± 22 32 70 ± 20 33 65 ± 24 34 70 ± 22 35 69 ± 21 36 70 ± 23 37 81 ± 14 38 85 ± 13 39 72 ± 26 40 74 ± 254174 ± 21 4283 ± 17 4375 ± 15 Example 6: Effect of compounds of general formula I on the expression of genes controlled by transcription factor NRF1 (NFE2L1) The human neuroblastoma cell line SH-SY5Y was cultured in DMEM medium containing 10% FBS and 2 mmol.l-1L-glutamine in a CO2 incubator at 37 °C and in an atmosphere containing 5% CO2. Compound 1 was added to 4x105cells in two technical and three biological repeats each time. After 16 hours, the cells were lysed and mRNA isolation was performed using the NucleoSpin RNA kit (Macherey-Nagel, catalogue number 740955.250) according to the manufacturer’s protocol. mRNA was then transcribed into cDNA using the TATTA GrandScript cDNA Supermix kit (TATAAbiocenter) according to the manufacturer’s recommendations. Quantitative RT-PCR (RT-qPCR) was performed using LightCycler 480 (Roche Life Science). The primers for each gene used in the RT-qPCR reaction are shown in Table 5. The mRNA encoding GAPDH was used for data normalisation. The results of the analysis are shown in Table 6. After treatment of the human neuroblastoma cell line SH- SY5Y with compound 1, the mRNA levels of all monitored genes encoding proteasome subunits (PSMB7, PSMD12 or PSMC4) were increased compared to the control (DMSO). A significant increase in mRNA levels after treatment of cells with compound 1 compared to the control was observed in the case of monitoring the levels of mRNA encoding heat shock protein (HSP1A1) and ubiquinone (NQO1). Table 5: Sequence of primers for RT-qPCR. Gene name Primer Sequence (5´- 3´) F TGCAAAGAGGGGATACAAGC (SEQ ID NO.1) PMSB7 R GCAACAACCATCCCTTCAGT (SEQ ID NO.2) F GGAAGACCATGTTGGCAAAG (SEQ ID NO.3) PMSC4 R AAGATGATGGCAGGTGCATT (SEQ ID NO.4) F GTGCGCGACTGACTAAAACA (SEQ ID NO.5) PSMD12 R TAGGCAGAGCCTCATTTGCT (SEQ ID NO.6) F GCTGCGACAGTCCACTACCT (SEQ ID NO.7) HSPA1A R TGCCGGTTCCCTGCTCTCTG (SEQ ID NO.8) F TCGACGAGGAGAAGACCTTT (SEQ ID NO.9) DNAJA1 R TCTGACCTGGATGAGAGGTG (SEQ ID NO.10) F CTGCCATCATGCCTGACTAA (SEQ ID NO.11) NQO1 R TGCAGATGTACGGTGTGGAT (SEQ ID NO.12) GAPDH F AATCCCATCACCATCTTCCA (SEQ ID NO.13) R TGGACTCCACGACGTACTCA (SEQ ID NO.14) Table 6: The effect of compound 1 on the expression of genes controlled by the transcription factor NRF1 (NFE2L1), monitored by quantitative RT-PCR. The efficiency of activation of the monitored genes is expressed as the rate of expression of a given mRNA in cells treated with the test compound compared to the expression of this mRNA in cells treated with dimethyl sulfoxide (DMSO) as a negative control. Statistics were evaluated by one-tailed unpaired t-test with Welch's adjustment in GraphPad Prism 9. The p-values indicate an increase in the level of a given mRNA and are relative to DMSO-treated cells; p-values < 0.0001 are indicated by the letter ‘a’, p < 0.01 = ‘c’, p < 0.05 = ‘d’. Experiments were performed in biological hexaplicate. PSMB7 PSMC4 COMPOUNDx̄ s p(DMSO) x̄ s p(DMSO)DMSO 1.05 ± 0.06 - 1.05 ± 0.06 - 1 1.30 ± 0.55 1.76 ± 0.34 c PSMD12 DNAJA1 COMPOUNDx̄ s p(DMSO) x̄ s p(DMSO)DMSO 1.05 ± 0.06 - 0.93 ± 0.07 - 1 2.40 ± 1.01 d 1.20 ± 0.44 HSPA1A NQO1 COMPOUNDx̄ s p(DMSO) x̄ s p(DMSO)DMSO 0.93 ± 0.07 - 0.99 ± 0.01 - 1 35.63 ± 6.94 a 15.75 ± 7.76 c Example 7: Effect of compounds of general formula I on the expression of proteins controlled by transcription factor NRF1 (NFE2L1) Subsequently, the expression level of HA-tagged protein of NRF1 (HA-NRF1) in HEK-293 cells overproducing the tagged protein HA-NRF1, and the expression level of proteins HSPA1A, NQO1 and PSMB7 in SH-SY5Y cells overproducing α-synuclein were monitored by western blot method. Cells were treated with dimethyl sulfoxide (DMSO) as a negative control or with compound 1 at 5 μmol.l-1concentration for 16 hours. After treatment of cells with compound 1, the levels of all proteins studied were increased compared with the control (Table 7). Table 7: Effect of compound 1 on the expression of proteins controlled by the transcription factor NRF1 (NFE2L1), monitored by western blotting. The expression level of the proteins monitored was calculated from the integrated fluorescence of the respective bands and normalised to β-actin. Statistics were performed using a one-sample Student’s t-test in GraphPad Prism 9 software, with p-values relative to DMSO-treated cells. The p-values < 0.05 = ‘d’. Experiments were performed in biological quadruplicate (HA-NRF1 in hexaplicate). HEK-293 HA-NRF1 SH-SY5Y HSPA1A COMPOUND x̄ s p(DMSO) x̄ s p(DMSO)DMSO 1.00 ± 0.00 1 ± 0.00 1 2.51 ± 2.02 4.24 ± 1.15 d SH-SY5Y NQO1 SH-SY5Y PSMB7 COMPOUND x̄ s p(DMSO) x̄ s p(DMSO)DMSO 1.00 ± 0.00 1.00 ± 0.00 1 6.94 ± 3.53 d 1.40 ± 0.64 Example 8: Effect of compounds of general formula I on proteasome activity in the cell The proteolytic activity of the 20S proteasome was measured using a fluorogenic substrate (Suc-LLVY- AMC, Bachem I-1395). Human HEK293 cell lines were incubated with the test compounds for 16 hours at a concentration of 7.5 µmol.l-1. Cells were lysed in lysis buffer (50 mmol.l-1HEPES, pH 7.5; 5 mmol.l-1EDTA; 150 mmol.l-1NaCl; 2 mmol.l-1ATP; 1% Triton) and lysates were incubated each time in technical triplicate in the dark for 30 minutes at 37 °C in 100 μL of buffer (50 mmol.l-1Tris, pH 8.0; 10 mmol.l-1MgCl2; 1mmol.l-1ATP; 1 mmol.l-1DTT) with 200 μmol.l-1Suc-LLVY-AMC fluorogenic substrate for measurement of chymotrypsin activity. The fluorescence of the formed AMC was measured with a fluorimeter at excitation wavelength λ = 360 nm and emission wavelength λ = 460 nm. The proteasome activities were relative to the control group affected only by DMSO. The results are shown in Table 8. It is evident that all the tested compounds increased the chymotrypsin activity of the proteasome comparable to the comparative compound ASC-JM17 or significantly better. Table 8: Relative chymotrypsin activity of the proteasome in HEK 293 cell lines after treatment with the test compounds at a concentration of 7.5 μmol.l-1for 16 hours. Experiments were performed in biological tetra- or pentaplicate. Also shown is the relative chymotrypsin proteasome activity in SH-SY5Y and MCF7 cell lines after treatment with the test compounds at concentrations of 2.5 μmol.l-1and 5 μmol.l-1for 16 hours. Statistics were evaluated by one-sample Student’s t test in GraphPad Prism 9 software. The p-values are relative to DMSO-treated cells. The p-values < 0.05 = ‘d’, < 0.01 = ‘c’, < 0.001 = ‘b’, < 0.0001 are indicated by ‘a’. Experiments were performed in technical triplicate. HEK-293; 7.5 μmol.l-1COMPOUND n Min Q0.25 Median Q0.75 Max DMSO 5 - - 1,00 - - ASC-JM17 4 0.88 0.93 1.18 1.40 1.4314 1.29 1.30 1.33 1.61 1.69 2 5 0.99 1.02 1.22 1.76 2.13 6 4 1.04 1.11 1.33 1.40 1.41 105 1.11 1.13 1.21 1.44 1.56 115 0.98 1.06 1.20 1.52 1.74 SH-SY5Y; 2.5 μmol.l-1MCF 7.5 μmol.l-1COMPOUND x̄ s p(DMSO)x̄ s p(DMSO)DMSO 1.00 0.03 - 1.00 0.06 - ASC-JM17 2.265 0.59 - 1.33 0.09 d 1 1.002 0.09 - 1.23 0.19 - 2 1.905 0.31 d 0.93 0.02 d 6 4.017 0.08 b 1.45 0.03 c 112.017 0.24 d 1.35 0.10 d Example 9: Protective effect of compounds of general formula I against proteotoxic stress in SH-SY5Y cells in which aggregation of overproduced α-synuclein was induced by rotenone The protective effect of the test compounds against proteotoxic stress was further investigated in the SH SY5Y-SNCA (synuclein overproducing) cell line compared to the parental SH-SY5Y line. Both cell lines were treated with DMSO, rotenone [1.125 μmol.l-1] (which specifically induces proteotoxic stress), ASC- JM17comparative compound, and compound 1 [in the concentration series of 2.5; 1.25; 0.625 and 0.3125 μmol.l-1]. Measured viability values were relative to the DMSO control and are presented as mean ± standard deviation [%]. All tested compounds showed a protective effect against proteotoxic stress induced by α-synuclein (Table 9).Table 9:Protective effect of compounds of general formulaIagainst proteotoxic stress. SH-SY5Y and SH- SY5Y SNCA cells were treated for 24 hours with DMSO, rotenone [1.125 μmol.l-1], ASC-JM17 comparative compound, or compounds of general formulaI[in the concentration series of 2.5; 1.25; 0.625 and 0.3125 μmol.l-1]. Viability values were relative to the DMSO control and are presented as mean ± standard deviation [%]. Statistics were evaluated by one-factor ANOVA with repeated measures. In the case of comparing the results of the tested compounds to the results of rotenone, a multiple comparison followed using the Dunnett’s test. In the case of comparing the results of the tested compounds with the results of the corresponding concentrations of ASC-JM17, Fisher’s LSD test was used. All calculations were performed in GraphPad Prism 9 software. The p-values < 0.01 = ‘c’, < 0.05 = ‘d’. Experiments were performed in biological triplicate. c SH-SY5Y SNCA SH-SY5Y COMPOUND [µmol. x p(ROTENOl-1]̄ sNE) p(ASC-JM17*) x̄ sRotenone 1.125 69.33 ± 7.64 - - 37.67 ± 3.79 0.312 5 74.67 ± 11.06 - 42.00 ± 3.61 Rotenone [1,125] 0.625 76.00 ± 10.44 - 43.00 ± 2.00 + ASC-JM17 1.25 79.33 ± 10.69 d - 47.00 ± 4.36 2.5 82.67 ± 11.93 c - 62.00 ± 2.65 0.312 5 76.33 ± 8.14 d 43.67 ± 3.06 Rotenone [1,125] 0.625 76.33 ± 9.07 - 44.67 ± 3.79 + 1 1.25 86.33 ± 8.96 d d 55.00 ± 4.00 2.5 90.33 ± 7.37 c d 76.00 ± 4.36 0.312 5 74.67 ± 9.45 39.33 ± 7.02 Rotenone [1,125] 0.625 79.33 ± 8.96 46.00 ± 6.00 + 2 1.25 76.00 ± 10.54 53.33 ± 8.39 2.5 89.67 ± 10.97 d 59.33 ± 8.50 0.312 5 75.67 ± 11.15 d 41.33 ± 4.04 Rotenone [1,125] 0.625 74.67 ± 9.24 40.67 ± 3.79 + 6 1.25 79.33 ± 9.82 d 47.33 ± 4.51 2.5 86.33 ± 10.79 d 72.67 ± 7.51 0.312 5 73.33 ± 11.24 41.00 ± 6.25 Rotenone [1,125] 0.625 75.67 ± 8.50 d 46.33 ± 4.93 + 10 1.25 71.67 ± 9.07 47.67 ± 11.06 2.5 73.00 ± 12.29 c c 66.33 ± 3.21 0.312 5 73.67 ± 10.41 40.67 ± 6.35 Rotenone [1,125] 0.625 76.00 ± 9.64 d 44.00 ± 2.65 + 11 1.25 74.67 ± 8.50 49.67 ± 6.51 2.5 79.67 ± 5.51 c d 73.00 ± 4.58 Example 10: Effect of compounds of general formula I on the formation of reactive oxygen species in the cell Reactive oxygen species (ROS) generation and associated oxidative stress in cells was measured using a 2',7'-dichlorofluorescin diacetate (H2DCFDA) probe (catalogue number D6883-50MG, Sigma-Aldrich) to detect ROS generation inside cells. For plate preparation, 10,000 SH-SY5Y cells were seeded per well in a 96-well plate, the cells were allowed to adhere overnight, and the following day the test compounds were added at two concentrations of 5 and 25 μmol.l-1; rotenone (Merck, catalogue number R8875-1G) and TBHP organic peroxide were used as controls for ROS induction in the cells. After 2 hours, the cells were washed with 1xPBS (137 mmol.l-1NaCl; 2.7 mmol.l-1KCl; 1.5 mmol.l-1KH2PO4; 10 mmol.l-1Na2HPO4) and then 100 μL per well of H2DCFDA probe dissolved in 1xPBS at a final concentration of 100 μmol.l-1was added for 30 minutes. This was followed by washing out the free probe. In the final step, 50 μL 1xPBS was added per well and the fluorescence signal was measured using a Tecan infinite M1000 reader at excitation and emission wavelengths of 480 / 535 nm. Experiments were performed in biological triplicate consisting of a technical quadruplicate for each experiment; data are shown as percentage of DMSO control. The results are listed in Table 10. Compound 1 does not cause the formation of reactive oxygen species at a concentration of 5 µmol.l-1or at a concentration 5 times higher (25 µmol.l-1), which is in sharp contrast to the comparative compound ASC-JM17, which significantly increases the ROS concentration compared to the DMSO control. Table 10: Effect of compound 1 on the formation of reactive oxygen species in the cell measured by DCF- DA assay. SH-SY5Y cells were treated with DMSO as a negative control or ASC-JM17 as a comparative compound. Statistics were evaluated by one-tailed Student’s t-test (against DMSO) and one-tailed unpaired t-test with Welch’s adjustment (ASC-JM17). The p-values indicate a significant change in ROS level and are relative to DMSO or ASC-JM17 treated cells; p-values < 0.05 = ‘d’. Experiments were performed in biological triplicate. 5 μmol.l-125 μmol.l-1COMPOUND x̄ s p(DMSO) p(ASC-JM17) x̄ s p(DMSO) p(ASC-JM17)DMSO 100.00 ± 0.00 - - 100 ± 0.00 - - ASC-JM17 137.90 ± 26.42 - 252.16 ± 68.18 - 1 92.59 ± 2.26 d d 98.27 ± 6.07 d Example 11: Effect of compounds of general formula I on the cell cycle Cell cycle analysis was performed using flow cytometry after treatment of SH-SY5Y cells with compound 1 in comparison with the negative control DMSO and the comparative compound ASC-JM17. The different phases of the cell cycle were determined by staining with propidium iodide (P4170-250MG, Sigma- Aldrich), which as a fluorescent dye intercalates into double-stranded DNA and thus allows semi- quantitative determination of the total DNA content and the distribution of the cell population in the different phases of the cycle: G0 / G1 phase (unreplicated content), S phase (DNA synthesis), G2 / M phase. Cells in 6-well plates at a density of 2.5×105cells / mL were exposed to the test compounds at a concentration of 5 μmol.l-1for 16 hours in a CO2 incubator. Subsequently, cells were collected into cytometry tubes, centrifuged for 5 minutes at 500 g, washed with nonsterile PBS, and fixed in 70% ethanol at 4 °C. The samples thus prepared were stored at -20 °C. Next, 500 μL of propidium iodide solution was added, and after mixing and incubation for 15 min in a water bath at 37 °C in the dark, 200 μL of ribonuclease A solution (0.7 mol.l-1, 060M7000V, Sigma-Aldrich, USA) was added, followed again by 15-min incubation under the same conditions. Samples incubated in this way were kept for at least 1 hour at 4 °C. The analysis was performed on a BD LSR Fortessa flow cytometer using an argon laser (excitation at a wavelength of 488 nm). The results are shown in Table 11. Compound 1 has no effect on cell cycle progression. In contrast, the comparative compound ASC-JM17 leaves a significant proportion of cells in G2 / M phase relative to the control, indicating cell cycle arrest at the G2 checkpoint and significant toxicity of this comparator. Table 11: Cell cycle analysis after treatment of SH-SY5Y cells with compound 1 at a concentration of 5 µmol.l-1for 16 hours. SH-SY5Y cells were treated with DMSO as a negative control or with the comparative compound ASC-JM17. Values are presented as mean ± standard deviation in %. G0 / G1 S G2 / M COMPOUND x̄ s x̄ s x̄ sDMSO 64.3 ± 0.2 22.6 ± 0.3 13.1 ± 0.2 ACS-JM17 43.3 ± 7.1 19.4 ± 0.3 37.4 ± 7.4 1 58.2 ± 0.0 24.1 ± 3.6 17.7 ± 3.6 Example 12: Effect of compounds of general formula I on the expression level of proteins involved in autophagy The efficacy of the new NRF1 pathway activators was monitored by analysing the expression levels of p62 and LC3 proteins involved in autophagy using western blot technique. The human HEK239 cell line was treated with compound 1 analogously to Example 7. As shown below in Table 12, compound 1 at a concentration of 10 μmol.l-1significantly increases the level of endogenous p62. At the same concentration, it significantly decreases the level of LC3-I and increases the level of the LC3-II form, thus indicating the activation of autophagy, a process that significantly participates in the degradation of abnormally folded proteins in the cell. Table 12: Analysis of p62 and LC3 protein expression levels by western blot in HEK-293 cells. Cells were treated with dimethyl sulfoxide (DMSO) as a negative control, or with compound 1 at different concentrations (1; 5 and 10 μmol.l-1) for 16 hours. The expression level of the monitored proteins was calculated from the integrated fluorescence of the respective bands and normalised to β-actin. For each LC3 protein variant (LC3-I and LC3-II), statistics were performed using Welch’s ANOVA followed by multiple comparisons using Dunnett’s T3 test. One-sample Student’s t test was used for p62 protein and total LC3 (I + II). The p-values are relative to DMSO-treated cells. Values p < 0.0001 are indicated by ‘a’, p < 0.001 = ‘b’, p < 0.01 = ’c’, p < 0.05 = ’d‘. Experiments were performed in biological duplicate. c p62 [µmol.l-1]x̄ s p(DMSO)DMSO 1.00 ± 0.00 - 1 1.08±0.18 1 5 1.29 ± 0,37 10 2.03 ± 0.40 d c LC3-I LC3-II LC3 (I + II) COMPOUND [µmol.l-1] x̄ s p(DMSO)x̄ s p(DMSO)x̄ s p(DMSO)DMSO 0.31 ± 0.09 - 0.69 ± 0.09 - 1.00 ± 0.00 - 1 0.24 ± 0.03 0.66 ± 0.11 0.90 ± 0.11 1 5 0.18 ± 0.15 1.46 ± 0.51 1.63 ± 0.45 10 0.08 ± 0.05 d 1.69 ± 0.33 d 1.77 ± 0.31 d Example 13: Effect of compounds of general formula I on the formation of Lewy body-like aggregates in SH-SY5Y cells overexpressing SNCA-GFP fusion protein The efficacy of the novel NRF1 pathway activators was further monitored by analysing Lewy body-like aggregates in SH-SY5Y cells that overexpressed the SNCA-GFP fusion protein. Cells were treated with DMSO (negative control) or test compound1(C = 5 μmol.l-1) for 72 hours. One hour after the addition of the aforementioned compounds, the formation of SNCA-GFP aggregates was induced by the addition of recombinant α-synuclein to a final concentration of 50 μmol.l-1. The results are shown inTable 13and represent the % of cells with Lewy body-like aggregates out of the total number of cells found within the analysed microscopic images. Test compound1significantly reduced the % of cells with Lewy body-like aggregates compared to the DMSO control. Table 13: Analysis of Lewy body-like aggregates in SH-SY5Y cells overproducing the SNCA-GFP fusion protein. Results in the table represent the % of cells with Lewy body-like aggregates out of the total number of cells found within the analysed microscopic images. Statistics were evaluated using Welch’s ANOVA test followed by multiple comparisons using Dunnett’s T3 test in GraphPad Prism 9. The p-values are relative to DMSO- or α-synuclein-treated cells. The p-values < 0.0001 are indicated by ‘a’, p < 0.001 = ‘b’, p < 0.01 = ‘c’, p < 0.05 = ‘d’. A total of 2,023 cells were analysed (≥ 678 cells per experiment). Experiments were performed in biological triplicate. COMPOUND n Min Q0.25Median Q0.75Max p(DMSO)p(α-synuclein)DMSO 17 0.00 5.09 7.41 10.87 13.33 - - α-synuclein + DMSO 24 18.18 27.14 31.86 42.11 62.50 a - α-synuclein + 1 21 20.00 21.13 25.00 26.88 33.33 a b Example 14: Effect of compounds of general formula I on the formation of polyQ aggregates in the cell To visualise and quantify the amount of expansive polyQ aggregates, U2OS cells were grown on slides divided into four individual compartments pre-coated with poly-D-lysine solution. Forty thousand cells in 450 μL of phenol red-free DMEM culture medium were seeded into individual chambers on these slides. Cells were subsequently transfected using Lipofectamine2000 (Thermo Fisher Scientific, USA) with the Htt EGFP-Q74 plasmid to generate expansion repeats. Four hours after transfection, the medium was replaced with clean medium and the test compounds were added at a final concentration of 5 μmol.l-1, and the treated cells were subsequently cultured for 24 hours. Subsequently, the culture medium was aspirated and the cells were washed with PBS and a fixative solution of 4% paraformaldehyde at 400 μL per chamber was added, and the slides were incubated in a hood for 20 minutes. The experiment was performed for each compound including the control in biological triplicate. Subsequently, the slides were washed two more times with PBS and the fixed cells were permeabilised with a solution of 0.3% Triton X100 and 0.1% FBS in PBS for half an hour. Subsequently, cell nuclei were stained using Hoechst 33255 solution (ThermoFisher Scientific, catalogue number H3569) at a concentration of 1 μg / mL for 10 min. Finally, the solution was aspirated and replaced with fresh PBS. Fluorescence images were taken using a Zeiss LSM 780 confocal microscope. The selected fluorophores were captured: EGFP excitation λ = 488 nm; emission λ = 495-555 nm, at 25% laser power and Hoechst 33255 excitation λ = 405 nm; emission λ = 410-435 nm, at 10% laser power. For each of the test compounds and for the control sample (DMSO), images of ≥ 60 randomly selected cells were taken, and image analysis was subsequently performed on the images thus acquired using ZEN (Zeiss, Germany) and ImageJ (National Institutes of Health, Bethesda USA) software to quantify the EGFP signal intensity in positive cells and to determine the number and size of expansive Htt-Q74 aggregates within GFP-positive cells. The results are shown in Table 14. Analysis of the number of expansive aggregates in cells treated with the test compounds clearly showed that the fluorescence intensity of one cell was reduced up to 42% in the case of treatment of cells with compound 1, which is significant compared to the comparative compound ASC-JM17. There was also a significant reduction of individual cells with aggregates up to 46%. Table 14: Analysis of expansive Htt-Q74 aggregates in U2OS cells after treatment of cells with compound 1 at a concentration of 5 μmol.l-1for 24 hours compared with DMSO control and ASC-JM17 comparative compound. The relative fluorescence intensities of the cells examined are relative to the DMSO control. Values of total area of aggregates in cells are given in µm2and the amount of GFP positive cells with aggregates are given as % of the total number of cells examined. Values of relative fluorescence intensities were statistically analysed using the Kolomorov-Smirnov test; the proportions of GFP-positive cells with aggregates were analysed using a one-tailed unpaired t-test with Welch’s adjustment in GraphPad Prism 9. The p-values are relative to cells treated with DMSO alone or ASC-JM17. The p-values < 0.0001 are indicated by ‘a’, p < 0.001 = ‘b’, and p < 0.05 = ‘d’. Experiments were performed in biological triplicate. Relative fluorescence intensity of a single cell COMPOUND n Min Q0.25Median Q0.75Max p(DMSO)p(ASC-JM17)DMSO 108 0.26 0.58 1.00 2.94 9.03 - - ASC-JM17 109 0.03 0.36 0.67 1.27 7.72 c - 1 104 0.00 0.27 0.42 0.63 6.21 a b Amount of GFP positive cells with aggregates [%] COMPOUND x̄ s p(DMSO)p(ASC-JM17)DMSO 75.33 ± 12.66 - - ASC-JM17 46.33 ± 13.32 d - 1 46.00 ± 11.53 d Example 15: Effect of compounds of general formula I on the activation of transcription factor SKN-1A (NRF1) in vivo The in vivo activity of compound 1 was monitored using the C. elegans reporter strain, GR2183. In this strain, activation of the transcription factor SKN-1A (NRF1 in C. elegans) is monitored via induced expression of the rpt-3P::GFP reporter. This strain was obtained from the Caenorhabditis Genetic Centre (CGC, University of Minnesota). Nematode worms were maintained at 20 °C under standard culture conditions. The nematode worms were castrated and age-synchronised offspring were grown at 20 °C until they reached maturity, thereby avoiding reproduction and obviating the need for fluorodeoxyuridine treatment. L4 larvae / young adults were cultured in a suspension of E. coli OP50 in S-complete medium, then treated with compound 1 (at concentrations of 10 μmol.l-1and 50 μmol.l-1) and pipetted into 96-well plates (approximately 15 individuals per well) in liquid culture. Plates were sealed to prevent evaporation of the medium and maintained at 20 °C for 24 hours. Fluorescence intensity was evaluated using a microscope (Zeiss Axio) equipped for epifluorescence. Image analyses were performed using ImageJ software (NIH, https: / / imagej.nih.gov / ij / ). The results shown in Table 15 indicate that compound 1 significantly induced the SKN1A (NRF1)- controlled pathway at both concentrations tested. Table 15: Activation of transcription factor SKN-1A via induced expression of the rpt-3P::GFP reporter in C. elegans, strain GR2183. Values represent the average relative fluorescence intensity of a single animal. Data were analysed using Kruskal-Wallis ANOVA followed by multiple comparisons using Dunn’s test. The p-values are relative to DMSO-treated cells. The p-values < 0.0001 are indicated by ‘a’, p < 0.001 = ‘b’, p < 0.01 = ‘c’, p < 0.05 = ‘d’. A total of 71 animals were analysed. Experiments were performed in biological triplicate. COMPOUND c [µmol.l-1] n Min Q0.25Median Q0.75Max p(DMSO)DMSO 21 14.28 25.37 29.69 35.83 43.22 - 10 30 25.76 33.98 39.29 49.67 70.18 b 1 50 20 23.72 39.89 52.56 61.83 75.70 a Example 16: Effect of compounds of general formula I on the formation of expansive protein aggregates in vivo The C. elegans AM140 strain producing Htt-Q35::YFP was cultured for 6 days with DMSO (negative control) or test compound 1 at a final concentration of 10, 20 or 50 μmol.l-1, analogously to Example 14. Size of aggregates was evaluated by analysing microscopic data using the ImageJ program (NIH, https: / / imagej.nih.gov / ij / ). The result of the in vivo experiment is shown in Table 16. Compound 1 significantly reduced the size of the expansive protein aggregates compared to the DMSO control. Table 16: Compound 1 inhibits huntingtin Q35 aggregation in C. elegans. The Htt-Q35::YFP-producing strain AM140 was cultured for 6 days with DMSO (negative control) or test compound 1 at a final concentration of 10, 20, or 50 µmol.l-1. The table shows the analysis of aggregate size in the test animals. Statistics were evaluated using the Kuskal-Wallis ANOVA test followed by multiple comparisons using Dunn’s test in GraphPad Prism 9. The p-values are relative to DMSO-treated cells. The p-values < 0.0001 are indicated by ‘a’, p < 0.01 = ‘c’. A total of 117 animals were analysed. Experiments were performed in biological triplicate. c Htt-Q35::YFP AGGREGATE SIZE COMPOUND [µmol.l-1] n Min Q0.25 Median Q0.75 Max p(DMSO) DMSO 278 4.44.10-51.78.10-42.00.10-31.23.10-28.98.10-1- 10 626 4.44.10-52.56.10-49.78.10-43.00.10-35.19.10-1c 1 20 223 4.44.10-52.22.10-45.78.10-42.00.10-32.30.10-2a 50 570 4.44.10-53.11.10-41.00.10-34.00.10-34.96.10-1 Example 17: In vivo toxicity of compounds of general formula I The in vivo toxicity of compound 1 was monitored in a wild-type strain of C. elegans, N2. This strain was obtained from the Caenorhabditis Genetic Centre (CGC, University of Minnesota). The nematode worms were maintained at 20 °C under standard culture conditions. Compound 1 was tested for baseline toxicity and also for worm fecundity, which was determined by a chitinase test and the results were expressed as percentage of vitality. Visual evaluation of nematode worms was performed under a microscope. Briefly, the L1 larval stage (age-synchronised) was diluted to a concentration of 200-300 individuals per mL, fed a bacterial suspension of 3 mg mL-1and transferred to 96-well plates. Larvae were treated with the test compound in DMSO or an equal volume of DMSO alone. The populations were allowed to grow at 20°C for 4 days, at which time healthy worms reached maturity and began to lay eggs. Healthy embryos produce chitinase at hatching. The chitinase activity was assessed after adding a fluorogenic substrate (4- methylumbelliferyl β- D-N,Nʹ,Nʹʹ-triacetylchitotrioside at 20 uM) to the wells and incubating the plates for 1 hour (at 37 °C). The reaction was then stopped by adding an alkaline buffer (1 M glycine / 1 M NaOH, pH 10.6) and the fluorescence intensity was measured at 360 / 460 λm. Results are given as percentage of DMSO. The results in Table 17 show that compound 1 did not show measurable toxicity at any concentration tested. Table 17: Effect of compound 1 on in vivo viability measured in a wild-type strain of C. elegans. The experiment was performed in six biological replicates. -1VIABILITY [%] c [μmol.l ] x̄ s50 95.77 ± 2.13 25 100.18 ± 2.78 12.5 96.83 ± 5.15 6.25 100.08 ± 0.43 3.125 97.96 ± 3.39 1.5625 99.09 ± 6.08 0.78125 105.29 ± 11.12 0.390625 99.96 ± 3.17 Example 18: Effect of compounds of general formula I on the loss of intracellular viral protein in viral infection Human hepatocellular carcinoma-derived cell lines constitutively expressing the NTCP cotransporter (HepG2-NTCP) were cultured in 6-well plates (5.5 x 105cells in 2 mL culture medium per well) in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37 °C in 5% CO2. Cells were infected with HBV virus and treated with compound 1 (or DMSO) for 16 hours on the seventh day after infection. Subsequently, the cells were harvested and the supernatant was stored for measurement of extracellular capsid protein by ELISA. Harvested cells were lysed and the lysate was subsequently subjected to western blot analysis. The experiment was performed in three independent measurements. The results in Table 18 show a significant loss of intracellular viral capsid protein in established HBV infection after treatment of infected cells with compound 1 compared to those treated with control (DMSO). Table 19 shows a significant loss of extracellular viral capsid protein in established HBV infection compared to control. Table 18: Effect of compound 1 on the loss of intracellular viral capsid protein in established HBV infection. HepG2-NTCP cells were infected with HBV virus and treated with compound 1 (or DMSO) for 16 hours on the seventh day after infection. The experiment was performed in three independent measurements. Statistics were evaluated by two-tailed Student’s unpaired t-test and values are relative to DMSO. The p-values indicate reduction in HBV capsid protein level and are relative to DMSO-treated cells; the p-values < 0.001 are marked with the letter ‘a’ and p-values < 0.05 are marked with ‘c’. COMPOUND 1 [μmol.l-1] % p(DMSO) DMSO (control) 100,0 1.0 73.6 ± 13.3 c 2.5 107.5 ± 48.3 5.0 69.1 ± 7.7 a 6.0 63.1 ± 22.3 c 7.0 65.7 ± 8.2 a 8.0 69.6 ± 45.5 Table 19: Effect of compound 1 on the loss of extracellular viral capsid protein in established HBV infection. HepG2-NTCP cells were infected with HBV virus and treated with compound 1 (or DMSO) for 16 hours on the seventh day after infection. The experiment was performed in three independent measurements. Statistics were evaluated by two-tailed Student’s unpaired t-test and values are relative to DMSO. The p-values indicate reduction in HBV capsid protein level and are relative to DMSO-treated cells; the p-values < 0.001 are marked with ‘a’, p-values < 0.01 are marked with ‘b’, and p-values < 0.05 are marked with ‘c’. COMPOUND 1 [μmol.l-1] % p(DMSO) DMSO (control) 100.0 1.0 83.0 ± 13.2 c 2.5 87.0 ± 2.8 a 5.0 86.0 ± 8.9 c Example 19: Effect of compounds of general formula I on intracellular viral protein loss in early viral infection Human hepatocellular carcinoma-derived cell lines constitutively expressing the NTCP cotransporter (HepG2-NTCP) were cultured in 6-well plates (5.5 x 105cells in 2 mL culture medium per well) in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37 °C in 5% CO2. Cells were treated with compound 1 (or DMSO) for 8 hours, then infected with HBV virus, and re-treated with compound 1 (or DMSO) for 16 hours on the third day after infection. On the seventh day, the cells were harvested and the supernatant was stored for measurement of extracellular capsid protein by ELISA. Harvested cells were lysed and the lysate was subsequently subjected to western blot analysis. The experiment was performed once. From the results in Table 20, there is a clear loss of intracellular viral capsid protein in early HBV infection after treatment of infected cells with compound 1 compared to those treated with control (DMSO). In agreement, from Table 21, there is a clear loss of extracellular viral capsid protein in early HBV infection compared to control. Table 20: Effect of compound 1 on the loss of intracellular viral capsid protein in the early phase of HBV infection. HepG2-NTCP cells were treated with compound 1 (or DMSO) for 8 hours, then infected with HBV virus and re-treated with compound 1 (or DMSO) for 16 hours on the third day after infection. On the seventh day, the cells were harvested. The experiment was performed once. Compound 1 [μmol.l-1] % DMSO (control) 100.0 2.0 75.7 4.0 54.3 8.0 56.7 Table 21: Effect of compound 1 on the loss of extracellular viral capsid protein in the early phase of HBV infection. HepG2-NTCP cells were treated with compound 1 (or DMSO) for 8 hours, then infected with HBV virus and re-treated with compound 1 (or DMSO) for 16 hours on the third day after infection. On the seventh day, the cells were harvested. The experiment was performed once. Compound 1 [μmol.l-1] % DMSO (control) 100.0 2.0 65.7 4.0 50.9 8.0 53.0 Example 20: Solubility of compounds of general formula I in the physiological environment The maximum solubility of the compounds in DMEM (Dulbecco’s Modified Eagle Medium) cell culture medium was determined by UV spectral analysis after centrifugation. The degree of precipitation was estimated by comparing the spectra of precipitates dissolved in DMSO with the spectra of compounds in DMSO of known concentration. The results presented in Table 22 show an increased solubility of the new compounds compared to the comparative compound ASC-JM17. Table 22: Solubility of compounds in DMEM cell culture medium determined by UV spectral analysis COMPOUND MAX SOLUBILITY [mmol.L-1] ASC-JM17 17 14824934954962674910131115Example 21: Efficacy of compounds of general formula I in activating the NRF1 (NFE2L1) transcriptional pathway monitored by cell-based reporter assay A stable cell line derived from HEK293 cells, containing a 3xPSMA4-ARE / minP / luc2P / reporter derived from an ARE (antioxidant response element) from the human PSMA4 gene promoter that allows monitoring of NRF1 pathway activation, was cultured in DMEM (Dulbecco’s Modified Eagle Medium) containing 10% FBS, 2 mmol.l-1L-glutamine, and 50 μg / mL penicillin, and 50 μg / mL streptomycin. Cells were cultured in a CO2 incubator at 37 °C in an atmosphere containing 5% CO2. This reporter line was transfected with the normalisation Renilla reporter pRL-TK (catalogue number E2241; Promega, Hercules, CA) at approximately 70% confluence. Polyethylenimine (PEI) was used in a PEI / DNA ratio of 3:1 dissolved in optiMEM medium. The cells were subsequently seeded on 384 well plates at a concentration of 10x103in a volume of 25 μL / well and, 16 hours after stabilisation, were treated with the tested compounds dissolved in dimethyl sulfoxide (DMSO) at a concentration of 5 μmol.l-1. The experiment was repeated in technical quadruplicates and biological triplicate. After 16-hour incubation, the medium was removed and cells were lysed in 5 μL of 1X lysis buffer (25 mmol.l-1, Tris-phosphate pH 7.8; 2 mmol.l-1dithiothreitol (DTT); 2 mmol. l-12,2′,2′′,2′′′-(ethane-1,2-diyldinitrile)tetraacetic acid; 10% (henceforth, percent by volume is always given) glycerol and 1% Triton X-100). After a 10-minute incubation on a shaker, substrate for Firefly / photinus luciferase was added (200 mM Tris–HCl; 15 mmol.l-1MgSO4; 0.1 mmol.l-1EDTA; 25 mmol.l-1DTT; 1 mmol.l-1ATP; 0.2 mmol.l-1coenzyme A; and 200 mmol.l-1D-luciferin, pH 8,0) in a volume of 20 μL per well and luminescence was measured. Firefly luciferase activity was measured followed by the addition of buffer (25 mmol.l-1Na4P2O7; 10 mmol.l-1AcONa; 15 mmol.l-1EDTA; 500 mmol.l-1Na2SO4; 500 mmol.l-1NaCl; 25 μmol.l-1phenyl-benzothiazole; 4 μmol.l-1coelenterazine and 0.04% BSA, pH 5.0) in the same volume and, after shaking, Renilla luciferase activity was measured. The results of the measurements (Table 23) are the ratio of Renilla luciferase activity to Firefly luciferase activity and represent the mean values from three biological replicates with technical quadruplicates with standard deviations. The activation of the pathway controlled by the transcription factor NRF1 in the tested compounds ranged from 3.98 to 13.33, i.e. the maximum increase compared to the control more than 13-fold, which with statistical significance relative to DMSO-treated cells was shown by most of the tested compounds. Table 23: Efficacy of NRF1 (NFE2L1) transcriptional pathway activation after exposure to the test compounds at a concentration of 5 µmol.l-1for 16 hours monitored by cell-based reporter assay. Comparison of the results against the control with DMSO was statistically evaluated using a one-sample Student’s t-test. For comparison with ASC-JM17 results, a two-sample Welch’s t-test was used. Statistical calculations were performed using GraphPad Prism 10 software. Activated luciferase values are presented as fold change against the DMSO-treated control. The p-values < 0.05 = ‘d’, < 0.01 = ‘c’, < 0.001 = ‘b’. The experiment was performed in biological triplicate. Emax [5 μmol.l-1] COMPOUND x̄ s p(DMSO)DMSO 1.00 ± 0.00 - 1 9.91 ± 3.03 d 4712.45 ± 2.71 d 4814.96 ± 0.57 b 5010.28 ± 4.39 5110.67 ± 1.47 c 529.09 ± 3.70 538.60 ± 3.29 547.68 ± 2.53 d 554.82 ± 1.20 d566.42 ± 0.83 c 5710.44 ± 1.67 d 588.11 ± 3.92 5912.02 ± 1.26 c 603.98 ± 1.09 d 619.90 ± 2.80 d 639.10 ± 2.89 d 658.32 ± 3.39 6613.33 ± 8.21 679.36 ± 5.66 688.96 ± 5.49 Normalised luciferase activity [fold change relative to DMSO] Example 22: Effect of compounds of general formula I on cell viability The human HEK293 cell line was cultured in a CO2incubator at 37 °C in an atmosphere containing 5% CO2. The cytotoxic effect of the tested compounds was measured using Resazurin / Almar blue assay according to the manufacturer’s protocol (ThermoFisher Scientific, catalogue number DAL1025). None of the tested compounds showed significant cytotoxicity at a given concentration as shown in Table 24. Table 24: Cytotoxicity of the tested compounds expressed as viability of the HEK293 cell line after exposure to compounds at a concentration of 5 µmol.l-1for 16 hours. Comparison of the results against the control with DMSO was statistically evaluated using one-sample Student’s t-test. For comparison with ASC-JM17 results, a two-sample Welch’s t-test was used. Statistical calculations were performed using GraphPad Prism 10.2. Viability values were relative to the DMSO-treated control and are reported as %. The p-values < 0.05 = ‘d’, < 0.01 = ‘c’. The experiment was performed in biological triplicate. VIABILITY [5 μmol.l-1] COMPOUND x̄ s p(DMSO)DMSO 100.00 ± 0.00 - 1 81.12 ± 13.66 47 77.64 ± 15.51 48 82.13 ± 16.06 49 103.00 ± 5.51 51 84.32 ± 14.98 52 88.78 ± 17.15 53 93.49 ± 16.65 54 82.39 ± 10.70 55 87.63 ± 3.24 d5681.15 11.11 5775.00 15.71 5878.46 15.04 5974.41 14.09 6088.42 6.63 6177.21 9.98 6298.26 5.27 6382.21 11.57 6488.06 9.36 6581.17 16.47 6685.34 20.36 6774.19 14.80 6882.42 21.35 [%; normalised against control with DMSO] Example 23: Influencing protein homeostasis (proteostasis) of a cell by compounds of general formula I U2OS cells stably expressing the Ub(G76V)-GFP reporter were cultured in DMEM medium containing 10% FBS, 2 mmol.l-1L-glutamine, 50 μg / mL penicillin, and 50 μg / mL streptomycin in a CO2incubator at 37 °C in an atmosphere containing 5% CO2. Cells were first seeded at 10x103cells / well in a 384-well plate in DMEM culture medium without the addition of phenol red. On the second day, the test compounds were added at a concentration of 10 µmol.l-1. After 6 hours, the GFP signal (excitation λ = 400 nm, emission λ = 510 nm) was measured. After subtracting the auto-fluorescence of the test compounds, the resulting signal was related to the basal GFP intensity of DMSO-treated cells and expressed as a percentage. Table 25 shows the results of the testing. The fluorescence in cells treated with the test compounds does not increase compared to the fluorescence in DMSO-treated cells, thus the degradation of endogenous proteins is not inhibited. It can be concluded that the new activators of the NRF1 pathway are not inhibitors of the ubiquitin-proteasomal system. Table 25 Analysis of the effect on protein homeostasis (proteostasis) of U2OS cells after treatment with the test compounds at a concentration of 10 µmol.l-1for 6 hours monitored by a GFP degron-based cell- based reporter assay. The results obtained are presented as mean ± standard deviation after relating to the DMSO-treated control in [%]. The experiment was performed in biological duplicate. GFP FLUORESCENCE [10 μmol.l-1] COMPOUND x̄ s DMSO 100.00 ± 0.00 ASC-JM17 382.03 ± 174.05 1 102.49 ± 18.9547107.95 ± 16.66 48105.42 ± 19.78 4996.91 ± 13.05 5092.20 ± 23.25 5198.27 ± 22.19 5284.96 ± 22.51 5394.81 ± 1.55 54104.76 ± 3.43 55104.25 ± 16.84 56111.49 ± 3,58 5794.16 ± 6.43 5888.18 ± 0.32 59113.90 ± 13.27 60108.83 ± 3.02 6191.48 ± 2.99 6299.26 ± 15.12 6387.03 ± 17.99 64117.07 ± 0.86 65108.97 ± 1.76 6681.80 ± 11.89 67109.36 ± 22.74 68118.23 ± 5.84 [%; normalised against control with DMSO] Example 24: Protective effect of compounds of general formula I against erastin-induced ferroptotic cell death in SH-SY5Y cells Erastin is a small molecule capable of initiating ferroptotic cell death by activation of voltage-dependent anion channels (VDACs) and functional inhibition of the cystine-glutamate anti-porter system Xc-. Cells treated with erastin are deprived of cysteine, which prevents them from synthesing the antioxidant glutathione. The depletion of glutathione in the cell leads to the accumulation of free reactive oxygen species (ROS), followed by lipid peroxidation, which eventually leads to iron-dependent ferroptotic cell death. The protective effect of compounds of general formula I against erastin-induced ferroptosis was measured in cells of the neuroblastoma line SH-SY5Y. These cells were seeded in a 384-well plate at a density of approximately 3×103cells / well. After stabilisation, cells were treated with the test compounds at a concentration of 3 μmol.l-1for 24 hours, after which erastin was added at a concentration of 20 μmol.l-1for an additional 24 hours. Cell viability was determined by Resazurin / Almar blue assay according to the manufacturer’s protocol (ThermoFisher Scientific, catalogue number DAL1025). 2 μl of AlmarBlue / Resazurin solution at a concentration of 0.15 mg / mL was added to each well. After an hour incubation at 37 °C and 5% CO2, resorufin fluorescence (excitation / emission: 560 / 590 nm) was determined on a Tecan Infinite M1000 instrument. The protective effect manifested by cell viability was expressed as the percentage of cells exposed to erastin, or erastin plus the test compounds, relative to control cells with DMSO (Table 26). Table 26 Protective effect of compounds of general formula I against ferroptosis of SH-SY5Y cells induced by erastin. SH-SY5Y cells were first treated with DMSO or the test compounds at a concentration of 3 µmol.l-1for 24 hours and then exposed to erastin at a concentration of 20 µmol.l-1for 24 hours. The results obtained are presented as mean ± standard deviation [%]. The comparison of the viability of cells treated with the test compounds versus the control treated with erastin alone was statistically evaluated by unpaired Welch’s t-test. Statistical calculations were performed using GraphPad Prism 10.2.0 software. The p-values indicate statistically significant increase in viability. The p-values < 0.05 = ‘d’. The experiment was performed in biological triplicate. VIABILITY [3 μmol.l-1] COMPOUND x̄ s p(Erastin)DMSO 100.00 ± 0.00 - Erastin 60.51 ± 5.12 - ASC-JM17 65.95 ± 5.04 1 76.53 ± 4.41 d 48 73.31 ± 9.23 50 71.09 ± 12.83 52 71.47 ± 5.58 54 72.87 ± 7.91 55 71.34 ± 8.88 59 71.46 ± 6.65 60 74.23 ± 2.48 d 61 74.33 ± 8.00 65 74.24 ± 6.33 d 66 71.79 ± 11.63 [%; normalised against control with DMSO] Example 25: Effect of compounds of general formula I on the ROS levels in SH-SY5Y cell line A fluorescence assay based on 2’,7’-dichlorofluorescein diacetate (DCFH-DA) was used to detect the reactive oxygen species (ROS) induction in the SH-SY5Y neuroblastoma cell line. Cells were cultured in 96-well plates and washed with a prewarmed HBSS buffer. A solution of DCFH-DA was added to the cells at a final concentration of 100 μmol.l-1, followed by 30 minutes of incubation. Cells were then treated with compound 1 or ASC-JM17 at a final concentration of 5 or 25 μmol.l-1, both dissolved in HBSS buffer, for another 2 hours. Control cells received a DMSO vehicle as a negative control or two stressors serving as a positive control: rotenone at a concentration of 250 μmol.l-1or tert-Butyl hydroperoxide (tBHP) at a concentration of 25 or 50 μmol.l-1. Fluorescence was measured at 485 / 530 nm. Table 27 shows that treatment with the tBHP positive control induced a 6- and 10-fold change in fluorescence intensity compared to DMSO-treated cells. Comparative compound ASC-JM17 increased fluorescence intensity, especially at higher concentration. On the other hand, compound 1 had no effect at both tested concentrations. Based on these results, it can be concluded that compound 1 does not induce ROS. Table 27. Treatment by compound 1 does not induce ROS in SH-SY5Y neuroblastoma cell line. The SH- SY5Y cells were treated with compound 1 or ASC-JM17 at a final concentration of 5 or 25 μmol.l-1. The DMSO vehicle as used as the negative control, while rotenone at a final concentration of 250 μmol.l-1and tBHP at a final concentration of 25 or 50 μmol.l-1were used as positive controls. Two hours after exposure, the DCF fluorescence intensity was measured. Statistical analysis was performed using a two-tailed one- sample t-test (versus DMSO) or a one-tailed two-sample t-test (versus ASC-JM17) in GraphPad Prism 10.2.0 software. Statistically significant increases in the fluorescence intensity are indicated by p-values, with p < 0.05 denoted as ‘d’ and p < 0.001 denoted as ‘b’. The experiment was performed in biological triplicate. DCF FLUORESCENCE INTENSITY TREATMENT c [μmol.l-1] x̄ s p(DMSO) p(ASC-JM17 5 µM) p(ASC-JM17 10 µM)DMSO - 1,00 ± 0,00 - - - Rotenone 250 2,15 ± 0,46 - - 25 6,36 ± 0,79 b - - tBHP 50 10,14 ± 0,66 b - - 5 1,38 ± 0,26 - - ASC-JM17 25 2,52 ± 0,68 - - 5 0,93 ± 0,02 d - 1 25 0,98 ± 0,06 - d [fold change relative to DMSO control] Example 26: Effect of compounds of general formula I on juglone-induced stress in vivo The protective effect of compound 1 against oxidative stress was tested in the wild-type N2 strain of Caenorhabditis elegans, which was exposed to the solid stressor and pro-oxidant juglone. This strain was obtained from the Caenorhabditis Genetics Center (CGC) at the University of Minnesota. Isolated nematode eggs were cultured in a liquid S-basal medium with the E. coli OP50 strain serving as a food source. Growing L4 larvae (young adults) were treated with compound 1 at a final concentration of 50 μmol.l-1or with an equal volume of DMSO as a vehicle (negative control) and incubated at 20°C for 24 hours. Subsequently, approximately 120 animals per group were transferred to plates containing juglone at a final concentration of 200 μmol.l-1to induce lethal oxidative stress. Dead animals were counted every hour over a 15-hour period. The resulting data were analysed using Kaplan-Meier survival analysis. Survival curves were compared using the Logrank (Mantel-Cox) test in GraphPad Prism software (v.10.2.2). The results in Table 28 show that treatment with compound 1 has a positive effect on the survival of juglone-stressed animals. Table 28: Protective effect of compound 1 against juglone-induced stress in vivo. The L4 larvae of the C. elegans wild-type strain N2 were treated with compound 1 or DMSO vehicle at a final concentration of 50 μmol.l-1for 24 hours before the addition of pro-oxidant juglone at a concentration 200 μmol.l-1. Overall, 488 animals were examined: DMSO = 2 populations of 113 and 125 animals, 238 animals in total | RUN- 47 = 2 populations of 115 and 135 animals, 250 animals in total. Number of the dead animals were counted every hour during the 15 hours experiment. Obtained Kaplan-Meier survival curves were compared by the Logrank test. *p<0.05 KAPLAN-MEIER SURVIVAL ANALYSIS TREATMENT [μmol.l-1] n Censored Deaths Hazard Ratio 95% CI Log-rank (Mantel-Haenszel) of Ratio p-value DMSO - 238 20 216 1,27 1,03 to 1,57 d 1 50 250 13 236 0,79 0,64 to 0,97 Example 27: Effect of compounds of general formula I on the motility of the Huntington’s disease animal model The synchronized animals C. elegans strain AM140 expressing polyglutamate repetitions fused with yellow fluorescent protein (Q35::YFP) were cultivated in S-complete medium supplemented with compound 1 or DMSO vehicle (negative control) at a final concentration of 50 μmol.l-1for 7 days at 19 °C. Subsequently, gently washed animals were transferred in a drop of M9 buffer into a transparent 384-well plates at two different time points, allowing 30 s-1for adaptation followed by 60 s-1interval for counting of the number of body bends / trashes. A body bend was defined as the change in direction of the bend in the mid-body of an animal. Overall, three independent experiments were performed. The result of the in vivo experiment is shown in Table 29. Compound 1 significantly increased animals motility compared to the DMSO control. Table 29: Compound 1 increases the thrashing rate of Huntington´s disease C. elegans model. The strain AM140 expressing Q35::YFP was treated with compound 1 or DMSO vehicle (negative control) at a final concentration of 50 μmol.l-1for 7 days. After adaptation, the number of body bends / trashes per 60 s-1was counted. A body bend was defined as the change in direction of the bend in the animal mid-body. Overall, 127 animals were analysed: DMSO = 48 | RUN-47 = 79 in the three individual experiments. c ANIMALS BODY TRASHES TREATMENT [μmol.l-1] n Min Q0,25 Median Q0,75 Max p(DMSO) DMSO 46 1,33 2,33 9,83 21,50 46,00 - 1 50 79 0,67 6,33 16,67 30,55 46,33 c [Number of body trashes per minute ]
Claims
CLAIMS 1. 4-amino-2,6-bis(phenylmethylen)cyclohexanones of general formula Iwherein R1, R2, R3and R4are independently selected from the group comprising a hydrogen atom, a hydroxy group, a C1-C3 alkoxy group, a trifluoromethoxy group, and a difluoromethoxy group; and R5and R6are independently selected from the group consisting of a C1-C3 alkyl and a hydrogen atom, or R5is a hydrogen atom and R6is an acyl or thioacyl group of general formula II or a sulfonic group of general formula IIIwherein X is O or S; R7is selected from a group consisting of R8and NH-R8, wherein R8is selected from a group consisting of C1–C6 alkyl, C3–C8 cycloalkyl, three- to eight-membered heterocycloalkyl, (CH2CH2O)n-(C1-C3 alkyl), CH2O(CH2CH2O)n-(C1-C3 alkyl), C6-C12 aryl, five- to nine-membered heteroaryl, (C6-C12)aryl-(C1- C3)alkyl-, five- to seven-membered heteroaryl-(C1-C3)alkyl-, five- to seven-membered heteroaryl-O-(C1- C3)alkyl-, (C1-C3 alkyl)O-C(O)-(C1-C3)alkyl-, wherein n is 1, 2, 3, 4 or 5, wherein substituent R8is optionally substituted with at least one substituent selected from the group consisting of C1-C3 alkyl, C1-C3 alkoxy, OH, halogen, =O, NH2, NH2C(=O)-(C1-C3 alkoxy), NHR9, wherein R9is selected from C1–C3 alkyl and NR102, wherein R10are independently selected from C1-C3 alkyl or both R10together are formed by C2-C5 alkylene, with the proviso that at least one of the substituents R1and R2is not a hydrogen atom, and at least one of the substituents R3and R4is not a hydrogen atom; and their pharmaceutically acceptable salts, addition salts and solvates.
2. 4-amino-2,6-bis(phenylmethylen)cyclohexanones of general formula I according to claim 1, wherein R1, R2, R3and R4are independently selected from the group comprising methoxy and ethoxy groups.
3. 4-amino-2,6-bis(phenylmethylen)cyclohexanones of general formula I according to claim 1 or 2, wherein R5is a hydrogen atom, R6is a group of general formula II, and R7is selected from the group comprising methyl, ethyl, propyl, cyclopropyl, azepanyl, morpholinyl, piperazinyl, phenyl, naphthyl, pyridyl, imidazolyl, pyrrolidinyl, quinuclidinyl, thiazolyl, oxazolyl, aminomethyl, aminoethyl, aminopropyl, N,N-dimethylaminopropyl, N,N-dimethylaminoethyl, N,N-dimethylaminomethyl, aminophenyl, diaminophenyl, N,N-dimethylaminophenyl, N,N-diethylaminomethyl, N-methylimidazolyl, (fluoro)pyrrolidinyl, (methoxymethyl)pyrrolidinyl, isopropylamino, N-methylpiperazinyl, aminocarbonylmethoxyphenyl, hydroxypyridyl, methylpyridyl, 6-hydroxy-4-methylpyridin-3-yl, (morpholin-4-yl)ethyl, difluoropyridyl, (methoxyethoxy)ethoxymethyl, pyrazolo[1,5-a]pyrimidinyl, piperidinylpyridine.
4. 4-amino-2,6-bis(phenylmethylen)cyclohexanones of general formula I according to claim 1 or 2, wherein R5is a hydrogen atom, R6is a sulfonic group of the general formula III, and R7is selected from the group comprising methyl, ethyl, propyl, cyclopropyl, azepanyl, morpholinyl, piperazinyl, phenyl, pyridyl, imidazolyl, pyrrolidinyl, aminopropyl, aminoethyl, aminophenyl, diaminophenyl, N- methylimidazolyl, (fluoro)pyrrolidinyl, (methoxymethyl)pyrrolidinyl, isopropylamino, N- methylpiperazinyl, aminocarbonylmethoxyphenyl, hydroxypyridyl, methylpyridyl, 6-hydroxy-4- methylpyridin-3-yl, (morpholin-4-yl)ethyl.
5. 4-amino-2,6-bis(phenylmethylen)cyclohexanones of general formula I according to any one of the preceding claims 1 to 4 for use as medicaments.
6. 4-amino-2,6-bis(phenylmethylen)cyclohexanones of general formula I according to any one of the preceding claims 1 to 4 for use in the treatment of proteinopathies, and viral diseases.
7. 4-amino-2,6-bis(phenylmethylen)cyclohexanones of general formula I according to any one of the preceding claims 1 to 4 for use in the treatment of neurodegenerative diseases selected from polyglutamine diseases, tauopathies, synucleinopathies, amyotrophic lateral sclerosis, amyloidosis, and cystic fibrosis.
8. 4-amino-2,6-bis(phenylmethylen)cyclohexanones of general formula I according to any one of the preceding claims 1 to 4 for use in the prevention of familial forms of neurodegenerative diseases selected from polyglutamine diseases, tauopathies, synucleinopathies, amyotrophic lateral sclerosis, familial amyloidosis, and cystic fibrosis.
9. 4-amino-2,6-bis(phenylmethylen)cyclohexanones of general formula I according to any one of the preceding claims 1 to 4 for use in the tratment of diabetes or viral diseases caused by the HBV virus.
10. 4-amino-2,6-bis(phenylmethylen)cyclohexanones of general formula I according to any one of the preceding claims 1 to 4 for use in the tratment of stroke, rhabdomyolysis, non-alcoholic steatohepatitis, acute pancreatitis, and psoriasis.
11. A pharmaceutical preparation, characterised in that it contains at least one 4-amino-2,6- bis(phenylmethylen)cyclohexanone of general formula I according to any one of the preceding claims 1 to 4, and at least one pharmaceutically acceptable excipient.