Compositions and methods for inhibiting expression of complement component 3 (C3)

Abstract

Compositions and methods useful to reduce expression of C3 gene and for treatment of C3-associated diseases and conditions are provided. Provided are C3 dsRNA agents, C3 antisense polynucleotide agents, compositions comprising C3 dsRNA agents, and compositions comprising C3 antisense polynucleotide agents that can be used to reduce C3 expression in cells and subjects.

Description

COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF COMPLEMENT COMPONENT 3 (C3)Field of the Invention

[0001] The invention relates, in part, to compositions and methods that can be used to inhibit a complement component3 (C3) gene expression.Background

[0002] The complement system or pathway was first discovered in the 1890s when it was found to aid or “complement” the killing of bacteria by heat-stable antibodies present in normal serum. The complement system or pathway is part of the innate immune system of host defence against invading pathogens. It mainly consists of more than 30 proteins that circulate in the bloodstream in the form of precursors that plays a significant role in both innate and adaptive immunity. Most of the proteins that form the complement system, including the complement component protein C3 (also referred to herein simply as C3) , are largely synthesised and secreted into the bloodstream by hepatocytes in the liver .

[0003] The proteins of the complement system act in a series of enzymatic cascades through a variety of protein interactions and cleavage events. Three main pathways of complement activation have been recognized and are referred to as classical pathway, alternative pathway and lectin pathway. In functional terms, complement activation occurs inherently at a low level (spontaneous cleavage of C3 to yield C3a and C3b) and is reinforced in the presence of microbes via an enzymatic cascade converting inactive forms of enzymes (zymogenes) into their active counterparts. One type of C3 convertases is a complex of C3b and complement factor B (CFB, Factor B) . Once formed, a C3 convertase can convert large amounts of C3 into its cleavage products C3a and C3b within short amount of time. The specific C3 convertase which is a complex of C3b and Factor B has originally been described in the context of the alternative pathway, but may form also in the context of the other two pathways. Inappropriate or excessive complement activation is an underlying cause or contributing factor to a number of serious diseases and conditions, and considerable effort has been devoted over the past several decades to exploring various complement inhibitors as therapeutic agents.

[0004] Several diseases are associated with aberrant acquired or genetic activation of the complement pathway as well as with aberrant or over-expression of C3. for example, these are C3 Glomerulopathy (C3G) , atypical Hemolytic Uremic Syndrome (aHUS) , Immune Complex-mediated Glomerulonephritis (IC-mediated GN) , C3 glomerulonephritis, post-Infectious Glomerulonephritis (PIGN) , Systemic Lupus Erythematosus, Lupus nephritis, Ischemia / reperfusion injury , IgA nephropathy (IgA N; ) , age-related macular degeneration (AMD) , Rheumatoid arthritis (RA) , antineutrophil Cytoplasmic Autoantibodies-associated Vasculitis (ANCA-AV) , dysbiotic periodontal Disease, Malarial Anaemia, Paroxysmal  Nocturnal Hemoglobinuria (PNH) , sepsis, neuromyelitis optica (NMO) , multifocal motor neuropathy (MMN) , myasthenia gravis (MG) , rheumatoid arthritis, and neurodegenerative diseases.

[0005] Accordingly, C3 RNAi agents disclosed herein for for treating diseases, disorders, and conditions associated withsubjects having a complement component C3-associated disease.Summary of the Invention

[0006] In general, the present disclosure features novel complement component3 (C3) gene-specific RNAi agents, compositions that include C3 RNAi agents, and methods for inhibiting expression of a C3 gene in vitro and / or in vivo using the C3 RNAi agents and compositions that include C3 RNAi agents described herein. The C3 RNAi agents described herein can selectively and efficiently decrease, inhibit, or silence expression of a C3 gene in a subject, e.g., a human or animal subject.

[0007] According to an aspect of the invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of C3 is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein said antisense strand comprises a region of complementarity to a C3 RNA transcript which comprises at least 15 contiguous nucleotides differing by no more than 1, 2, or 3 nucleotides from any one of the antisense sequences listed in any one of Tables 1-3, and optionally comprising a targeting ligand, wherein the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.

[0008] In some embodiments, the dsRNA agent including a sense strand and an antisense strand, nucleotide positions 2 to 18 in the antisense strand including a region of complementarity to a C3 RNA transcript, wherein the region of complementarity includes at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally including a targeting ligand.

[0009] In some embodiments, the C3 RNA transcript is SEQ ID NO: 1.

[0010] In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent is fully complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, the dsRNA agent includes a sense strand sequence set forth in any one of Tables 1-3.

[0011] In certain embodiments, the dsRNA agent includes a sense strand sequence set forth in any one of Tables 1-3, wherein the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent includes an antisense strand sequence set forth in any one of Tables 1-3. In some embodiments, the dsRNA agent includes the sequences set forth as a duplex sequence in any of Tables 1-3.

[0012] In certain embodiments , the dsRNA agent including a sense strand and an antisense strand, wherein said antisense strand comprises a region of complementarity to a C3 RNA  transcript which comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences of any one of SEQ ID NOs: 25-28, 31-35, 39-41, 45-47; and optionally including a targeting ligand.

[0013] In certain embodiments, the dsRNA agent includes a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence selected from the following sequencesSEQ ID NOs: 2-5, 8-12, 16-18, 22-24; and optionally including a targeting ligand.

[0014] In certain embodiments, the dsRNA agent includes a sense strand and an antisense strand, the sense strand and antisense strands comprise nucleotide sequences selected from the group consisting of:

[0015] (a) SEQ ID NOs: 2 and 25, respectively;

[0016] (b) SEQ ID NOs: 3 and 26, respectively;

[0017] (c) SEQ ID NOs: 4 and 27, respectively;

[0018] (d) SEQ ID NOs: 8 and 31, respectively;

[0019] (e) SEQ ID NOs: 9 and 32, respectively;

[0020] (f) SEQ ID NOs: 10 and 33, respectively;

[0021] (g) SEQ ID NOs: 11 and 34, respectively;

[0022] (h) SEQ ID NOs: 12 and 35, respectively;

[0023] (i) SEQ ID NOs: 16 and 39, respectively;

[0024] (j) SEQ ID NOs: 17 and 40, respectively;

[0025] (k) SEQ ID NOs: 18 and 41, respectively;

[0026] (l) SEQ ID NOs: 22 and 45, respectively;

[0027] (m) SEQ ID NOs: 23 and 46, respectively; and

[0028] (n) SEQ ID NOs: 24 and 47, respectively.

[0029] In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 2 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 25. In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 3 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 26. In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 4 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 27. In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 8 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 31. In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 9 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 32. In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 10 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 33. In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 11 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 34. In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 12 , wherein the  antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 35. In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 16 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 39. In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 17 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 40.In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 18 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 41. In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 22 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 45. In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 23 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 46. In some embodiments, the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 24 , wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 47.

[0030] In some embodiments, the antisense strand of dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (I) : 5'-Z1UAUUCAUGAGCUUCGUAGZ2-3' (I) , wherein Z1 is selected from one of C, G, A, U or absent, Z2 is a nucleotide sequence is 0-15 nucleotides in length. In certain embodiments, Z1 is U. In certain embodiments, Z2 is selected from A, AC, AU, AA, AG, or absent. In some embodiments, the sense strand of dsRNA comprises a nucleotide sequence at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (II) : 5'-Z3CUACGAAGCUCAUGAAUAZ4-3' (II) , wherein Z3 is a nucleotide sequence is 0-15 nucleotides in length, Z4 is selected from one of C, G, A, U or absent. In certain embodiments, Z4 is A. In certain embodiments, Z3 is selected from U, GU, CU, UU, AU, or absent. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand, wherein the antisense strand of dsRNA comprises nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (I) and the sense strand of dsRNA comprises nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (II) , wherein the nucleotide formula (I) and (II) are as described above. In some embodiments, each strand is no more than 40 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, each strand is no more than 23 nucleotides in length. In certain embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 16 and 23 nucleotides in length. In some embodiments, the region of complementarity is 19-21 nucleotides in length. In some embodiments, Z1 is a nucleotide complementary to Z4. In some embodiments, Z2 is a nucleotide sequence complementary to Z3.

[0031] In some embodiments, the antisense strand of dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from  formula (III) : 5'-Z5UGUUCAUUCUGAUUCCUUZ6-3' (III) , wherein Z5 is selected from one of C, G, A, U or absent, Z6is a nucleotide sequence is 0-15 nucleotides in length. In certain embodiments, Z5 is U. In certain embodiments, Z6 is selected from C, CG, CC, CU, CA, or absent. In some embodiments, the sense strand of dsRNA comprises a nucleotide sequence at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (IV) : 5'-Z7AAGGAAUCAGAAUGAACAZ8-3' (IV) , wherein Z7 is a nucleotide sequence is 0-15 nucleotides in length, Z8is selected from one of C, G, A, U or absent. In certain embodiments, Z8 is A. In certain embodiments, Z7 is selected from G, CG , AG, GG, UG, or absent. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand, wherein the antisense strand of dsRNA comprises nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (III) and the sense strand of dsRNA comprises nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (IV) , wherein the nucleotide formula (III) and (IV) are as described above. In some embodiments, each strand is no more than 40 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, each strand is no more than 23 nucleotides in length. In certain embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 16 and 23 nucleotides in length. In some embodiments, the region of complementarity is 19-21 nucleotides in length. In some embodiments, Z5 is a nucleotide complementary to Z8. In some embodiments, Z6 is a nucleotide sequence complementary to Z7.

[0032] In some embodiments, the antisense strand of dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (V) : 5'-Z9GUAGUAGAAUUUCUCUGUZ10-3' (V) , wherein Z9 is selected from one of C, G, A, U or absent, Z10 is a nucleotide sequence is 0-15 nucleotides in length. In certain embodiments, Z9 is U. In certain embodiments, Z2 is selected from A, AC, AU, AG, AA, or absent. In some embodiments, the sense strand of dsRNA comprises a nucleotide sequence at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (VI) : 5'-Z11ACAGAGAAAUUCUACUACZ12-3' (VI) , wherein Z11 is a nucleotide sequence is 0-15 nucleotides in length, Z12 is selected from one of C, G, A, U or absent. In certain embodiments, Z12 is A. In certain embodiments, Z11 is selected from U, GU , AU, CU, UU, or absent. In some embodiments, the dsRNA agent includes a sense strand and an antisense strand, wherein the antisense strand of dsRNA comprises nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (V) and the sense strand of dsRNA comprises nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (VI) , wherein the nucleotide formula (V) and (VI) are as described above. In some embodiments, each strand is no more than 40 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, each strand is no more than 23 nucleotides in length. In certain  embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 16 and 23 nucleotides in length. In some embodiments, the region of complementarity is 19-21 nucleotides in length. In some embodiments, Z9 is a nucleotide complementary to Z12. In some embodiments, Z10 is a nucleotide sequence complementary to Z11.

[0033] In some embodiments, the dsRNA agent includes at least one modified nucleotide. In certain embodiments, all or substantially all of the nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least one of the modified nucleotides comprises: 2’-O-methyl nucleotide, 2’ -fluoro nucleotide, 2’ -deoxy nucleotide, 2’ 3’ -seco nucleotide mimic, locked nucleotide, unlocked nucleic acid nucleotide (UNA) , glycol nucleic acid nucleotide (GNA) , 2’ -F-Arabino nucleotide, 2’ -methoyxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted abasic nucleotide, inverted 2’ -Ome nucleotide, inverted 2’ -deoxy nucleotide, isomannide nucleotide, 2’ -amino-modified nucleotide, 2’ -alkyl-modified nucleotide, mopholino nucleotide, and 3’ -OMe nucleotide, a nucleotide including a 5’ -phosphorothioate group, or a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2’ -amino-modified nucleotide, a phosphoramidite, or a non-natural base including nucleotide.

[0034] In some embodiments, the dsRNA agent includes an E-vinylphosphonate nucleotide at the 5′ end of the guide strand.

[0035] In some embodiments, the dsRNA agent includes a phos-15 nucleoside at the 5′ end of the guide strand.

[0036] In certain embodiments, the dsRNA agent includes at least one phosphorothioate internucleoside linkage. In certain embodiments, the sense strand includes at least one phosphorothioate internucleoside linkage. In some embodiments, the antisense strand includes at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand includes 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.

[0037] In some embodiments, all or substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from a 2’ -O-methyl nucleotide, a 2’ -fluoro nucleotide and an UNA modified nucleotide, wherein less than 6 modified nucleotides are 2’ -fluoro nucleotides. In some embodiments, the antisense strand comprises 3 or 5 2’ -fluoro nucleotides, preferably, the antisense strand comprises 5 2’ -fluoro nucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from a 2’ -O-methyl nucleotide and a 2’ -fluoro nucleotide, wherein less than 4 modified nucleotides are 2’ -fluoro nucleotides. In certain embodiments, the sense strand comprises 3 2’ -fluoro nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from a 2’ -O-methyl nucleotide and a 2’ -fluoro nucleotide, wherein at least 14 modified nucleotides are 2’ -O-methyl nucleotides and the nucleotides at  positions 2, 5, 7, 11, 12, 14, 16 and / or 18 counting from the first matching position of the 5’ end of the antisense strand are independently a 2’ -fluoro nucleotide. In some embodiments, the antisense strand comprises at least one UNA modified nucleotide and 5 2’ -fluoro nucleotides. In some embodiments, the antisense strand comprises one UNA modified nucleotide at position 7 and 5 2’ -fluoro nucleotides at positions 2, 5, 12, 14 and 16 counting from the first matching position of the 5’ end, and the rest 2’ -O-methyl nucleotides. In some embodiments, the antisense strand comprises one UNA modified nucleotide at position 7 and 5 2’ -fluoro nucleotides at positions 2, 5, 12, 14 and 18 counting from the first matching position of the 5’ end, and the rest 2’-O-methyl nucleotides. In some embodiments, the antisense strand comprises one UNA modified nucleotide at position 7 and 5 2’ -fluoro nucleotides at positions 2, 5, 11, 14 and 16 counting from the first matching position of the 5’ end, and the rest 2’ -O-methyl nucleotides. In some embodiments, the antisense strand comprises 5 2’ -fluoro nucleotides at positions 2, 7, 12, 14 and 16 counting from the first matching position of the 5’ end, and the rest 2’ -O-methyl nucleotides. In some embodiments, the antisense strand comprises 5 2’ -fluoro nucleotides at positions 2, 7, 11, 14 and 16 counting from the first matching position of the 5’ end, and the rest 2’-O-methyl nucleotides. In some embodiments, the antisense strand comprises 5 2’ -fluoro nucleotides at positions 2, 5, 12, 14 and 16 counting from the first matching position of the 5’ end, and the rest 2’ -O-methyl nucleotides. In some embodiments, the antisense strand comprises 5 2’ -fluoro nucleotides at positions 2, 5, 12, 14 and 18 counting from the first matching position of the 5’ end, and the rest 2’ -O-methyl nucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from a 2’ -O-methyl nucleotide and a 2’ -fluoro nucleotide, preferably, wherein at least 18 modified nucleotides are 2’-O-methyl nucleotides and the nucleotides at positions 9, 11 and / or 13 counting from the first matching position of the 3’ end of the sense strand are 2’ -fluoro nucleotides. In some embodiments, the sense strand comprises at least 18 modified nucleotides are 2’ -O-methyl nucleotides and the nucleotides at positions 8, 11 and / or 13 counting from the first matching position of the 3’ end of the sense strand are 2’ -fluoro nucleotides. In some embodiments, the modified sense strand is a modified sense strand sequence set forth in one of Tables 2-3. In some embodiments, the modified antisense strand is a modified antisense strand sequence set forth in one of Tables 2-3.

[0038] In some embodiments, the dsRNA agent includes at least one modified nucleotide and further includes one or more targeting groups or linking groups. In some embodiments, the one or more targeting groups or linking groups are conjugated to the sense strand. In some embodiments, the targeting group or linking group includes N-acetyl-galactosamine (GalNAc) .

[0039] In some embodiments, the targeting group has a structure:

[0040] n” are independently selected from 1 or 2.

[0041] In some embodiments, the targeting group has a structure:

[0042] In certain embodiments, the dsRNA agent includes a targeting group that is conjugated to the 5’ -terminal end of the sense strand. In some embodiments, the dsRNA agent includes a targeting group that is conjugated to the 3'-terminal end of the sense strand.

[0043] In some embodiments, the antisense strand includes one inverted abasic residue at 3’ -terminal end.

[0044] In certain embodiments, the sense strand includes one or two inverted abasic residues and / or one or two imann residues at 3’ or / and 5’ terminal end. In certain embodiments, each end of the sense strand includes one inverted abasic residue. In certain embodiments, each end of the sense strand includes one imann residue. In some embodiments, one or more inverted abasic residues or one or more imann residues conjugate to either end or both ends of the sense strand via phosphorothioate linkages. In some embodiments, the targeting group further conjugates to either end of the sense strand via a phosphorothioate linkage. In some embodiments, the targeting group further conjugates to 5’ -end of the sense strand via a phosphorothioate linkage. In certain embodiments, includes one inverted abasic residue or imann residues at the 5'terminal end of the sense strand, wherein inverted abasic residue or imann residues is linked to an adjacent nucleotide via a phosphorothioate linkage to the 5'terminal end of the nucleotide sequence of the sense strand. In certain embodiments, the sense strand further includes targeting group linked to an inverted abasic residue or an imann residue at the 5'terminal end of the sense strand, wherein targeting group is linked to an adjacent inverted abasic residue or imann residue via a phosphorothioate linkage, and optionally targeting group is N-acetyl-galactosamine (GalNAc) .

[0045] In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand includes a 3’ overhang of at least 1 nucleotide. In some embodiments, at least one strand includes a 3’ overhang of at least 2 nucleotides.

[0046] In certain embodiments, the dsRNA comprises a duplex selected from AV04969, AV04970, AV04971, AV04972, AV04973, AV04974, AV04975, AV04976, AV04977, AV04978, AV04979, AV04980 and wherein duplex optionally including a targeting ligand. In certain embodiments, the dsRNA comprises a duplex selected from the group consisting of AD01444, AD01444-1, AD01444-2, AD01444-3, AD00193, AD00193-1, AD00193-2, AD00193-4, AD01424, AD01428, AD01447, AD01447-1, AD01447-2, AD01447-3, AD01447-4.

[0047] According to another aspect of the invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of C3 is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to part of a C3 RNA transcript, wherein each strand is about 15 to about 30 nucleotides in length, wherein the sense strand comprises sequence may be represented by formula (A) :

[0048] 5′- (N′L) n′N′L N′L N′L N′L N′F N′L N′F N′L N′N1 N′N2 N′L N′L N′L N′L N′L (N′L) m′-3′ (A)

[0049] wherein:

[0050] each N′F represents a 2'-fluoro-modified nucleotide; each N′N1 and N′N2 independently represents a modified or unmodified nucleotide; each N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and m′and n′are each independently an integer of 0 to 7.

[0051] In some embodiments, N′N1 and N′N2 include only one 2'-fluorine modified nucleotides.

[0052] In some embodiments, N′N1 independently represents a 2'-fluoro-modified nucleotide.

[0053] In some embodiments, N′N2 independently represents a 2'-fluoro-modified nucleotide.

[0054] In some embodiments, m′is 2 and n′is 4, or m′is 2 and n′is 2. In some embodiments, m′is 1 and n′is 4, or m′is 1 and n′is 2. In some embodiments, m′is 0 and n′is 4, or m′is 0 and n′is 2.

[0055] In some embodiments, the dsRNA agent includes a targeting group that is conjugated to the 5’ -terminal end of the sense strand, preferably, the targeting group is any one selected from aforesaid GLO-1 through GLO-16 and GLS-1*through GLS-16*, more preferably, the targeting group is aforesaid GLS-15*. In certain embodiments, the dsRNA agent includes a targeting group that is conjugated to the 3'-terminal end of the sense strand. In certain embodiments, the antisense strand includes one inverted abasic residue at 3’ -terminal end. In certain embodiments, the sense strand includes one or two inverted abasic residues and / or one or two imann residues at 3’ or / and 5’ terminal end. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an inverted abasic residue. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an imann residue. In certain embodiments, the sense strand includes two inverted abasic residues at 3’ and 5’ terminal end and either residue at 3’ or 5’ terminal end is further conjugated to a targeting group, which preferably is aforesaid GLS-15*. In certain embodiments, the sense strand includes two imann residues at 3’ and 5’ terminal end and either residue at 3’ or 5’ terminal end is further conjugated  to a targeting group, which preferably is aforesaid GLS-15*. In certain embodiments, the sense strand includes one inverted abasic residue or imann residues at the 5'terminal end of the sense strand, wherein inverted abasic residue or imann residues is linked to an adjacent nucleotide via a phosphorothioate linkage to the 5'terminal end of the nucleotide sequence of the sense strand. In certain embodiments, the sense strand further includes targeting group linked to an inverted abasic residue or imann residues at the 5'terminal end of the sense strand, wherein targeting group is linked to an adjacent inverted abasic residue or imann residue via a phosphorothioate linkage, and optionally targeting group is N-acetyl-galactosamine (GalNAc) .

[0056] According to another aspect of the invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of C3 is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a C3 RNA transcript, wherein each strand is about 18 to about 30 nucleotides in length, wherein the antisense strand comprises sequence may be represented by formula (B) :

[0057] 3′- (NL) n NM1 NL NM2 NL NF NL NM3 NM4 NL NL NL NM5 NL NM6 NL NL NF NL-5′ (B)

[0058] wherein:

[0059] each NF represents a 2'-fluoro-modified nucleotide; each NM1, NM2, NM3, NM4, NM5, and NM6 independently represents a modified or unmodified nucleotide; each NL independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and n is an integer of 0 to 7.

[0060] In some embodiments, NM1, NM2, NM3, NM4, NM5, and NM6 have only three 2'-fluoro-modified nucleotides.

[0061] In some embodiments, NM2, NM3 and NM5 each independently represents a 2'-fluoro-modified nucleotide.

[0062] In some embodiments, NM2, NM4 and NM5 each independently represents a 2'-fluoro-modified nucleotide.

[0063] In some embodiments, NM1, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide.

[0064] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide.

[0065] In some embodiments, NM2, NM4 and NM6 each independently represents a 2'-fluoro-modified nucleotide.

[0066] In some embodiments, NM1, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide and NM5 represents an UNA modified nucleotide.

[0067] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide and NM5 represents an UNA modified nucleotide.

[0068] In some embodiments, NM2, NM4 and NM6 each independently represents a 2'-fluoro-modified nucleotide and NM5 represents an UNA modified nucleotide.

[0069] In some embodiments, n is 1, or n is 2, or n is 3, or n is 5.

[0070] According to another aspect of the invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of C3 is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein said sense strand is complementary to the antisense strand, wherein said antisense strand comprises a region of complementarity to a C3 RNA transcript, wherein the region of complementarity comprises at least 15 contiguous nucleotides, wherein the dsRNA duplex comprises represented by formula (C) :

[0071] sense: 5′- (N′L) n′N′L N′L N′L N′L N′F N′L N′F N′L N′N1 N′N2 N′L N′L N′L N′L N′L (N′L) m′-3′

[0072] antisense: 3′- (NL) n NM1 NL NM2 NL NF NL NM3 NM4 NL NL NL NM5 NL NM6 NL NL NF NL-5′ (C)

[0073] wherein:

[0074] each strand is about 18 to about 30 nucleotides in length;

[0075] each NF and N′F independently represents a 2'-fluoro-modified nucleotide; NM1, NM2, NM3, NM4, NM5, NM6, N′N1, and N′N2 each independently represents a modified or unmodified nucleotide; each NL and N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and m′, n′and n are each independently an integer of 0 to 7.

[0076] In some embodiments, NM1, NM2, NM3, NM4, NM5, and NM6 have only three 2'-fluoro-modified nucleotides, N′N1 and N′N2 include only one 2'-fluorine modified nucleotides.

[0077] In some embodiments, m′is 2 and n′is 4, m′is 2 and n′is 6, or m′is 2 and n′is 2. In some embodiments, m′is 1 and n′is 4, or m′is 1 and n′is 2. In some embodiments, m′is 0 and n′is 4, or m′is 0 and n′is 2. In some embodiments, n is 1, or n is 2, or n is 3, or n is 5.

[0078] In some embodiments, N′N1 independently represents a 2'-fluoro-modified nucleotide.

[0079] In some embodiments, N′N2 independently represents a 2'-fluoro-modified nucleotide.

[0080] In some embodiments, NM2, NM3 and NM5 each independently represents a 2'-fluoro-modified nucleotide.

[0081] In some embodiments, NM2, NM4 and NM5 each independently represents a 2'-fluoro-modified nucleotide.

[0082] In some embodiments, NM1, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide.

[0083] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide.

[0084] In some embodiments, NM2, NM4 and NM6 each independently represents a 2'-fluoro-modified nucleotide.

[0085] In some embodiments, NM1, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide and NM5 represents an UNA modified nucleotide.

[0086] In some embodiments, NM2, NM3 and NM6 each independently represents a 2'-fluoro-modified nucleotide and NM5 represents an UNA modified nucleotide.

[0087] In some embodiments, NM2, NM4 and NM6 each independently represents a 2'-fluoro-modified nucleotide and NM5 represents an UNA modified nucleotide.

[0088] In some embodiments, the dsRNA agent includes a targeting group that is conjugated to the 5’ -terminal end of the sense strand, preferably, the targeting group is any one selected from aforesaid GLO-1 through GLO-16 and GLS-1*through GLS-16*, more preferably, the targeting group is aforesaid GLS-15*. In certain embodiments, the dsRNA agent includes a targeting group that is conjugated to the 5'-terminal end of the sense strand. In certain embodiments, the antisense strand includes one inverted abasic residue at 3’ -terminal end. In certain embodiments, the sense strand includes one or two inverted abasic residues and / or one or two imann residues at 3’ or / and 5’ terminal end. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an inverted abasic residue. In certain embodiments, each 3’ and 5’ terminal end of the sense strand independently includes an imann residue. In certain embodiments, the sense strand includes two inverted abasic residues at 3’ and 5’ terminal end and either residue at 3’ or 5’ terminal end is further conjugated to a targeting group, which preferably is aforesaid GLS-15*. In certain embodiments, the sense strand includes two imann residues at 3’ and 5’ terminal end and either residue at 3’ or 5’ terminal end is further conjugated to a targeting group, which preferably is aforesaid GLS-15*. In certain embodiments, the dsRNA agent has two blunt ends. In certain embodiments, at least one strand includes a 3’ overhang of at least 1 nucleotide. In certain embodiments, at least one strand includes a 3’ overhang of at least 2 nucleotides. In some embodiments, one or more inverted abasic residues or one or more imann residues conjugate to either end or both ends of the sense strand via phosphorothioate linkages. In some embodiments, the targeting group further conjugates to either end of the sense strand via a phosphorothioate linkage. In certain embodiments, each end of the sense strand includes one inverted abasic residue or imann residues at the 5'terminal end of the sense strand, wherein inverted abasic residue or imann residues is linked to an adjacent nucleotide via a phosphorothioate linkage to the 5'terminal end of the nucleotide sequence of the sense strand. In certain embodiments, the sense strand further includes targeting group linked to an inverted abasic residue or imann residues at the 5'terminal end of the sense strand, wherein targeting  group is linked to an adjacent inverted abasic residue or imann residue via a phosphorothioate linkage, and optionally targeting group is N-acetyl-galactosamine (GalNAc) . In some embodiments of aforesaid dsRNA agents, the region of complementarity to part of an C3 mRNA transcript comprises at least 15, 16, 17, 18 or 19 contiguous nucleotides differing by no more than 0, 1, 2, or 3 nucleotides from the complement of any one of the aforesaid target regions of C3 mRNA transcript. In certain embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments of aforesaid dsRNA agents, the C3 mRNA transcript is SEQ ID NO: 1.

[0089] In some embodiments, any one of the sense strands in Table 1 may further be modified in a pattern shown in aforesaid Formula (A) or (C) .

[0090] In some embodiments, any one of the antisense strands in Table 1 may further be modified in a pattern shown in aforesaid Formula (B) or (C) .

[0091] In some embodiments, any one of the duplexes in Table 1 may further be modified in a pattern shown in aforesaid Formula (C) .

[0092] In some embodiments, the dsRNA agent includes an antisense strand sequence set forth in any one of Tables 1.

[0093] According to an aspect of the invention, a composition is provided that includes any embodiment of the aforementioned dsRNA agent aspect of the invention. In certain embodiments, the composition also includes a pharmaceutically acceptable carrier. In some embodiments, the composition also includes one or more additional therapeutic agents. In certain embodiments, the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous administration or is formulated for intravenous (IV) administration.

[0094] According to another aspect of the invention a cell is provided that includes any embodiment of an aforementioned dsRNA agent aspect of the invention. In some embodiments, the cell is a mammalian cell, optionally a human cell.

[0095] According to another aspect of the invention, a method of inhibiting the expression of a C3 gene in a cell, is provided, the method including: (i) preparing a cell including an effective amount of any embodiment of the aforementioned dsRNA agent aspect of the invention or any embodiment of an aforementioned composition of the invention. In certain embodiments, the method also includes: (ii) maintaining the prepared cell for a time sufficient to obtain degradation of the mRNA transcript of a C3 gene, thereby inhibiting expression of the C3 gene in the cell. In some embodiments, the cell is in a subject and the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the cell is in a subject and the dsRNA agent is administered to the subject by IV administration. In certain embodiments, the method also includes assessing inhibition of the C3 gene, following the administration of the dsRNA agent to the subject, wherein a means for the assessing comprises: (i) determining one or more physiological characteristics of a C3-associated disease or condition in the subject and (ii)  comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the C3-associated disease or condition and / or to a control physiological characteristic of the C3-associated disease or condition, wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the C3 gene in the subject. In some embodiments, the physiological characteristic is one or more of: the C3 mRNA level and the C3 protein level. In certain embodiments, the determined physiological characteristic is C3 levels in blood. In certain embodiments, paroxysmal nocturnal hemoglobinuria (PNH) , a relatively rare disorder comprising an acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobin Physiological characteristics identified by urine, bone marrow failure, and thrombophilia (proneness to form blood clots) . A decrease in C3 levels and / or C3 in the blood indicates a decrease in C3 gene expression in the subject.

[0096] According to another aspect of the invention, a method of inhibiting expression of a C3 gene in a subject, is provided, the method including administering to the subject an effective amount of an embodiment of the aforementioned dsRNA agent aspect of the invention or an embodiment of an aforementioned composition of the invention. In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In certain embodiments, the dsRNA agent is administered to the subject by IV administration. In some embodiments, the method also includes: assessing inhibition of the C3 gene, following the administration of the dsRNA agent, wherein a means for the assessing comprises: (i) determining one or more physiological characteristics of a C3-associated disease or condition in the subject and (ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the C3-associated disease or condition and / or to a control physiological characteristic of the C3-associated disease or condition, wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the C3 gene in the subject. In some embodiments, expression of the C3 gene can be assessed based on the level or change in level of any variable associated with C3 gene expression, such as C3 mRNA level, C3 protein level.

[0097] According to another aspect of the invention, a method of treating a disease or condition associated with the presence of C3 protein is provided, the method including: administering to a subject an effective amount of an embodiment of any aforementioned dsRNA agent aspect of the invention or an embodiment of any aforementioned composition of the invention, to inhibit C3 gene expression. In some embodiments, the disease, disorder or condition associated with C3 is selected from the group consisting of: C3 Glomerulopathy (C3G) , atypical Hemolytic Uremic Syndrome (aHUS) , Immune Complex-mediated Glomerulonephritis (IC-mediated GN) , C3 glomerulonephritis, post-Infectious Glomerulonephritis (PIGN) , Systemic Lupus Erythematosus, Lupus nephritis, Ischemia / reperfusion injury , IgA nephropathy (IgA N; ) , age-related macular degeneration (AMD) , Rheumatoid arthritis (RA) , antineutrophil Cytoplasmic Autoantibodies-associated Vasculitis (ANCA-AV) , dysbiotic periodontal Disease, Malarial  Anaemia, Paroxysmal Nocturnal Hemoglobinuria (PNH) , sepsis, neuromyelitis optica (NMO) , multifocal motor neuropathy (MMN) , myasthenia gravis (MG) , rheumatoid arthritis, and neurodegenerative diseases.

[0098] In some embodiments, the method also includes: administering an additional therapeutic regimen to the subject. In some embodiments, the additional therapeutic regimen includes a treatment for the C3-associated disease or condition. In certain embodiments, the additional therapeutic regimen comprises: administering to the subject one or more C3 antisense polynucleotides of the invention, administering to the subject a non-C3 dsRNA therapeutic agent, and a behavioral modification in the subject. additional therapeutic select from an inhibitor of C5, such as an anticomplement component C5 antibody, or antigen-binding fragment thereof (e.g., eculizumab, ravulizumab-cwvz, or pozelimab (REGN3918) ) or a C5 peptide inhibitor (e.g., zilucoplan) ; C3 peptide inhibitor, such as compstatin.

[0099] In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In certain embodiments, the dsRNA agent is administered to the subject by IV administration. In some embodiments, the method also includes determining an efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject.

[0100] In some embodiments, a means of determining an efficacy of the treatment in the subject comprises: (i) determining one or more physiological characteristics of the C3-associated disease or condition in the subject and (ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the C3-associated disease or condition wherein the comparison indicates one or more of a presence, absence, and level of efficacy of the administration of the double-stranded ribonucleic acid (dsRNA) agent to the subject.

[0101] In some embodiments, expression of the C3 gene can be assessed based on the level or change in level of any variable associated with C3 gene expression, such as C3 mRNA level, C3 protein level in the subject.

[0102] According to another aspect of the invention, a method of decreasing a level of C3 protein in a subject compared to a baseline pre-treatment level of C3 protein in the subject, is provided, the method including administering to the subject an effective amount of an embodiment of any aforementioned dsRNA agent of the invention or an embodiment of any aforementioned composition of the invention, to decrease the level of C3 gene expression. In some embodiments, the dsRNA agent is administered to the subject subcutaneously or is administered to the subject by IV administration.

[0103] According to another aspect of the invention, a method of altering a physiological characteristic of a C3-associated disease or condition in a subject compared to a baseline pre-treatment physiological characteristic of the C3-associated disease or condition in the subject is provided, the method including administering to the subject an effective amount of an embodiment of any aforementioned dsRNA agent of the invention or an embodiment of any aforementioned composition of the invention, to alter the physiological characteristic of the C3-associated disease or condition in the subject. In some embodiments, the dsRNA agent is  administered to the subject subcutaneously or is administered to the subject by IV administration. In certain embodiments, the physiological characteristic and symptoms are one or more of: C3 mRNA level, C3 protein level in the subject. In certain embodiments, paroxysmal nocturnal hemoglobinuria (PNH) , a relatively rare disorder comprising an acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobin Physiological characteristics identified by urine, bone marrow failure, and thrombophilia (proneness to form blood clots) .

[0104] According to another aspect of the invention, the aforementioned dsRNA agent for use in a method of treating a disease or condition associated with the presence of C3 protein is provided. In some embodiments, the disease or condition is one or more of: C3 Glomerulopathy (C3G) , atypical Hemolytic Uremic Syndrome (aHUS) , Immune Complex-mediated Glomerulonephritis (IC-mediated GN) , C3 glomerulonephritis, post-Infectious Glomerulonephritis (PIGN) , Systemic Lupus Erythematosus, Lupus nephritis, Ischemia / reperfusion injury , IgA nephropathy (IgA N; ) , age-related macular degeneration (AMD) , Rheumatoid arthritis (RA) , antineutrophil Cytoplasmic Autoantibodies-associated Vasculitis (ANCA-AV) , dysbiotic periodontal Disease, Malarial Anaemia, Paroxysmal Nocturnal Hemoglobinuria (PNH) , sepsis, neuromyelitis optica (NMO) , multifocal motor neuropathy (MMN) , myasthenia gravis (MG) , rheumatoid arthritis, and neurodegenerative diseases.

[0105] Brief Description of the Sequences

[0106] SEQ ID NO: 1 are Homo sapiens C3 mRNA [NCBI Reference Sequence: NM_000064.4] .

[0107] SEQ ID NOs: 2-24 , 110 , 112 are shown in Table 1 and are sense strand sequences.

[0108] SEQ ID NOs: 25-47, 111, 113 are shown in Table 1 and are antisense strand sequences.

[0109] SEQ ID NOs: 48-71 are shown in Table 2 with chemical modifications.

[0110] SEQ ID NOs: 72-101, 102-107 are shown in Table 3. A delivery molecule is indicated as “GLX-__” at the 3’ end or 5’ end of each sense strand.Brief Description of the Drawings

[0111] Figure 1 is a graph showing C3 siRNA (AD01444, AD01428, AD01447) in monkey serum protein silencing effect after a single subcutaneous dose of siRNA compounds at 5 mg / kg.

[0112] Figure 2 is a graph showing C3 siRNA (AD00193-3, AD01444, AD01444-3, AD01447-2) in monkey serum protein silencing effect after a single subcutaneous dose of siRNA compounds at 5 mg / kg.

[0113] Figure 3 is a graph showing C3 siRNA (AD00193-3, AD01447-2, AD01447-4, AD01447-5, AD01447-6) in monkey liver biopsy C3 mRNA silencing effect after a single subcutaneous dose of siRNA compounds at 6 mg / kg.Detailed Description

[0114] The invention in part, includes RNAi agents, for example, though not limited to double stranded (ds) RNAi agents, which are capable of inhibiting complement component3 (C3) gene expression. The invention, in part also includes compositions comprising C3 RNAi agents and methods of use of the compositions. C3 RNAi agents disclosed herein may be attached to delivery compounds for delivery to cells, including to hepatocytes. Pharmaceutical compositions of the invention may include at least one dsRNA C3 agent and a delivery compound. In some embodiments of compositions and methods of the invention, the delivery compound is a GalNAc-containing delivery compound. C3 RNAi agents delivered to cells are capable of inhibiting C3 gene expression, thereby reducing activity in the cell of the C3 protein product of the gene. dsRNAi agents of the invention can be used to treat C3-associated diseases and conditions.

[0115] In some embodiments of the invention reducing C3 expression in a cell or subject treats a disease or condition associated with C3 expression in the cell or subject, respectively. Non-limiting examples of diseases and conditions that may be treated by reducing C3 activity . In certain embodiments, paroxysmal nocturnal hemoglobinuria (PNH) , a relatively rare disorder comprising an acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobin Physiological characteristics identified by urine, bone marrow failure, and thrombophilia (proneness to form blood clots) . "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment.

[0116] As used herein, "G, " "C, " "A" and "U" each generally stand for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person understands that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the invention by a nucleotide containing, for example, inosine. Sequences comprising such replacement moieties are embodiments of the invention.

[0117] As used herein, "complement component 3 " used interchangeably with the term "C3" refers to the naturally occurring gene that encodes a complement component 3 protein from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, porcine, ovine, primate, monkey, and guinea pig, unless specified otherwise. The term also refers to fragments and variants of native C3 that maintain at least one in vivo or in vitro activity of a native C3. The amino acid and complete coding sequences of the reference sequence of the human C3 gene may be found in, for example, GenBank Ref Seq Accession No. NM_000064.4 (SEQ ID NO: 1) . Additional examples of C3 mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, Ensembl and OMIM.

[0118] The following describes how to make and use compositions comprising C3 single-stranded (ssRNA) and dsRNA agents to inhibit C3 gene expression, as well as compositions and methods for treating diseases and conditions caused by or modulated by C3 gene expression. The term “RNAi” is also known in the art, and may be referred to as “siRNA” .

[0119] As used herein, the term “RNAi” refers to an agent that comprises RNA and mediates targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. As is known in the art, an RNAi a target region refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a gene, including messenger RNA (mRNA) that is a product of RNA processing of a primary transcription product. The target portion of the sequence will be at least long enough to serve as a substrate for RNAi-directed cleavage at or near that portion. A target sequence may be from 8-30 nucleotides long (inclusive) , from 10 -30 nucleotides long (inclusive) , from 12 -25 nucleotides long (inclusive) , from 15 -23 nucleotides long (inclusive) , from 16 -23 nucleotides long (inclusive) , or from 18 –23 nucleotides long (inclusive) , including all shorter lengths within each stated range. In some embodiments of the invention, a target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides long. In certain embodiment a target sequence is between 9 and 26 nucleotides long (inclusive) , including all sub-ranges and integers there between. For example, though not intended to be limiting, in certain embodiments of the invention a target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long, with the sequence fully or at least substantially complementary to at least part of an RNA transcript of a C3 gene. Some aspects of the invention include pharmaceutical compositions comprising one or more C3 dsRNA agents and a pharmaceutically acceptable carrier. In certain embodiments of the invention, a C3 RNAi as described herein inhibits expression of C3 protein.

[0120] As used herein, a “dsRNA agent” means a composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner. Although not wishing to be limited to a particular theory, dsRNA agents of the invention may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced  silencing complex or RISC) of mammalian cells) , or by any alternative mechanism (s) or pathway (s) . Methods for silencing genes in plant, invertebrate, and vertebrate cells are well known in the art [see, for example, (Sharp et al., Genes Dev. 2001, 15: 485; Bernstein, et al., (2001) Nature 409: 363; Nykanen, et al., (2001) Cell 107: 309; and Elbashir, et al., (2001) Genes Dev. 15: 188) ] , the disclosure of each of which is incorporated herein by reference in its entirety. ] . Art-known gene silencing procedures can be used in conjunction with the disclosure provided herein to inhibit expression of C3.

[0121] DsRNA agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short interfering RNAs (siRNAs) , RNAi agents, micro RNAs (miRNAs) , short hairpin RNAs (shRNA) , and dicer substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the mRNA being targeted. It is understood in the art that different lengths of dsRNA duplex structure can be used to inhibit target gene expression. For example, dsRNAs having a duplex structure of 19, 20, 21, 22, and 23 base pairs are known to be effective to induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888) . It is also known in the art that shorter or longer RNA duplex structures are also effective to induce RNA interference. In some embodiments, the sense strand and the antisense strand may be the same length or different lengths. In some embodiments, each strand is no more than 40 nucleotides in length. In some embodiments, each strand is no more than 30 nucleotides in length. In some embodiments, each strand is no more than 25 nucleotides in length. In some embodiments, each strand is no more than 23 nucleotides in length. In some embodiments, each strand is no more than 21 nucleotides in length. In some embodiments, the sense and antisense strands of the RNAi agents can each be 15 to 49 nucleotides in length. In some embodiments, the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the length of the sense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, the sense strand and the antisense strand are both 21 nucleotides in length. In some embodiments, the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 15 and 23 nucleotides in length. In some embodiments, the region of complementarity is 19-21 nucleotides in length. In some embodiments, the region of complementarity is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. C3 dsRNAs in certain embodiments of the invention can include at least one strand of a length of minimally 21 nt or may have shorter duplexes based on one of the sequences set forth in any one of Tables 1-3, but minus 1, 2, 3, or 4 nucleotides on one or both ends may also be effective as compared to the dsRNAs set forth in Tables 1-3, respectively. In some embodiments of the invention, C3 dsRNA agents may have a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one or more sequences of Tables 1-3, and differ in their ability to inhibit the expression of a C3 gene by not more than 5%, 10%, 15%, 20%, 25%, or 30%from the level of inhibition resulting from a dsRNA comprising the full  sequence. A sense sequence, an antisense sequence and a duplex disclosed in Tables 1-3 may be referred to herein as a “parent” sequence, meaning that the sequences disclosed in Tables 1-3 may be modified, shorten, lengthened, include substitutions, etc. as set forth herein, with the resulting sequences retaining all or at least a portion of the efficacy of their parent sequences in methods and compositions of the invention. Sense and antisense strands included in a dsRNA of the invention are independently selected. As used herein the term “independently selected” means each of two or more like elements can be selected independent of the selection of the other elements. For example, though not intended to be limiting, in preparing a dsRNA of the invention, one may select the “elements” of the two strands to include in the duplex. One selected element, the sense sequence may be SEQ ID NO: 56 (shown in Table 2) and the other selected element, the antisense sequence, may be SEQ ID NO: 68, or may be SEQ ID NO: 68 that is modified, shortened, lengthened, and / or includes 1, 2, or 3 substitutions as compared to its parent sequence SEQ ID NO: 68. It will be understood that a duplex of the invention need not include both sense and antisense sequences shown as paired in duplexes in Tables 1-3. Each sense and antisense strand sequence in the tables is immediately followed by its SEQ ID NO.

[0122] Certain embodiments of compositions and methods of the invention comprise a single-strand RNA in a composition and / or administered to a subject. For example, an antisense strand such as one listed in any one of Tables 1-3 may be a composition or in a composition administered to a subject to reduce C3 polypeptide activity and / or expression of C3 gene in the subject. Tables 1 shows certain C3 dsRNA agent antisense strand and sense strand core stretch base sequences. A single-strand antisense molecule that may be included in certain compositions and / or administered in certain methods of the invention are referred to herein as a “single-strand antisense agent” or an “antisense polynucleotide agent” . A single-strand sense molecule that may be included in certain compositions and / or administered in certain methods of the invention are referred to herein as a “single-strand sense agent” or a “sense polynucleotide agent” . The term “base sequence” is used herein in reference to a polynucleotide sequence without chemical modifications or delivery compounds. For example, the sense strand GUCUACGAAGCUCAUGAAUAA (SEQ ID NO: 10) shown in Table 1 is the base sequence for SEQ ID NO: 56 in Table 2 and for SEQ ID NO: 83 , or 84, 86, and / or 87 in Table 3, with SEQ ID NO: 56 and SEQ ID NO: 83 , or 84, 86, and / or 87 shown with their chemical modifications and a delivery compound. Sequences disclosed herein may be assigned identifiers. For example, a single-stranded sense sequence may be identified with a “Sense strand SS#” ; a single stranded antisense sequence may be identified with an “Antisense strand AS#” and a duplex that includes a sense strand and an antisense strand may be identified with a “Duplex AD# / AV#” .

[0123] Table 1 includes sense and antisense strands and provides the identification number of duplexes formed from the sense and antisense strand on the same line in Table 1. In certain embodiments of the invention an antisense sequence includes nucleobase u or nucleobase a in position 1 of the antisense sequence. In certain embodiments of the invention an antisense  sequence includes nucleobase u in position 1 of the antisense sequence. As used herein, the term “matching position” in a sense and an antisense strand are the positions in each strand that “pair” when the two strands are duplexed strands. For example, in a 21 nucleobases sense strand and a 21 nucleobases antisense strand, nucleobase in position 1 of the sense strand and position 21 in the antisense strand are in “matching positions” . In yet another non-limiting example in a 23 nucleobases sense strand and a 23 nucleobases antisense strand, nucleobase 2 of the sense strand and position 22 of the antisense strand are in matching positions. In another non-limiting example, in an 18 nucleobases sense strand and an 18 nucleobases antisense strand, nucleobase in position 1 of the sense strand and nucleobase 18 in the antisense strand are in matching positions, and nucleobase 4 in the sense strand and nucleobase 15 in the antisense strand are in matching positions. A skilled artisan will understand how to identify matching positions in sense and antisense strands that are or will be duplexed strands and paired strands.

[0124] The final column in Table 1 indicates a Duplex AV#for a duplex that includes the sense and antisense sequences in the same table row. For example, Table 1 discloses the duplex assigned Duplex AV01447. um, which includes sense strand SEQ ID NO: 10 and antisense strand SEQ ID NO: 33. Thus, each row in Table 1 identifies a duplex of the invention, each comprising the sense and antisense sequences shown in the same row, with the assigned identifier for each duplex shown in the first column in the row.

[0125] In some embodiments of methods of the invention, an RNAi agent comprising a polynucleotide sequence shown in any one of Tables 1-3 is administered to a subject. In some embodiments of the invention an RNAi agent administered to a subject comprises is a duplex comprising at least one of the base sequences set forth in Table 1, including 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 sequence modifications. In some embodiments of methods of the invention an RNAi agent comprising a polynucleotide sequence shown in any one of Tables 1-3 is attached to a delivery molecule, a non-limiting example of which is a delivery compound comprising a GalNAc compound, or a GLS-15*compound.

[0126] Table 1: Unmodified C3 RNAi agent antisense strand and sense strand sequences. All sequences shown 5’ to 3’ direction. Duplex AV#are the number assigned to the duplex of the two strands in the same row in the table.

[0127] In certain embodiments of the invention a dsRNA (also referred to herein as a “duplex” ) is one disclosed in one of Tables 1-3. Each row in Tables 1-3 discloses a duplex comprising the sequence of the sense strand and the sequence of the antisense strand in that table row. In addition to the duplexes disclosed in Tables 1-3, it will be understood that in some embodiments, a duplex of the invention may include sense and antisense sequences shown in Tables 1-3, that differ by zero, one, two, or three nucleotides shown in a sequence shown in Tables 1-3. Thus, as non-limiting examples, in some embodiments, an antisense strand in a duplex of the invention may be SEQ ID NO: 86, 87, 88, or 90 with zero, one, two, or three different nucleotides than those in SEQ ID NO: 86, 87, 88, or 90 respectively.

[0128] It will be understood that the sequence of the sense strand and the sequence of the antisense strand in a duplex of the invention may be independently selected. Thus, a dsRNA of the invention may comprise a sense strand and an antisense strand of a duplex disclosed in a row in Tables 1-3. Alternatively, in a dsRNA of the invention, one or both of the selected sense and antisense strand in the dsRNA may include sequences shown in Tables 1-3 but with one or both of the sense and antisense sequences including 1, 2, 3, or more nucleobase substitutions from the parent sequence. The selected sequences may in some embodiments be longer or shorter than their parent sequence. Thus, dsRNA agents included in the invention can but need not include exact sequences of the sense and antisense pairs disclosed as duplexes in Tables 1-3.

[0129] In some embodiments, a dsRNA agent comprises a sense strand and an antisense strand, nucleotide positions 2 to 18 in the antisense strand comprising a region of complementarity to a C3 RNA transcript, wherein the region of complementarity comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally comprising a targeting ligand. In some instances, the region of complementarity to the C3 RNA transcript comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by no more than 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3. In some embodiments of a dsRNA agent of the invention, the antisense strand of the dsRNA is at least substantially complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments, an antisense strand of a dsRNA agent of the invention is fully complementary to any one of a target region of SEQ ID NO: 1 and is provided in any one of Tables 1-3. In some embodiments a dsRNA agent includes a sense strand sequence set forth in any one of Tables 1-3, and the sense strand sequence  is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In other embodiments, a dsRNA agent of the invention comprises a sense strand sequence set forth in any one of Tables 1-3, and the sense strand sequence is fully complementary to the antisense strand sequence in the dsRNA agent. In some instances, a dsRNA agent of the invention comprises an antisense strand sequence set forth in any one of Tables 1-3. Some embodiments of a dsRNA agent of the invention comprises the sense and antisense sequences disclosed as duplex in any of Tables 1-3. As described herein, it will be understood that the sense and antisense strands in a duplex of the invention may be independently selected.

[0130] Mismatches

[0131] It is known to skilled in art, mismatches are tolerated for efficacy in dsRNA, especially the mismatches are within terminal region of dsRNA. Certain mismatches tolerate better, for example mismatches with wobble base pairs G: U and A: C are tolerated better for efficacy (Du et el., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21; 33 (5) : 1671-7. Doi: 10.1093 / nar / gki312. Nucleic Acids Res. 2005; 33 (11) : 3698) . Some embodiments of methods and compounds of the invention a C3 dsRNA agent may contain one or more mismatches to the C3 target sequence. In some embodiments, C3 dsRNA agent of the invention includes no mismatches. In certain embodiments, C3 dsRNA agent of the invention includes no more than 1 mismatch. In some embodiments, C3 dsRNA agent of the invention includes no more than 2 mismatches. In certain embodiments, C3 dsRNA agent of the invention includes no more than 3 mismatches. In some embodiments of the invention, an antisense strand of a C3 dsRNA agent contains mismatches to a C3 target sequence that are not located in the center of the region of complementarity. In some embodiments, the antisense strand of the C3 dsRNA agent includes 1, 2, 3, 4, or more mismatches that are within the last 5, 4, 3, 2, or 1 nucleotide from one or both of the 5'or 3'end of the region of complementarity. Methods described herein and / or methods known in the art can be used to determine whether a C3 dsRNA agent containing a mismatch to a C3 target sequence is effective in inhibiting the expression of the C3 gene.

[0132] Complementarity

[0133] As used herein, unless otherwise indicated, the term “complementary, ” when used to describe a first nucleotide sequence (e.g., C3 dsRNA agent sense strand or targeted C3 mRNA) in relation to a second nucleotide sequence (e.g., C3 dsRNA agent antisense strand or a single-stranded antisense polynucleotide) , means the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize [form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro) ] and form a duplex or double helical structure under certain conditions with an oligonucleotide or polynucleotide including the second nucleotide sequence. Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. A skilled artisan will be able  to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification.

[0134] Complementary sequences, for example, within a C3 dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. It will be understood that in embodiments when two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs are not regarded herein as mismatches with regard to the determination of complementarity. For example, a C3 dsRNA agent comprising one oligonucleotide 19 nucleotides in length and another oligonucleotide 20 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 19 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein. Thus, as used herein, “fully complementary” means that all (100%) of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0135] The term “substantially complementary” as used herein means that in a hybridized pair of nucleobase sequences, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. The term “substantially complementary” can be used in reference to a first sequence with respect to a second sequence if the two sequences include one or more, for example at least 1, 2, 3, 4, or 5 mismatched base pairs upon hybridization for a duplex up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs (bp) , while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of C3 gene expression via a RISC pathway.

[0136] The term, “partially complementary” may be used herein in reference to a hybridized pair of nucleobase sequences, in which at least 75%, but not all, of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. In some embodiments, “partially complementary” means at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%of the bases in a contiguous sequence of a first polynucleotide will hybridize with the same number of bases in a contiguous sequence of a second polynucleotide.

[0137] The terms “complementary, ” “fully complementary, ” “substantially complementary, ” and “partially complimentary” are used herein in reference to the base matching between the sense strand and the antisense strand of a C3 dsRNA agent, between the antisense strand of a C3 dsRNA agent and a sequence of a target C3 mRNA, or between a single-stranded antisense oligonucleotide and a sequence of a target C3 mRNA. It will be understood that the term “antisense strand of a C3 dsRNA agent” may refer to the same sequence of an “C3 antisense polynucleotide agent” .

[0138] As used herein, the term “substantially identical” or “substantial identity” used in reference to a nucleic acid sequence means a nucleic acid sequence comprising a sequence with at least about 85%sequence identity or more, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, compared to a reference sequence. Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The inventions disclosed herein encompasses nucleotide sequences substantially identical to those disclosed herein. e.g., in Tables 1-3. In some embodiments, the sequences disclosed herein are exactly identical, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%percent identical to those disclosed herein, e.g., in Tables 1-3.

[0139] As used herein, the term “strand comprising a sequence” means an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature. The term “double-stranded RNA” or “dsRNA, ” as used herein, refers to an RNAi that includes an RNA molecule or complex of molecules having a hybridized duplex region comprising two anti-parallel and substantially or fully complementary nucleic acid strands, which are referred to as having “sense” and “antisense” orientations with respect to a target C3 RNA. The duplex region can be of any length that permits specific degradation of a desired target C3 RNA through a RISC pathway but will typically range from 9 to 30 base pairs in length, e.g., 15-30 base pairs in length. Considering a duplex between 9 and 30 base pairs, the duplex can be any length in this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any sub-range therein between, including, but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. C3 dsRNA agents generated in the cell by processing  with Dicer and similar enzymes are generally in the range of 19-22 base pairs in length. One strand of the duplex region of a C3 dsDNA agent comprises a sequence that is substantially complementary to a region of a target C3 RNA. The two strands forming the duplex structure can be from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. Where the duplex region is formed from two strands of a single molecule, the molecule can have a duplex region separated by a single stranded chain of nucleotides (herein referred to as a “hairpin loop” ) between the 3'-end of one strand and the 5'-end of the respective other strand forming the duplex structure. In some embodiments of the invention, a hairpin look comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more unpaired nucleotides. Where the two substantially complementary strands of a C3 dsRNA agent are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than a hairpin loop, the connecting structure is referred to as a “linker. ” The term “siRNA” is also used herein to refer to a dsRNA agent as described herein.

[0140] In some embodiments of the invention a C3 dsRNA agent may include a sense and antisense sequence that have no-unpaired nucleotides or nucleotide analogs at one or both terminal ends of the dsRNA agent. An end with no unpaired nucleotides is referred to as a “blunt end” and as having no nucleotide overhang. If both ends of a dsRNA agent are blunt, the dsRNA is referred to as “blunt ended. ” In some embodiments of the invention, a first end of a dsRNA agent is blunt, in some embodiments a second end of a dsRNA agent is blunt, and in certain embodiments of the invention, both ends of a C3 dsRNA agent are blunt.

[0141] In some embodiments of dsRNA agents of the invention, the dsRNA does not have one or two blunt ends. In such instances there is at least one unpaired nucleotide at the end of a strand of a dsRNA agent. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least 1, 2, 3, 4, 5, 6, or more nucleotides. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. It will be understood that in some embodiments a nucleotide overhang is on a sense strand of a dsRNA agent, on an antisense strand of a dsRNA agent, or on both ends of a dsRNA agent and nucleotide (s) of an overhang can be present on the 5'end, 3'end or both ends of either an antisense or sense strand of a dsRNA. In certain embodiments of the invention, one or more of the nucleotides in an overhang is replaced with a nucleoside thiophosphate.

[0142] As used herein, the term “antisense strand” or “guide strand” refers to the strand of a C3 dsRNA agent that includes a region that is substantially complementary to a C3 target sequence. As used herein the term “sense strand, ” or “passenger strand” refers to the strand of a C3 dsRNA agent that includes a region that is substantially complementary to a region of the antisense strand of the C3 dsRNA agent.

[0143] Modifications

[0144] In some embodiments of the invention the RNA of a C3 RNAi agent is chemically modified to enhance stability and / or one or more other beneficial characteristics. Nucleic acids in certain embodiments of the invention may be synthesized and / or modified by methods well established in the art, for example, those described in “Current protocols in Nucleic Acid Chemistry, " Beaucage, S. L. et al. (Eds. ) , John Wiley &Sons, Inc., New York, N. Y., USA, which is incorporated herein by reference. Modifications that can be present in certain embodiments of C3 dsRNA agents of the invention include, for example, (a) end modifications, e.g., 5'end modifications (phosphorylation, conjugation, inverted linkages, etc. ) 3'end modifications (conjugation, DNA nucleotides, inverted linkages, etc. ) , (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides) , or conjugated bases, (c) sugar modifications (e.g., at the 2'position or 4'position) or replacement of the sugar, as well as (d) backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of RNA compounds useful in certain embodiments of C3 dsRNA agents, C3 antisense polynucleotides, and C3 sense polynucleotides of the invention include, but are not limited to RNAs comprising modified backbones or no natural internucleoside linkages. As a non-limiting example, an RNA having a modified backbone may not have a phosphorus atom in the backbone. RNAs that do not have a phosphorus atom in their internucleoside backbone may be referred to as oligonucleosides. In certain embodiments of the invention, a modified RNA has a phosphorus atom in its internucleoside backbone.

[0145] It will be understood that the term “RNA molecule” or “RNA” or “ribonucleic acid molecule” encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA comprising one or more ribonucleotide / ribonucleoside analogs or derivatives as described herein or as known in the art. The terms “ribonucleoside” and “ribonucleotide” may be used interchangeably herein. An RNA molecule can be modified in the nucleobase structure or in the ribose-phosphate backbone structure, e.g., as described herein below, and molecules comprising ribonucleoside analogs or derivatives must retain the ability to form a duplex. As non-limiting examples, an RNA molecule can also include at least one modified ribonucleoside including but not limited to a 2'-O-methyl modified nucleoside, a nucleoside comprising a 5'phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino-modified nucleoside, 2'-alkyl-modified nucleoside, morpholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof. In some embodiments of the invention, an RNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or up to the full length of the C3 dsRNA agent molecule’s ribonucleosides that are modified ribonucleosides. The modifications need not be the same for each of such a plurality of modified ribonucleosides in an RNA molecule.

[0146] DsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides of the invention may, in some embodiments comprise one or more independently selected modified nucleotide and / or one or more independently selected non-phosphodiester linkage. As used herein the term “independently selected” used in reference to a selected element, such as a modified nucleotide, non-phosphodiester linkage, etc., means that two or more selected elements can but need not be the same as each other.

[0147] As used herein, a “nucleotide base, ” “nucleotide, ” or “nucleobase” is a heterocyclic pyrimidine or purine compound, which is a standard constituent of all nucleic acids, and includes the bases that form the nucleotides adenine, guanine, cytosine, thymine, and uracil. A nucleobase may further be modified to include, though not intended to be limiting: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. The term “ribonucleotide” or “nucleotide” may be used herein to refer to an unmodified nucleotide, a modified nucleotide, or a surrogate replacement moiety. Those in the art will recognize that guanine, cytosine, adenine, and uracil can be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety.

[0148] In one embodiment, modified RNAs contemplated for use in methods and compositions described herein are peptide nucleic acids (PNAs) that have the ability to form the required duplex structure and that permit or mediate the specific degradation of a target RNA via a RISC pathway. In certain embodiments of the invention, a C3 RNA interference agent includes a single stranded RNA that interacts with a target C3 RNA sequence to direct the cleavage of the target C3 RNA.

[0149] Modified RNA backbones can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5'linkages, 2'-5'linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5'to 5'-3'or 2'-5'to 5'-2'. Various salts, mixed salts and free acid forms are also included. Means of preparing phosphorus-containing linkages are routinely practiced in the art and such methods can be used to prepare certain modified C3 dsRNA agents, certain modified C3 antisense polynucleotides, and / or certain modified C3 sense polynucleotides of the invention.

[0150] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside) ; siloxane backbones; sulfide, sulfoxide  and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Means of preparing modified RNA backbones that do not include a phosphorus atom are routinely practiced in the art and such methods can be used to prepare certain modified C3 dsRNA agents, certain modified C3 antisense polynucleotides, and / or certain modified C3 sense polynucleotides of the invention.

[0151] In certain embodiments of the invention, RNA mimetics are included in C3 dsRNAs, C3 antisense polynucleotides, and / or C3 sense polynucleotides, such as, but not limited to: replacement of the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units with novel groups. In such embodiments, base units are maintained for hybridization with an appropriate C3 nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA) . In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Means of preparing RNA mimetics are routinely practiced in the art and such methods can be used to prepare certain modified C3 dsRNA agents of the invention.

[0152] Some embodiments of the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH2-NH-CH2-, -CH2-N (CH3) -O-CH2- [known as a methylene (methylimino) or MMI backbone] , -CH2-O-N (CH3) -CH2-, -CH2-N (CH3) -N (CH3) -CH2-and -N (CH3) -CH2- [wherein the native phosphodiester backbone is represented as -O-P-O-CH2-] . Means of preparing RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones are routinely practiced in the art and such methods can be used to prepare certain modified C3 dsRNA agents, certain C3 antisense polynucleotides, and / or certain C3 sense polynucleotides of the invention.

[0153] Modified RNAs can also contain one or more substituted sugar moieties. C3 dsRNAs, C3 antisense polynucleotides, and / or C3 sense polynucleotides of the invention may comprise one of the following at the 2'position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Exemplary suitable modifications include O [ (CH2) nO] mCH3, O (CH2) nOCH3, O (CH2) nNH2, O (CH2) nCH3, O (CH2) nONH2, and O (CH2) nON [ (CH2) nCH3) ] 2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2'position: C1 to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of a C3 dsRNA agent, or a group for improving the pharmacodynamic properties of a C3 dsRNA agent, C3 antisense polynucleotide,  and / or C3 sense polynucleotide, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O- (2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78: 486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a O (CH2) 2ON (CH3) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE) , i.e., 2'-O-CH2-O-CH2-N (CH2) 2. Means of preparing modified RNAs such as those described are routinely practiced in the art and such methods can be used to prepare certain modified C3 dsRNA agents of the invention.

[0154] Other modifications include 2'-methoxy (2'-OCH3) , 2'-aminopropoxy (2'-OCH2CH2CH2NH2) and 2'-fluoro (2'-F) . Similar modifications can also be made at other positions on the RNA of a C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide of the invention, particularly the 3'position of the sugar on the 3'terminal nucleotide or in 2'-5'linked C3 dsRNAs, C3 antisense polynucleotides, or C3 sense polynucleotides, and the 5'position of 5'terminal nucleotide. C3 dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Means of preparing modified RNAs such as those described are routinely practiced in the art and such methods can be used to prepare certain modified C3 dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides of the invention.

[0155] An C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide may, in some embodiments, include nucleobase (often referred to in the art simply as "base" ) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine and uracil. Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-Me-C) , 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil) , 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Additional nucleobases that may be included in certain embodiments of C3 dsRNA agents of the invention are known in the art, see for example: Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, Ed. John Wiley &Sons, 1990, English et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC  Press, 1993. Means of preparing dsRNAs, C3 antisense strand polynucleotides and / or C3 sense strand polynucleotides that comprise nucleobase modifications and / or substitutions such as those described herein are routinely practiced in the art and such methods can be used to prepare certain modified C3 dsRNA agents, C3 sense polynucleotides, and / or C3 antisense polynucleotides of the invention.

[0156] Certain embodiments of C3 dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides of the invention include RNA modified to include one or more locked nucleic acids (LNA) . A locked nucleic acid is a nucleotide with a modified ribose moiety comprising an extra bridge connecting the 2'and 4'carbons. This structure effectively “locks” the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids in a C3 dsRNA agent, C3 antisense polynucleotides, and / or C3 sense polynucleotides of the invention may increase stability in serum, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33 (1) : 439-447; Mook, O R. et al., (2007) Mol Canc Ther 6 (3) : 833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31 (12) : 3185-3193) . Means of preparing dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides that comprise locked nucleic acid (s) are routinely practiced in the art and such methods can be used to prepare certain modified C3 dsRNA agents of the invention.

[0157] Certain embodiments of C3 dsRNA compounds, sense polynucleotides, and / or antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: a 2’ -O-methyl nucleotide, 2’ -Fluoro nucleotide, 2’ -deoxy nucleotide, 2’ 3’ -seco nucleotide mimic, locked nucleotide, 2’ -F-Arabino nucleotide, 2’ -methoyxyethyl nucleotide, 2’ -amino-modified nucleotide, 2’ -alkyl-modified nucleotide, mopholino nucleotide, and 3’ -OMe nucleotide, a nucleotide comprising a 5’ -phosphorothioate group, or a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2’ -amino-modified nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide. In some embodiments, a C3 dsRNA compound includes an E-vinylphosphonate nucleotide at the 5′ -end of the antisense strand, also referred to herein as the guide strand.

[0158] Certain embodiments of C3 dsRNA compounds, 3’ and 5’ end of sense polynucleotides, and / or 3’ end of antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: abasic nucleotide, ribitol, inverted nucleotide, inverted abasic nucleotide, inverted 2’ -OMe nucleotide, inverted 2’ -deoxy nucleotide. It is known to skilled in art, including an abasic or inverted abasic nucleotide at the end of oligonucleotide enhances stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003; 31 (11) : 2705-2716. doi: 10.1093 / nar / gkg393) . In some embodiments, a C3 dsRNA compound includes one or more inverted abasic residues (invab) at either 3’ -end or 5’ -end, or both 3’ -end and 5’ -end. Exemplified inverted abasic residues (invab) include, but are not limited to the following:

[0159] when at the 3′ -end;

[0160] attached to 3′ -end of oligonucleotide

[0161] Certain embodiments of C3 dsRNA compounds, 3’ and 5’ end of sense polynucleotides, and / or 3’ end of antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises: isomannide nucleotide or stereoisomer of said isomannide nucleotide. Specific examples of isomannide nucleotides or stereoisomers of said isomannide nucleotides include, but are not limited to: wherein the phrase “Olig” each independently represents a polynucleotide moiety. Exemplified isomannide residues (imann) include, but are not limited to, the following:

[0162] In certain embodiments, the isomannide nucleotides may further conjugate to one or more targeting groups or delivery molecules, such as GalNAc moieties.

[0163] Certain embodiments of C3 dsRNA compounds, antisense polynucleotides of the invention, include at least one modified nucleotide, wherein the at least one modified nucleotide comprises unlocked nucleic acid nucleotide (UNA) or / and glycol nucleic acid nucleotide (GNA) .  It is known to skilled in art, UNA and GNA are thermally destabilizing chemical modifications, can significantly improves the off-target profile of a siRNA compound (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018; 9 (1) : 723. doi: 10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010; 6: 862–70) .

[0164] Another modification that may be included in the RNA of certain embodiments of C3 dsRNA agents, C3 antisense polynucleotides, and / or C3 sense polynucleotides of the invention, comprises chemically linking to the RNA one or more ligands, moieties or conjugates that enhance one or more characteristics of the C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide, respectively. Non-limiting examples of characteristics that may be enhanced are: C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide activity, cellular distribution, delivery of a C3 dsRNA agent, pharmacokinetic properties of a C3 dsRNA agent, and cellular uptake of the C3 dsRNA agent. In some embodiments of the invention, a C3 dsRNA agent comprises one or more targeting groups or linking groups, which in certain embodiments of C3 dsRNA agents of the invention are conjugated to the sense strand. A non-limiting example of a targeting group is a compound comprising N-acetyl-galactosamine (GalNAc) . The terms “targeting group” , “targeting agent” , “linking agent” , “targeting compound” , “delivery molecule” , “delivery compound” and “targeting ligand” may be used interchangeably herein. In certain embodiments of the invention a C3 dsRNA agent comprises a targeting compound that is conjugated to the 5'-terminal end of the sense strand. In certain embodiments of the invention a C3 dsRNA agent comprises a targeting compound that is conjugated to the 3'-terminal end of the sense strand. In some embodiments of the invention, a C3 dsRNA agent comprises a targeting group that comprises GalNAc. In certain embodiments of the invention a C3 dsRNA agent does not include a targeting compound conjugated to one or both of the 3'-terminal end and the 5'-terminal end of the sense strand. In certain embodiments of the invention a C3 dsRNA agent does not include a GalNAc containing targeting compound conjugated to one or both of the 5'-terminal end and the 3'-terminal end of the sense strand.

[0165] Additional targeting and linking agents are well known in the art, for example, targeting and linking agents that may be used in certain embodiments of the invention include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556) , cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4: 1053-1060) , a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N. Y. Acad. Sci., 1992, 660: 306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3: 2765-2770) , a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20: 533-538) , an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10: 1111-1118; Kabanov et al., FEBS Lett., 1990, 259: 327-330; Svinarchuk et al., Biochimie, 1993, 75: 49-54) , a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1, 2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18: 3777-3783) , a polyamine or a polyethylene glycol chain (Manoharan et al.,  Nucleosides &Nucleotides, 1995, 14: 969-973) , or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654) , a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264: 229-237) , or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277: 923-937) .

[0166] Certain embodiments of a composition comprising a C3 dsRNA agent, C3 antisense polynucleotide, and / or C3 sense polynucleotide may comprise a ligand that alters distribution, targeting, or etc. of the C3 dsRNA agent. In some embodiments of a composition comprising a C3 dsRNA agent of the invention, the ligand increases affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. A ligand useful in a composition and / or method of the invention may be a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA) , low-density lipoprotein (LDL) , or globulin) ; a carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid) ; or a lipid. A ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid or polyamine. Examples of polyamino acids are a polylysine (PLL) , poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly (L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N- (2-hydroxypropyl) methacrylamide copolymer (HMPA) , polyethylene glycol (PEG) , polyvinyl alcohol (PVA) , polyurethane, poly (2-ethylacryllic acid) , N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL) , spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

[0167] A ligand included in a composition and / or method of the invention may comprise a targeting group, non-limiting examples of which are a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody that binds to a specified cell type such as a kidney cell or a liver cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

[0168] Other examples of ligands include dyes, intercalating agents (e.g. acridines) , cross-linkers (e.g. psoralene, mitomycin C) , porphyrins (TPPC4, texaphyrin, Sapphyrin) , polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine) , artificial endonucleases (e.g. EDTA) , lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1, 3-Bis-O (hexadecyl) glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1, 3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl) lithocholic acid, O3- (oleoyl) cholenic acid, dimethoxytrityl, or phenoxazine)  and peptide conjugates (e.g., antennapedia peptide, Tat peptide) , alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K) , MPEG, [MPEG] 2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin) , transport / absorption facilitators (e.g., aspirin, vitamin E, folic acid) , synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles) , dinitrophenyl, HRP, or AP.

[0169] A ligand included in a composition and / or method of the invention may be a protein, e.g., glycoprotein, or peptide, for example a molecule with a specific affinity for a co-ligand, or an antibody, for example an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, cardiac cell, or bone cell. A ligand useful in an embodiment of a composition and / or method of the invention can be a hormone or hormone receptor. A ligand useful in an embodiment of a composition and / or method of the invention can be a lipid, lectin, carbohydrates, vitamin, cofactos, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, or multivalent fucose. A ligand useful in an embodiment of a composition and / or method of the invention can be a substance that can increase uptake of the C3 dsRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and / or intermediate filaments. Non-limiting examples of this type of agent are: taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.

[0170] In some embodiments, a ligand attached to a C3 dsRNA agent of the invention functions as a pharmacokinetic (PK) modulator. An example of a PK modulator that may be used in compositions and methods of the invention includes but is not limited to: a lipophiles, a bile acid, a steroid, a phospholipid analogue, a peptide, a protein binding agent, PEG, a vitamin, cholesterol, a fatty acid, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, a phospholipid, a sphingolipid, naproxen, ibuprofen, vitamin E, biotin, an aptamer that binds a serum protein, etc. Oligonucleotides comprising a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone may also be used in compositions and / or methods of the invention as ligands.

[0171] C3 dsRNA agent compositions

[0172] In some embodiments of the invention, a C3 dsRNA agent is in a composition. A composition of the invention may include one or more C3 dsRNA agent and optionally one or more of a pharmaceutically acceptable carrier, a delivery agent, a targeting agent, detectable label, etc. A non-limiting example of a targeting agent that may be useful according to some embodiments of methods of the invention is an agent that directs a C3 dsRNA agent of the invention to and / or into a cell to be treated. A targeting agent of choice will depend upon such elements as: the nature of the C3-associated disease or condition, and on the cell type being targeted. In a non-limiting example, in some embodiments of the invention it may be desirable  to target a C3 dsRNA agent to and / or into a liver cell. It will be understood that in some embodiments of methods of the invention, a therapeutic agent comprises a C3 dsRNA agent with only a delivery agent, such as a delivery agent comprising N-Acetylgalactosamine (GalNAc) , without any additional attached elements. For example, in some aspects of the invention a C3 dsRNA agent may be attached to a delivery compound comprising GalNAc and included in a composition comprising a pharmaceutically acceptable carrier and administered to a cell or subject without any detectable labels, or targeting agents, etc. attached to the C3 dsRNA agent.

[0173] In cases where a C3 dsRNA agent of the invention is administered with and / or attached to one or more delivery agents, targeting agents, labeling agents, etc. a skilled artisan will be aware of and able to select and use suitable agents for use in methods of the invention. Labeling agents may be used in certain methods of the invention to determine the location of a C3 dsRNA agent in cells and tissues and may be used to determine a cell, tissue, or organ location of a treatment composition comprising a C3 dsRNA agent that has been administered in methods of the invention. Procedures for attaching and utilizing labeling agents such as enzymatic labels, dyes, radiolabels, etc. are well known in the art. It will be understood that in some embodiments of compositions and methods of the invention, a labeling agent is attached to one or both of a sense polynucleotide and an antisense polynucleotide included in a C3 dsRNA agent.

[0174] Delivery of C3 dsRNA agents and C3 antisense polynucleotide agents

[0175] Certain embodiments of methods of the invention, includes delivery of a C3 dsRNA agent into a cell. As used herein the term, “delivery” means facilitating or effecting uptake or absorption into the cell. Absorption or uptake of a C3 dsRNA agent can occur through unaided diffusive or active cellular processes, or by use of delivery agents, targeting agents, etc. that may be associated with a C3 dsRNA agent of the invention. Delivery means that are suitable for use in methods of the invention include, but are not limited to: in vivo delivery, in which a C3 dsRNA agent is in injected into a tissue site or administered systemically. In some embodiments of the invention, a C3 dsRNA agent is attached to a delivery agent.

[0176] Non-limiting examples of methods that can be used to deliver C3 dsRNA agents to cells, tissues and / or subjects include: C3 dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been used successfully in the art to deliver therapeutic RNAi agents for treatment of various diseases and conditions, such as but not limited to: liver diseases, acute intermittent porphyria (AIP) , hemophilia, pulmonary fibrosis, etc. Details of various delivery means are found in publications such as: Nikam, R. R. &K. R. Gore (2018) Nucleic Acid Ther, 28 (4) , 209-224 Aug 2018; Springer A. D. &S. F. Dowdy (2018) Nucleic Acid Ther. Jun 1; 28 (3) : 109–118; Lee, K. et al., (2018) Arch Pharm Res, 41 (9) , 867-874; and Nair, J. K. et al., (2014) J. Am. Chem. Soc. 136: 16958-16961, the content each of which is incorporated by reference herein.

[0177] Some embodiments of the invention comprise use of lipid nanoparticles (LNPs) to deliver a C3 dsRNA agent of the invention to a cell, tissue, and / or subject. LNPs are routinely  used for in vivo delivery of C3 dsRNA agents, including therapeutic C3 dsRNA agents. One benefit of using an LNP or other delivery agent is an increased stability of the C3 RNA agent when it is delivered to a subject using the LNP or other delivery agent. In some embodiments of the invention an LNP comprises a cationic LNP that is loaded with one or more C3 RNAi molecules of the invention. The LNP comprising the C3 RNAi molecule (s) is administered to a subject, the LNPs and their attached C3 RNAi molecules are taken up by cells via endocytosis, their presence results in release of RNAi trigger molecules, which mediate RNAi.

[0178] Another non-limiting example of a delivery agent that may be used in embodiments of the invention to delivery a C3 dsRNA agent of the invention to a cell, tissue and / or subject is an agent comprising GalNAc that is attached to a C3 dsRNA agent of the invention and delivers the C3 dsRNA agent to a cell, tissue, and / or subject. Examples of certain additional delivery agents comprising GalNAc that can be used in certain embodiments of methods and composition of the invention are disclosed in PCT Application: WO2020191183A1 (incorporated herein in its entirety) . A non-limiting example of a GalNAc targeting ligand that can be used in compositions and methods of the invention to deliver a C3 dsRNA agent to a cell is a targeting ligand cluster. Examples of targeting ligand clusters that are presented herein are referred to as: GalNAc Ligand with phosphodiester link (GLO) and GalNAc Ligand with phosphorothioate link (GLS) . The term “GLX-n” may be used herein to indicate the attached GalNAc-containing compound is any one of compounds GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each of which is shown below, with the below with location of attachment of the GalNAc-targeting ligand to an RNAi agent of the invention at far right of each (shown with ) . It will be understood that any RNAi and dsRNA molecule of the invention can be attached to the GLS-1*, GLS-2*, GLS-3*, GLS-4*, GLS-5*, GLS-6*, GLS-7*, GLS-8*, GLS-9*, GLS-10*, GLS-11*, GLS-12*, GLS-13*, GLS-14*, GLS-15*, GLS-16*, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, GLO-1 through GLO-16 and GLS-1*through GLS-16*structures are shown below.

[0179] In certain embodiments, the aforesaid isomannide nucleotides may further conjugate to one or more GalNAc targeting ligands. Specific examples of isomannide nucleotides conjugated to a GalNAc targeting ligand include, but are not limited to: wherein the phrase "olig" each independently represents a polynucleotide moiety.

[0180] In some embodiments of the invention, in vivo delivery can also be by a beta-glucan delivery system, such as those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005 / 0281781, which are hereby incorporated by reference in their entirety. In vitro introduction of a C3 RNAi agent into a cell may also be done using art-known methods such as electroporation and lipofection. In certain embodiments of methods of the invention, a C3 dsRNA is delivered without a targeting agent. These RNAs may be delivered as “naked” RNA molecules. As a non-limiting example, a C3 dsRNA of the invention may be administered to a subject to treat a C3-associated disease or condition in the subject, such as a cardiovascular disease, in a pharmaceutical composition comprising the RNAi agent, but not including a targeting agent such as a GalNAc targeting compound.

[0181] In addition to certain delivery means described herein, it will be understood that RNAi delivery means, such as but not limited to those described herein and those used in the art, can be used in conjunction with embodiments of C3 RNAi agents and treatment methods described herein.

[0182] C3 dsRNA agents of the invention may be administered to a subject in an amount and manner effective to reduce a level and activity of C3 polypeptide in a cell and / or subject. In some embodiments of methods of the invention one or more C3 dsRNA agents are administered to a cell and / or subject to treat a disease or condition associated with C3 expression and activity.  Methods of the invention, in some embodiments, include administering one or more C3 dsRNA agents to a subject in need of such treatment to reduce a disease or condition associated with C3 expression in the subject. C3 dsRNA agents or C3 antisense polynucleotide agents of the invention can be administered to reduce C3 expression and / or activity in one more of in vitro, ex vivo, and in vivo cells.

[0183] In some embodiments of the invention, a level, and thus an activity, of C3 polypeptide in a cell is reduced by delivering (e.g. introducing) an C3 dsRNA agent or C3 antisense polynucleotide agent into a cell. Targeting agents and methods may be used to aid in delivery of a C3 dsRNA agent or C3 antisense polynucleotide agent to a specific cell type, cell subtype, organ, spatial region within a subject, and / or to a sub-cellular region within a cell. An C3 dsRNA agent can be administered in certain methods of the invention singly or in combination with one or more additional C3 dsRNA agents. In some embodiments, 2, 3, 4, or more independently selected C3 dsRNA agents are administered to a subject.

[0184] In certain embodiments of the invention, an C3 dsRNA agent is administered to a subject to treat a C3-associated disease or condition in conjunction with one or more additional therapeutic regimens for treating the C3-associate disease or condition. Non-limiting examples of additional therapeutic regimens are: administering one or more C3 antisense polynucleotides of the invention, administering a non-C3 dsRNA therapeutic agent, and a behavioral modification. An additional therapeutic regimen may be administered at a time that is one or more of: prior to, simultaneous with, and following administration of a C3 dsRNA agent of the invention. It will be understood that simultaneous with as used herein, within five minutes of time zero, within 10 minutes of time zero, within 30 minutes of time zero, within 45 minutes of time zero, and within 60 minutes of time zero, with “time zero” the time of administration of the C3 dsRNA agent of the invention to the subject. Non-limiting examples of non-C3 dsRNA therapeutic agents are: an inhibitor of C5, such as an anticomplement component C5 antibody, or antigen-binding fragment thereof (e.g., eculizumab, ravulizumab-cwvz, or pozelimab (REGN3918) ) or a C5 peptide inhibitor (e.g., zilucoplan) . Eculizumab is a humanized monoclonal IgG2 / 4, kappa light chain antibody that specifically binds complement component C5 with high affinity and inhibits cleavage of C5 to C5a and C5b, thereby inhibiting the generation of the terminal complement complex C5b-9. Ravulizumab-cwvz is a humanized IgG2 / 4 monoclonal antibody that specifically binds complement component C5 with high affinity and inhibits cleavage of C5 to C5a and C5b, thereby inhibiting the generation of the terminal complement complex C5b-9. Pozelimab (also known as H4H12166P, described in US20170355757) is a fully-human IgG4 monoclonal antibody designed to block complement factor C5. Zilucoplan is a synthetic, macrocyclic peptide that binds complement component 5 (C5) with sub-nanomolar affinity and allosterically inhibits its cleavage into C5a and C5b upon activation of the classical, alternative, or lectin pathways. Preferably, the additional therapeutic is a C3 peptide inhibitor, or analog thereof. In one embodiment, the C3 peptide inhibitor is compstatin. Compstatin is a cyclic tridecapeptide with potent and selective C3 inhibitory activity.  These and other therapeutic agents and behavior modifications are known in the art and used to treat a C3-associated disease or condition in a subject and may be administered to a subject in combination with the administration of one or more C3 dsRNA agents of the invention to treat the C3-associated disease or condition. A C3 dsRNA agent of the invention administered to a cell or subject to treat a C3-associated disease or condition may act in a synergistic manner with one or more other therapeutic agents or activities and increase the effectiveness of the one or more therapeutic agents or activities and / or to increase the effectiveness of the C3 dsRNA agent at treating the C3-associated disease or condition.

[0185] Treatment methods of the invention that include administration of a C3 dsRNA agent can be used prior to the onset of a C3-associated disease or condition and / or when a C3-associated disease or condition is present, including at an early stage, mid-stage, and late stage of the disease or condition and all times before and after any of these stages. Methods of the invention may also be to treat subjects who have previously been treated for a C3-associated disease or condition with one or more other therapeutic agents and / or therapeutic activities that were not successful, were minimally successful, and / or are no longer successful at treating the C3-associated disease or condition in the subject.

[0186] Vector Encoded dsRNAs

[0187] In certain embodiments of the invention, a C3 dsRNA agent can be delivered into a cell using a vector. C3 dsRNA agent transcription units can be included in a DNA or RNA vector. Prepare and use of such vectors encoding transgenes for delivering sequences into a cell and or subject are well known in the art. Vectors can be used in methods of the invention that result in transient expression of C3 dsRNA, for example for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks. The length of the transient expression can be determined using routine methods based on elements such as, but not limited to the specific vector construct selected and the target cell and / or tissue. Such transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92: 1292) .

[0188] An individual strand or strands of a C3 dsRNA agent can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced to a cell using means such as transfection or infection. In certain embodiments each individual strand of a C3 dsRNA agent of the invention can be transcribed by promoters that are both included on the same expression vector. In certain embodiments of the invention a C3 dsRNA agent is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the C3 dsRNA agent has a stem and loop structure.

[0189] Non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors. Expression vectors useful in embodiments of the invention can be compatible with eukaryotic  cells. Eukaryotic cell expression vectors are routinely used in the art and are available from a number of commercial sources. Delivery of C3 dsRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that allows for introduction into a desired target cell.

[0190] Viral vector systems that may be included in an embodiment of a method of the include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc. ; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Constructs for the recombinant expression of a C3 dsRNA agent may include regulatory elements, such as promoters, enhancers, etc., which may be selected to provide constitutive or regulated / inducible expression. Viral vector systems, and the use of promoters and enhancers, etc. are routine in the art and can be used in conjunction with methods and compositions described herein.

[0191] Certain embodiments of the invention include use of viral vectors for delivery of C3 dsRNA agents into cells. Numerous adenovirus-based delivery systems are routinely used in the art for deliver to, for example, lung, liver, the central nervous system, endothelial cells, and muscle. Non-limiting examples of viral vectors that may be used in methods of the invention are: AAV vectors, a pox virus such as a vaccinia virus, a Modified Virus Ankara (MVA) , NYVAC, an avipox such as fowl pox or canary pox.

[0192] Certain embodiments of the invention include methods of delivering C3 dsRNA agents into cells using a vector and such vectors may be in a pharmaceutically acceptable carrier that may, but need not, include a slow release matrix in which the gene delivery vehicle is imbedded. In some embodiments, a vector for delivering a C3 dsRNA can be produced from a recombinant cell, and a pharmaceutical composition of the invention may include one or more cells that produced the C3 dsRNA delivery system.

[0193] Pharmaceutical Compositions Containing C3 dsRNA or ssRNA agents

[0194] Certain embodiments of the invention include use of pharmaceutical compositions containing a C3 dsRNA agent or C3 antisense polynucleotide agent and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the C3 dsRNA agent or C3 antisense polynucleotide agent can be used in methods of the invention to reduce C3 gene expression and C3 activity in a cell and is useful to treat a C3-associated disease or condition. Such pharmaceutical compositions can be formulated based on the mode of delivery. Non-limiting examples of formulations for modes of delivery are: a composition formulated for subcutaneous delivery, a composition formulated for systemic administration via parenteral delivery, a composition formulated for intravenous (IV) delivery, a composition formulated for  intrathecal delivery, a composition formulated for direct delivery into brain, etc. Administration of a pharmaceutic composition of the invention to deliver a C3 dsRNA agent or C3 antisense polynucleotide agent into a cell may be done using one or more means such as: topical (e.g., by a transdermal patch) , pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration. A C3 dsRNA agent or C3 antisense polynucleotide agent can also be delivered directly to a target tissue, for example directly into the liver, directly into a kidney, etc. It will be understood that “delivering a C3 dsRNA agent” or “delivering a C3 antisense polynucleotide agent” into a cell encompasses delivering a C3 dsRNA agent or C3 antisense polynucleotide agent, respectively, directly as well as expressing a C3 dsRNA agent in a cell from an encoding vector that is delivered into a cell, or by any suitable means with which the C3 dsRNA or C3 antisense polynucleotide agent becomes present in a cell. Preparation and use of formulations and means for delivering inhibitory RNAs are well known and routinely used in the art.

[0195] As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention and a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier for administration of a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract. Agents included in drug formulations are described further herein below.

[0196] As used herein terms such as: “pharmacologically effective amount, ” “therapeutically effective amount” and “effective amount” refers to that amount of a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention to produce the intended pharmacological, therapeutic or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 10%reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 10%reduction in that parameter. For  example, a therapeutically effective amount of a C3 dsRNA agent or C3 antisense polynucleotide agent can reduce C3 polypeptide levels by at least 10%.

[0197] Effective amounts

[0198] Methods of the invention, in some aspects comprise contacting a cell with a C3 dsRNA agent or C3 antisense polynucleotide agent in an effective amount to reduce C3 gene expression in the contacted cell. Certain embodiments of methods of the invention comprise administering a C3 dsRNA agent or a C3 antisense polynucleotide agent to a subject in an amount effective to reduce C3 gene expression and treat a C3-associated disease or condition in the subject. An “effective amount” used in terms of reducing expression of C3 and / or for treating a C3-associated disease or condition, is an amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of a C3 dsRNA agent or C3 antisense polynucleotide agent to treat a C3-associated disease or condition could be that amount necessary to (i) slow or halt progression of the disease or condition; or (ii) reverse, reduce, or eliminate one or more symptoms of the disease or condition. In some aspects of the invention, an effective amount is that amount of a C3 dsRNA agent or C3 antisense polynucleotide agent that when administered to a subject in need of a treatment of a C3-associated disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. According to some aspects of the invention, an effective amount is that amount of a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention that when combined or co-administered with another therapeutic treatment for a C3-associated disease or condition, results in a therapeutic response that prevents and / or treats the disease or condition. In some embodiments of the invention, a biologic effect of treating a subject with a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention may be the amelioration and or absolute elimination of symptoms resulting from the C3-associated disease or condition. In some embodiments of the invention, a biologic effect is the complete abrogation of the C3-associated disease or condition, as evidenced for example, by a diagnostic test that indicates the subject is free of the C3-associated disease or condition. A non-limiting example of a physiological symptom that may be detected includes a reduction in C3 level in liver of a subject following administration of an agent of the invention. Additional art-known means of assessing the status of a C3-associated disease or condition can be used to determine an effect of an agent and / or methods of the invention on a C3-associated disease or condition.

[0199] Typically, an effective amount of a C3 dsRNA agent or C3 antisense polynucleotide agent to decrease C3 polypeptide activity to a level to treat a C3-associated disease or condition will be determined in clinical trials, establishing an effective dose for a test population versus a control population in a blind study. In some embodiments, an effective amount will be that results in a desired response, e.g., an amount that diminishes a C3-associated disease or condition in cells, tissues, and / or subjects with the disease or condition. Thus, an effective amount of a C3 dsRNA agent or C3 antisense polynucleotide agent to treat a C3-associated disease or  condition that can be treated by reducing C3 polypeptide activity may be the amount that when administered decreases the amount of C3 polypeptide activity in the subject to an amount that is less than the amount that would be present in the cell, tissue, and / or subject without the administration of the C3 dsRNA agent or C3 antisense polynucleotide agent. In certain aspects of the invention the level of C3 polypeptide activity, and / or C3 gene expression present in a cell, tissue, and / or subject that has not been contacted with or administered a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention is referred to as a “control” amount. In some embodiments of methods of the invention a control amount for a subject is a pre-treatment amount for the subject, in other words, a level in a subject before administration of a C3 agent can be a control level for that subject and compared to a level of C3 polypeptide activity and / or C3 gene expression in the subject following siRNA administered to the subject. In the case of treating a C3-associated disease or condition the desired response may be reducing or eliminating one or more symptoms of the disease or condition in the cell, tissue, and / or subject. The reduction or elimination may be temporary or may be permanent. It will be understood that the status of a C3-associated disease or condition can be monitored using methods of determining C3 polypeptide activity, C3 gene expression, symptom evaluation, clinical testing, etc. In some aspects of the invention, a desired response to treatment of a C3-associated disease or condition is delaying the onset or even preventing the onset of the disease or condition.

[0200] An effective amount of a compound that decreases C3 polypeptide activity may also be determined by assessing physiological effects of administration of a C3 dsRNA agent or C3 antisense polynucleotide agent on a cell or subject, such as a decrease of a C3-associated disease or condition following administration. Assays and / or symptomatic monitoring of a subject can be used to determine efficacy of a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention, which may be administered in a pharmaceutical compound of the invention, and to determine the presence or absence of a response to the treatment. A non-limiting example, paroxysmal nocturnal hemoglobinuria (PNH) , a relatively rare disorder comprising an acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobin Physiological characteristics identified by urine, bone marrow failure, and thrombophilia (proneness to form blood clots) . Another non-limiting example, is that one or more art-known tests of liver function can be used to determine the status of the C3-associated lipid imbalance in a subject before and after treatment of the subject with a C3 dsRNA agent of the invention.

[0201] Some embodiments of the invention include methods of determining an efficacy of an dsRNA agent or C3 antisense polynucleotide agent of the invention administered to a subject, to treat a C3-associated disease or condition by assessing and / or monitoring one or more “physiological characteristics” of the C3-associated disease or condition in the subject. Non-limiting examples of physiological characteristics of a C3-associated disease or condition are the C3 mRNA level, the C3 protein level. Standard means of determining such physiological characteristic are known in the art and include, but are not limited to, blood tests, imaging studies, physical examination, etc.

[0202] It will be understood that the amount of a C3 dsRNA agent or C3 antisense polynucleotide agent administered to a subject can be modified based, at least in part, on such determinations of disease and / or condition status and / or physiological characteristics determined for a subject. The amount of a treatment may be varied for example by increasing or decreasing the amount of a C3-dsRNA agent or C3 antisense polynucleotide agent, by changing the composition in which the C3 dsRNA agent or C3 antisense polynucleotide agent, respectively, is administered, by changing the route of administration, by changing the dosage timing and so on. The effective amount of a C3 dsRNA agent or C3 antisense polynucleotide agent will vary with the particular condition being treated, the age and physical condition of the subject being treated; the severity of the condition, the duration of the treatment, the nature of the concurrent therapy (if any) , the specific route of administration, and additional factors within the knowledge and expertise of the health practitioner. For example, an effective amount may depend upon the desired level of C3 polypeptide activity and or C3 gene expression that is effective to treat the C3-associated disease or condition. A skilled artisan can empirically determine an effective amount of a particular C3 dsRNA agent or C3 antisense polynucleotide agent of the invention for use in methods of the invention without necessitating undue experimentation. Combined with the teachings provided herein, by selecting from among various C3 dsRNA agents or C3 antisense polynucleotide agents of the invention, and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned that is effective to treat the particular subject. As used in embodiments of the invention, an effective amount of a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention can be that amount that when contacted with a cell results in a desired biological effect in the cell.

[0203] It will be recognized that C3 gene silencing may be determined in any cell expressing C3, either constitutively or by genomic engineering, and by any appropriate assay. In some embodiments of the invention, C3 gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%by administration of a C3 dsRNA agent of the invention. In some embodiments of the invention, C3 gene expression is reduced by at between 5%and 10%, 5%and 25%, 10%and 50%, 10%and 75%, 25%and 75%, 25%and 100%, or 50%and 100%by administration of a C3 dsRNA agent of the invention.

[0204] Dosing

[0205] C3 dsRNA agents and C3 antisense polynucleotide agents are delivered in pharmaceutical compositions in dosages sufficient to inhibit expression of C3 genes. In certain embodiments of the invention, a dose of C3 dsRNA agent or C3 antisense polynucleotide agent is in a range of 0.01 to 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of 1 to 50 mg per kilogram body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, 4 to 15 mg / kg  body weight per day, inclusive. For example, the C3 dsRNA agent or C3 antisense polynucleotide agent can be administered in an amount that is from about 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3.0 mg / kg, 3.1 mg / kg, 3.2 mg / kg, 3.3 mg / kg, 3.4 mg / kg, 3.5 mg / kg, 3.6 mg / kg, 3.7 mg / kg, 3.8 mg / kg, 3.9 mg / kg, 4 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 6 mg / kg, 6.1 mg / kg, 6.2 mg / kg, 6.3 mg / kg, 6.4 mg / kg, 6.5 mg / kg, 6.6 mg / kg, 6.7 mg / kg, 6.8 mg / kg, 6.9 mg / kg, 7 mg / kg, 7.1 mg / kg, 7.2 mg / kg, 7.3 mg / kg, 7.4 mg / kg, 7.5 mg / kg, 7.6 mg / kg, 7.7 mg / kg, 7.8 mg / kg, 7.9 mg / kg, 8 mg / kg, 8.1 mg / kg, 8.2 mg / kg, 8.3 mg / kg, 8.4 mg / kg, 8.5 mg / kg, 8.6 mg / kg, 8.7 mg / kg, 8.8 mg / kg, 8.9 mg / kg, 9 mg / kg, 9.1 mg / kg, 9.2 mg / kg, 9.3 mg / kg, 9.4 mg / kg, 9.5 mg / kg, 9.6 mg / kg, 9.7 mg / kg, 9.8 mg / kg, 9.9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, through 50 mg / kg body per single dose.

[0206] Various factors may be considered in the determination of dosage and timing of delivery of a C3 dsRNA agent of the invention. The absolute amount of a C3 dsRNA agent or C3 antisense polynucleotide agent delivered will depend upon a variety of factors including a concurrent treatment, the number of doses and the individual subject parameters including age, physical condition, size and weight. These are factors well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. In some embodiments, a maximum dose can be used, that is, the highest safe dose according to sound medical judgment.

[0207] Methods of the invention may in some embodiments include administering to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses of a C3 dsRNA agent or C3 antisense polynucleotide agent. In some instances, a pharmaceutical compound, (e.g., comprising a C3 dsRNA agent or comprising a C3 antisense polynucleotide agent) can be administered to a subject at least daily, every other day, weekly, every other week, monthly, etc. Doses may be administered once per day or more than once per day, for example, 2, 3, 4, 5, or more times in one 24 hour period. A pharmaceutical composition of the invention may be administered once daily, or the C3 dsRNA agent or C3 antisense polynucleotide agent may be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In some embodiments of methods of the invention, a pharmaceutical composition of the invention is administered to a subject one or more times per day, one or more times per week, one or more times per month, or one or more times per year.

[0208] Methods of the invention, in some aspects, include administration of a pharmaceutical compound alone, in combination with one or more other C3 dsRNA agents or C3 antisense polynucleotide agents, and / or in combination with other drug therapies or treatment activities or regimens that are administered to subjects with a C3-associated disease or condition. Pharmaceutical compounds may be administered in pharmaceutical compositions. Pharmaceutical compositions used in methods of the invention may be sterile and contain an amount of a C3 dsRNA agent or C3 antisense polynucleotide agent that will reduce activity of a C3 polypeptide to a level sufficient to produce the desired response in a unit of weight or volume suitable for administration to a subject. A dose administered to a subject of a pharmaceutical composition that includes a C3 dsRNA agent or C3 antisense polynucleotide agent to reduce C3 protein activity can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.

[0209] Treatment

[0210] As used herein, “C3-associated disease” , “C3-associated diseases and conditions” and “diseases and conditions caused and / or modulated by C3” is intended to include any disease associated with the C3 gene or protein. Such diseases may be caused, for example, by overproduction of C3 protein, by mutation of the C3 gene, by abnormal cleavage of the C3 protein, by abnormal interaction between C3 and other proteins or other endogenous or exogenous substances. Exemplary C3 -associated diseases include, but are not limited to: C3 Glomerulopathy (C3G) , atypical Hemolytic Uremic Syndrome (aHUS) , Immune Complex-mediated Glomerulonephritis (IC-mediated GN) , C3 glomerulonephritis, post-Infectious Glomerulonephritis (PIGN) , Systemic Lupus Erythematosus, Lupus nephritis, Ischemia / reperfusion injury , IgA nephropathy (IgA N; ) , age-related macular degeneration (AMD) , Rheumatoid arthritis (RA) , antineutrophil Cytoplasmic Autoantibodies-associated Vasculitis (ANCA-AV) , dysbiotic periodontal Disease, Malarial Anaemia, Paroxysmal Nocturnal Hemoglobinuria (PNH) , sepsis, neuromyelitis optica (NMO) , multifocal motor neuropathy (MMN) , myasthenia gravis (MG) , rheumatoid arthritis, and neurodegenerative diseases.

[0211] In certain aspects of the invention, a subject may be administered a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention at a time that is one or more of before or after diagnosis of a C3-associated disease or condition. In some aspects of the invention, a subject is at risk of having or developing a C3-associated disease or condition. A subject at risk of developing a C3-associated disease or condition is one who has an increased probability of developing the C3-associated disease or condition, compared to a control risk of developing the C3-associated disease or condition. In some embodiments of the invention, a level of risk may  be statistically significant compared to a control level of risk. A subject at risk may include, for instance, a subject who is, or will be, a subject who has a preexisting disease and / or a genetic abnormality that makes the subject more susceptible to a C3-associated disease or condition than a control subject without the preexisting disease or genetic abnormality; a subject having a family and / or personal medical history of the C3-associated disease or condition; and a subject who has previously been treated for a C3-associated disease or condition. It will be understood that a preexisting disease and / or a genetic abnormality that makes the subject more susceptible to a C3-associated disease or condition, may be a disease or genetic abnormality that when present has been previously identified as having a correlative relation to a higher likelihood of developing a C3-associated disease or condition.

[0212] It will be understood that a C3 dsRNA agent or C3 antisense polynucleotide agent may be administered to a subject based on a medical status of the individual subject. For example, a health-care provided for a subject may assess a C3 level measured in a sample obtained from a subject and determine it is desirable to reduce the subject’s C3 level, by administration of a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention. In this example, the C3 level may be considered to be a physiological characteristic of a C3-associated condition, even if the subject is not diagnosed as having a C3-assoicated disease such as one disclosed herein. A healthcare provider may monitor changes in the subject’s C3 level, as a measure of efficacy of the administered C3 dsRNA agent or C3 antisense polynucleotide agent of the invention. In a non-limiting example, a biological sample, such as a blood or serum sample may be obtained from a subject and a C3 level for the subject determined in the sample. A C3 dsRNA agent or C3 antisense polynucleotide agent is administered to the subject and a blood sample is obtained from the subject following the administration and the C3 level determined using the sample and the results compared to the results determined in the subject’s pre-administration (prior) sample. A reduction in the subject’s C3 level in the later sample compared to the pre-administration level indicates the administered C3 dsRNA agent or C3 antisense polynucleotide agent efficacy in reducing the lipid level in the subject.

[0213] Certain embodiments of methods of the invention include adjusting a treatment that includes administering a dsRNA agent or a C3 antisense polynucleotide agent of the invention to a subject based at least in part on assessment of a change in one or more of the subject’s physiological characteristics of a C3-associated disease or condition resulting from the treatment. For example, in some embodiments of the invention, an effect of an administered dsRNA agent or C3 antisense polynucleotide agent of the invention may be determined for a subject and used to assist in adjusting an amount of a dsRNA agent or C3 antisense polynucleotide agent of the invention subsequently administered to the subject. In a non-limiting example, a subject is administered a dsRNA agent or C3 antisense polynucleotide agent of the invention, the subject’s C3 level is determined after the administration, and based at least in part on the determined level, a greater amount of the dsRNA agent or C3 antisense polynucleotide agent is determined to be desirable in order to increase the physiological effect of the administered agent, for example to  reduce or further reduce the subject’s C3 level. In another non-limiting example, a subject is administered a dsRNA agent or C3 antisense polynucleotide agent of the invention, the subject’s C3 level is determined after the administration and based at least in part on the determined level, a lower amount of the dsRNA agent or C3 antisense polynucleotide agent is desirable to administer to the subject.

[0214] Thus, some embodiments of the invention include assessing a change in one or more physiological characteristics of resulting from a subject’s previous treatment to adjust an amount of a dsRNA agent or C3 antisense polynucleotide agent of the invention subsequently administered to the subject. Some embodiments of methods of the invention include 1, 2, 3, 4, 5, 6, or more determinations of a physiological characteristic of a C3-associated disease or condition to assess and / or monitor the efficacy of an administered C3 dsRNA agent or C3 antisense polynucleotide agent of the invention, and optionally using the determinations to adjust one or more of: a dose, administration regimen, and or administration frequency of a dsRNA agent or C3 antisense polynucleotide agent of the invention to treat a C3-associated disease or condition in a subject. In some embodiments of methods of the invention, a desired result of administering an effective amount of a dsRNA agent or C3 antisense polynucleotide agent of the invention to a subject is a reduction of the subject’s the C3 mRNA level, the C3 protein level in the subject, paroxysmal nocturnal hemoglobinuria (PNH) , a relatively rare disorder comprising an acquired hemolytic anemia characterized by complement-mediated intravascular hemolysis, hemoglobin Physiological characteristics identified by urine, bone marrow failure, and thrombophilia (proneness to form blood clots) .

[0215] As used herein, the terms “treat” , “treated” , or “treating” when used with respect to a C3-associated disease or condition may refer to a prophylactic treatment that decreases the likelihood of a subject developing the C3-associated disease or condition, and also may refer to a treatment after the subject has developed a C3-associated disease or condition in order to eliminate or reduce the level of the C3-associated disease or condition, prevent the C3-associated disease or condition from becoming more advanced (e.g., more severe) , and / or slow the progression of the C3-associated disease or condition in a subject compared to the subject in the absence of the therapy to reduce activity in the subject of C3 polypeptide.

[0216] Certain embodiments of agents, compositions, and methods of the invention can be used to inhibit C3 gene expression. As used herein in reference to expression of a C3 gene, the terms “inhibit, ” “silence, ” “reduce, ” “down-regulate, ” and “knockdown” mean the expression of the C3 gene, as measured by one or more of: a level of RNA transcribed from the gene, a level of activity of C3 expressed, and a level of C3 polypeptide, protein or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the C3 gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is contacted with (e.g., treated with) a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention, compared to a control level of RNA transcribed from the C3 gene, a level of activity of expressed C3, or a level of C3 translated from the MRNA, respectively. In some embodiments, a control  level is a level in a cell, tissue, organ or subject that has not been contacted with (e.g., treated with) the C3 dsRNA agent or C3 antisense polynucleotide agent.

[0217] Administration methods

[0218] A variety of administration routes for a C3 dsRNA agent or C3 antisense polynucleotide agent are available for use in methods of the invention. The particular delivery mode selected will depend at least in part, upon the particular condition being treated and the dosage required for therapeutic efficacy. Methods of this invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of treatment of a C3-associated disease or condition without causing clinically unacceptable adverse effects. In some embodiments of the invention, a C3 dsRNA agent or C3 antisense polynucleotide agent may be administered via an oral, enteral, mucosal, subcutaneous, and / or parenteral route. The term “parenteral” includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal, and intrasternal injection, or infusion techniques. Other routes include but are not limited to nasal (e.g., via a gastro-nasal tube) , dermal, vaginal, rectal, sublingual, and inhalation. Delivery routes of the invention may include intrathecal, intraventricular, or intracranial. In some embodiments of the invention, a C3 dsRNA agent or C3 antisense polynucleotide agent may be placed within a slow-release matrix and administered by placement of the matrix in the subject. In some aspects of the invention, a C3 dsRNA agent or C3 antisense polynucleotide agent may be delivered to a subject cell using nanoparticles coated with a delivery agent that targets a specific cell or organelle. Various delivery means, methods, agents are known in the art. Non-limiting examples of delivery methods and delivery agents are additionally provided elsewhere herein. In some aspects of the invention, the term “delivering” in reference to a C3 dsRNA agent or C3 antisense polynucleotide agent may mean administration to a cell or subject of one or more “naked” C3 dsRNA agent or C3 antisense polynucleotide agent sequences and in certain aspects of the invention “delivering” means administration to a cell or subject via transfection means, delivering a cell comprising a C3 dsRNA agent or C3 antisense polynucleotide agent to a subject, delivering a vector encoding a C3 dsRNA agent or C3 antisense polynucleotide agent into a cell and / or subject, etc. Delivery of a C3 dsRNA agent or C3 antisense polynucleotide agent using a transfection means may include administration of a vector to a cell and / or subject.

[0219] In some methods of the invention one or more C3 dsRNA agents or C3 antisense polynucleotide agents may be administered in formulations, which may be administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. In some embodiments of the invention a C3 dsRNA agent or C3 antisense polynucleotide agent may be formulated with another therapeutic agent for simultaneous administration. According to methods of the invention, a C3 dsRNA agent or C3 antisense polynucleotide agent may be administered in a pharmaceutical  composition. In general, a pharmaceutical composition comprises a C3 dsRNA agent or C3 antisense polynucleotide agent and optionally, a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well-known to those of ordinary skill in the art. As used herein, a pharmaceutically acceptable carrier means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients, e.g., the ability of the C3 dsRNA agent or C3 antisense polynucleotide agent to inhibit C3 gene expression in a cell or subject. Numerous methods to administer and deliver dsRNA agents or C3 antisense polynucleotide agents for therapeutic use are known in the art and may be utilized in methods of the invention.

[0220] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers and other materials that are well-known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Pat. No. 5, 211, 657 and others are known by those skilled in the art. Such preparations may routinely contain salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.

[0221] Some embodiments of methods of the invention include administering one or more C3 dsRNA agents or C3 antisense polynucleotide agents directly to a tissue. In some embodiments, the tissue to which the compound is administered is a tissue in which the C3-associated disease or condition is present or is likely to arise, non-limiting examples of which are the heart. Direct tissue administration may be achieved by direct injection or other means. Many orally delivered compounds naturally travel to and through the liver and kidneys and some embodiments of treatment methods of the invention include oral administration of one or more C3 dsRNA agents to a subject. C3 dsRNA agents or C3 antisense polynucleotide agents, either alone or in conjunction with other therapeutic agents, may be administered once, or alternatively they may be administered in a plurality of administrations. If administered multiple times, the C3 dsRNA agent or C3 antisense polynucleotide agent may be administered via different routes. For example, though not intended to be limiting, a first (or first several) administrations may be made via subcutaneous means and one or more additional administrations may be oral and / or systemic administrations.

[0222] For embodiments of the invention in which it is desirable to administer a C3 dsRNA agent or C3 antisense polynucleotide agent systemically, the C3 dsRNA agent or C3 antisense polynucleotide agent may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage  form, e.g., in ampoules or in multi-dose containers, with or without an added preservative. C3 dsRNA agent formulations (also referred to as pharmaceutical compositions) may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents.

[0223] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's , or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose) , and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Lower doses will result from other forms of administration, such as intravenous administration. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Multiple doses per day may be used as needed to achieve appropriate systemic or local levels of one or more C3 dsRNA agents or C3 antisense polynucleotide agents and to achieve appropriate reduction in C3 protein activity.

[0224] In yet other embodiments, methods of the invention include use of a delivery vehicle such as biocompatible microparticle, nanoparticle, or implant suitable for implantation into a recipient, e.g., a subject. Exemplary bioerodible implants that may be useful in accordance with this method are described in PCT Publication No. WO 95 / 24929 (incorporated by reference herein) , which describes a biocompatible, biodegradable polymeric matrix for containing a biological macromolecule.

[0225] Both non-biodegradable and biodegradable polymeric matrices can be used in methods of the invention to deliver one or more C3 dsRNA agents or C3 antisense polynucleotide agents to a subject. In some embodiments, a matrix may be biodegradable. Matrix polymers may be natural or synthetic polymers. A polymer can be selected based on the period of time over which release is desired, generally in the order of a few hours to a year or longer. Typically, release over a period ranging from between a few hours and three to twelve months can be used. The polymer optionally is in the form of a hydrogel that can absorb up to about 90%of its weight in water and further, optionally is cross-linked with multivalent ions or other polymers.

[0226] In general, C3 dsRNA agents or C3 antisense polynucleotide agents may be delivered in some embodiments of the invention using the bioerodible implant by way of diffusion, or by degradation of the polymeric matrix. Exemplary synthetic polymers for such use are well known in the art. Biodegradable polymers and non-biodegradable polymers can be used for delivery of C3 dsRNA agents or C3 antisense polynucleotide agents using art-known methods. Bioadhesive polymers such as bioerodible hydrogels (see H. S. Sawhney, C. P. Pathak and J. A.  Hubell in Macromolecules, 1993, 26, 581-587, the teachings of which are incorporated by reference herein) may also be used to deliver C3 dsRNA agents or C3 antisense polynucleotide agents for treatment of a C3-associated disease or condition. Additional suitable delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of a C3 dsRNA agent or C3 antisense polynucleotide agent, increasing convenience to the subject and the medical care professional. Many types of release delivery systems are available and known to those of ordinary skill in the art. (See for example: U.S. Pat. Nos. 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686 (the teaching of each of which is incorporated herein by reference) . In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.

[0227] Use of a long-term sustained release implant may be suitable for prophylactic treatment of subjects and for subjects at risk of developing a recurrent C3-associated disease or condition. Long-term release, as used herein, means that the implant is constructed and arranged to deliver a therapeutic level of a C3 dsRNA agent or C3 antisense polynucleotide agent for at least up to 10 days, 20 days, 30 days, 60 days, 90 days, six months, a year, or longer. Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above.

[0228] Therapeutic formulations of C3 dsRNA agents or C3 antisense polynucleotide agents may be prepared for storage by mixing the molecule or compound having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers [Remington's Pharmaceutical Sciences 21st edition, (2006) ] , in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol) ; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes) ; and / or non-ionic surfactants such as or polyethylene glycol (PEG) .

[0229] Cells, Subjects, and Controls

[0230] Methods of the invention may be used in conjunction with cells, tissues, organs and / or subjects. In some aspects of the invention a subject is a human or vertebrate mammal including but not limited to a dog, cat, horse, cow, goat, mouse, rat, and primate, e.g., monkey. Thus, the  invention can be used to treat C3-associated diseases or conditions in human and non-human subjects. In some aspects of the invention a subject may be a farm animal, a zoo animal, a domesticated animal or non-domesticated animal and methods of the invention can be used in veterinary prevention and treatment regimens. In some embodiments of the invention, the subject is a human and methods of the invention can be used in human prevention and treatment regimens.

[0231] Non-limiting examples of subjects to which the present invention can be applied are subjects who are diagnosed with, suspected of having, or at risk of having a disease or condition associated with a higher than desirable C3 expression and / or activity, also referred to as “elevated levels of C3 expression” . Non-limiting examples of diseases and conditions associated with a higher than desirable levels of C3 expression and / or activity are described elsewhere herein. Methods of the invention may be applied to a subject who, at the time of treatment, has been diagnosed as having the disease or condition associated with a higher than desirable C3 expression and / or activity, or a subject who is considered to be at risk for having or developing a disease or condition associated with a higher than desirable C3 expression and / or activity. In some aspects of the invention a disease or condition associated with a higher than desirable C3 level of expression and / or activity is an acute disease or condition, and in certain aspects of the invention a disease or condition associated with a higher than desirable C3 level of expression and / or activity is a chronic disease or condition.

[0232] In a non-limiting example, a C3 dsRNA agent of the invention is administered to a subject diagnosed with, suspected of having, or at risk of having, statin resistant hypercholesterolemia, which is a disease in which it is desirable to reduce C3 expression. Methods of the invention may be applied to the subject who, at the time of treatment, has been diagnosed as having the disease or condition, or a subject who is considered to be at risk for having or developing the disease or condition.

[0233] In another non-limiting example, a C3 dsRNA agent of the invention is administered to a subject diagnosed with, suspected of having, or at risk of having, hyperlipidemia, which is a disease in which it is desirable to reduce C3 expression. Methods of the invention may be applied to the subject who, at the time of treatment, has been diagnosed as having the disease or condition, or a subject who is considered to be at risk for having or developing the disease or condition.

[0234] A cell to which methods of the invention may be applied include cells that are in vitro, in vivo, ex vivo cells. Cells may be in a subject, in culture, and / or in suspension, or in any other suitable state or condition. A cell to which a method of the invention may be applied can be a liver cell, a hepatocyte, a cardiac cell, a pancreatic cell, a cardiovascular cell, kidney cell or other type of vertebrate cell, including human and non-human mammalian cells. In certain aspects of the invention, a cell to which methods of the invention may be applied is a healthy, normal cell that is not known to be a disease cell. In certain embodiments of the invention a cell to which methods and compositions of the invention are applied to a liver cell, a hepatocyte, a cardiac cell,  a pancreatic cell, a cardiovascular cell, and / or a kidney cell. In certain aspects of the invention, a control cell is a normal cell, but it will be understood that a cell having a disease or condition may also serve as a control cell in particular circumstances for example to compare results in a treated cell having a disease or condition versus an untreated cell having the disease or condition, etc.

[0235] A level of C3 polypeptide activity can be determined and compared to control level of C3 polypeptide activity, according to methods of the invention. A control may be a predetermined value, which can take a variety of forms. It can be a single cut-off value, such as a median or mean. It can be established based upon comparative groups, such as in groups having normal levels of C3 polypeptide and / or C3 polypeptide activity and groups having increased levels of C3 polypeptide and / or C3 polypeptide activity. Another non-limiting example of comparative groups may be groups having one or more symptoms of or a diagnosis of a C3-associated disease or condition; groups without having one or more symptoms of or a diagnosis of the disease or condition; groups of subjects to whom an siRNA treatment of the invention has been administered; groups of subjects to whom an siRNA treatment of the invention has not been administered. Typically, a control may be based on apparently healthy normal individuals in an appropriate age bracket or apparently healthy cells. It will be understood that controls according to the invention may be, in addition to predetermined values, samples of materials tested in parallel with the experimental materials. Examples include samples from control populations or control samples generated through manufacture to be tested in parallel with the experimental samples. In some embodiments of the invention, a control may include a cell or subject not contacted or treated with a C3 dsRNA agent of the invention and in such instances, a control level of C3 polypeptide and / or C3 polypeptide activity can be compared to a level of C3 polypeptide and / or C3 polypeptide activity in a cell or subject contacted with a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention.

[0236] In some embodiments of the invention a level of C3 polypeptide determined for a subject can be a control level against which a level of C3 polypeptide determined for the same subject at a different time is compared. In a non-limiting example, a level of C3 is determined in a biological sample obtained from a subject who has not been administered a C3 treatment of the invention. In some embodiments, the biological sample is a serum sample. The level of C3 polypeptide determined in the sample obtained from the subject can serve as a baseline or control value for the subject. After one or more administrations of a C3 dsRNA agent to the subject in a treatment method of the invention, one or more additional serum samples can be obtained from the subject and the level of C3 polypeptide in the subsequent sample or samples can be compared to the control / baseline level for the subject. Such comparisons can be used to assess onset, progression, or recession of a C3 associated disease or condition in the subject. For example, a level of C3 polypeptide in the baseline sample obtained from the subject that is higher than a level obtained from the same subject after the subject has been administered a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention indicates regression of the C3-associated  disease or condition and indicates efficacy of the administered C3 dsRNA agent of the invention for treatment of the C3-associated disease or condition.

[0237] In some aspects of the invention, values of one or more of a level of C3 polypeptide and / or C3 polypeptide activity determined for a subject may serve as control values for later comparison of levels of C3 polypeptide and / or C3 activity, in that same subject, thus permitting assessment of changes from a “baseline” C3 polypeptide activity in a subject. Thus, an initial C3 polypeptide level and / or initial C3 polypeptide activity level may be present and / or determined in a subject and methods and compounds of the invention may be used to decrease the level of C3 polypeptide and / or C3 polypeptide activity in the subject, with the initial level serving as a control level for that subject.

[0238] Using methods of the invention, C3 dsRNA agents and / or C3 antisense polynucleotide agents of the invention may be administered to a subject. Efficacy of the administration and treatment of the invention can be assessed when a level of C3 polypeptide in a serum sample obtained from a subject is decreased by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a pre-administration level of C3 polypeptide in a serum sample obtained from the subject at a prior time point, or compared to a non-contacted control level, for example a level of C3 polypeptide in a control serum sample. It will be understood that a level of C3 polypeptide and a level of C3 polypeptide activity both correlate with a level of C3 gene expression. Certain embodiments of methods of the invention comprise administering a C3 dsRNA and / or C3 antisense agent of the invention to a subject in an amount effective to inhibit C3 gene expression and thereby reduce a level of C3 polypeptide and reduce a level of C3 polypeptide activity in the subject.

[0239] Some embodiments of the invention, include determining presence, absence, and / or an amount (also referred to herein as a level) of C3 polypeptide in one or more biological samples obtained from one or more subjects. The determination can be used to assess efficacy of a treatment method of the invention. For example, methods and compositions of the invention can be used to determine a level of C3 polypeptide in a biological sample obtained from a subject previously treated with administration of a C3 dsRNA agent and / or a C3 antisense agent of the invention. A level of C3 polypeptide determined in a serum sample obtained from the treated subject that is lower by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a pretreatment level of C3 polypeptide determined for the subject, or compared to a non-contacted control biological sample level, indicates a level of efficacy of the treatment administered to the subject.

[0240] In some embodiments of the invention a physiological characteristic of a C3-associated disease or condition determined for a subject can be a control determination against which a determination of the physiological characteristic in the same subject at a different time is compared. In a non-limiting example, a physiological characteristic such as the C3 mRNA level, the C3 protein level in the subject. The C3 mRNA level (and / or other physiological characteristic of a C3 disease or condition) determined in the sample obtained from the subject  can serve as a baseline or control value for the subject. After one or more administrations of a C3 dsRNA agent to the subject in a treatment method of the invention, one or more additional serum samples can be obtained from the subject and C3 mRNA level and / or C3 protein level in the subsequent sample or samples are compared to the control / baseline level and / or ratio, respectively, for the subject. Such comparisons can be used to assess onset, progression, or recession of a C3 associated disease or condition in the subject. For example, C3 mRNA level in the baseline sample obtained from the subject that is higher than C3 mRNA level determined in a sample obtained from the same subject after the subject has been administered a C3 dsRNA agent or C3 antisense polynucleotide agent of the invention indicates regression of the C3-associated disease or condition and indicates efficacy of the administered C3 dsRNA agent of the invention for treatment of the C3-associated disease or condition.

[0241] In some aspects of the invention, values of one or more of a physiological characteristic of a C3-associcated disease or condition determined for a subject may serve as control values for later comparison of the physiological characteristics in that same subject, thus permitting assessment of changes from a “baseline” physiological characteristic in a subject. Thus, an initial physiological characteristic may be present and / or determined in a subject and methods and compounds of the invention may be used to decrease the level of C3 polypeptide and / or C3 polypeptide activity in the subject, with the initial physiological characteristic determination serving as a control for that subject.

[0242] Using methods of the invention, C3 dsRNA agents and / or C3 antisense polynucleotide agents of the invention may be administered to a subject in an effective amount to treat a C3 disease or condition. Efficacy of the administration and treatment of the invention can be assessed by determining a change in one or more physiological characteristics of the C3 disease or condition. In a non-limiting example, a C3 mRNA level in a serum sample obtained from a subject is decreased by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to a pre-administration lipid in a serum sample obtained from the subject at a prior time point, or compared to a non-contacted control level, for example C3 mRNA level in a control serum sample. It will be understood that the C3 mRNA level, the C3 protein level in the subject, or the lipid level, the triglyceride, the cholesterol level, the free fatty acids level in the plasma or the tissue sample each correlates with a level of C3 gene expression. Certain embodiments of methods of the invention comprise administering a C3 dsRNA and / or C3 antisense agent of the invention to a subject in an amount effective to inhibit C3 gene expression and thereby reduce the C3 mRNA level, the C3 protein level in the subject, or otherwise positively impact a physiological characteristic of a C3-assocaited disease or condition in the subject.

[0243] Some embodiments of the invention, include determining presence, absence, and / or a change in a physiological characteristic of a C3-associated disease or condition using methods such as but not limited to: (1) assessing one or more biological samples obtained from one or more subjects for the physiological characteristic; (2) imaging a subject (for example but not  limited to obtaining a liver image) ; and (3) or physical examination of the subject. The determination can be used to assess efficacy of a treatment method of the invention.

[0244] Kits

[0245] Also within the scope of the invention are kits that comprise one or more C3 dsRNA agents and / or C3 antisense polynucleotide agents and instructions for its use in methods of the invention. Kits of the invention may include one or more of a C3 dsRNA agent, C3 sense polynucleotide, and C3 antisense polynucleotide agent that may be used to treat a C3-associated disease or condition. Kits containing one or more C3 dsRNA agents, C3 sense polynucleotides, and C3 antisense polynucleotide agents can be prepared for use in treatment methods of the invention. Components of kits of the invention may be packaged either in aqueous medium or in lyophilized form. A kit of the invention may comprise a carrier being compartmentalized to receive in close confinement therein one or more container means or series of container means such as test tubes, vials, flasks, bottles, syringes, or the like. A first container means or series of container means may contain one or more compounds such as a C3 dsRNA agent and / or C3 sense or antisense polynucleotide agent. A second container means or series of container means may contain a targeting agent, a labelling agent, a delivery agent, etc. that may be included as a portion of a C3 dsRNA agent and / or C3 antisense polynucleotide to be administered in an embodiment of a treatment method of the invention.

[0246] A kit of the invention may also include instructions. Instructions typically will be in written form and will provide guidance for carrying-out a treatment embodied by the kit and for making a determination based upon that treatment.

[0247] The following examples are provided to illustrate specific instances of the practice of the present invention and are not intended to limit the scope of the invention. As will be apparent to one of ordinary skill in the art, the present invention will find application in a variety of compositions and methods.

[0248] Examples

[0249] Example 1.

[0250] Phosphoramidite Compound 2

[0251] DMTrCl (232 g, 684 mmol, 1.0 eq) in pyridine (400 mL) was added to the solution of isomannide compound A (100 g, 684 mmol, 1.0 eq) in pyridine (600 mL) , and the mixture was stirred at 25 ℃ for 12 hrs. LC-MS showed compound A was consumed completely and one main peak with desired mass was detected. The resulting reaction mixture was diluted with water (500 mL) , extracted with DCM (500 mL *2) , and the combined organic phases were washed with brine (500 mL) , dried over Na2SO4 and concentrated in vacuum to get the residue. The residue was purified by column chromatography (DCM / MeOH=100 / 1 to 50 / 1, 0.1%Et3N) to give compound B (150 g, 48.9%yield) a yellow solid.

[0252] 1H NMR: EC4783-404-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.46 (br d, J=7.63 Hz, 2 H) 7.28 -7.37 (m, 6 H) 7.19 -7.25 (m, 1 H) 6.90 (br d, J=7.88 Hz, 4 H) 4.70 (d, J=6.50 Hz, 1 H) 3.99 -4.09 (m, 6 H) 3.88 -3.96 (m, 2 H) 3.83 (br dd, J=7.82, 6.94 Hz, 1 H) 3.74 (s, 6 H) 3.41 (br t, J=8.13 Hz, 1 H) 3.05 (t, J=8.44 Hz, 1 H) 2.85 (br t, J=7.50 Hz, 1 H) .

[0253] To a solution of compound B (80.0 g, 178 mmol, 1.0 eq) in DCM (800 mL) at 25 ℃ under N2 atmosphere was added dropwise 2H-tetrazole (0.45 M, 436 mL, 1.1 eq) , then compound C (80.6 g, 267 mmol, 85.0 mL, 1.5 eq) in DCM (200 mL) was added dropwise to the mixture. The reaction mixture was stirred at 25℃ under for 1.0 hr. LC-MS showed compound B was consumed completely and one main peak with desired mass was detected. The resulting reaction mixture was cooled to -20 ℃ and poured into ice cold sat. NaHCO3 (500 mL) , extracted with DCM (500 mL *3) , the combined organic layers were washed with sat. NaHCO3 / brine=1: 1 (3 00 mL / 300 mL) , dried over Na2SO4 and concentrated in vacuum (35 ℃) to get the residue (100 mL) . The residue was purified by column chromatography (Al2O3, DCM / MeOH=100 / 1 to 50 / 1, 0.1%Et3N) to give compound 2 (77 g, 119 mmol, 66.5%yield) as a white solid.

[0254] 1H NMR: EC4783-423-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.22 (br d, J=7.50 Hz, 2 H) 7.05 -7.14 (m, 6 H) 6.96 -7.02 (m, 1 H) 6.67 (br dd, J=8.82, 1.81 Hz, 4 H) 3.95 -4.07 (m, 2 H) 3.73 -3.83 (m, 1 H) 3.62 -3.72 (m, 2 H) 3.48 -3.53 (m, 6 H) 3.27 -3.37 (m, 3 H) 3.11 (s, 6 H) 2.82 (td, J=8.54, 2.31 Hz, 1 H) 2.47 -2.63 (m, 3 H) 2.28 (br d, J=1.63 Hz, 3 H) 0.82 -1.00 (m, 13 H) .

[0255] Phosphoramidite Compound 1

[0256] To a solution of compound B (500 mg, 1.11 mmol, 1.0 eq) in DCM (5.0 mL) was added compound D (607 mg, 3.34 mmol, 3.0 eq) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 eq) under N2 atmosphere at 0-5 ℃, the mixture was stirred at 25 ℃ for 1.0 hrs. LC-MS showed Compound B was consumed completely, several new peaks were shown on LC-MS and ～70.9% of desired compound was detected. The resulting reaction mixture was cooled to -20 ℃ and poured into cold (0-5 ℃) sat. NaHCO3 (5.0 mL) solution, extracted with DCM (5.0 mL *2) , the combined organic layers were washed with cold (0-5 ℃) sat. NaHCO3 / brine =1: 1 (5.0 mL / 5.0 mL) , dried over Na2SO4 and concentrated in vacuum to get the residue (～5 mL) . The residue was purified by column chromatography (alkaline Al2O3, Petroleum ether / Ethyl acetate=10 / 1 to 5 / 1, 0.1%Et3N) to give compound 1 (280 mg, 471 μmol, 42.3%yield) was obtained as a white solid.

[0257] 1H NMR: EC10615-49-P1N (400 MHz, DMSO-d6) δ ppm 7.44 (br d, J=7.63 Hz, 2 H) , 7.31 (br t, J=7.94 Hz, 6 H) , 7.18 -7.26 (m, 1 H) , 6.89 (brd, J=8.00 Hz, 4 H) , 4.08 -4.13 (m, 1 H) , 3.95 -4.03 (m, 1 H) , 3.84 -3.93 (m, 1 H) , 3.77 -3.83 (m, 1 H) , 3.74 (s, 6 H) , 3.43 -3.53 (m, 3 H) , 3.38 (br d, J=6.75 Hz, 1 H) , 2.94 -3.04 (m, 1 H) , 2.70 -2.85 (m, 1 H) , 1.09 -1.15 (m, 12 H) , 1.07 (br s, 3 H) .

[0258] Other phosphoramidites may be prepared according to procedures described herein and / or prior arts such as, but are not limited to, US426, 220 and WO02 / 36743.

[0259] Example 2. Preparation of a solid support comprising phosphoramidites monomers of the present invention

[0260] reprensents amine methyl polyethylene macroporous resin carrier part

[0261] Dichloromethane (19.50kg) was added to the 50 L glass kettle under the protection of nitrogen and started stirring. The temperature was controlled at 20～30 ℃, and DMTr imann (1.47 kg) , triethylamine (1.50 kg) , 4-dimethylaminopyridine (0.164 kg) and succinic anhydride (1.34 kg) was added to the glass kettle. The system was kept at 20～30 ℃ for 18h, samples were taken and the reaction was ended. Saturated sodium bicarbonate solution (22.50 kg) was added into the reaction system, stirred for 10-20 min, and allowed to separate into layers. The organic phase was separated, and the aqueous phase was extracted twice with dichloromethane, and the organic phase was combined and dried over anhydrous sodium sulfate, filtered, and concentrated in vacuum to get the residue forming a gray to off-white solid of 1.83 kg.

[0262] N, N-dimethylformamide (23.50 kg) was added into a 100L glass kettle and stirred. The temperature was controlled at 20～30 ℃. Under the protection of nitrogen, the products of the previous step, O-benzotriazole tetramethylurea hexafluorophosphate (0.33 kg) and N, N-diisopropylethylamine (0.13 kg) were added into the aforesaid 100L glass kettle through the solid feeding funnel and stirred for 10～30 minutes and were discharged into a 50 L zinc barrel for use. Macroporous amine methyl resin (3.25 kg) (purchased from Tianjin Nankai Hecheng Science and Technology Co., Ltd., batch number HA2X1209, load capacity 0.48 mmol / g) were  added into the aforesaid 100 L solid phase synthesis reactor through the solid feeding funnel, the temperature was controlled at 20～30 ℃, N, N-dimethylformamide (21.00 kg+21.00 kg) and the reaction solution in the zinc barrel of the previous step were add into the solid phase synthesis reactor. The system was subject to thermal insulation reaction, and the solid load was tracked to ≥ 250umol / g, and the load detection method was UV. The system was filtered under the pressure of nitrogen, the filter cake was washed with N, N-dimethylformamide for three times (26.00kg+26.10kg+26.00kg) , and the filter cake was left in the kettle. CAP. A (50%acetonitrile and 50%acetic anhydride, 4.40kg+4.42kg+4.30kg) and CAP. B (20%pyridine and 30%N-methylimidazole and 50%acetonitrile, 4.40kg+4.40kg+4.47kg) were added into the 80L glass kettle, and stirred for 3～8min before use. This operation was repeated for three times to cap, and acetonitrile (18.00 kg+18.00 kg+18.00 kg+17.50 kg+17.50 kg) was added into the solid phase synthesis kettle. Filter-pressed after nitrogen bubbling for 10～30 min. This operation was repeated for four times, the filter cake was purged in the solid phase synthesis kettle with nitrogen for 2-4 h, and then was transferred to a 50 L filter press tank. The temperature was controlled at 15～30 ℃, continued drying, and obtained yellow to white solid product after drying, weight: 3.516 kg.

[0263] The isomannide residue can be added to the 5'-end or 3'-end of the oligonucleotide chain by a method well known to those skilled in the art, such as the reverse abasic (invab) method, and further added to the target to the group.

[0264] Example 3. Synthesis of C3 RNAi Agents.

[0265] C3 RNAi agent duplexes shown in Table 2-3, above, were synthesized in accordance with the following general procedures:

[0266] Sense and antisense strand sequences of siRNA were synthesized on oligonucleotide synthesizers using a well-established solid phase synthesis method based on phosphoramidite chemistry. Oligonucleotide chain propagation is achieved through 4-step cycles: a deprotection, a condensation, a capping and an oxidation or a sulfurization step for addition of each nucleotide. Syntheses were performed on a solid support made of controlled pore glass (CPG,  ) . Monomer phosphoramidites may be purchased from commercial sources or may be the phosporamidite compounds in example 1. The phosporamidite compounds herein may be attached to the 3'-end as a monomeric phosphoramidite, and further be attached to the CPG solid support. In the case of attachment at the 5'-end, the phosphoramidite compounds may be used for the final coupling reaction, and can be further conjugated to target ligands if necessary. Phosphoramidites with GalNAc ligand cluster (GLS-5*or GLS-15*Phosphoramidites as non-limiting examples) were public in WO2023 / 045995A1 (incorporated herein in its entirety) . For siRNAs used for in vitro screening (Table 2) , syntheses were carried out at 2 μmol scale, and for siRNAs used for in vivo testing (Table 3) , syntheses were carried out at scale of 5 μmol or larger. In the case where the GalNAc ligand (GLO-n Phosphoramidites as non-limiting examples were public in WO2023 / 045995A1 (incorporated herein in its entirety) ) is attached at 3’ -end of sense  strand, GalNAc ligand attached CPG solid support was used. In the case where the GalNAc ligand (GLS-5*or GLS-15*as non-limiting example are attached at 5’ -end of sense strand, GLS-5*or GLS-15*Phosphoramidites with GalNAc ligand cluster were public in WO2023 / 045995A1 (incorporated herein in its entirety) ) are attached at 5’ -end of sense strand, a GalNAc phosphoramidite was used for the last coupling reaction. Trichloroacetic acid (TCA) 3%in dichloromethane was used for deprotection of 4, 4′-dimethoxytrityl protecting group (DMT) . 5-Ethylthio-1H-tetrazole was used as an activator. I2 in THF / Py / H2O and phenylacetyl disulfide (PADS) in pyridine / MeCN was used for oxidation and sulfurization reactions, respectively. After the final solid phase synthesis step, solid support bound oligomer was cleaved and protecting groups were removed by treating with a 1: 1 volume solution of 40 wt. %methylamine in water and 28%ammonium hydroxide solution. For the synthesis of siRNAs used for in vitro screening, crude mixture was concentrated. The remaining solid was dissolved in 1.0 M NaOAc, and ice cold EtOH was added to precipitate out the single strand product as the sodium salt, which was used for annealing without further purification. For the synthesis of siRNAs used for in vivo testing, crude single strand product was further purified by ion pairing reversed phase HPLC (IP-RP-HPLC) . Purified single strand oligonucleotide product from IP-RP-HPLC was converted to sodium salt by dissolving in 1.0 M NaOAc and precipitation by addition of ice cold EtOH. Annealing of equimolar complementary sense stand and antisense strand oligonucleotide in water was performed to form the double strand siRNA product, which was lyophilized to afford a fluffy white solid.

[0267] In certain studies, a method used to attach a targeting group comprising GalNAc (also referred to herein as a GalNAc delivery compound) to the 5’ -end of a sense strand included use of a GalNAc phosphoramidite (GLS-5*or GLS-15*Phosphoramidites) in the last coupling step in the solid phase synthesis, using a synthetic process such as the process used if oligonucleotide chain propagation of adding a nucleotide to the 5’ -end of the sense strand is performed.

[0268] In some studies a method of attaching a targeting group comprising GalNAc to the 3’ -end of a sense strand comprised use of a solid support (CPG) that included a GLO-n. In some studies, a method of attaching a targeting group comprising GalNAc to the 3’ -end of a sense strand comprises attaching a GalNAc targeting group to CPG solid support through an ester bond and using the resulting CPG with the attached GalNAc targeting group when synthesizing the sense strand, which results in the GalNAc targeting group attached at the 3’ -end of the sense strand.

[0269] The imann residues can be added to the 5'end or 3'end of the oligonucleotide chain by a method well known to those skilled in the art, such as the inverted abasic residues (invab) method, and / or further added to the target to the GalNAc targeting group.

[0270] Example 4. In Vitro Screening of C3 siRNA Duplexes

[0271] Huh7 cells were trypsinized and adjusted to appropriate density, and seeded into 96-well plates. Cells were transfected with test siRNAs or a control siRNA using Lipofectamine  RNAiMax (Invitrogen -13778-150) at the same time of seeding following the protocol according to manufacturer’s recommendation. The siRNAs were tested at two concentrations (0.6 nM and 0.08nM) in triplicate. siRNA-transfected cell samples were cultured for 24hrs before QPCR analysis of target gene expression in mRNA level.

[0272] The result shown in Table 5.

[0273] Table 5 provides experimental results of in vitro studies using various C3 RNAi agents to inhibit C3 expression. The duplex sequences used correspond to those shown in Table3.

[0274] Example 5 In Vivo testing of C3 siRNA Duplexes

[0275] At day 1, female C57BL / 6J mice (4 in each group) were infected by intravenous administration of a solution of adeno-associated virus 8 (AAV8) vector encoding human C3 and luciferase gene. At day 8, mice were subcutaneously administered a single 3 mg / kg of C3 siRNA agents or PBS. Blood samples were collected at day 8, before dosing of siRNA, at day 15, and day 22 . Plasma samples were isolated and luciferase activity of plasma samples was measured per manufacturer’s recommended protocol. Since expression of human C3 level correlates with expression level of luciferase, percent of remaining C3 was calculated by comparing luciferase activity in samples from siRNA treated groups before and after treatment, normalized by the change of luciferase activity over the same period of time in samples from the control treated group. Results are summarized in Table 6 and Table 7.

[0276] Table 6. C3 siRNA single 3 mpk subcutaneous dose screening in AAV-C3 transduced mouse. Percent of reduction of human C3 in mouse serum was normalized to C3 expression pre-dosing of siRNA and to the PBS control group.

[0277] Table 7. C3 siRNA single 2mpk subcutaneous dose screening in AAV-C3 transduced mouse. Percent of reduction of human C3 in mouse serum was normalized to C3 expression pre-dosing of siRNA and to the PBS control group.

[0278] Example 6 In Vivo testing of C3 siRNA Duplexes

[0279] At day 1, female C57BL / 6J mice (4 in each group) were infected by intravenous administration of a solution of adeno-associated virus 8 (AAV8) vector encoding human C3 and luciferase gene. At day 8, mice were subcutaneously administered a single 6 mg / kg of C3 siRNA agents or PBS. Blood samples were collected at day 8, before dosing of siRNA, at day 15, and day 22 . Plasma samples were isolated and luciferase activity of plasma samples was measured per manufacturer’s recommended protocol. Since expression of human C3 level correlates with expression level of luciferase, percent of remaining C3 was calculated by comparing luciferase activity in samples from siRNA treated groups before and after treatment, normalized by the change of luciferase activity over the same period of time in samples from the control treated group. Results are summarized in Table 8.

[0280] Table 8. C3 siRNA single 6 mpk subcutaneous dose screening in AAV-C3 transduced mouse. Percent of reduction of human C3 in mouse serum was normalized to C3 expression pre-dosing of siRNA and to the PBS control group.

[0281] Example 7 In Vivo testing of C3 siRNA Duplexes

[0282] At day 1, female C57BL / 6J mice (4 in each group) were infected by intravenous administration of a solution of adeno-associated virus 8 (AAV8) vector encoding human C3 and luciferase gene. At day 8, mice were subcutaneously administered a single 6 mg / kg of C3 siRNA agents or PBS. Blood samples were collected at day 8, before dosing of siRNA, at day 15 . Plasma samples were isolated and luciferase activity of plasma samples was measured per manufacturer’s recommended protocol. Since expression of human C3 level correlates with expression level of luciferase, percent of remaining C3 was calculated by comparing luciferase  activity in samples from siRNA treated groups before and after treatment, normalized by the change of luciferase activity over the same period of time in samples from the control treated group. Results are summarized in Table 9.

[0283] Table 9. C3 siRNA single 6 mpk subcutaneous dose screening in AAV-C3 transduced mouse. Percent of reduction of human C3 in mouse serum was normalized to C3 expression pre-dosing of siRNA and to the PBS control group.

[0284] Example 8 In Vivo testing of C3 siRNA Duplexes in NHP PD model

[0285] Male cynomolgus monkeys (5-6years old, 5～7kg of weights, 3 monkeys in each group) were enrolled in the study. Each monkey received a subcutaneous injection with one of the testing articles formulated in sterile saline at 5 mg / kg at day 0. After overnight fast, blood samples were drawn at day -14 (pre-dose) , -7 (pre-dose) , 0 (pre-dose) , 7 14, 21 and 28. C3 protein concentration in serum were measured by ELISA method (Abcam) . Percents inhibition of C3 (normalized to average C3 protein level in serum samples pre-dosing of siRNA) for groups dosed with testing siRNA duplexes a is shown in Figure 1.

[0286] Example 9 In Vivo testing of C3 siRNA Duplexes

[0287] At day 1, female C57BL / 6J mice (4 in each group, 4-6 weeks) were infected by intravenous administration of a solution of adeno-associated virus 8 (AAV8) vector encoding human C3 and luciferase gene. At day 8, mice were subcutaneously administered a single 1, 3, and 6 mg / kg of C3 siRNA agents or PBS. Blood samples were collected at day 8, before dosing of siRNA, at day 15 and 22. Plasma samples were isolated and luciferase activity of plasma samples was measured per manufacturer’s recommended protocol. Since expression of human C3 level correlates with expression level of luciferase, percent of remaining C3 was calculated by comparing luciferase activity in samples from siRNA treated groups before and after  treatment, normalized by the change of luciferase activity over the same period of time in samples from the control treated group. Results are summarized in Table 10.

[0288] Table 10. C3 siRNA single 1, 3, or 6 mpk subcutaneous dose screening in AAV-C3 transduced mouse. Percent of reduction of human C3 in mouse serum was normalized to C3 expression pre-dosing of siRNA and to the PBS control group.

[0289] Example 10 In Vivo testing of C3 siRNA Duplexes in NHP PD model

[0290] Male cynomolgus monkeys (5-6 years old, 5～7kg of weights, 3 monkeys in each group) were enrolled in the study. Each monkey received a subcutaneous injection with one of the testing articles formulated in sterile saline at 5 mg / kg at day 0. After overnight fast, blood samples were drawn at day -7 (pre-dose) , 0 (pre-dose) , 7 14, 21 and 28. C3 protein concentration in serum were measured by ELISA method (Abcam) . Percents inhibition of C3 (normalized to average C3 protein level in serum samples pre-dosing of siRNA) for groups dosed with testing siRNA duplexes a is shown in Figure 2.

[0291] Example 11 In Vivo testing of C3 siRNA Duplexes in NHP PD model

[0292] Male cynomolgus monkeys (5-6 years old, 5～7kg of weights, 3 monkeys in each group) were enrolled in the study. Each monkey received a subcutaneous injection with one of the testing articles formulated in sterile saline at 6 mg / kg at day 1. After overnight fast, liver biopsy samples were drawn at day -7 (pre-dose) , 29 and 57. C3 mRNA level were measured by qPCR method assay. Percents inhibition of C3 mRNA (normalized to average C3 level in liver biopsy samples day -7 pre-dosing of siRNA) for groups dosed with testing siRNA duplexes a is shown in Figure 3.

[0293] Example 12 phosphoramidite 15 (Enantiomeric phosphoramidite-15-1 and enantiomeric phosphoramidite-15-2)

[0294] Benzoyl chloride (126 g, 893 mmol, 104 mL) was added to a solution containing uracil (50.0 g, 446 mmol) in pyridine (735 g, 9.29 mol, 750 mL) and acetonitrile (1.50 L) at 0℃, the reaction solution was stirred at 20-25℃ for 12.0 hours, and TLC showed that the compound uracil was completely consumed. The reaction mixture was concentrated in vacuo to obtain a residue. The residue was diluted with cold water (1.0 L) and extracted with ethyl acetate (1.0 L *3) . The combined organic layers were washed with brine (500 mL) and dried over anhydrous sodium sulfate to obtain The residue was purified by column chromatography (SiO2 , ethyl acetate / petroleum ether = 1 / 10 to 1 / 1) to obtain white solid Phos-15-1A (63 g, 65.3%yield) .

[0295] 1H NMR: EC4783-420-P1N (400 MHz, DMSO-d6 ) δ ppm 7.96 (dd, J =8.4, 1.2 Hz, 2 H) , 7.76-7.81 (m, 1 H) , 7.67 (dd, J =7.6, 5.6 Hz, 1 H) , 7.58-7.64 (m, 2 H) , 5.75 (dd, J =7.6, 1.2 Hz, 1 H) .

[0296] To a solution of Phos-15-SM2 (4.0 g, 47.6 mmol) and compound Phos-15-1A (7.91 g, 36.6 mmol) in tetrahydrofuran (80 mL) was added triphenylphosphine (11.5 g, 43.9 mmol) and azo Diethyl dicarboxylate (7.64g, 43.9 mmol, 7.98 mL) , the mixture was stirred at 20-25℃ for 16 hours. LC-MS showed that compound Phos-15-1A was completely consumed. The reaction mixture was concentrated under reduced pressure to remove tetrahydrofuran. The residue was diluted with water (80 mL) , and then extracted with ethyl acetate (80 mL *3) . The combined organic phases were washed with brine (80 mL) , dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by column chromatography (SiO2, MeOH / DCM=0 / 10 to 1 / 10) to obtain compound Phos-15-1B (14 g, crude product) as a white solid.

[0297] Under nitrogen protection, a mixture of compound Phos-15-1B (7.0 g, 9.30 mmol) and m-chloroperoxybenzoic acid (2.27 g, 11.1 mmol, 85%purity) in dichloromethane (70 mL) was  heated at 0-5℃. After 16 hours of reaction, TLC showed that compound Phos-15-1B was completely consumed, and a major new spot with lower polarity was detected. Slowly adjust the pH of the reaction mixture to 7～8 with saturated NaHSO3 and NaHCO3 solutions (1: 1) , then extract with ethyl acetate (70 mL *3) , and wash the combined organic phases with brine (700mL) . Dry over anhydrous sodium sulfate and concentrate under reduced pressure. The residue was purified by silica gel column chromatography (100-200 mesh silica gel) , eluting with ethyl acetate: petroleum ether (1: 30～1: 1) to obtain white solid compound Phos-15-1C (1.2 g, crude product) .

[0298] To a solution of compound Phos-15-SM3 (4.0 g, 14.4 mmol) in tetrahydrofuran (24.0 mL) was added KSAc (1.81 g, 15.8 mmol) and tetrabutylammonium iodide (TBAI, 531.4 mg, 1.44 mmol) , and the mixture was stirred at 70℃ for 4.0 hours. LC-MS showed that the raw material Phos-15-SM3 was completely consumed, and a main peak with the desired target molecule molecular weight was detected. The reaction mixture was cooled and concentrated under reduced pressure. The solid residue was removed by filtration with a short silica gel pad and rinsed with ethyl acetate. The filtrate was concentrated in vacuo to obtain compound Phos-15-1D (3.50 g, 98.5%yield) as a brown oil. Compound Phos-15-1D was used in the next step without further purification.

[0299] 1H NMR: EC11950-13-P1B (400 MHz, DMSO-d6 ) δ ppm 3.96-4.07 (m, 4H) 3.27 (d, J =14.0 Hz, 2H) 2.40 (s, 3H) 1.22 (t, J =7.2 Hz, 6H) .

[0300] To a solution of compound Phos-15-1C (1.20 g, 4.02 mmol) in ethanol (15.0 mL) were added potassium carbonate (1.11 g, 8.05 mmol) and compound Phos-15-1D (1.91 g, 8.45 mmol) , and the mixture was added Stir at 20-25℃ for 3.0 hours. TLC showed that compound Phos-15-1C was completely consumed and a major new spot with greater polarity was detected. The resulting reaction mixture was filtered, diluted with water (20 mL) , extracted with dichloromethane (20 mL*3) , the combined organic layers were washed with brine, dried over anhydrous sodium sulfate and concentrated in vacuo to obtain a residue. The residue was purified by column chromatography (SiO2 , MeOH / DCM = 1 / 100 to 10 / 100) to obtain compound Phos-15-1E as a brown oil (1.00 g, 65.7%yield , 1: 1 mixture of enantiomeric compound-1E-1 and compound-1E-2) .

[0301] 1H NMR: EC10615-82-P1N1 (400 MHz, DMSO-d6 ) δ ppm 11.23 (br s, 1 H) , 7.69 (d, J =8.0 Hz, 1 H) , 5.58 (dd, J =8.0, 1.6 Hz, 1 H) , 4.93 (q, J =8.8 Hz, 1 H) , 3.96-4.17 (m, 5 H) , 3.08-3.17 (m, 1 H) , 3.03 (dd, J = 14.0, 2.0 Hz , 2 H) , 2.38-2.47 (m, 1 H) , 2.04-2.07 (m, 1 H) , 1.82-1.90 (m, 1 H) , 1.56-1.59 (m, 1 H) , 1.25 (t, J =6.8 Hz, 6 H) .

[0302] Compound Phos-15-1E can obtain enantiomers Phos-15-1E-1 and Phos-15-1E-2 through chiral resolution. Resolution conditions: DAICELCHIRALPAK AD 40mm column, 140 mL / min, ethanol: carbon dioxide = 35: 75. It can be understood that when it is necessary to obtain enantiomeric phosphoramidite-15-1 or enantiomeric phosphoramidite-15-2, as long as the corresponding enantiomer Phos-15-1E-1 or Phos-15-1E-2 is used as the starting material and reacted with the phosphorus reagent, it can be obtained

[0303] Under a nitrogen atmosphere at room temperature, to a solution of compound Phos-15-1E (400 mg, 1.06 mmol) and di-isopropylamine-tetrazolium salt (199 mg, 1.16 mmol) in dichloromethane (4.0 mL) was added a solution of bis (diisopropylamino) (2-cyanoethoxy) phosphine (P reagent, 956 mg, 3.17 mmol, 1.01 mL) in dichloromethane (0.5 mL) , and the mixture was stirred at 40℃ for 1.0 h. LC-MS showed that compound Phos-15-1E was  completely consumed, several new peaks appeared on LC-MS, and approximately 80%of the desired compound was detected. The resulting reaction mixture was cooled to -20℃ and poured into cold (0-5℃) saturated aqueous sodium bicarbonate solution (10 mL) , extracted with dichloromethane (10 mL*2) , and the combined organic layers were washed with cold (0-5 ℃) saturated aqueous sodium bicarbonate solution / brine (5 mL / 5 mL) , dry over anhydrous sodium sulfate, and concentrate in vacuo to obtain a residue (～2.0 mL) . The residue was purified by column chromatography (basic Al2O3 , MeOH / DCM = 1 / 80 to 1 / 40, 0.1%Et3N) to give phosphoramidite-15 as a colorless oil (350 mg, 0.6 mmol, 57.2%yield, 1: 1 mixture of enantiomeric phosphoramidite-15-1 and enantiomeric phosphoramidite-15-2 ) .

[0304] Enantiophosphoramidite-15-1 or enantiophosphoramidite-15-2 can be obtained independently, from the corresponding Phos-15-1E-1 or Phos-15-1E-2 obtained by SFC separation and purification as the starting material, according the same process as above.

[0305] δ ppm 11.23 (br s, 1 H) , 7.70 (d, J =8.0 Hz, 1 H) , 5.55-5.60 (m, 1 H) , 4.89 (q, J =8.4 Hz, 1H) , 4.29-4.42 (m, 1H) , 3.99-4.09 (m, 4H) , 3.65-3.84 (m, 2H) , 3.53-3.62 (m, 2H) , 3.35-3.41 (m, 1H) , 3.02 (dd, J =14.0 , 8.0 Hz, 2H) , 2.76-2.79 (m, 2H) , 2.40-2.49 (m, 1H) , 2.15-2.25 (m, 1H) , 1.95-2.07 (m, 1H) , 1.65-1.75 (m, 1H) , 1.23-1.26 (m, 6H) 1.12-1.21 (m, 12H) .

[0306] The phosporamidite 15 compounds a 1: 1 mixture of phosporamidite 15-1 and phosporamidite 15-2 herein may be attached to the 5'-end as a monomeric phosphoramidite, in the case, the phosphoramidite compounds may be used for the final coupling reaction, For example, the formation of phos-15*nucleotide at 5’ end of antisense.

[0307] Equivalents

[0308] Although several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the present invention. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations will depend upon the specific application or applications for which the teachings of the present invention is / are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto; the invention may be practiced otherwise than as specifically described and claimed. The present invention is directed to each individual feature, system, article, material, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, and / or methods, if such features, systems,  articles, materials, and / or methods are not mutually inconsistent, is included within the scope of the present invention.

[0309] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0310] The indefinite articles “a” and “an, ” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one. ”

[0311] The phrase “and / or, ” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the “and / or” clause, whether related or unrelated to those elements specifically identified, unless clearly indicated to the contrary.

[0312] All references, patents and patent applications and publications that are cited or referred to in this application are incorporated herein in their entirety herein by reference.

Claims

1.A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of C3, wherein the dsRNA agent including a sense strand and an antisense strand, wherein said antisense strand comprises a region of complementarity to a C3 RNA transcript which comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from one of the antisense sequences of any one of SEQ ID NOs: 25-28, 31-35, 39-41, 45-47; and optionally including a targeting ligand; wherein the sense strand and the antisense strand can be partially, substantially, or fully complementary to each other.2.The dsRNA agent of claim 1, wherein the dsRNA agent includes a sense strand and an antisense strand, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from aone of the antisense sequences of any one of SEQ ID NOs: 2-5, 8-12, 16-18, 22-24 .3.The dsRNA agent of any one of claims 1-2, wherein the sense strand and antisense strands comprise the sequences set forth as a duplex sequences selected from the group consisting of:(a) SEQ ID NOs: 2 and 25, respectively;(b) SEQ ID NOs: 3 and 26, respectively;(c) SEQ ID NOs: 4 and 27, respectively;(d) SEQ ID NOs: 8 and 31, respectively;(e) SEQ ID NOs: 9 and 32, respectively;(f) SEQ ID NOs: 10 and 33, respectively;(g) SEQ ID NOs: 11 and 34, respectively;(h) SEQ ID NOs: 12 and 35, respectively;(i) SEQ ID NOs: 16 and 39, respectively;(j) SEQ ID NOs: 17 and 40, respectively;(k) SEQ ID NOs: 18 and 41, respectively;(l) SEQ ID NOs: 22 and 45, respectively;(m) SEQ ID NOs: 23 and 46, respectively; and(n) SEQ ID NOs: 24 and 47, respectively.4.The dsRNA agent of any one of claims 1-2, wherein the antisense strand of dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (I) : 5'-Z1UAUUCAUGAGCUUCGUAGZ2 -3' (I) , wherein Z1is selected from one of C, G, A, U or absent, Z2 is a nucleotide sequence is 0-15 nucleotides in length.5.The dsRNA agent of any one of claims 1-2, wherein the antisense strand of dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (III) : 5'-Z5UGUUCAUUCUGAUUCCUUZ6-3' (III) , wherein Z5 is selected from one of C, G, A, U or absent, Z6 is a nucleotide sequence is 0-15 nucleotides in length..6.The dsRNA agent of any one of claims 1-2, wherein the antisense strand of dsRNA comprises a nucleotide sequence of at least 15, 16, 17, 18, or 19 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from formula (V) : 5'-Z9GUAGUAGAAUUUCUCUGUZ10-3' (V) , wherein Z9 is selected from one of C, G, A, U or absent, Z10 is a nucleotide sequence is 0-15 nucleotides in length.7.The dsRNA agent of any one of claims 1-6, wherein the dsRNA agent comprises at least one modified nucleotide.8.The dsRNA agent of any one of claims 1-7, wherein all or substantially all of the nucleotides of the sense strand and / or the antisense strand are modified nucleotides.9.A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of C3, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to part of a C3 RNA transcript, wherein each strand is about 15 to about 30 nucleotides in length, wherein the sense strand comprises sequence may be represented by formula (A) : 5′- (N′L) n′N′LN′LN′LN′LN′FN′LN′FN′LN′N1N′N2N′LN′LN′LN′LN′L (N′L) m′-3′  (A)wherein:each N′F represents a 2'-fluoro-modified nucleotide; each N′N1 and N′N2 independently represents a modified or unmodified nucleotide; each N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and m′ and n′ are each independently an integer of 0 to 7.10.A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of C3is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand comprises a region complementary to part of a C3 RNA transcript, , wherein each strand is about 18 to about  30 nucleotides in length, wherein the antisense strand comprises sequence may be represented by formula (B) : 3′- (NL) nNM1NLNM2NLNFNLNM3NM4NLNLNLNM5NLNM6NLNLNFNL-5′ (B)wherein:each NF represents a 2'-fluoro-modified nucleotide; each NM1, NM2, NM3, NM4, NM5, and NM6 independently represents a modified or unmodified nucleotide; each NL independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and n is an integer of 0 to 7.11.A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of C3 is provided, wherein the dsRNA agent including a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein said sense strand is complementary to the antisense strand, wherein said antisense strand comprises a region of complementarity to a C3 RNA transcript, wherein the region of complementarity comprises at least 15 contiguous nucleotides, wherein the dsRNA comprises duplex represented by formula (C) : sense: 5′- (N′L) n′N′LN′LN′LN′LN′FN′LN′FN′LN′N1N′N2N′LN′LN′LN′LN′L (N′L) m′-3′ antisense: 3′- (NL) nNM1NLNM2NLNFNLNM3NM4NLNLNLNM5NLNM6NLNLNFNL-5′ (C)wherein:each strand is about 18 to about 30 nucleotides in length;each NF and N′F independently represents a 2'-fluoro-modified nucleotide; NM1, NM2, NM3, NM4, NM5, N′N1, and N′N2 each independently represents a modified or unmodified nucleotide; N′N1 and N′N2 include only one 2'-Fluorine modified nucleotides; NM1, NM2, NM3, NM4, NM5, and NM6 have only three 2'-fluoro-modified nucleotides; each NL and N′L independently represents a modified or unmodified nucleotide but not a 2'-fluoro-modified nucleotide, and m′, n′ and n are each independently an integer of 0 to 7.12.The dsRNA agent of any one of claims 1-11, wherein the one or more modified nucleotides are independently selected from the group consisting of: a 2’-O-methyl nucleotide, a 2’-Fluoro nucleotide, a 2’-deoxy nucleotide, a 2’3’-seco nucleotide mimic, a locked nucleotide, an unlocked nucleic acid nucleotide (UNA) , a glycol nucleic acid nucleotide (GNA) , a 2’-F-Arabino nucleotide, a 2’-methoyxyethyl nucleotide, an abasic nucleotide, an ribitol, inverted nucleotide, an inverted abasic nucleotide, an isomannide nucleotide, an inverted 2’-Ome nucleotide, an inverted 2’-deoxy nucleotide, a 2’-amino-modified nucleotide, a 2’-alkyl-modified nucleotide, a mopholino nucleotide, a 3’-OMe nucleotide, a nucleotide comprising a  5’-phosphorothioate group, a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a 2’-amino-modified nucleotide, a phosphoramidate, or a non-natural base comprising nucleotide.13.The dsRNA agent of any one of claims 1-12, comprises an E-vinylphosphonate nucleotide at the 5′ end of the guide strand.14.The dsRNA agent of any one of claims 1-13, wherein the dsRNA agent comprises at least one phosphorothioate internucleoside linkage.15.The dsRNA agent of any one of claims 1-14 wherein the sense strand comprises at least one phosphorothioate internucleoside linkage.16.The dsRNA agent of any one of claims 1-14, wherein the antisense strand comprises at least one phosphorothioate internucleoside linkage.17.The dsRNA agent of any one of claims 1-14, wherein the sense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.18.The dsRNA agent of any one of claims 1-14, wherein the antisense strand comprises 1, 2, 3, 4, 5, or 6 phosphorothioate internucleoside linkages.19.The dsRNA agent of any one of claims 1-18, whereinthe dsRNA comprises a duplex selected from AV04969, AV04970, AV04971, AV04972, AV04973, AV04974, AV04975, AV04976, AV04977, AV04978, AV04979, AV04980 and wherein duplex optionally including a targeting ligand.20.The dsRNA agent of any one of claims 1-19, wherein the sense strand is complementary or substantially complementary to the antisense strand, and the region of complementarity is between 16 and 23 nucleotides in length.21.The dsRNA agent of any one of claims 1-20, wherein the region of complementarity is 19-21 nucleotides in length.22.The dsRNA agent of any one of claims 1-21, wherein each strand is no more than 40 nucleotides in length.23.The dsRNA agent of any one of claims 1-21, wherein each strand is no more than 30 nucleotides in length.24.The dsRNA agent of any one of claims 1-21, wherein each strand is no more than 25 nucleotides in length.25.The dsRNA agent of any one of claims 1-21, wherein each strand is no more than 23 nucleotides in length.26.The dsRNA agent of any one of claims 1-25, wherein the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups.27.The dsRNA agent of claim 26, wherein the one or more targeting groups or linking groups are conjugated to the sense strand.28.The dsRNA agent of claim 26 or 27, wherein the targeting group or linking group comprises N-acetyl-galactosamine (GalNAc) .29.The dsRNA agent of claim 26-28, wherein the targeting group has a structure: n” are independently selected from 1 or 2.30.The dsRNA agent of claim26-29, wherein the targeting group has a structure: 31.The dsRNA agent of any one of claims 1-30, wherein the dsRNA agent comprises a targeting group that is conjugated to the 5’-terminal end of the sense strand.32.The dsRNA agent of any one of claims 1-30, wherein the dsRNA agent comprises a targeting group that is conjugated to the 3'-terminal end of the sense strand.33.The dsRNA agent of any one of claims 1-30, wherein the antisense strand comprises one inverted abasic residue at 3’-terminal end.34.The dsRNA agent of any one of claims 1-30, wherein the sense strand comprises one or two inverted abasic residues or imann residues at 3’ or / and 5’ terminal end.35.The dsRNA agent of any one of claims 1-34, wherein the dsRNA agent has two blunt ends.36.The dsRNA agent of any one of claims 1-34, wherein at least one strand comprises a 3’ overhang of at least 1 nucleotide.37.The dsRNA agent of any one of claims 1-34, wherein at least one strand comprises a 3’ overhang of at least 2 nucleotides.38.The dsRNA agent of any one of claims 1-37, the dsRNA comprises a duplex selected from the group consisting of AD01444, AD01444-1, AD01444-2, AD01444-3, AD00193, AD00193-1, AD00193-2, AD00193-4, AD01424, AD01428, AD01447, AD01447-1, AD01447-2, AD01447-3, AD01447-4 .39.The dsRNA agent of any one of claims 1-38 wherein the C3 RNA transcript is SEQ ID NO: 1.40.A composition comprising a dsRNA agent of any one of claims 1-39.41.The composition of claim 49, further comprising a pharmaceutically acceptable carrier.42.The composition of claim 41, further comprising one or more additional therapeutic agents.43.The composition of claim 42, wherein the composition is packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial.44.The composition of any one of claims40-43, wherein the composition is formulated for subcutaneous administration or is formulated for intravenous (IV) administration.45.A cell comprising a dsRNA agent of any one of claims 1-39, optionally, the cell is a mammalian cell, optionally a human cell.46.A method of inhibiting the expression of a C3 gene in a cell, the method comprising:(i) preparing a cell comprising an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-39 or a composition of any one of claims 40-44.47.The method of claim 46, further comprising:(ii) maintaining the cell prepared in claim 46 (i) for a time sufficient to obtain degradation of the mRNA transcript of a C3 gene, thereby inhibiting expression of the C3 gene in the cell.48.The method of any one of claims 46-47, wherein the cell is in a subject and the dsRNA agent is administered to the subject subcutaneously.49.The method of any one of claims 46-47, wherein the cell is in a subject and the dsRNA agent is administered to the subject by IV administration.50.The method of claim 48 or 49, further comprising assessing inhibition of the C3 gene, following the administration of the dsRNA agent to the subject, wherein a means for the assessing comprises:(i) determining one or more physiological characteristics of a C3-associated disease or condition in the subject and(ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the C3-associated disease or condition and / or to a control physiological characteristic of the C3-associated disease or condition,wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the C3 gene in the subject.51.The method of claim 50, wherein the determined physiological characteristic is one or more of: the C3 mRNA level, the C3 protein level in the subject.52.The method of claim 51, wherein a reduction in one or more of the subject’s C3 mRNA level, the C3 protein level in the subject.53.A method of inhibiting expression of a C3 gene in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-39 or a composition of any one of claims 40-44.54.The method of claim 53, wherein the dsRNA agent is administered to the subject subcutaneously.55.The method of claim 53, wherein the dsRNA agent is administered to the subject by IV administration.56.The method of any one of claims 53-55, further comprising assessing inhibition of the C3 gene, following the administration of the dsRNA agent, wherein a means for the assessing comprises:(i) determining one or more physiological characteristics of a C3-associated disease or condition in the subject and(ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the C3-associated disease or condition and / or to a control physiological characteristic of the C3-associated disease or condition,wherein the comparison indicates one or more of a presence or absence of inhibition of expression of the C3 gene in the subject.57.A method of treating a disease or condition associated with the presence of C3 protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-39, or a composition of any one of claims 40-44, to inhibit C3 gene expression.58.The method of claim 57, wherein the disease or condition is one or more of: C3 Glomerulopathy (C3G) , atypical Hemolytic Uremic Syndrome (aHUS) , Immune Complex-mediated Glomerulonephritis (IC-mediated GN) , C3 glomerulonephritis, post-Infectious Glomerulonephritis (PIGN) , Systemic Lupus Erythematosus, Lupus nephritis, Ischemia / reperfusion injury , IgA nephropathy (IgA N;) , age-related macular degeneration (AMD) , Rheumatoid arthritis (RA) , antineutrophil Cytoplasmic Autoantibodies-associated Vasculitis (ANCA-AV) , dysbiotic periodontal Disease, Malarial Anaemia, Paroxysmal Nocturnal Hemoglobinuria (PNH) , sepsis, neuromyelitis optica (NMO) , multifocal motor neuropathy (MMN) , myasthenia gravis (MG) , rheumatoid arthritis, and neurodegenerative diseases .59.The method of claim 58, further comprising administering an additional therapeutic regimen to the subject.60.The method of claim 59, wherein the additional therapeutic regimen comprises: administering to the subject one or more C3 antisense polynucleotides of the invention, administering to the subject a non-C3 dsRNA therapeutic agent, and a behavioral modification in the subject.61.The method of claim 60, wherein the non-C3 dsRNA therapeutic agent is one of more of: an inhibitor of C5, such as an anticomplement component C5 antibody, or antigen-binding fragment thereof (e.g., eculizumab, ravulizumab-cwvz, or pozelimab (REGN3918) ) or a C5 peptide inhibitor (e.g., zilucoplan) ; C3 peptide inhibitor, such as compstatin.62.The method of any one of claims 57-61, wherein the dsRNA agent is administered to the subject subcutaneously.63.The method of any one of claims 57-61, wherein the dsRNA agent is administered to the subject by IV administration.64.The method of any one of claims 57-63, further comprising determining an efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject.65.The method of claim 64, wherein a means of determining an efficacy of the treatment in the subject comprises:(i) determining one or more physiological characteristics of the C3-associated disease or condition in the subject and(ii) comparing the determined physiological characteristic (s) to a baseline pre-treatment physiological characteristic of the C3-associated disease or conditionwherein the comparison indicates one or more of a presence, absence, and level of efficacy of the administration of the double-stranded ribonucleic acid (dsRNA) agent to the subject.66.The method of claim 65, wherein the determined physiological characteristic is: the C3 mRNA level, the C3 protein level in the subjec.

Images