METHOD FOR GENETIC ANALYSIS OF A SAMPLE
The method uses a nuclease to degrade free nucleic acids while preserving those within intact envelopes, improving the efficiency and precision of microorganism detection and characterization in complex samples by enhancing PCR sensitivity and reproducibility.
Patent Information
- Application Number
- FR2024001799
- Authority / Receiving Office
- FR · FR
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-02-23
- Publication Date
- 2025-08-29
AI Technical Summary
Existing methods for distinguishing intact microorganisms from non-intact or non-reproductive microorganisms in complex biological samples are inefficient, costly, and lack precision, particularly due to interference from free nucleic acids and PCR inhibitors.
A method involving the use of a nuclease to degrade free nucleic acids while preserving those within intact envelopes, followed by PCR amplification or CRISPR/Cas9 modification, to selectively analyze or modify genetic material within intact microorganisms.
This approach enhances the speed, sensitivity, and reproducibility of microorganism detection and characterization, allowing for the selective identification of viable microorganisms and reducing PCR interference.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
Title of the invention: METHOD FOR GENETIC ANALYSIS OF A SAMPLE Field of invention
[0001] The present invention relates to a method for analyzing the genetic material contained in a sample, in particular a sample taken from the environment. The applications of the present invention relate more particularly to the detection and characterization of living microorganisms when they are present within a complex matrix in a sample.
[0002] The present invention is therefore in the field of analysis of genetic material. State of the art
[0003] Samples comprising biological material, in particular those taken from the environment, are commonly very rich in components of all kinds, including in particular cells and cell debris, as well as so-called "free" nucleic acid, i.e. not included in a cell, a viral envelope or any other envelope. However, it is often necessary to specifically distinguish, within such a complex sample, the presence of intact microorganisms potentially capable of reproducing. It is desirable to distinguish intact microorganisms from non-integrated microorganisms and / or microorganisms incapable of reproducing. The reproductive capacity of microorganisms is in fact conditioned by their integrity.
[0004] A method currently used to achieve the integrity of microorganisms is amplification by culture, particularly on Petri dishes. This technology, in addition to its cost and the time it involves, only partially achieves the desired objectives since not all intact microorganisms are necessarily cultivable, or do not thrive in the conditions or on the matrices used to cultivate them.
[0005] Another method is microscopic observation, carried out during a microscopic examination carried out by an expert or by flow cytometry. However, the level of precision and reliability of these measurements does not reach the degree of precision of molecular biology methods and may depend on the experience of the person carrying out the microscopic observation or the detection by cytometry.
[0006] There is therefore a need to have a method for analyzing a sample that makes it possible to specifically distinguish intact microorganisms, said method being rapid, efficient and reproducible. Statement of the invention
[0007] The inventors have now developed a method for analyzing the genetic material present in a sample, in which the genetic material contained within any intact envelope present in said sample is specifically detected. A method according to the invention therefore makes it possible to sensitively and specifically detect genetic material not parasitized by so-called "free" nucleic acid, i.e. not included in an intact envelope.
[0008] The inventors have also developed a method for modifying the genetic material present in a sample, in which the genetic material contained within any intact envelope present in said sample is specifically modified. A method according to the invention therefore also makes it possible to specifically modify genetic material not parasitized by so-called "free" nucleic acid, i.e. not included in an intact envelope.
[0009] A first step of the method according to the invention consists, during the preparation and extraction prior to genetic analysis by PCR, in digesting with a nuclease the nucleic acid molecules not enveloped in an intact membrane. In a sample taken from the environment, said free nucleic acids originate in particular from cells or viruses whose membrane is degraded. Said nucleic acids can also be contained in the spores of dormant microorganisms.
[0010] A method according to the invention leads to the degradation of free nucleic acids and those not included in an intact compartment, which has the advantage of eliminating, in complex matrices with a high concentration of microorganisms, free nucleic acids likely to hinder PCR detection due to congestion, and of discriminating between intact microorganisms and compartments, on the one hand, and non-integrated microorganisms and compartments, on the other hand.
[0011] It appears in fact that, in particular for applications of detecting the presence of microorganisms of any nature, whether eukaryotic, prokaryotic or viral, relevant information, in particular for evaluating the viability of said microorganisms, concerns more specifically the nucleic acid included inside intact envelopes.
[0012] Indeed, the capacity of microorganisms to reproduce is conditioned by their viability, which is itself conditioned by the integrity of their genetic material, on the one hand, and the integrity of their structure, on the other hand.
[0013] A method according to the invention therefore comprises, prior to carrying out an analysis, in particular by PCR amplification, or a modification, in particular by means of a CRISPR / Cas9 type technique, a step of preparing a sample and adding to the prepared sample a nuclease chosen from the nucleases active in the presence of a high saline concentration in the reaction medium, this high saline concentration is indeed necessary for PCR amplification. A method according to the invention comprises bringing into contact, under controlled reaction conditions, a nuclease and the genetic material present in the sample. The application of controlled reaction conditions leads to the degradation of the nucleic acid which is not included in an integral envelope such as a cell membrane, a spore envelope, a viral envelope or a synthetic capsule. On the other hand, during this step the nuclease does not cross, or only negligibly, said cell membrane, spore envelope, viral envelope or synthetic capsule. The nucleic acids contained within said envelopes are therefore preserved and can be analyzed or modified.
[0014] A method according to the invention combines the advantages of a molecular biology method such as PCR with the analytical relevance of microscopic observation or culture methods. A method according to the invention has, on the one hand, advantages of speed, sensitivity, versatility, reproducibility and low cost as well as, on the other hand, selective detection of the microorganism(s) of interest which are intact and viable.
[0015] The applications of the present invention are numerous and varied. Indeed, the invention finds a particular application in the detection of the presence of intact and / or viable microorganisms in a sample. Said microorganisms are preferably chosen from bacteria, yeasts and viruses. The invention also finds a particular application for genotyping. This is the case, for example, of pollen genotyping, genotyping of microorganisms capable of producing toxins or of being resistant to antibiotics, genotyping of protoplasts or gametes. Finally, the invention is applicable to the analysis of synthetic nucleic acid artificially encapsulated in synthetic membranes.
[0016] More particularly, the subject of the present invention is a method for analyzing the genetic material present in a sample, this method comprising a prior step of selecting an appropriate nuclease then a step of treating the sample of interest with said nuclease, under specific reaction conditions, prior to the amplification by PCR of at least one target nucleotide sequence.
[0017] The inventors propose in fact a means for selecting in advance a nuclease capable of specifically degrading the free nucleic acid while preserving the nucleic acid included inside an intact envelope, that is to say that said nuclease is not active with respect to said nucleic acid present within an intact membrane. The present invention makes it possible to specifically detect the nucleic acid contained within any intact envelope, said envelope being not only a cell membrane but also a viral envelope, a spore envelope or a synthetic capsule. In particular, the present invention makes it possible to specifically detect intracellular nucleic acid, i.e. nucleic acid included in an intact cell and therefore considered, a priori, as viable. Detailed description of the invention
[0018] In the present description, the term "comprising" includes the term "including" and the expression "consisting of". For example, a composition comprising compound X means a composition comprising exclusively compound X or may also comprise another compound.
[0019] According to a first aspect, the invention relates to a method for analyzing or modifying the genetic material contained in an intact envelope, comprising at least the following steps:
[0020] a) treatment with at least one nuclease of a first fraction of a biological sample containing or likely to contain i) free nucleic acid and ii) nucleic acid comprised in at least one intact envelope, then inactivation of said nuclease by any method known to the person skilled in the art, b) detection of a target nucleotide sequence and nucleic acid degraded by said treatment in said first fraction, c) detection of a target nucleotide sequence and nucleic acid degraded by said treatment in said first fraction, in a second fraction of the biological sample not subjected to treatment with said nuclease, d) comparison of the results obtained during steps b) and c) of detection of the target nucleotide sequence and degraded nucleic acid in said first and second fractions,e) selection of at least one nuclease capable of degrading the free nucleic acid while preserving the nucleic acid included in an intact envelope, f) treatment by said at least one nuclease of a test fraction of said biological sample, g) application, to at least one target nucleotide sequence of the nucleic acid present inside said intact envelope, of an analysis or modification method.
[0021] According to a first embodiment of this first aspect, the invention relates to a method for analyzing the genetic material contained in an intact envelope, comprising at least the following steps: a) treatment by at least one nuclease of a first fraction of a biological sample containing or likely to contain i) free nucleic acid and ii) nucleic acid included in at least one intact envelope, then inactivation of said nuclease by any method known to the person skilled in the art, b) detecting a target nucleotide sequence and nucleic acid degraded by said treatment in said first fraction, c) detection of a target nucleotide sequence and of nucleic acid degraded by said treatment in said first fraction, in a second fraction of the biological sample not subjected to treatment by said nuclease, d) comparison of the results obtained during steps b) and c) of detection of the target nucleotide sequence and degraded nucleic acid in said first and second fractions, e) selection of at least one nuclease capable of degrading free nucleic acid while preserving the nucleic acid included in an intact envelope, f) treatment with said at least one nuclease of a test fraction of said biological sample, g) amplification by a PCR reaction of at least one target nucleotide sequence of the nucleic acid present inside said intact envelope, (h) analysis of the genetic material present inside at least one intact envelope of said biological sample.
[0022] According to a second embodiment of this first aspect, the invention relates to a method for modifying the genetic material contained in an intact envelope, comprising at least the following steps: a) treatment by at least one nuclease of a first fraction of a biological sample containing or likely to contain i) free nucleic acid and ii) nucleic acid included in at least one intact envelope, then inactivation of said nuclease by any method known to the person skilled in the art, b) detecting a target nucleotide sequence and nucleic acid degraded by said treatment in said first fraction, c) detection of a target nucleotide sequence and nucleic acid degraded by said treatment in said first fraction, in a second fraction of the biological sample not subjected to treatment by said nuclease, d) comparison of the results obtained during steps b) and c) of detection of the target nucleotide sequence and degraded nucleic acid in said first and second fractions, e) selection of at least one nuclease capable of degrading free nucleic acid while preserving the nucleic acid included in an intact envelope, f) treatment with said at least one nuclease of a test fraction of said biological sample, g) modification of at least one target nucleotide sequence of the nucleic acid present inside said integrated envelope by means of a CRIPR / Cas9 type technique.
[0023] By "biological sample" is meant a sample containing or likely to contain biological material, that is to say any material containing genetic information and which is self-reproducing or reproducible in a biological system.
[0024] According to a particular embodiment, a method according to the invention is implemented from a biological sample chosen from: a sample from the environment or a sample of human or animal origin, and more particularly: - a liquid sample, in particular a sample from the environment chosen from: groundwater, precipitation, surface water, ice and glacial melt, salt water, brine, estuary water, wastewater, water from industrial processes and drinking water, - a solid sample, in particular a sample from the environment chosen from: a soil sample, a plant sample, in particular a plant or flower sample, a porous solid support, such as a wipe, - a gaseous sample, in particular a sample from the environment, - a sample of human or animal origin, said sample being liquid or solid, such as in particular a biopsy or a sample of blood, urine, saliva or other bodily sample.
[0025] By “liquid sample” is meant a sample of a predominantly liquid nature, possibly also containing particles or colloidal elements.
[0026] By “solid sample” is meant a sample of a predominantly solid nature.
[0027] The sample may comprise two or more targets, it may be purified or unpurified, and / or clarified or unclarified, prior to the method according to the invention. The sample may be a biological sample that has been treated for use in the methods of the invention. In certain embodiments, if the biological sample does not interfere with the methods of the invention, it may be used untreated (and / or unpurified).
[0028] The biological sample may include, in particular, cells, tissues, blood products, bodily fluids and viral material.
[0029] By "analysis of genetic material" is meant the characterization of the nucleic acid present in a sample.
[0030] By "envelope" is meant eukaryotic and prokaryotic cell membranes, viral particles and any other spore-type envelope, as well as any type of synthetic envelope capable of containing nucleic acids. By "integral envelope" is meant a container capable of delimiting an interior compartment isolated from the exterior of said compartment. Said envelope may in particular be of natural or synthetic origin. By "genetic material contained in an integral envelope" means the genetic material included in the compartment delimited by an integral envelope. By "envelope" is meant a container chosen from a cell envelope, including in particular a cell membrane and possibly a wall, a viral envelope, a spore envelope and a synthetic capsule.
[0031] By "nucleic acid", "polynucleotide" or "oligonucleotide" is meant a polymer of nucleotide monomers or an analogue thereof, including double- and single-stranded polymers, deoxyribonucleotides, ribonucleotides, their alpha-anomeric forms, and similar polymers. Within said nucleic acid polymers, or nucleic acid chains, the monomers are notably linked by phosphodiester bonds, the term "phosphodiester bond" referring to phosphodiester bonds or to bonds comprising phosphate or analogues thereof, including associated counterions. The expression "polymer of nucleotide monomers" is also referred to as "nucleotide monomer chain" or "nucleotide chain".
[0032] By "target nucleotide sequence" is meant a particular sequence of a nucleic acid polymer to which a particular primer or probe is capable of hybridizing specifically. In a method according to the invention, one or more target nucleotide sequences may be present within a nucleic acid polymer.
[0033] By "nuclease" is meant an enzyme whose main function, or the only known function, consists of the partial or total degradation of at least one type of nucleic acid. A nuclease mainly degrades the phosphodiester bonds of nucleic acid strands. Said nucleic acid is DNA, cDNA or RNA. According to a particular aspect, said nuclease is a deoxyribonuclease, or DNase, or DNase, which hydrolyzes DNA. According to another particular aspect, said nuclease is a ribonuclease or RNase, or RNase, which hydrolyzes RNA. The substrate of said nucleases is a single-stranded nucleic acid or a double-stranded nucleic acid. In a method according to the invention, said nuclease is an endonuclease or an exonuclease. In addition, said nuclease may be natural or recombinant. The said nuclease can be natural or recombinant. This definition excludes DNA polymerases capable of cleaving nucleotides.
[0034] According to a particular aspect, a method according to the invention comprises a step of treatment by at least one nuclease of a first fraction of a biological sample containing or likely to contain i) free nucleic acid and ii) nucleic acid included in at least one intact envelope, said step being carried out under specific reaction conditions likely to represent the reaction conditions encountered during the analysis of the genetic material of a sample. taken from the environment. Said specific reaction condition is notably chosen from: - a high saline concentration, - a high concentration of tannins, - a high concentration of components known for their inhibitory nature of PCR amplification reactions.
[0035] A step of treating a sample with at least one nuclease comprises bringing together: - an effective quantity of nuclease, expressed in nuclease units, and - of the sample, at a temperature permitting nuclease activity and for a sufficient time to observe nuclease activity.
[0036] A person skilled in the art will easily be able to select the effective quantity of nuclease allowing degradation, at least partial and preferably total, of the free nucleic acid.
[0037] This step makes it possible to select at least one nuclease likely to be active in the sample subject to the test method.
[0038] According to a particular aspect, to carry out this selection, the step of treatment with at least one nuclease of a first fraction of a biological sample containing or likely to contain i) free nucleic acid and ii) nucleic acid included in at least one intact envelope, is carried out under hypersalinity reaction conditions. This condition can in particular be recreated by the addition of a saline concentration of at least 10 mM, at least 20 mM, at least 50 mM, or 60 mM. The salt used for said saline addition is in particular sodium chloride (NaCl). A person skilled in the art will be able to choose any appropriate concentration of any type of salt.
[0039] In particular, a nuclease active in the presence of a high salt concentration indicates a nuclease whose reference catalytic activity is retained at least 70%, preferably at least 80% or at least 90% of its reference catalytic activity in a medium characterized by a high salt concentration.
[0040] In a method according to the invention, the nuclease concentration in the sample is defined in number of units (U), one nuclease unit being defined as the quantity of enzyme capable of completely degrading 1 pg of DNA in 10 minutes at 37°C in a reaction volume of 25 pL, the enzyme and the substrate being suspended in an appropriate buffer.
[0041] By "inactivation of said nuclease" is meant any known method of enzymatic inactivation, in particular by thermal inactivation, in particular in a dry bath at 65°C for 10 minutes, or by chemical inactivation, in particular by the addition of a conventional inactivation buffer, well known to those skilled in the art.
[0042] Genetic analysis of a sample is currently commonly carried out using techniques such as, in particular, the polymerase chain reaction (PCR), more particularly quantitative PCR (q-PCR) and digital PCR (dPCR). By "PCR" is meant any amplification method comprising at least one PCR step, more particularly a quantitative PCR (q-PCR) or digital PCR (dPCR) step. Preferably, a method according to the invention comprises a dPCR amplification step.
[0043] A method according to the invention is compatible with all digital PCR platforms on the market, in particular microdroplets and / or micro compartments. Among these, commercial equivalents such as the QIAcuity Digital PCR System - QIAGEN and QX ONE Droplet Digital PCR (ddPCR) System - Bio-Rad may be mentioned. Said PCR reaction is carried out in a multiplex digital PCR device.
[0044] The presence of a target nucleotide sequence is demonstrated according to methods well known to a person skilled in the art.
[0045] The measured signals are in particular signals detected at a wavelength characteristic of a dye, fluorescent agents or radioactive agents. The detection of the signal includes any type of detection such as in particular direct detection or a method of energy transfer between fluorescent molecules, such as for example FRET (“Forster Resonance Energy Transfer”).
[0046] The dyes are chosen from all available dyes allowing the selective identification of a given nucleotide target. A person skilled in the art will easily be able to choose from all available dyes to select dyes distinguishable during the multiplex analysis. In particular, a person skilled in the art will be able to choose two or more different fluorophores having absorption and emission wavelengths well separated from each other.
[0047] The dyes may be attached to a primer or probe, this attachment to a primer or probe being compatible with PCR amplification, or intercalate into the DNA, preferably double-stranded, where appropriate (intercalator dyes).
[0048] In a method according to the invention, the dyes are chosen from simple dyes (i.e. non-fluorescent) and fluorescent dyes (fluorophores). Fluorophores commonly used in FRET include fluorescein, 5-carboxyfluorescein (FAM), 2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), rhodamine, 6-carboxyrhodamine (R6G), N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA).
[0049] The radioactive agents are chosen from all the agents usable in a multiplex dPCR method known to a person skilled in the art. These include phosphorus 32, tritium, technetium-99m, iodine 125 or any other element known in the art.
[0050] According to a second aspect, the invention relates to a method for analyzing or modifying the genetic material present inside an intact envelope, said method comprising at least the following steps: a) treatment with at least one nuclease of a biological sample containing, or likely to contain, i) nucleic acid included in at least one intact envelope and ii) nucleic acid not included in an intact envelope, said nuclease being chosen from: a DNAse chosen from: - DNase TURBOTM (ref: AM2238 / 2239, Thermo Fisher Scientific, Waltham, MA, USA) - DNase LXT (ref: M0570, New England BioLabs, Beverly, MA) - DNase I (ref: M0303, New England BioLabs, Beverly, MA) b) application to at least one target nucleotide sequence of the nucleic acid present inside said intact envelope, of an analysis or modification method.
[0051] According to a particular aspect, a method for analyzing the genetic material present inside an integral envelope, according to the invention, comprises at least the following steps: a) treatment with at least one nuclease of a biological sample containing, or likely to contain, i) nucleic acid included in at least one intact envelope and ii) nucleic acid not included in an intact envelope, said nuclease being chosen from: a DNAse chosen from: - DNase TURBOTM (ref: AM2238 / 2239, Thermo Fisher Scientific, Waltham, MA, USA) - DNase LXT (ref: M0570, New England BioLabs, Beverly, MA) - DNase I (ref: M0303, New England BioLabs, Beverly, MA) b) amplification by a PCR reaction of at least one target nucleotide sequence of the nucleic acid present inside said intact envelope, (c) analysis of the genetic material of said biological sample, present inside an intact envelope.
[0052] According to another particular embodiment of this second aspect, the invention relates to a method for modifying the genetic material present inside an intact envelope, said method comprising at least the following steps: a) treatment with at least one nuclease of a biological sample containing, or likely to contain, i) nucleic acid included in at least one envelope integrates and ii) nucleic acid not included in an integral envelope, said nuclease being chosen from: a DNAse chosen from: - DNase TURBOTM (ref: AM2238 / 2239, Thermo Fisher Scientific, Waltham, MA, USA) - DNase I-XT (ref: M0570, New England BioLabs, Beverly, MA) - DNase I (ref: M0303, New England BioLabs, Beverly, MA) b) modification of at least one target nucleotide sequence of the nucleic acid present inside said integrated envelope by means of a CRIPR / Cas9 type technique.
[0053] Preferably, in a method according to the invention, said envelope is chosen from: a cellular envelope, a viral capsule and a synthetic capsule.
[0054] The invention is applicable to the analysis of synthetic nucleic acid artificially encapsulated within any type of synthetic membrane.
[0055] According to a particular aspect, in a method according to the invention said nuclease is chosen from: - a DNAse of the “DNase LXT” type distributed by the company New England BioLabs.
[0056] According to a particular aspect, a method according to the invention comprises an additional step in which the sample prepared and treated with a nuclease is diluted prior to the actual PCR analysis. The dilution of the sample is preferably at least a factor of 10, preferably a factor of 50, more preferably a factor of 100.
[0057] According to a particular aspect, at least two different dilutions of the sample are analyzed by PCR. The advantage of this dilution step is to provide a limiting dilution of the sample, in order to promote the detection of a significant co-occurrence of the presence of several microorganisms in the same sample compared to the detection of a co-occurrence of several microorganisms which would be purely statistical. A second advantage of this particular aspect of a method according to the invention is to provide at least two results for the genetic analysis of the same sample, and therefore to allow a more complete analysis of said sample. By "at least two different dilutions" is meant two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen or fifteen dilutions, or more depending on the needs of the genetic analysis.
[0058] According to a particular aspect of a method according to the invention, the amplification step by a PCR reaction is preceded by a step of lysis of the envelopes likely to be present in said intact sample. A membrane lysis method can easily be implemented depending on the nature of the envelope whose lysis is desired. In particular, said lysis step will be carried out by adding a lysis buffer, well known to those skilled in the art, and by providing mechanical pretreatment to the sample, this pretreatment may in particular consist of a step of grinding or rubbing the sample in the presence of glass beads. This thermal pretreatment leads to the weakening of resistant membranes, in particular the membranes of spores and the membranes of certain bacteria. According to a particular aspect of the method according to the invention, the step of amplification by a PCR reaction is preceded by a step of destruction of said intact envelope.
[0059] The kits used are: - NucleoMag DNA / RNA Water kit, MWA1 Lysis Buffer (ref: 744220.4, Macherey Nagel, Germany) - NucleoMag Pathogen kit, NPL1 Lysis Buffer (ref: 744210.4, Macherey Nagel, Germany) - NucleoMag Tissue kit, manufacturer of Lyse Tl (ref: 744210.4, Macherey Nagel, Germany).
[0060] A method according to the invention is compatible with all PCR platforms on the market, in particular digital PCR (dPCR), in particular in microdroplets and / or micro compartments. Among these, commercial equivalents such as the QIAcuity Digital PCR System - QIAGEN and QX ONE Droplet Digital PCR (ddPCR) System - Bio-Rad may be mentioned. According to one aspect of the invention, said method comprises a PCR reaction carried out in a digital PCR (dPCR) device.
[0061] According to a more particular aspect, a method according to the invention comprises a multiplex PCR reaction.
[0062] According to a particular aspect, the invention relates to the use of a method according to the invention for analyzing genetic material for the detection of at least one microorganism in a sample.
[0063] According to another particular aspect, the invention relates to the use of a method according to the invention for analyzing genetic material for detecting the co-occurrence of at least two microorganisms in the same sample.
[0064] According to a particular aspect, the invention relates to the use of a method according to the invention for analyzing the genetic material present in a sample, for detecting the co-occurrence of at least two microorganisms in the same sample.
[0065] According to a particular aspect, the invention relates to the use of a method according to the invention for analyzing the genetic material present in a sample for genotyping.
[0066] According to a particular aspect, the invention also relates to the use of a method as defined above for: detecting the co-occurrence of at least two microorganisms in the same biological sample, for genotyping and / or for the analysis of genetic material contained in a synthetic envelope
[0067] According to another particular aspect, the invention also relates to the use of a modification method as defined above for the modification of the genetic material included in a synthetic envelope.
[0068] By "genotyping" we mean the determination of a genetic variation at a given position in the genome considered.
[0069] Other advantages and characteristics will appear on examining the detailed description of a non-limiting embodiment, and the attached drawings.
[0070] [Fig.l] of Example 1 represents the scatter diagrams of the results obtained under “classical” reaction conditions of DNAse action during the amplification by dPCR of samples prepared in vitro, lines A, B and C of the figure correspond respectively to the following conditions: - A: culture of E. coli, - B: DNA extract of E. coli and - C: E. coli culture supplemented with an E. coli DNA extract.
[0071] From left to right, the results show the untreated samples (left column), treated with DNAse I (center column) or treated with DNAse XT (right column). For each of the figures, the number of positive partitions (Part. +), negative partitions (Part. -) and the detection threshold are indicated.
[0072] [Fig.2] of Example 1 represents the scatter diagrams of the results obtained under reaction conditions of DNAse action in high salinity, with: - line A: an extract of DNA from E. coli, and - line B: an E. coli culture extract supplemented with an E. coli DNA extract.
[0073] From left to right, the results show the untreated samples (left column), treated with DNAse I (center column) or treated with DNAse XT (right column). For each of the figures, the number of positive partitions (Part. +), negative partitions (Part. -) and the detection threshold are indicated.
[0074] [Fig. 3] of example 2 shows schematically the steps of a method according to the invention.
[0075] It is understood that the embodiments which will be described subsequently do not are in no way limiting. In particular, it is possible to imagine variants of the invention comprising only a selection of characteristics described below isolated from the other characteristics described, if this selection of characteristics is sufficient to confer a technical advantage or to differentiate the invention from the prior art. The present invention will be better understood by reading the following examples, which are given to illustrate the invention and not to limit its scope. EXAMPLES
[0076] Example 1: In vitro detection of intact microorganisms Materials and methods
[0077] Samples are prepared from an in vitro culture of E. coli according to different reaction conditions presented in Table 1 below: [Tables 1] Sample A Sample B Sample C Sample Preparation E. coli Bacterial Culture E. coli DNA Extracts E. coli Bacterial Culture + E. coli DNA Extracts Treatment + DNAse No DNAse + DNAse No DNAse + DNAse No DNAse
[0078] The Escherichia coli culture is carried out from a glystock, it is a 14H culture at 37°C with shaking at 300 rpm in LB (lysogeny broth) media. The extraction is carried out with the NucleoMag DNA / RNA Water kit (ref: 744220.4, Macherey Nagel, Germany) from a test sample of 100 pL of the culture.
[0079] The condition “E. coli bacterial culture” corresponds to 100 pL of said culture, the condition “E. coli DNA extracts” corresponds to the DNA extracted from 100 pL of said culture, the condition “E. coli bacterial culture + E. coli DNA extracts” corresponds to 100 pL of the culture supplemented with the DNA extracted from 100 pL of the culture. The samples are stored at 4°C pending further processing.
[0080] Where appropriate, the samples are supplemented with a nuclease under the following conditions: - addition of DNAse I or DNAse LXT from the supplier NEB (New England BioLabs), according to the supplier's recommendations, i.e. 2u of DNase LXT or DNase I, Buffer 10X in a final volume of 100 pL. The reaction conditions are: either the standard conditions recommended by the supplier, or the high saline conditions. Either: - DNase LXT Reaction Buffer (10x) + 2 units DNase I + qsp 100 pL H2O Nuclease free. Incubate for 15 min at 37°C and - DNase LXT Reaction Buffer (10x) + 2 units DNase I + qsp 100 pL H2O Nuclease free. Incubate for 10 min at 37°C, then add 1 pL of 0.5M EDTA then incubate for 10 min at 75°C then add 1 pL of a 6M NaCl stock solution.
[0081] The samples are then analyzed by PCR. The following products and kits are used: QIAcuity Nanoplate 26K 24 well (Ref. ID: 250001) and QIAcuity Probe PCR Kit Qiagen, (Ref. ID: 250102). In the PCR mix, the forward and reverse primers antisense probes are present at a final concentration of 450 nM, the probe 5'-HEX-CCTGCCGCGTTGGCAATGTCGAGT-BHQ-1-3' (SEQ ID No. 1) is present at a final concentration of 125 nM.
[0082] The nucleotide sequences, the amplification conditions and the signal detection conditions are respectively described in Tables 2, 3 and 4 below. [Tables 2] SEQ ID No. Description Sequence 1 E. coli detection - probe CCTGCCGCGTTGGCAATGTCGAG T 2 E. coli detection - forward primer CCAGTTTGCGTTCAATACCG 3 E. coli detection - reverse primer GTCGCTAGAAAACGTCCGTA
[0083] [Tables3] STEPS Temperature Time Cycles Initial denaturation 95°C 2 min 1 Denaturation 95°C 15 sec 40 Hybridization / elongation Tm(final): 58°C 6 sec Imaging 1
[0084] [Tables4] Fluorescence Channel Exposure time (ms) Gain HEX Yellow 700 8 Results
[0085] The results are analyzed by QIAcuity Software Suite, they are expressed in number of copies per microliter of sample and presented in the following table 5: [Tables 5] Sample Conditions / Dilution Factor Treatment Concentration copy / microl Valid Partitions Positive Partitions Negative Partitions A Standard Control - 3788.8 25390 23833 1557 A Standard DNAse I ND 25466 25466 0 A Standard DNAse XT 1800.2 25384 18612 6772 B Standard Control - ND 25359 25359 0 B Standard DNAse I 751.2 25319 10507 14812 B Standard DNAse XT 1228 25422 22 25400 B FD 100 Control - 331.1 25285 5503 19782 B FD 100 DNAse I 2476 25377 47 25330 B FD 100 DNAse 20045 B NaCl 60 mM DNAse 3432 C FD 100 Control - 3389.4 24768 22544 2224 C FD 100 DNAse I ND 25368 25368 0 C FD 100 DNAse 14 C NaCl 60 mM DNAse I 13095.7 25367 25365 2 C NaCl 60 mM DNAse XT 18461 25326 18461 6865
[0086] [Fig.l] represents the scatter diagrams of the results obtained under “classical” reaction conditions of DNAse action with: - line A: an extract of E. coli culture, - line B: an extract of E. coli DNA, and - line C: an extract of E. coli culture supplemented with an extract of E. coli DNA.
[0087] From left to right, the results show the untreated (left column), DNAse I-treated (center column), or DNAse XT-treated (right column) samples.
[0088] In the case of the E. coli culture extract ([Fig.l] line A), the experimental results show that DNAse I did not cleave the DNA while DNAse XT cleaved part of the culture. Bacterial mortality is observed, which led to free DNA that was cleaved by DNAse XT.
[0089] In the case of the E. coli DNA extract ([Fig.l] line B), the experimental results show that DNAse I partially cleaved the DNA while DNAse XT almost completely cleaved the DNA.
[0090] In the case of the E. coli culture extract supplemented with an E. coli DNA extract ([Fig.l] line C), the experimental results show that DNAse I did not cleave the DNA while DNAse XT cleaved part of the free DNA.
[0091] In [Fig.2], lines A and B respectively represent the scatter diagrams of the results obtained under reaction conditions of DNAse action in high salinity, with a concentration of 60 mM of NaCl with: - line A: an extract of E. coli DNA, and - line B: an extract of E. coli culture supplemented with an extract of E. coli DNA.
[0092] From left to right, the results show the untreated (left column), DNAse I-treated (center column), or DNAse XT-treated (right column) samples.
[0093] In the case of the E. coli DNA extract ([Fig.2] line A), DNAse I is sensitive to the presence of NaCl at a concentration of 60 mM, with the presence of a "rain" cluster while DNAse XT has cleaved almost all of the free DNA.
[0094] In the case of the E. coli culture extract supplemented with an E. coli DNA extract ([Fig.2] line B), DNAse I did not cleave the DNA while DNAse XT cleaved part of the free DNA. The results also show the uncleaved DNA corresponds to the intact E. coli bacteria. Mortality was observed in the bacterial culture. Conclusion
[0095] These results show that in control conditions on a simple matrix, i.e. a “non-environmental” sample, with or without NaCl, DNase LXT is active and presents a higher percentage of free DNA digestion than that of DNase I.
[0096] Example 2: Detection of the presence of the bacterial strain Microthrix in environmental samples Materials and methods
[0097] [Fig. 3] shows schematically a method according to the invention, in which the matrix comprises free nucleic acid and microorganisms. The addition to this medium of a high-tolerance DNAse leads to the specific degradation of the free nucleic acid, without acting on the nucleic acid enveloped in an intact microorganism. After treatment with DNAse, the nucleic acid is extracted from the environment and then amplified by dPCR.
[0098] Environmental samples constitute a complex matrix, including PCR inhibitors, and in particular a high concentration of salts and tannins and the presence of free nucleic acids.
[0099] Samples are taken at different points in a wastewater treatment plant, in order to detect the presence of the bacterial strain Microthrix in its natural environment. The “WWTP inlet” sample is taken before treatment in the wastewater treatment plant (WWTP). The “digester” sample is taken during the treatment of sludge-type waste in anaerobic conditions. The “recirculation sludge” sample » is taken from the sludge after its treatment in the digester. The samples are stored at 4°C pending further processing.
[0100] The samples, sewage treatment plant sludge or sewage treatment plant wastewater, are then pretreated as indicated below.
[0101] The sewage sludge is treated as follows from the raw sample received, with a volume of up to one litre or one kilogram: - Homogenise by turning 10 times - Take 200 pL in a 2 mL tube - Centrifugation at room temperature (RT): 15 min-5000 g - Removal of the supernatant - Addition of 20 pL DNase LXT Reaction Buffer (lOx) + 2 pL (4 units) DNase LXT + 178 pL H2O Nuclease free - Resuspend the pellet then incubate for 15 min at 37°C. Centrifuge for 5 min at 5000 g then remove the supernatant - Addition of 2 glass beads (diameter 6 mm) - GENOGRINDER cycle: 1 cycle of 30 sec at 1400 cpm - Centrifugation at RT: 30s-5000 g - Add 200 pL PBS Ix - Vortex: 5 min-1500 rpm - Centrifugation at RT: 5 min-500 g - Transfer the supernatant into an identified 1.5 mL tube.
[0102] The sample is ready for extraction.
[0103] For the sewage treatment plant sludge matrix: Add 20 pL DNase LXT Reaction Buffer (10x) + 2 pL (4 units) DNase LXT + 178 pL H2O Nuclease free. The pellet is resuspended then incubated for 15 min at 37°C, centrifugation for 5 min at 5000 g and removal of the supernatant are carried out.
[0104] The wastewater from the treatment plant is treated as follows, from the raw sample received (up to 1 L): - 10 turns - 15 mL sample - Centrifugation at RT: 15 min-3234 g - Removal of the supernatant - Add 20 pL DNase LXT Reaction Buffer (10x) + 2 pL (4 units) DNase LXT + 178 pL H2O Nuclease free. Resuspend the pellet then incubate for 15 min at 37°C. Centrifuge.
[0105] The sample is ready for extraction.
[0106] For the wastewater matrix: add 20 pL DNase LXT Reaction Buffer (10x) + 2 pL (4 units) DNase LXT + 178 pL H2O Nuclease free. Resuspend the pellet then incubate for 15 min at 37°C. The pellet is resuspended then incubated for 15 min at 37°C, centrifugation for 5 min at 5000 g and removal of the supernatant are carried out.
[0107] The samples are then analyzed by PCR. The following products and kits are used: QIAcuity Nanoplate 26K 24 well (Ref. ID: 250001) and QIAcuity Probe PCR Kit Qiagen, (Ref. ID: 250102). In the PCR mix, the sense and antisense primers are present at a final concentration of 450 nM, the probe 5'-FAM-TGAAATCTCAGGGCCCAACCCTGAGC-BHQ-1-3' (SEQ ID No. 4) is present at a final concentration of 125 nM.
[0108] The nucleotide sequences, amplification conditions and signal detection conditions are respectively described in Tables 6, 7 and 8 below. [Tables: SEQ ID No. Description Sequence 4 Microthrix detection - probe TGAAATCTCAGGGCCCAACCCTGA GC 5 Microthrix detection - forward primer TCGTAGGTGGTTGAGTAAGT 6 Microthrix detection - reverse primer GACTCTAGTCAGAGCAGTATC
[0109] [Tables7] Steps Temperature Duration Cycles Initial denaturation 95°C 2 min 4 Denaturation 95°C 15 sec 40 Hybridization / elongation Tm(final): 58°C 60 sec Imaging 1
[0110] [Tables8] Fluorescence Channel Exposure time (ms) Gain FAM Green 700 8
[0111] Results are analyzed by QIAcuity Software Suite and Easydata. Results are expressed as number of copies per liter of sample. Table 9 shows results by collection date.
[0112] [T ables 9] Sample name Date of collection DNAse Absent Present STEP input 20-09-22 ND ND Recirculation sludge 20-09-22 3.87E+07 8.45E+06 Digester 20-09-22 l,59E+07 2.42E+07 STEP input 22-09-22 7.07E+04 ND Recirculation sludge 22-09-22 2.29E+08 2.68E+06 BIO 2 pond sludge 22-09-22 2.42E+08 9.63E+06 Digester 22-09-22 l.15E+08 l.49E+07 AL IM - DIGESTEU R 22-09-22 l.62E+08 l.45E+08 STEP input 27-09-22 7.20E+04 ND Recirculation sludge 27-09-22 2.05E+08 l.03E+07 Digester 27-09-22 9.28E+07 1.11E+07 STEP input 29-09-22 ND ND Recirculation sludge 29-09-22 2.39E+08 4.53E+07 Digester 29-09-22 7.64E+07 l.01E+07 STEP input 04-10-22 l.77E+06 3.27E+06 Recirculation sludge 04-10-22 l.99E+08 3.21E+06 Digester 04-10-22 l.10E+08 E+06
[0113] Table 10 presents the results by sample type. [Tables 10] Sample Name Collection Date DNAse Absent Present STEP Input 20-09-22 ND ND STEP Input 22-09-22 7.07E+04 ND STEP Input 27-09-22 7.20E+04 ND STEP Input 29-09-22 ND ND STEP Input 04-10-22 l.77E+06 3.27E+06 Recirculation Sludge 20-09-22 3.87E+07 8.45E+06 Recirculation Sludge 22-09-22 2.29E+08 2.68E+06 Recirculation Sludge 27-09-22 2.05E+08 l.03E+07 Recirculation Sludge 29-09-22 2.39E+08 4.53E+07 Recirculation sludge 04-10-22 l,99E+08 3.21E+06 Digester 20-09-22 l,59E+07 2,42E+07 Digester 22-09-22 l,15E+08 l,49E+07 Digester 27-09-22 9,28E+07 1,11E+07 Digester 29-09-22 7,64E+07 l,01E+07 Digester 04-10-22 l,10E+08 E+06 Pond sludge BIO 2 22-09-22 2,42E+08 9,63E+06 AL IM - DIGESTEU R 22-09-22 l,62E+08 l,45E+08
[0114] The experimental results show a difference observed between the recirculation sludge and the digester, between the samples treated with DNAse and the untreated samples. In the samples entering the WWTP from 22-09 and 27-09, DNAse would cleave all the free DNA and there would be no intact bacteria. For the sample from 4-10-22, there would only be intact bacteria. The samples not treated with DNAse are more concentrated than the samples treated with DNAse, the difference between the two groups of samples is 1 to 2 log. The “Microthrix without DNAse” samples contain free DNA and intact bacteria. The “Microthrix with DNAse” samples contain intact bacteria. Conclusion
[0115] The results show a difference in quantification with or without DNase LXT treatment. These results are consistent with the presence of free DNA in the raw sample, eliminated by DNase LXT treatment.
Claims
Claims
1. Method for analyzing or modifying the genetic material present inside an intact envelope, comprising at least the following steps: a) treatment with at least one nuclease of a first fraction of a biological sample containing or likely to contain i) free nucleic acid and / or ii) nucleic acid included in an intact envelope, b) detection of a target nucleotide sequence and nucleic acid degraded by said treatment in said first fraction, c) detection of a target nucleotide sequence and nucleic acid degraded by said treatment in said first fraction, in a second fraction of the biological sample not subjected to treatment with said nuclease, d) comparison of the results obtained during steps b) and c) of detection of the target nucleotide sequence and degraded nucleic acid in said first and second fractions,e) selection of at least one nuclease capable of degrading the free nucleic acid while preserving the nucleic acid included in an intact envelope, f) treatment by said at least one nuclease of a test fraction of said biological sample, g) application to at least one target nucleotide sequence of the nucleic acid present inside said intact envelope, of an analysis or modification method.,
2. Method according to claim 1, in which step g) consists of an amplification by a PCR reaction of at least one target nucleotide sequence of the nucleic acid present inside said intact envelope and is followed by a step of analyzing the genetic material of said biological sample.
3. Method according to claim 1, in which step g) consists of a modification of at least one target nucleotide sequence of the nucleic acid present inside said integral envelope by means of a CRIPR / Cas9 type technique.
4. Method for analyzing or modifying genetic material present inside an intact envelope, comprising at least the following steps: a) treatment by at least one nuclease of a biological sample containing or likely to contain i) free nucleic acid and ii) nucleic acid included in an intact envelope, said nuclease being chosen from: a DNAse chosen from DNase I-XT, DNase TURBO, b) application to at least one target nucleotide sequence of the nucleic acid present inside said intact envelope, of an analysis or modification method.
5. Method according to claim 4, in which step b) consists of a step of amplification by a PCR reaction of at least one target nucleotide sequence of the nucleic acid present inside said intact envelope and analysis of the genetic material of said biological sample which is present inside an intact envelope.
6. Method according to claim 4, in which step b) consists of a modification of at least one target nucleotide sequence of the nucleic acid present inside said integral envelope by means of a CRIPR / Cas9 type technique.
7. Method according to one of the preceding claims, in which said integral envelope is chosen from: a cellular envelope, a viral capsule and a synthetic capsule.
8. Method according to one of the preceding claims, characterized in that said nuclease is: a DNAse of the “DNase I-XT” type from the distributor New England BioLabs.
9. Method according to any one of the preceding claims 2, 5 or 7-8, characterized in that the step of amplification by a PCR reaction is preceded by a dilution of the sample, said dilution being at least a factor of 10, preferably a factor of 50, more preferably a factor of 100.
10. Method according to any one of the preceding claims 2, 5 or 7-9, characterized in that the step of amplification by a PCR reaction is preceded by a step of destruction of said intact envelope.
11. Method according to any one of the preceding claims 2, 5 or 7-10, characterized in that the step of amplification by a PCR reaction is carried out in a digital PCR (dPCR) device.
12. Method according to any one of the preceding claims 2 or 7-11, characterized in that said PCR reaction is multiplexed.
13. Use of a method according to any one of the preceding claims for detecting the presence of at least one microorganism in a sample.
14. Use of a method according to the preceding claim for: the detection of the co-occurrence of at least two microorganisms in the same biological sample, for genotyping and / or for the analysis of genetic material included in a synthetic envelope
15. Use of a method according to any one of claims 1, 3 and 6-8 for the modification of genetic material included in a synthetic envelope.
Citation Information
Patent Citations
Compositions and methods of using a synthetic dnase i
WO2004090114A2
Methods of detecting microbial content in cannabis
WO2020198452A1
Methods for microbial DNA analysis
WO2021016036A1
Dnase i variants, compositions, methods, and kits
WO2022250676A1