NEW BIOCONTROL AGENT AND ITS USE IN THE FIGHT AGAINST FUNGAL PLANT DISEASES

Abstract

The present invention relates to a new biocontrol agent and its use for the control of fungal diseases of plants.

Description

Title of the invention: NEW BIOCONTROL AGENT AND ITS USE FOR THE FIGHT AGAINST FUNGAL PLANT DISEASES Technical field

[0001] The present invention relates to a novel biocontrol agent and its use for combating fungal diseases of plants. Prior art

[0002] Various diseases threaten wheat during its growth. They can be classified into three categories:

[0003] • diseases of the base of the stems (e.g.: eyespot, fusarium wilt), • leaf diseases (e.g. powdery mildew, septoria, helminthosporiosis, yellow rust and brown rust); • and ear diseases (e.g., ear fusarium, ear powdery mildew, and septoria).

[0004] Depending on the plant variety and climatic conditions, significant quantitative losses of crops are possible, such as with septoria, which reduces the plant's photosynthetic activity. In addition, other diseases can affect the quality of the harvest, such as ear fusarium, which produces mycotoxins.

[0005] More precisely:

[0006] [1] Septoria, the pathogenic agent of which is Septoria tritici (= Mycosphaerella gra- minicola), is the most common and quantitatively damaging disease of soft wheat, with, for example, a 17 q / ha drop in average yield across the country over the last ten years. "Wheat septoria" refers to two diseases:

[0007] • ear septoria caused by the fungus Phaeosphaeria nodorum (anamorph / asexual form: Stagonospora nodorum) which attacks the leaves but also the ears and grains of wheat; and • leaf septoria caused by the fungus Mycosphaerella gra-minicola (anamorph / asexual form: Septoria tritici, recently renamed Zymoseptoria tritici) which attacks wheat leaves and sheaths.

[0008] Septoria P. nodorum was the predominant species in France until the 1980s; nowadays the majority form is Septoria M. graminicola, probably for ecological reasons (Bearchell, SJ, Fraaije, BA, Shaw, MW, & Fitt, BDL (2005). Wheat archive links long-term fungal pathogen population dynamics to air pollution. Proceedings of the National Academy of Sciences of the United States of America, 102(15), 5438-42.).

[0009] [2] Fusarium wilt, the pathogenic agent of which is Gibberella zeae (= Fusarium gra- minearum), is a generic term for a group of fungal diseases. In the case of wheat, this disease can devastate a crop a few weeks before harvest. In addition to wheat, it is also found on other species such as corn and barley. Unlike Septoria, Fusarium ear blight can infect all parts of the plant, from roots to ears, and at all stages of development. The term "Fusarium ear blight" of cereals covers three types of symptoms (Parry, DW, Jenkinson, P., & McLeod, L. (1995). Fusarium ear blight (scab) in small grain cereals, a review. Plant Pathology, 44(2), 207-238.):

[0010] • seed fusarium; • Fusarium crown wilt; And • fusarium head blight.

[0011] The latter, ear blight, is associated with a complex of fungal species belonging to the genera Fusarium and Microdochium. The genus Fusarium was first described in 1809 by Link and owes its name to the Latin "fusus" (spindle) in relation to the fusiform appearance of its spores. It belongs to the division of Ascomycetes, to the order Hypocreales and to the family Nectriaceae. Among the twenty or so species of the genus Fusarium that can cause ear blight, F. gra-minearum is one of the most problematic species in France due to its production of mycotoxins including trichothecene deoxynivalenol (DON).

[0012] [3] Wheat brown rust, the pathogen of which is Puccinia recondita, is a disease that generally appears quite late in the spring. It can cause significant damage if poorly controlled. The fungus overwinters mainly on cereal regrowth and early-sown crops in the form of urediniospores. These urediniospores germinate in the presence of free water and at temperatures between 15 and 25°C. The sporulation period is 5 to 25 days depending on the temperature and the variety. Under favorable conditions, more than 3000 urediniospores can be produced per pustule, which explains the explosive nature of the disease. Spores are disseminated mainly by wind (Ali, S., Gladieux, P., Leconte, M., Gautier, A., Justesen, AF, Hovm011er, MS, Enjalbert, J., de Val-lavieille-Pope, C. (2014). Origin, Migration Routes and Worldwide Population Genetic Structure of the Wheat Yellow Rust Pathogen Puccinia striiformis f.sp. tritici. PLoS Pathogens, 10(1), el003903; De Vallavieille-Pope, C., Ali, S., & Leconte, M.(2012). Special Report Virulence Dynamics and Regional Structuring of Puccinia striiformis f sp. tritici in France Between 1984 and 2009.). .

[0013] [4] Yellow rust of wheat, the pathogen of which is Puccinia striiformis, is a disease that can be very harmful to susceptible varieties in the event of early attacks. Cool, humid conditions are favorable to its development. Rust Yellow rust overwinters as mycelium or active spores on volunteer cereals or crops sown early in the fall. This fungus is resistant to sub-zero temperatures and usually survives the winter on infected plants. In spring, yellow rust begins to develop and produce active spores, especially in cool, humid weather. Optimal conditions for spore germination occur when temperatures are between 10 and 13°C with 100% relative humidity. Spores are spread primarily by wind (Rossi, V., Racca, P., Giosue', S., Pancaldi, D., & Alberti, I. (1997). A simulation model for the development of brown rust epidemics in winter wheat. European Journal of Plant Pathology, 103(5), 453-465.).

[0014] Among the various control methods available to combat these diseases, in particular Septoria and Fusarium wilt and their consequences, there are chemical control (fungicides), varietal resistance, plant defense stimulators (SDN or "elicitors"), agronomic control (soil work, previous crops, management of crop residues or regrowth, sowing date and density, nitrogen fertilization, etc.). However, these either have environmental disadvantages linked to the pollution of soil and water tables, or involve a significant human and time cost.

[0015] In an effort to respect the environment, natural biological control methods using microorganisms have been developed. The latter, also called direct microbiological control, consists of introducing specific microbial antagonists into the soil or onto plant material. These antagonists, also called biological control agents or BCAs (Biological Control Agents), can interfere with the growth and / or survival of pathogens, thus enabling them to be controlled. To do this, biological control agents or BCAs can control the target pathogens through one or more modes of action:

[0016] 1. competition, which can take place between the BCA and the pathogen for oxygen, for space, or even for nutrients; 2. antibiosis, which corresponds to interactions involving at least one diffusible compound of low molecular mass or an antibiotic produced by a microorganism which inhibits the growth of another microorganism; 3. parasitism and the production of hydrolytic enzymes and / or antibiotic metabolites to the detriment of another host organism; and / or 4. the induction of resistance in the host plant (“elicitation”) like the bacteria of the rhizosphere, known as PGPR (Plant Growth Promoting Rhizobacteria), which are capable of inducing in the plant an induced systemic resistance (ISR, Induced Systemic Resistance) which makes it possible to increase resistance to pathogens thanks to a phenomenon of po priming, which corresponds to a state of wakefulness allowing a faster and more intense immune response from the plant.

[0017] The genus Trichoderma includes various species of fungi capable of being biocontrol agents, their mode of action has been the subject of numerous studies. They report in particular a capacity of this filamentous fungus to intervene according to various mechanisms: mycoparasitism, antagonism (competition), antibiosis (production of antibiotics), root stimulation, stimulation of growth by solubilization of fertilizing minerals, stimulation of the natural defenses of plants, etc. They colonize the roots of herbaceous and woody plants without any damage. In addition, this fungus can penetrate the roots and promote development, nutrition and resistance to diseases. However, the effects are unequal from one species to another or even from one strain to another because a good biological control agent must be a good colonizer and a good antagonist but above all, it must also be compatible with the rhizosphere and with the plants. BRIEF OVERVIEW

[0018] In this context of combating fungal diseases, such as septoria and fusarium, a first aim of the invention therefore consists of providing an effective strain, such as a biological control agent (or biocontrol agent).

[0019] A second aim of the invention is to provide phytosanitary compositions for the prevention and / or treatment of fungal diseases of plants.

[0020] A third aim of the invention is also to provide phytosanitary coating compositions where, in association with a plant seed, the strain of the invention is used as an agent for accelerating the germination of said seed.

[0021] Another object of the invention is to provide methods for manufacturing said compositions and for implementing the prevention and / or treatment of fungal diseases of plants, and the acceleration of germination. Description of the embodiments

[0022] A first aspect of the invention relates to an isolated strain of Trichoderma atroviride whose ech42 gene has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333.

[0023] Surprisingly, it appeared that the strain of Trichoderma atroviride TAL-17 developed by the inventors, whose ech42 gene was sequenced, has excellent growth-stimulating properties, antagonistic properties useful in agriculture as well as high stability in terms of viability. In fact, it constitutes an ideal biocontrol agent for effectively combating diseases plant fungi.

[0024] By "a sequence identity of at least 98% with the sequence SEQ ID NO: 1" is meant a sequence identity of at least 98.5%, at least 99% or even at least 99.5% with the sequence SEQ ID NO: 1 represented by the following nucleic acid sequence:

[0025] ACAGTATAAGCATATCGGAGAAATGCCACCACCAGCAACGTTGCTAGAC TTGGCGAGGTGCGGCATAGTTCAGTGATATTGCGCCGGGGCATCCCCTGGA TATGCTTATCTTCTGAATCTGGGGAACTTGGGAATTCTACGAGTCGACAGC CGCCGAGCCCTGGGCACGGGACAGGGGCCACAAGCTCTTGCACGATGGCA CTATTCTAGAGCAGAAGTGAGCATAACGTTGCGATTGACCATGTTGGCAAA GCATGGGTTACATACCTACTCGTGCTAAGAACCCCGAAAGGGAAGCTTCAT AAGTTGACTTCAGATTTCGCTGAACAATAGGAGGCTCCACAATCACTTATA AATATGCTGCATATCCTTCCAGCACTTCGGATGAAAATTCCATCCAGCAGC AGCAACTTGGAGAGCTCTTTTCAGCAGCAACTTCTTCCTTTCAAAGCATCTC TTGACAACCTTTGCTGAATCTCAAACACTTCACCATGTTGGGCTTCCTCGGA AAATCCGTGGCCCTGCTTGCTGCGCTGCAGGCCACTCTCATTTCTGCATCTC CTGTAACTGCAAACGACGTCTCTGTTGAGAAGAGAGCCAGTGGATACGCA AACGCCGTCTACTTCACCAACTGGTAAGTGAAGCTGCTTCAGAGTCATGAA AATCAGGACTAACCATTGGTGATTAAAGGGGTATTTACGGCCGCAACTTCC AGCCTCAGAACCTGGTCGCGTCGGACATCACTCATGTCATCTACTCGTTCA TGAACTTCCAAGCAGACGGCACTGTGTAAGTTTTGAAGACAAGAGTCAAG ATATTCTAATTTCCATATCCAGTGACTAATCTTTTCACTTATAGCGTCTCTG GAGATGCCTACGCCGATTATCAGAAGCACTATGACGACGATTGTATGCTAG CCCTACTCCCTTTGTTCTCTCCTGTTTTTGAGCTCTTCAGGTATACTAACGTCTACAACAGCTTGGAACGACGTCGGTAACAATGCGTACGGCTGTGTGAAGC AGCTGTTCAAGCTGAAGAAGGCCAACCGCAACTTGAAGGTTATGCTTTCCA TCGGTGGCTGGACCTGGTCCACCAACTTTCCTTCTGCAGCAAGCACCGATG CCAACCGCAAGAACTTTGCCAAGACTGCCATCACCTTCATGAAGGACTGGG GTTTCGATGGTATTGACGTCGATTGGGAGTACCCCGCCGATGATACCCAGG CCACCAACATGGTTCTTCTGCTCAAGGAGATCCGATCTCAGCTAGATGCCT ATGCTGCGCAATACGCTCCGGGCTACCACTTCCTTCTTTCCATTGCTGCCCC CGCTGGCCCAGAGCACTACTCTTTCCTGCACATGTCCGACCTTGGCCAAGT TCTCGACTATGTCAACCTCATGGCCTACGACTATGCTGGTTCTTGGAGCAG CTACTCCGGACACGATGCCAACTTGTTTGCCAACCCGTCCAACCCCAACTC TTCACCATACAACACCGATCAAGCTATCAAGGACTATATCAAGGGAGGTGT TCCCGCAAGCAAGATCGTTCTTGGCATGCCCATCTACGGACGAGCTTTTGA GAGCACCGGTGGCATTGGCCAGACCTACAGTGGAATTGGATCTGGAAGCT GGGAGAACGGTATTTGGGACTACAAGGTTCTTCCCAAGGCCGGCGCCACA GTCCAGTATGACTCTGTCGCACAGGCATACTACAGCTATGACCCCAGCAGC AAGGAGCTCATCTCTTTCGATACCCCTGACATGATCAACACCAAGGTCTCT TACCTCAAGAACCTCGGCCTGGGAGGCAGCATGTTCTGGGAAGCTTCTGCT GACAAGACTGGCTCTGACTCCTTGATCGGAACAAGCCACAGAGCTTTGGGA AGCCTAGACTCCACTCAGAACTTGCTGAGCTACCCCAACTCCCAGTATGAT AACATCCGAAGCGGTCTCAACTAGAGATCTTTCTTCTTCTTATCTTTTTCTTT TACTTCCCCTATGGTTGTACCAACATTTCACACACGTTATGCGAAACGATTA TGCAGGGAGCGTTATTTTTTAGTAAATAGTTGCCCTTTGAGATATGAAC CTGTACATAAAGAACTACTAGCAGTATATAAGGAGACATGCAGG.

[0026] Within the meaning of the Invention, the sequence identity is measured by conventional sequence comparison tools known to those skilled in the art such as the algorithms of the BLAST platform or the MatGat program (Campanella, Bitincka and Smalley, 2003).

[0027] More particularly, one of the objects of the invention is the isolated strain of Trichoderma atroviride deposited on July 3, 2018 at the CNCM under the number CNCM I-5333.

[0028] By "isolated strain" is meant the culture of a single microorganism which has been isolated from different microorganisms present on and / or in the tissues of a fragment of wheat leaf grown in the field.

[0029] In a very particular manner, one of the objects of the invention relates to an isolated strain of Trichoderma atroviride whose ech42 gene has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333,

[0030] in particular said isolated strain of Trichoderma atroviride is the TAL-17 strain deposited on July 3, 2018 at the CNCM under number CNCM 1-5333.

[0031] According to this same aspect, another of the objects of the invention relates to the isolated strain of Trichoderma atroviride of the invention in the form of spores, produced by fermentation in a solid or liquid medium, said spores being able to be in purified form or in the production matrix, said production matrix being solid or liquid.

[0032] By "in the form of spores" is meant in the form of conidiospores or chlamydospores, (more particularly conidiospores) ensuring the function of asexual multiplication in the fungus.

[0033] By "solid-state fermentation (SSF)" is meant any process allowing the development of the microorganism on the surface and / or inside a solid, moistened porous production matrix, in the absence of free water.

[0034] By “liquid fermentation” is meant any process allowing the development of the microorganism using a production matrix with the presence of free water.

[0035] By “production matrix” is meant any natural and / or synthetic substrate, which allows the development of the microorganism and induces the production of biomass, and / or enzymes, and / or primary and / or secondary metabolites. Examples of enzyme families or enzymes produced by the fungus are proteases, chitinases and Zeto-1,3-glucanase.

[0036] By "spores [...] in purified form" is meant spores concentrated following the elimination of the majority of the remainder of the matrix after production which was not used for the formation of the spores, with the aid of a sieving process for example.

[0037] By "spores [...] in the production matrix" is meant the spores remaining in the production matrix at the end of the manufacturing process, without a purification step.

[0038] Another of the objects of the invention relates to the isolated strain of Trichoderma atroviride of the invention as a biological control agent.

[0039] By "biological control agent", it is meant that a strain of Trichoderma atroviride according to the invention can interfere with the growth and / or survival of pathogenic agents, thus making it possible to control them, via one or more of the modes of action described above (e.g. via the development of its biomass and / or its production of enzymes and / or secondary metabolites). For example, one of the ways of demonstrating that a strain of Trichoderma atroviride according to the invention is a biological control agent is to carry out a Dual culture test on culture medium in a Petri dish such as those presented among the examples below. More precisely, by "Dual culture test", it is meant a test on a Petri dish in the laboratory on culture medium, where the strain of the biological control agent microorganism and the strain of the pathogen are cultured on the same dish in order to observe the effect of one strain on another over time and vice versa.

[0040] Another of the objects of the invention relates to the isolated strain of Trichoderma atroviride of the invention, as an antifungal agent for plants.

[0041] By "plant antifungal agent" is meant that a strain of Trichoderma atroviride according to the invention is capable of combating phytopathogenic fungi. For example, one of the means of demonstrating that a strain of Trichoderma atroviride according to the invention is a plant antifungal agent is to carry out a Dual culture test such as those presented among the examples below.

[0042] In a very particular manner, one of the objects of the invention relates to the isolated strain of Trichoderma atroviride of the invention as a biological control agent,

[0043] in particular as an antifungal agent for plants directed against a fungus pathogenic to plants, said pathogenic fungus being in particular chosen from Septoria tritici or Gibberella zeae (= Fusarium graminearum) or Puccinia recondita or Puccinia striiformis.

[0044] A second aspect of the invention relates to the use of the isolated strain of Trichoderma atroviride of the invention, in particular in the field of malting.

[0045] More particularly, the invention relates to the use of said isolated strain of Trichoderma atroviride in the prevention and / or treatment of fungal diseases of plants, in particular plants belonging to the Poaceae family, in particular wheat and / or maize and / or barley. Advantageously, the invention relates to the use of said isolated strain of Trichoderma atroviride in the prevention and / or treatment of fungal diseases of wheat and / or maize and / or barley.

[0046] The invention also relates to the use of said isolated strain of Trichoderma atroviride for promoting the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or maize and / or barley. Advantageously, the invention relates to the use of said isolated strain of Trichoderma atroviride for promoting the germination of a seed of wheat and / or maize and / or barley. Regarding this particular aspect, it should be noted that the germination aid advantageously and at the same time allows the prevention and / or treatment of fungal diseases at the time of sowing. The development of a disease after sowing is thus avoided and the yield is optimized via the biostimulant aspect of the strain of the invention.Advantageously, this aspect also makes it possible to avoid a significant slowdown in the development of the crop if a period of drought occurs some time after sowing (which can happen in spring) and therefore to avoid yield losses at harvest.

[0047] A third aspect of the invention relates to a phytosanitary composition comprising:

[0048] - the isolated strain of Trichoderma atroviride of the invention as active ingredient; or - the metabolites emitted during the production of the isolated strain of Trichoderma atroviride of the invention as an active ingredient; or - the isolated strain of Trichoderma atroviride of the invention and its metabolites emitted during its production as an active ingredient; or - the isolated strain of Trichoderma atroviride of the invention in association with at least one other biological control agent (BCA) as active ingredient; or - the isolated strain of Trichoderma atroviride of the invention and its metabolites emitted during the production of the strain in association with at least one other biological control agent as active ingredient.

[0049] By "metabolites emitted during the production of the strain" or "its metabolites emitted during its production" is meant any molecule produced by the strain of the invention during its development. For example and in a non-limiting manner, such metabolites may be enzymes produced by the fungus such as proteases, chitinases and beta-1,3-glucanase.

[0050] By "biological control agent" is meant a microorganism that can interfere with the growth and / or survival of pathogens, thus making it possible to control them. The strain of the invention TAL-17 (filed on July 3, 2018 at the CNCM under number CNCM 1-5333) is an example, but within the meaning of the invention, it is a question here of combining the strain of the invention with at least one other biological control agent, which is different from the strain of the invention. By "at least one other biological control agent", it is meant that the phytosanitary composition of the invention can contain 2 biological control agents (that of the invention and another), just as it can contain 3, 4 or 5 (that of the invention and 2, 3 or 4 others).

[0051] More particularly, one of the objects of the invention relates to the phytosanitary composition previously described, said phytosanitary composition being presented at the base (on purchase) in the form of a concentrated solid or liquid composition. Such a concentrated solid or liquid composition can be, for example, obtained thanks to a particular formulation of the spores of the isolated strain of Trichoderma atroviride of the invention produced by fermentation in a solid or liquid medium, said spores possibly being in purified form or in the production matrix, said production matrix being solid or liquid.

[0052] By "concentrated [...] composition" is meant a composition in which the concentration of the active ingredient (i.e. the strain of the invention, which may be in the form of spores) is greater than an effective amount of 107 spores / g or 107 CFU / g. Also, a particular aspect of the invention relates to the phytosanitary composition comprising the isolated strain of Trichoderma atroviride of the invention as active ingredient, said phytosanitary composition being in the form of a concentrated solid or liquid composition in which the concentration of the active ingredient is greater than an effective amount of 107 spores / g.

[0053] By "greater than an effective amount of 107 spores / g" is also meant greater than an effective amount of 108 spores / g, greater than an effective amount of 109 spores / g, greater than an effective amount of 1010 spores / g, greater than an effective amount of 1011 spores / g or greater than an effective amount of 1012 spores / g.

[0054] The user of the above-mentioned composition must then incorporate or suspend it in a solid (e.g. potting soil, etc.) or aqueous (e.g. water) medium to obtain a diluted composition comprising an effective amount of 104 to 1012 spores / g of the Trichoderma atroviride strain of the invention, which may be in spore form. The diluted solid or liquid composition obtained can then be spread on the plants for which the prevention and / or treatment of a fungal plant disease is desired.

[0055] Within the meaning of the Invention, the spreading of the above-mentioned composition comprises in particular the conventional spreading techniques known to those skilled in the art, which are used to spread solid materials (e.g. sewage sludge, manure, etc.) or liquid (eg pesticides, etc.) of agronomic interest.

[0056] More particularly, one of the objects of the invention relates to the phytosanitary composition previously described, comprising an effective quantity of 104 to 1012 spores / g, more particularly of 107 to 109 spores / g,

[0057] said phytosanitary composition being optionally obtained after a preparation step (e.g. dilution by suspension or mixing) making it ready for spreading.

[0058] By “effective quantity of spores / g” is meant the number of spores capable of forming a colony on culture medium (CFU = colony forming unit) per g (gram) of product.

[0059] In addition, the expression "from 104 to 1012 spores / g" can also mean from 104 to 105 spores / g, from 104 to 106 spores / g, from 104 to 107 spores / g, from 104 to 108 spores / g, from 104 to 109 spores / g, from 104 to 1010 spores / g, from 104 to 1011 spores / g, from 105 to 106 spores / g, from 105 to 107 spores / g, from 105 to 108 spores / g, from 105 to 109 spores / g, from 105 to 1010 spores / g, from 105 to 1011 spores / g, 105 to 1012 spores / g, 106 to 107 spores / g, 106 to 108 spores / g, 106 to 109 spores / g, 106 to 1010 spores / g, 106 to 1011 spores / g, 106 to 1012 spores / g, 107 to 108 spores / g, 107 to 109 spores / g, 107 to 1010 spores / g, 107 to 1011 spores / g, 107 to 1012 spores / g, 108 to 109 spores / g, 108 to 1010 spores / g, 108 to 1011 spores / g, 108 to 1012 spores / g, 109 to 1010 spores / g, 109 to 1011 spores / g, 109 to 1012 spores / g, 1010 to 1011 spores / g, 1010 to 1012 spores / g or 1011 to 1012 spores / g.

[0060] For the purposes of the invention, the invention also relates to a phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride of the invention and optionally at least one fixing agent, said phytosanitary coating composition making it possible to produce a coated seed. The invention therefore relates both to a phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride of the invention, said phytosanitary coating composition making it possible to produce a coated seed; and to a phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride of the invention and at least one fixing agent, said phytosanitary coating composition making it possible to produce a coated seed.

[0061] One of the objects of the invention therefore relates to a coated seed comprising a plant seed and said phytosanitary coating composition, said plant belonging in particular to the Poaceae family, in particular wheat and / or corn and / or barley. Advantageously, the invention relates to a coated seed comprising a plant seed and said phytosanitary coating composition, said plant being wheat and / or corn and / or barley.

[0062] A fourth aspect of the invention concerns the use of the composition of the invention.

[0063] More particularly, the invention relates to the use of the composition of the invention in the prevention and / or treatment of fungal diseases of plants, in particular plants belonging to the Poaceae family, in particular wheat and / or maize and / or barley. Advantageously, the invention relates to the use of the composition of the invention in the prevention and / or treatment of fungal diseases of wheat and / or maize and / or barley.

[0064] The invention also relates to the use of the composition of the invention for promoting the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley. Advantageously, the invention relates to the use of the composition of the invention for promoting the germination of a seed of wheat and / or corn and / or barley.

[0065] In a very particular manner, one of the objects of the invention relates to the use of the isolated strain of Trichoderma atroviride of the invention or of the phytosanitary composition described above in the prevention and / or treatment of fungal diseases of plants, in particular of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley; and / or

[0066] to promote the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley.

[0067] A fifth aspect of the invention relates to a method for protecting and / or treating a plant against a disease caused by a plant-pathogenic fungus comprising applying the composition of the invention to at least a portion of said plant or the soil in the vicinity of said plant.

[0068] More particularly, the invention relates to said method of the invention, where said part of said plant is a leaf, a fruit, a seed.

[0069] In a very particular manner, one of the objects of the invention relates to a method for protecting and / or treating a plant against a disease caused by a fungus pathogenic to plants comprising the application of the composition of the invention to at least a part of said plant or of the soil close to said plant,

[0070] in particular said part of said plant is a leaf, a fruit, a seed, and

[0071] in particular said plant belongs to the Poaceae family, in particular wheat and / or corn and / or barley.

[0072] Still according to this fifth aspect, the invention relates to the method described above, in which said composition is spread

[0073] - at a rate of 10 to 500 L / ha, in particular 50 to 250 L / ha, in particular for aerial spraying; or - at an effective quantity of 1010 to 1014 spores / ha, in particular 1010 to 1012 spores / ha, in particular for aerial applications of the foliar spraying type.

[0074] The expression "from 10 to 500 L / ha (litre / hectare)" also means from 10 to 400 L / ha, from 10 to 300 L / ha, from 10 to 200 L / ha, from 10 to 100 L / ha, from 100 to 500 L / ha, from 200 to 500 L / ha, from 300 to 500 L / ha, from 400 to 500 L / ha, from 50 to 500 L / ha, from 50 to 250 L / ha or from 250 to 500 L / ha. The expression "from 1010 to 1014 spores / ha" also means from 1010 to 1011 spores / ha, from 1010 to 1013 spores / ha, from 1011 to 1012 spores / ha, from 1011 to 1013 spores / ha, from 1011 to 1014 spores / ha, from 1012 to 1013 spores / ha, from 1012 to 1014 spores / ha or from 1013 to 1014 spores / ha.

[0075] The invention relates more particularly to the method described above, in which said plant belongs to the Poaceae family, in particular wheat and / or corn and / or barley. Advantageously, the invention relates to the method described above, in which said plant is wheat and / or corn and / or barley.

[0076] The invention preferably relates to the method described above, in which said pathogenic fungus is Septoria tritici or Gibberella zeae (= Fusarium graminearum) or Puccinia recondita or Puccinia striiformis.

[0077] By “Septoria tritici” we mean the pathogenic agent of septoria.

[0078] By “Gibberella zeae (= F. graminearum)” we mean the pathogenic agent of fusarium wilt.

[0079] By "Puccinia recondita" is meant the pathogen of brown rust of wheat.

[0080] By "Puccinia striiformis" is meant the pathogen of yellow rust of wheat.

[0081] The invention relates more particularly to the method described above, in which

[0082] - the protection of said plant comprises the spraying of said composition at the time of sowing or at the germination of said plant; and / or - the treatment of said plant comprises spraying said composition during different phenological stages of the plant to prevent a risk of infection of all or part of the plant by said pathogenic fungus.

[0083] The present invention is further illustrated, without however being limited thereto, by the following figures and examples. LIST OF FIGURES

[0084] [fig.l]

[0085] Figure 1 represents the visual observations of the Dual culture test against Fusarium graminearum, on the left of the Petri dishes, at 6 (A and B) and 10 (C and D) days of culture for the TAL-17 strain (A and C) and the BCA C strain (B and D), on the right of the Petri dishes.

[0086] [fig.2]

[0087] Figure 2 represents the microscopic observation (magnification 100) with an inverted microscope of the mycelia of F. graminearum (black arrow) and of the TAL-17 strain (white arrow) on a Petri dish containing PDA medium (potato, dextrose, agar), after 8 days of growth.

[0088] [fig.3]

[0089] Figure 3 represents the occupied surface (in %) and the associated photographs of the front face of a Petri dish inoculated with a rake with three strains of microorganisms (F. graminearum, TAL-17 and BCA C alone or in mixtures after 7 days of growth. Mean ± sd Different letters indicate a significant difference between the modalities (ANOVA 1 factor, p<0.05).

[0090] [fig.4]

[0091] Figure 4 represents the evolution of the surface occupied by the microorganisms BCA TAL-17 and Fusarium graminearum alone or in a mixture after depositing 30 pL in the center of a culture dish with PDA medium after 72 h (A) and after 96 h (B) of culture at 25°C under a light hood.

[0092] [fig.5]

[0093] Figure 5 represents the evolution of the percentage of inhibition of Fusarium graminearum on the box according to the formulation used.

[0094] [fig.6]

[0095] Figure 6 represents the percentage of CIV tubes showing septoria spots as a function of treatment after 18 days and 26 days of disease inoculation.

[0096] [fig.7]

[0097] Figure 7 represents the percentage of healthy grains observed at harvest during the phytotronic room tests.

[0098] [fig.8]

[0099] Figure 8 represents the mass of grains per ear at harvest during the phytotronic room tests.

[0100] [fig.9]

[0101] Figure 9 represents the percentage of visual symptoms of contamination on ears by fusarium wilt during the phytotronic room tests.

[0102] [fig.10]

[0103] Figure 10 represents the mass of grains per ear at harvest during the phytotronic room tests.

[0104] [fig.ll]

[0105] Figure 11 represents the percentage of fusariosis grains at harvest during the phytotronic room tests carried out.

[0106] [fig.12]

[0107] Figure 12 shows the germination of corn plants after 6 days of growth with a sowing treatment of a TAL-17 spore suspension at 1.105 spores CFU / seed or 1.108 spores CFU / seed. An aerial treatment is carried out later during from the 5-leaf stage and is not taken into account when measuring germination. Mean ± sd Different letters indicate a significant difference between the different modalities (1-way ANOVA, p<0.05).

[0108] [fig.13]

[0109] Figure 13 shows the measurement of the height of corn plants after 25 days of growth with a sowing treatment of a TAL-17 spore suspension at 1.105 spores CFU / seed or 1.108 spores CFU / seed. An aerial treatment is carried out later at the 5-leaf stage and is not taken into account when measuring germination. Mean ± sd Different letters indicate a significant difference between the different modalities (1-way ANOVA, p<0.05).

[0110] [fig.14]

[0111] Figure 14 represents the percentage of germination of spring wheat seeds (Calixo) in the presence or absence of suspended spores of Trichoderma atroviride TAL-17 at sowing. Cultivation in a phytotronic chamber with photoperiod. Mean ± sd Significant difference between the water modality and the TAL-17 modality (1-way ANOVA, p<0.05).

[0112] [fig.15]

[0113] Figure 15 includes photographs (A) and a graph (B).

[0114] (A) Visual observations of the Dual culture test against Fusarium graminearum, at right of the Petri dishes, at 6 and 10 days of co-culture with the TAL-17 strain (top panel) or the BCA D strain (center panel), left of the Petri dishes. The bottom panel corresponds to the culture of Fusarium graminearum alone. The white arrows indicate the area of ​​overlap of the TAL-17 strain on Fusarium graminearum.

[0115] (B) Graphical representation of the length of the covering of the pathogen F. gra minearum (F. gram) by BCA in Dual culture on PDA agar (25°C without photoperiod). Examples

[0116] (I) Isolation of the Trichoderma atroviride strain TAL-17

[0117] Strain isolated from a leaf of wheat grown in fields.

[0118] The leaf sample from the wheat crop was ground and then brought into contact with a PDA (Potato Dextrose Agar) at 50°C, which contains Fusarium graminearum spores, and mixed thoroughly. The dish was cultured at 25°C under a light hood. Thus, only strains capable of reproducing in the presence of Fusarium graminearum developed on the dish. Among these strains, TAL-17 was present. A specific sample from an area of ​​interest in the dish and several successive subcultures made it possible to isolate the TAL-17 strain, which was then deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333.

[0119] (II) In vitro study of the efficacy and mode of action of TAL-17 against F. graminearum Competitiveness, mycoparasitism and antibiosis

[0120] 1 / Dual-culture tests side by side on Petri dish

[0121] Several Dual-culture tests with BCA vs. F. graminearum were carried out in proximity on PDA (Potato Dextrose Agar) medium. 30 pL containing 1.104 spores / mL (sp / mL) of F. graminearum were inoculated, 2 cm from the end of an 8.5 cm diameter Petri dish containing PDA medium, and 30 pL containing 1.106 spores / mL of another microorganism (TAL-17 or another Trichoderma BCA C) at the other end of the Petri dish. The Petri dishes were incubated at 23-27°C under artificial light (24h / 24) (F36WT8 / 2084 BriteGro® fluorescent tube). Macroscopic observations were carried out at 6 days and 10 days after inoculation (Figure 1). Controls of F. graminearum alone and BCA alone were carried out. The strains tested were the TAL-17 strain and another reference strain also referenced as a Trichoderma atroviride used in Biocontrol (= BCA C > Reference: ATCC® 20476).

[0122] The TAL-17 and BCA C strains both showed the ability to occupy space, whereas the TAL-17 strain, unlike the BCA C strain, is capable of developing on the mycelium of Fusarium graminearum (Figure 1). The TAL-17 strain therefore has a much greater mycoparasitism potential than the other reference strain BCA C. Microscopic observations of the mycelium of the TAL-17 strain in the presence of Fusarium graminearum mycelium also revealed a coiling of the mycelium of the TAL-17 strain around Fusarium graminearum (Figure 2), which phenomenon was not observed with the other strain of Trichoderma atroviride (= BCA C) tested.

[0123] Compared to the existing bibliography on the subject, mycoparasitism of the genus Trichoderma, which corresponds to the genus of the strain TAL-17, has been studied on numerous occasions and on numerous targets. Hibar et al. (Hibar, K., Daami-Remadi, M., Khiareddine, H., & Mahjoub, M. El. (2005). Inhibitory effect in vitro and in vivo of Trichoderma harzianum on Fusarium oxysporum f. sp. Radicis-lycopersici.) presented an in vivo and vitro inhibitory effect of Trichodermaharzianum on Fusarium oxysporum, in particular by microscopic observations of the contact zone between the two strains which highlights significant lysis, accompanied by rolling of the T. harzianum strain on F. oxysporum. Steyaert et al. (Steyaert J., Ridgway H., Elad Y., Stewart A. (2003). Genetic basis of mycoparasitism: A mechanism of biological control by species of Trichoderma.New Zealand Journal of Crop and Horticultural Science; 31(4), 281-291) demonstrated mycoparasitism of a strain of Trichodermaatroviride around a hypha of a strain of . Botrytis cinerea. The microscopic results previously described therefore confirm the increased mycoparasitism potential of the TAL-17 strain, particularly compared to the BCA C strain.

[0124] In addition, these tests on dishes showed an inhibition zone created by the TAL-17 strain, a sign of a potential antibiosis effect, and another test using culture filtrate from the TAL-17 strain showed an inhibitory effect on the growth of the pathogen Fusarium graminearum (data not shown).

[0125] 2 / Tests in mixture deposit on the entire surface

[0126] Another Dual-culture test with BCA vs. F. graminearum was carried out on PDA medium, but this time in a mixture, with 100 μl spread over the entire Petri dish (diameter 8.5 cm). In the center of an 8.5 cm Petri dish containing PDA medium, 100 μL of a mixture containing 1.104 spores / mL of F. graminearum and 1.104 spores / mL of BCA (or 0.5.104 spores / mL of each BCA for the BCA mixture modality) are spread on the surface. In addition, for certain modalities, this mixture also contains 0.5% of the Appyphyt formulation, which is an emulsion of vegetable oil esters (Vegetable oil esters: 60-80%; Bio-sourced emulsifier; 1-5%; Qsp Water). The mixture was inoculated after 2 h of contact. Petri dishes were incubated at 25°C under artificial light (24 h / 24) (F36WT8 / 2084 Britegro fluorescent tube). F. graminearum growth measurements (in cm) were taken after 48, 72, 96 and 168 h (i.e. 2 to 7 days) of culture after inoculation.Controls of F. graminearum alone and BCA alone were performed. The strains tested were TAL-17 and BCA C. .

[0127] During this test, TAL-17 was the most efficient, its mycoparasitism allowing 100% of the front face of the box to be covered after 7 days (Figure 3).

[0128] (III) Plant tests to observe whether the mode of action of TAL-17 has an endophvetic character

[0129] The term endophyte comes from two Greek words "endon" and "phuton" which mean respectively "inside" and "plant". The definition of endophyte has changed very often over time. First, the definition concerned any organism that could live inside a plant. Today, endophytic organisms are organisms having a lifestyle with the plant called "endophism". That is, endophytic species are able to colonize the internal structures of plants in an asymptomatic way (Hardoim, PR, van Overbeek, LS, Berg, G., Pirttilâ, AM, Compant, S., Campisano, A., ... Sessitsch, A. (2015). The Hidden World within Plants: Ecological and Evolutionary Considerations for Defining Functioning of Microbial Endophytes. Microbiology and Molecular Biology Reviews, 79(3), 293-320.). Endophytes can be microorganisms such as fungi. They can colonize the plant at different levels depending on the micro organism. The organs concerned can be, depending on the case, the stem, the roots, the segments of leaves, the fruits, the buds, the seeds but also in the dead and hollow hyaline cells of plants (Stçpniewska, Z., & Kuzniar, A. (2013). En-dophytic microorganisms—promising applications in bioremediation of greenhouse gases. Applied Microbiology and Biotechnology, 97(22), 9589-96.).

[0130] Method for preparing samples for observation

[0131] Cotton blue (LACP-00D-100 Labkem®) with lactophenol was used in this study as a stain for the detection of fungi. Wheat leaf samples of 1 x 0.5 cm and corn of 2.5 x 1.5 cm were taken for each modality studied. The procedure for processing the sections is as follows:

[0132] 1. Etching with bleach (3 min) 2. Washing in ultrapure water 3. Staining in lactophenol cotton blue (3 min) 4. Rinse in lactoglycerol 5. The samples are then placed under a slide and coverslip for microscopic observation (x 400). 1 / Tests on wheat

[0133] 6 wheat seeds were sown per 0.5 L pot and pierced at the bottom for drainage. The The substrate used was a mixture of universal potting soil and expanded vermiculite (0.5-10 mm) (2:1 v / v). The substrate was moistened 24 hours before sowing with reverse osmosis water. The seeds were moistened the day before sowing for 24 hours at 4°C. Once sowing was complete, the pots were placed under a light hood at 25°C (16 / 8 hour photoperiod) and were watered three times a week.

[0134] Different treatments were carried out. For the sowing treatment, 1 mL of the TAL-17 solution at the desired concentration was added to the sown seed (500 μL before seed deposition and 500 μL after). For the control and other conditions tested, the seeds did not receive BCA treatment but 1 mL of sterile drilling water. The spray treatment was carried out at the 2-leaf stage or at the flowering stage. The pots not receiving BCA treatments were treated with drilling water by the same device. The first leaves located at the lowest point of the plant were used for this test.

[0135] Fungal mycelium was observed in the leaves and roots of the plant treated at sowing, unlike the control plant not treated at sowing. 2 / Tests on corn

[0136] 3 seeds are sown per 5 L pot pierced at the bottom for drainage. The substrate used is a mixture of universal potting soil and expanded vermiculite (0.5-10 mm) (2:1 v / v). The substrate was moistened 24 hours before sowing with osmosis water. The pots were watered three times a week with an increasing volume of osmosis water depending on the development of the plant.

[0137] For the sowing treatment, 1 mL of TAL-17 solution at the desired concentration (105 or 108 / mL) was added to the sown seed (500 pL before seed deposition and 500 pL after). For the control and other conditions tested, the seeds did not receive BCA treatment but 1 mL of sterile drilling water. The spray treatment was carried out at the 5-leaf stage.

[0138] Fungal mycelium was observed in the leaves and roots of the plant treated at sowing, unlike the control plant not treated at sowing.

[0139] Finally, these tests (see examples II and III) showed that the TAL-17 strain is capable of acting against Fusarium graminearum in different ways. It combines competition, antibiosis, mycoparasitism and is capable of penetrating the plant. (IV) BCA inoculation strategy Development of formulations 1 / Mixing tests with center deposition

[0140] Another Dual-culture test with BCA vs F. graminearum was carried out on PDA medium, but this time in a mixture, with a drop deposited in the center of the dish (30 μl). In this test only TAL-17 was tested. Measurements of the growth of F. graminearum (in cm) were taken after 48, 72 and 96 h of culture (Figure 4).

[0141] In the center of an 8.5 cm Petri dish containing PDA medium, 30 μL of a mixture containing 1.104 spores / mL of F. graminearum and 1.104 spores of BCA were inoculated. In addition, for certain modalities, this mixture also contains 0.5% of the Appyphyt formulation, which is an emulsion of vegetable oil esters (Vegetable oil esters: 60-80%; Bio-based emulsifier: 1-5%; Qsp Water). The mixture was inoculated after 2 h of contact. The Petri dishes were incubated at 23-27°C under artificial light (24 h / 24) (F36WT8 / 2084 BriteGro® fluorescent tube). Measurements of the growth of F. graminearum were carried out from 2 to 7 days after inoculation. Controls of F. graminearum alone and BCA alone were carried out.

[0142] The TAL-17 strain allowed a reduction of the order of 63% in the development of Fusarium graminearum on Petri dishes at 72 h and 78% at 96 h. This reduction increased to 77% at 72 h and to 85% at 96 h when coupled with the Appyphyt formulation (Figure 5). It should be noted that at 96 h the Appyphyt formula alone did not show any inhibition on the growth of Fusarium graminearum. 2 / Seed coating

[0143] The previous results, which demonstrated the endophytic aspect, indicate a potential interest in coating the seeds of the target crops with the TAL-17 strain. This interest was confirmed by the biostimulation tests on germination (see above). After). (V) Effect of BCAs on plant protection Study in phytotronic room 1 / Septoria

[0144] In vitro culture was developed to screen potential BCAs selected against wheat septoria Septoria tritici. The standard in vitro culture medium was modified by removing sucrose to avoid possible contamination.

[0145] Two tests were carried out.

[0146] The disease and BCA were applied simultaneously by spraying under conditions as close to the field as possible.

[0147] The percentages of plants showing septoria spots according to the modalities are presented in Figure 6. Two Trichoderma atroviride were tested including TAL-17. The latter proved to be the most interesting against this disease. Note the quantity of BCA is in number of viable spores (equivalent 5.1011 viable spores / hectare). 2 / Fusarium wilt

[0148] The phytotronic room has the possibility of increasing humidity to 90% RH during infection at the time of ear flowering. The tray allows 30 planters of 15 plants to be tested. The tests were carried out with the spring wheat "Calixo".

[0149] The treatments with BCA were exclusively carried out at the time of flowering for these tests and the BCAs used are:

[0150] • TAL-17 (c / Example I); • BCA A > Trichoderma asperellum (Ref: ATCC® 52438) and • BCA B > Trichoderma atroviride (Internal Ref.: BCA B-15).

[0151] A first test showed an interest in the TAL-17 strain (Figures 7 and 8). This interest was confirmed by a new test (Figures 9, 10 and 11). The latter highlighted an interest in the use of TAL-17 (equivalent 1011 spores CFU / ha) with the Appyphyt formulation (equivalent IL / ha) on wheat for the visual symptoms of the disease and on the mass of grains per ear which are then both statistically different from the modality contaminated with Fusarium graminearum alone. However, the mass of grains per ear when the wheat was treated with TAL-17 and the Appyphyt formula does not reach the mass of the uncontaminated control wheat (i.e. 0.831 g / ear for Figure 8 and 0.77 g / ear for Figure 10).

[0152] In conclusion, the TAL-17 strain has shown interest for application at the flowering stage of wheat, but given its endophytic nature, a much earlier application is of interest in the fight against ear fusarium.

[0153] In addition, a treatment strategy with half-dose of fungicide is possible.

[0154] Study in phytotronic room / greenhouse / biostimulation 1 / Greenhouse trials on corn

[0155] Three seeds were sown per 5 L pot with holes in the bottom for drainage. The substrate used was a mixture of universal potting soil and expanded vermiculite (0.5-10 mm) (2:1 v / v). The substrate was moistened 24 h before sowing with osmosis water. The pots were watered three times a week with an increasing volume of osmosis water depending on the development of the plant.

[0156] The treatments carried out were identical to those of Example (III), 1 / .

[0157] As a reminder, the control (A) did not receive any treatment; the treatment at sowing (B and C) was carried out with a TAL-17 solution of 1.105 or 1.108 spores / seed (sp / seed); the spray treatment at the 5-leaf stage (D and E), i.e. 21 days of growth, was carried out with a TAL-17 solution of 1.1011 or 5.1011 spores / ha.

[0158] The results obtained for the germination percentage on 6-day-old plants are shown in Figure 12. The values ​​for maize plants that have not (control) or have not yet (aerial spraying) received TAL-17 treatments are statistically identical and of the order of 80%. Similarly, with the BCA treatment at sowing at 1.105 spores / seed, no significant difference is visible compared to the untreated control. On the other hand, with the sowing treatment of 1.108 spores / seed, i.e. a concentration 1000x higher than the previous one, the germination percentage reaches 100% as early as 6 days after sowing. After 9 days of growth (data not shown), the germination rate tended towards 97% for the modalities having received the sowing treatment at 1.105 spores / seed and for those having not yet received the aerial treatment. The control modality, without treatment, increased to a germination percentage of 93%.

[0159] The results of the height measurements of the 25-day-old plants shown are presented in Figure 13, and highlighted a statistical difference between the TAL-17 sowing treatment and the aerial spray treatment and the control. The sowing treatments at 1.105 and 1.108 spores / seed (viable spores) allowed plant growth of around 105 cm, while the aerial treatments, carried out 4 days earlier and the control, only allowed growth ranging from 97 cm for the control, to 100.5 cm for the aerial treatment at 1.1011 spores / ha and 101 cm for the treatment at 5.1011 spores / ha. These values ​​were found in the same statistical group. 2 / Phytotronic room tests on wheat

[0160] Culture:

[0161] 6 wheat seeds were sown per 0.5 L pot and pierced at the bottom for drainage. The The substrate used was a mixture of universal potting soil and expanded vermiculite (0.5-10 mm) (2:1 v / v). The substrate was moistened 24 hours before sowing with osmosis water.

[0162] For the arrangement of the pots in the phytotronic room, they were grouped in groups of 3 in a planter saucer. 12 "planters" were seeded with 0.5 mL of a suspension of TAL-17 spores at 106 spores CFU / seeds in 0.5 mL and 18 planters were seeded with 0.5 mL of sterile drilling water in order to avoid the need for different water inputs depending on the treatments.

[0163] The pots were placed in the phytotronic room (photoperiod 16 / 8h) and were watered twice a week.

[0164] The germination percentage was observed at 4 and 11 days depending on the methods.

[0165] This average percentage is calculated per planter (i.e. on 18 seeds) then the whole data from the planters for each modality was statistically treated by ANOVA (p<0.05).

[0166] It appears that the modalities inoculated with the TAL-17 strain presented a germination rate higher than the water control modality by 5% at 11 days (Figure 14). This difference is statistically significant.

[0167] (VI) Comparison of strain TAL-17 to other BCAs

[0168] Dual-culture side-by-side tests on Petri dishes (continuation of part (II) 1 / )

[0169] The experimental protocol was the same as that described previously. The strain TAL-17 was compared to BCA D strain (= Trichoderma atroviride, Ref.: I-12137). The Dual culture test was performed with 30 μl of BCA or F. graminearum placed at the ends of the Petri dish. After 6 and 10 days of culture at 25°C on PDA under a light hood with a 16-h photoperiod, the dishes were observed (Figure 15A) and the length of pathogen coverage by BCA was measured (Figure 15B).

[0170] In this example also, the TAL-17 strain showed the particularity of developing on the mycelium of the pathogen over time, unlike BCA D.

Claims

Claims

1. Isolated strain of Trichoderma atroviride whose ech42 gene has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333, in particular said isolated strain of Trichoderma atroviride is the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333.

2. Isolated strain of Trichoderma atroviride according to claim 1, in the form of spores, produced by fermentation in solid or liquid medium, said spores being able to be in purified form or in the production matrix, said production matrix being solid or liquid.

3. Isolated strain of Trichoderma atroviride according to claim 1 or 2, as a biological control agent, in particular as a plant antifungal agent directed against a plant pathogenic fungus, said pathogenic fungus being in particular chosen from Septoria tritici or Gibberella zeae (= Fusarium graminearum) or Puccinia recondita or Puccinia striiformis.

4. A phytosanitary composition comprising: - the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 as an active ingredient; or - the metabolites emitted during the production of the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 as an active ingredient; or - the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 and its metabolites emitted during its production as an active ingredient; or - the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 in association with at least one other biological control agent as an active ingredient; or - the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 and its metabolites emitted during the production of the strain in association with at least one other biological control agent as an active ingredient.

5. Phytosanitary composition according to claim 4, comprising an effective quantity of 104 to 1012 spores / g, more particularly of 107 to 109 spores / g, said phytosanitary composition optionally being obtained after a preparation step making it ready for spreading.

6. Use of the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 or of the phytosanitary composition according to claim 4 or 5 in the prevention and / or treatment of fungal diseases of plants, in particular plants belonging to the Poaceae family, in particular wheat and / or maize and / or barley; and / or for promoting the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or maize and / or barley.

7. Phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 and optionally at least one fixing agent.

8. Coated seed comprising a plant seed, said plant seed being coated with the phytosanitary coating composition as defined according to claim 7 and said plant belonging in particular to the Poaceae family, in particular wheat and / or corn and / or barley.

9. A method of protecting and / or treating a plant against a disease caused by a plant pathogenic fungus comprising applying the composition according to claim 4 or 5 to at least a part of said plant or the soil in the vicinity of said plant, in particular said part of said plant is a leaf, a fruit, a seed, and in particular said plant belongs to the Poaceae family, in particular wheat and / or corn and / or barley.

10. A method according to claim 9, wherein said composition is spread - at a rate of 10 to 500 L / ha, in particular 50 to 250 L / ha, in particular for aerial spraying; or - at a rate of an effective amount of 1010 to 1014 spores / ha, in particular 1010 to 1012 spores / ha, in particular for aerial spraying of the foliar spray type.

11. A method according to claim 9 or 10, wherein said pathogenic fungus is Septoria tritici or Gibberella zeae (= Fusarium gra-minearum) or Puccinia recondita or Puccinia striiformis.

12. Method according to any one of claims 9 to 11, wherein - the protection of said plant comprises spraying said composition at the time of sowing or germination of said plant; and / or - the treatment of said plant comprises spraying said composition during different phenological stages of the plant to prevent a risk of infection of all or part of the plant by said pathogenic fungus.

Images