Method for enriching foodborne pathogens in agricultural water and use thereof

A method combining suction filtration, elution, and tangential flow filtration enables simultaneous enrichment of bacteria and viruses in agricultural water, achieving high recovery rates for rapid detection.

GB2616708BActive Publication Date: 2025-09-10JIANGSU ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
GB2023000422
Authority / Receiving Office
GB · GB
Patent Type
Patents
Current Assignee / Owner
Priority Date
2022-03-18
Filing Date
2023-01-11
Publication Date
2025-09-10
Estimated Expiration
2043-01-11

Smart Images

  • Figure 00000001_0000
    Figure 00000001_0000
  • Figure 00000001_0001
    Figure 00000001_0001
Patent Text Reader

Abstract

A method for enriching foodborne pathogens in agricultural water includes: conducting suction filtration on pre-treated agricultural water through filter membranes to obtain a filter membrane with int
Need to check novelty before this filing date? Find Prior Art

Description

[1] The present disclosure belongs to the technical field of foodbome pathogens detection, and particularly relates to a method for enriching foodbome pathogens in agricultural water and use thereof. BACKGROUND [2] Foodbome pathogens are the main biological hazards that contaminate food and agricultural products, seriously threatening human health, and causing huge economic losses to the food and agricultural products industries. There are various foodbome pathogenic contaminations found in fresh fruits and vegetables. The sources of these foodbome pathogens are mainly from the agricultural habitat environment. In the field, fresh fruits and vegetables can be easily contaminated by foodbome pathogens such as noroviruses and diarrheagenic Escherichia coli. Moreover, since fresh fruits and vegetables require cold chain transportation due to their short shelf life, the pathogens could survive for a longer time in supply chains (and foodbome viruses may not be eliminated completely), resulting in risks for processing or consuming (especially eaten-raw). [3] The agricultural water was usually contaminated by different variety of pathogens with low concentration. Therefore, the simultaneous, comprehensive and effective methods for enriching all foodbome pathogens in agricultural water is a key link in simultaneous detection of the pathogenic bacteria and foodbome viruses. At present, the commonly-used methods for enriching pathogens are mostly only for pathogenic bacteria or foodbome viruses, and limitations are found in targeting all common pathogens (including the pathogenic bacteria and foodbome viruses) in agricultural water. [4] Currently, the microorganisms of agricultural water are mainly enriched by membrane filter methods for the bacteria, as well as material enrichment methods using glass wool, graphene and the like and pressurized membrane filter methods for viruses. There is currently no method available for the simultaneous enrichment of both bacteria and viruses in agricultural water. SUMMARY [5] In view of this, a purpose of the present disclosure is to provide a method for enriching foodbome pathogens in agricultural water and use thereof, thereby simultaneously enriching pathogenic bacteria and foodbome viruses. [6] The present disclosure provides a method for enriching foodbome pathogens in agricultural water, including the following steps: [7] step 1) conducting suction filtration of pretreated agricultural water to obtain a filter membrane with intercepted microorganisms and a filter membrane filtrate; [8] step 2) eluting the filter membrane with intercepted microorganisms obtained in the step 1), the solid-liquid separation was performed to obtain a solid phase as membrane bacteria component and a liquid phase as membrane virus component; [9] step 3) conducting tangential flow filtration of the filter membrane filtrate obtained in the step 1) to obtain a tangential flow-filtered virus component;

[10] the step 2) and the step 3) can be conducted in any order.

[11] In one embodiment, in the step 1), the pore size of filter membrane is from 0.2 pm to 0.8 pm.

[12] In one embodiment, in the step 1), the suction filtration includes filtration with a large-pore filter membrane and a small-pore filter membrane sequentially;

[13] the pore size of large-pore filter membrane is from 0.45 pm to 0.8 pm; and the pore size of small-pore filter membrane is 0.2 pm.

[14] In one embodiment, in the step 2), the eluting is conducted using a first elution buffer;

[15] the first elution buffer contains: 10 g / L to 15 g / L of beef powder, 0.1 mol / L to 0.2 mol / L of Tris-Base, and 0.05 mol / L to 0.1 mol / L of glycine;

[16] in the step 2), the solid-liquid separation is conducted by centrifugation at 3000xg to 6000xg for 5 min to 10 min.

[17] In one embodiment, in the step 3), the tangential flow filtering includes tangential flow filtration concentration and elution sequentially.

[18] In one embodiment, time of the tangential flow filtration concentration is 30 min to 60 min.

[19] In one embodiment, the eluting is conducted using a second elution buffer; and the second elution buffer contains: 20 g / L to 30 g / L of beef powder, 0.2 mol / L to 0.4 mol / L of Tris-Base, and 0.1 mol / L to 0.2 mol / L of glycine.

[20] In one embodiment, the method further includes: conducting virus precipitation on the solution containing a membrane virus component obtained in the step 2) and / or the tangential flow-filtered virus component obtained in the step 3) to obtain a viral solution containing foodbome viruses and / or coronaviruses.

[21] In one embodiment, the virus precipitation is conducted by polyethylene glycol (PEG) precipitation reagent treatment and solid-liquid separation sequentially.

[22] In one embodiment, the PEG precipitation reagent includes an aqueous solution containing the following components by concentration: 8 g / L to 200 g / L of PEG-8000 and 17.5 g / L to 37.4 g / L of sodium chloride;

[23] the PEG precipitation is conducted for 1 h to 12 h;

[24] the PEG precipitation is conducted at 1°C to 5°C; and

[25] the solid-liquid separation is conducted by centrifugation at 4500 rpm to 8000 rpm for 30 min to 120 min.

[26] In one embodiment, the pathogenic bacteria are one or more selected from the group consisting of Listeria monocytogenes, Staphylococcus aureus, Escherichia coli and Salmonella',

[27] the foodbome viruses are one or more selected from the group consisting of norovirus, hepatitis A virus, and rotavirus;

[28] the coronavirus includes porcine epidemic diarrhea virus.

[29] The present disclosure further provides a use of the method combined with real-time fluorescence quantitative PCR detection or high-throughput sequencing for rapid foodbome pathogens detection in agricultural water.

[30] The present disclosure provides a method for enriching foodbome pathogens in agricultural water. In the method, the pretreated agricultural water is subjected to initial separation of microorganisms by a pressurized filter membrane method, so that some microorganisms such as bacteria are mainly intercepted on the filter membrane, while most viruses may pass through the filter membrane and into the filtrate; the microorganisms intercepted on the filter membrane undergo elution and solid-liquid separation, to obtain a solid phase as membrane bacteria component and a liquid phase as membrane vims component; meanwhile, the filter membrane filtrate is tangential flow filtered to obtain a tangential flow-filtered vims component. In the present disclosure, the method may simultaneously enrich and separate various pathogenic bacteria and foodbome vimses in a water sample. The enrichment time of the method is short, and the method has a recovery rate of the foodbome vimses up to 62.60% and a recovery rate of the pathogenic bacteria up to 94.24%. The method may effectively enrich various common pathogenic bacteria (such as Listeria monocytogenes, Staphylococcus aureus, Salmonella, and Escherichia coli), foodbome vimses (such as human norovimses GI and GII, hepatitis A vims, and rotavirus), and coronaviruses (such as porcine epidemic diarrhea vims), which may be used in combination with high-throughput sequencing in rapid detection of foodbome pathogens in agricultural water. BRIEF DESCRIPTION OF THE DRAWINGS

[31] FIG. 1 is a schematic diagram of a filter membrane-based suction filtration device involved in the enrichment process of the present disclosure; and

[32] FIG. 2 is a schematic diagram of a tangential flow-based filtration and concentration device involved in the enrichment process of the present disclosure. DETAILED DESCRIPTION OF THE EMBODIMENTS

[33] The present disclosure provides a method for enriching foodbome pathogens in agricultural water, including the following steps:

[34] step 1) conducting suction filtration on pretreated agricultural water through filter membranes to obtain a filter membrane with intercepted microorganisms and a filter membrane filtrate;

[35] step 2) eluting the filter membrane with intercepted microorganisms obtained in the step 1), subjecting an obtained eluate to solid-liquid separation to obtain a solid phase as a membrane bacteria component and a liquid phase as a solution containing a membrane virus component; and

[36] step 3) tangential flow filtering the filter membrane filtrate obtained in the step 1) to obtain a tangential flow-filtered virus component.

[37] In the present disclosure, suction filtration is conducted on the pretreated agricultural water through the filter membranes to obtain the filter membrane with intercepted microorganisms and the filter membrane filtrate.

[38] In the present disclosure, the agricultural water includes preferably agricultural irrigation water and / or breeding water. The pretreatment is preferably to remove impurities such as aquatic plants and algae in the agricultural water. The impurities are removed preferably by a filter with a pore size of 1 mm to 2 mm. In one embodiment, the impurities are removed by filtration with 4 to 6 layers of sterilized gauze. There is no special limitation on a source of the agricultural water, and sources of the agricultural water known in this field can be used. In one embodiment, the agricultural water is derived from natural samples of agricultural irrigation water and agricultural breeding water in Nanjing, Jurong, and Yancheng.

[39] In the present disclosure, the filter membrane has a pore size of preferably 0.2 pm to 0.8 pm, specifically 0.2 pm, 0.45 pm, and 0.8 pm. When the agricultural water has a high concentration of the microorganisms, the filtration is conducted preferably by a large-pore-size filter membrane firstly to obtain a large-pore-size filter membrane with intercepted microorganisms and a filtrate; then the large-pore-size filtrate is filtered through the small-pore-size filter membrane to obtain a small-pore-size filter membrane filtrate and a small-pore filter membrane with intercepted microorganisms. The large-pore filter membrane has a pore size of preferably 0.45 pm to 0.8 pm; and the small-pore-size filter membrane has a pore size of preferably 0.2 pm. The suction filtration is conducted using preferably a filter membrane-based suction filtration device shown in FIG. 1. The suction filtration is conducted at a negative pressure of preferably 50 kPa to 70 KPa, more preferably 60 KPa.

[40] In the present disclosure, elution is conducted on the filter membrane with intercepted microorganisms; an obtained eluate is subjected to solid-liquid separation to obtain a solid phase as a membrane bacteria component and a liquid phase as a solution containing a membrane virus component.

[41] In the present disclosure, the elution method includes preferably shaking and incubating the filter membrane (including the large-pore-size filter membrane with intercepted microorganisms and the small-pore-size filter membrane with intercepted microorganisms) using an elution solution. The incubation is conducted for preferably 30 min to 60 min, most preferably 60 min. The shaking is conducted at preferably 100 rpm to 300 rpm, most preferably 200 rpm. The elution is conducted using a first elution buffer. The first elution buffer includes preferably the following components by concentration: 10 g / L to 15 g / L of a beef powder, 0.1 mol / L to 0.2 mol / L of Tris-Base, and 0.05 mol / L to 0.1 mol / L of glycine. The first elution buffer can elute most of the microorganisms intercepted on the filter membrane. The solid-liquid separation is conducted by preferably centrifugation. The centrifugation is conducted at preferably 3000*g to 6000xg, most preferably 6000xg. The centrifugation is conducted for preferably 5 min to 10 min, most preferably 10 min. The precipitate is a membrane bacteria component, and the supernatant is a membrane virus component. The membrane bacteria component mainly includes most of the pathogenic bacteria enriched in agricultural water.

[42] In the present disclosure, the small-pore-size filter membrane filtrate is tangential flow filtered to obtain the tangential flow-filtered virus component.

[43] In the present disclosure, since virus particles are small, most of the viruses may enter the filtrate through the filter membrane during membrane filtration; the tangential flow filter treatment method may achieve the enrichment of most viruses in the water. The filtration treatment is preferably conducted using a tangential flow filtration device shown in FIG. 2. The tangential flow filtration treatment includes preferably concentration by tangential flow filtration and elution in sequence. In one embodiment, a method for the tangential flow filtration treatment specifically includes: putting the inlet and outlet pipe of the filtration device into the filtrate, and turning on a peristaltic pump until the filtration device reaches a negative pressure state; transferring the concentrated filtrate to a sterile centrifuge tube through the water outlet pipe, adding an equal volume of the elution solution into the filtration device through the inlet pipe, and conducting recycling elution; transferring a resulting component to a sterile centrifuge tube through the outlet pipe, to obtain the tangential flow-filtered virus-enriched component. The pressure of negative pressure is preferably 1.5 MPa to 2.0 MPa. The concentration by tangential flow filtration is conducted for preferably 30 min to 60 min, most preferably 60 min. The recycling elution is conducted for preferably 10 min to 20 min at preferably 0.5 MPa to 1.0 MPa. The elution is conducted preferably using a second elution buffer; and the second elution buffer includes preferably the following components by concentration: 20 g / L to 30 g / L of a beef powder, 0.2 mol / L to 0.4 mol / L of Tris-Base, and 0.1 mol / L to 0.2 mol / L of glycine. There is no special limitation on a source of the tangential flow-based filtration and concentration device, and tangential flow-based filtration and concentration devices known in the field can be used.

[44] In the present disclosure, the method further includes preferably: conducting virus precipitation on the solution containing a membrane virus component and / or the tangential flow-filtered virus component to obtain a viral solution containing foodbome viruses and / or coronaviruses. The virus precipitation is conducted preferably by PEG precipitation and solid-liquid separation sequentially. The PEG precipitation reagent includes an aqueous solution containing preferably the following components by final concentration: 8 g / L to 200 g / L of PEG-8000 and 17.5 g / L to 37.4 g / L of sodium chloride, most preferably 200 g / L of the PEG-8000 and 37.4 g / L of the sodium chloride. The PEG precipitation is conducted for preferably 1 h to 12 h, most preferably 10 h. The PEG precipitation is conducted at preferably 1°C to 5°C, most preferably 4°C. The solid-liquid separation is conducted by preferably centrifugation. The centrifugation is conducted at preferably 4500 rpm to 8000 rpm, most preferably 8000 rpm. The centrifugation is conducted for preferably 30 min to 120 min, most preferably 30 min.

[45] In the present disclosure, the method is suitable for all kinds of pathogenic bacteria, foodbome viruses, and coronaviruses. In one embodiment, an enriched bacteria component is subjected to enrichment culture to ensure the detection of low-concentration pathogenic bacteria. Taqman real-time fluorescent quantitative PCR was used to detect the nucleic acids obtained from the enriched solution containing the pathogenic bacteria, the food-borne viruses and the coronaviruses respectively.

[46] The primer pairs and probes of murine norovirus were derived from Kitajima et al. (2010); the primer pairs and probes of human norovirus (types GI and GII) and the hepatitis A virus were derived from the international standard ISO / TS 15216-1 (2017); the primer pairs and probes of rotavirus were derived from Asmah, et.al. (2001); and the primer pairs and probes of coronavirus (porcine epidemic diarrhea virus) were derived from Fan et al. (2019). The primer pairs and probes of pathogenic bacteria were derived from the Chinese national standard SNT 1870-2016.

[47] In one embodiment of the present disclosure, common pathogenic bacteria (Listeria monocytogenes, Staphylococcus aureus, Salmonella, and Escherichia coli 0157), foodbome viruses (GI and GII noroviruses, rotavirus, and hepatitis A vims), and coronavirus (porcine epidemic diarrhea vims) are detected in natural agricultural irrigation water and aquaculture water in Nanjing, Jurong and Yancheng. The limit of detection (LOD) of pathogenic bacteria is 1.61 CFU / ml to 146 CFU / ml; the LOD of foodbome viruses is 1.32 gene copies (GC) / ml to 55 GC / ml; and the LOD of coronavirus (porcine epidemic diarrhea virus) is 103 GC / ml.

[48] The present disclosure further provides a use of the enrichment method combined with real-time fluorescence quantitative PCR detection or high-throughput sequencing in rapid detection of foodbome pathogens in agricultural water.

[49] The method for enriching foodbome pathogens in agricultural water and the use thereof provided by the present disclosure is described in detail below with reference to the examples, but these examples may not be understood as limiting the protection scope of the present disclosure.

[50] Example 1

[51] A method for enriching pathogens in artificially contaminated agricultural irrigation water sample added with foodbome pathogens (including Listeria monocytogenes, Staphylococcus aureus, Salmonella enteritidis, norovirus, rotavirus, murine norovirus (as a quality control vims), hepatitis A virus, and coronavirus)

[52] 500 ml of agricultural irrigation water was added with a diluted mixture containing the above viruses and bacteria, where the concentration of viral stock solution was 108 GC / ml, and the concentration of bacterial stock solution was 108 CFU / ml; the final concentrations of viruses and bacteria in the water sample after dilution were 10° GC / ml, 101 GC / ml, 102 GC / ml, 103 GC / ml, 104 GC / ml, 105 GC / ml and 10° CFU / ml, 101 CFU / ml, 102 CFU / ml, 103 CFU / ml, 104 CFU / ml, 105 CFU / ml, respectively; the viruses included human noroviruses (GI and GII), murine norovirus, rotavirus, hepatitis A vims and coronavirus (porcine epidemic diarrhea vims); and the bacteria included Listeria monocytogenes, Staphylococcus aureus and Salmonella', the sample was subjected to suction filtration by filter membranes with different pore sizes in sequence.

[53] Suction filtration of large-pore-size filter membrane: a 0.45 pm sterile filter membrane was used in a sterilized filter membrane-based suction filtration device (FIG. 1), connected with a pump, and the pump was turned on until the filter membrane reached a negative pressure state; the artificial contaminated water sample was added to the upper container of the suction filtration device, and filtered through the filter membrane to the lower conical flask to obtain a large-pore-size filter membrane filtrate; the pump was turned off, the filter membrane was transferred to a sterile petri dish, and incubated with an elution buffer for elution on a shaker for 60 min at 200 rpm, to obtain large-pore-size filter membrane enriched component; the component was separated by centrifugation at 6000xg for 5 min, to obtain the precipitation as large-pore-size membrane bacteria component and the supernatant as a large-pore-size membrane virus component; the large-pore membrane bacteria component was dissolved in DPBS.

[54] Suction filtration of small-pore-size filter membrane: a 0.2 pm sterile filter membrane was used in another sterilized filter membrane-based suction filtration device (FIG. 1), connected with the pump, and the pump was turned on until the filter membrane reached a negative pressure state; the large-pore-size filter membrane filtrate was added to the upper container, and filtered through the filter membrane to the lower conical flask to obtain a 0.2 pm filter membrane filtrate; the pump was turned off, the filter membrane was transferred to a sterile petri dish, and incubated in an elution buffer for elution on a shaker for 60 min at 200 rpm, to obtain0.2 pm filter membrane enriched component; the component was separated by centrifugation at 6000xg for 5 min, to obtain a precipitation as a 0.2 pm membrane bacteria component and a supernatant as a 0.2 pm membrane virus component; the 0.2 pm membrane bacteria component was dissolved in DPBS.

[55] The 0.2 pm filter membrane filtrate (FIG. 1, in the lower conical flask) was enriched by tangential flow filtration (FIG. 2), the water inlet and outlet pipe of the filtration device were put into the filtrate, and the pump was turned on to make the device as negative pressure state at 2.0 MPa for 60 min; the concentrated filtrate was transferred to a sterile tube through the outlet pipe, an equal volume of elution buffer was added into the filtration device through the inlet pipe, and the recycling elution was conducted at 1.0 MPa for 20 min; after elution, the component was transferred to the same tube through outlet pipe, to obtain a tangential flow-filtered virus component.

[56] Virus precipitation: virus precipitation was conducted separately for the membrane virus components obtained after the large-pore-size filter membrane and the 0.2 pm filter membrane filtration, and for the tangential flow filtration. For each component, PEG-8000 (100 g / L) and NaCl (24 g / L) were added and mixed; the mixture was precipitated at 4°C for 4 h; centrifugation was conducted at 4°C, 8000 rpm for 30 min; the precipitation of the membrane virus component or the tangential flow-filtered virus component was dissolved with DPBS.

[57] Nucleic acids extraction of foodbome viruses: RNAs of the membrane virus components (enriched by large-pore-size and 0.2 pm filter membranes) and the tangential flow-filtered virus component were extracted by TRIZOL-LS, and Taqman real-time fluorescence quantitative detection of each virus is conducted by using a one-step RNA reverse transcription real-time fluorescence quantitative detection kit (TOYOBO, Japan; Qiagen, Germany). The primers are shown in Table 1, and the PCR reaction procedures are shown in Table 2.

[58] Table 1 Primers list GIQNIF4 (FW): CGC TGG ATG CGN TTC CAT (SEQ ID NO: 1) GINVILCR(REV): CCT TAG ACG CCA TCA TCA TTT AC (SEQ ID NO: 2) NVGGlp (PROBE): FAM - TGG ACA GGA GAY CGC RAT CT - TAMRA (SEQ ID NO: 3) GIIQNIF2 (FW): ATG TTC AGR TGG ATG AGR TTC TCW GA (SEQ ID NO: 4) GIT COG2R (REV): TCG ACG CCA TCT TCA TTC ACA (SEQ ID NO: 5) QNIFS (PROBE): FAM - AGC ACG TGG GAG GGC GAT CG - TAMRA (SEQ ID NO: 6) PEDV-N-F GTCTGAAAAGCCAATCATTC (SEQ ID NO: 7) PEDV-N-R TTGCCTCTGTTGTTACTC (SEQ ID NO: 8) PEDN-N-probe 5'FAM-CTGTTGTTGCCATTGCCACGA-Eclipse 3' (SEQ ID NO: 9) MNV-s (FW) CCG CAG GAA CGC TCA GCA G (SEQ ID NO: 10) MNV-AS (REV) GGY TGA ATG GGG ACG GCC TG (SEQ ID NO: 11) MNV-TP (PROBE) FAM-ATGAGTGATGGCGCA-MGB-NFQ (SEQ ID NO: 12) RotaNVP3-F ACC ATC TAC ACA TGA CCC TC (SEQ ID NO: 13) RotaNVP3-R GGT CAC ATAACG CCC C (SEQ ID NO: 14) RV (PROBE) FAM-ATG AGC ACA ATAGTT AAA AGC TAA CAC TGT CAA-TAMRA (SEQ ID NO: 15) Salmonella-7 GCGGCGTTGGAGAGTGATA(SEQIDNO: 16) Salmonella-R AGCAATGGAAAAAGCAGGATG (SEQ ID NO: 17) Salmonella probe 5'-FAM-CATTTCTTAAACGGCGGTGTCTTTCCCT-TAMRA-3' (SEQ ID NO: 18) S. aureus-F TTCTTCACGACTAAATAAACGCTCA (SEQ ID NO: 19) S. aureus-R GGTACTACTAAAGATTATCAAGACGGCT (SEQ ID NO: 20) S. aureus probe 5-FAM-CAGAACACAATGTTTCCGATGCAACGT-TAMRA-3' (SEQ ID NO:21) L. monocytogenes-F CTGAATCTCAAGCAAAACCTGGT (SEQ ID NO:22) L. monocytogenes-R CGCGACCGAAGCCAACTA(SEQ ID NO:23) L. monocytogenes probe 5'-FAM-ATACGATAACATCCACGGCTCTGGCTGG-TAMRA-3' (SEQ ID NO:24)

[59] Table 2 Reaction procedures for virus detection Reaction stage Temperature and time Number of cycles Reverse transcription 50°C or 55°C for 60 min 1 Initial denaturation 95°C for 5 min; 1 Denaturation 95°C for 5 sec 45 Annealing 60°C for 30 sec Extension 65°C for 30 sec or72°C for 15 sec

[60] The recovery of the virus was calculated according to equation I.

[61] Recovery (%) = (enriched virus GC / added virus GC) x 100% Equation I

[62] Results were shown in Table 3. For artificial contaminated water samples, the recoveries of human noroviruses (GI type and GII type) were from 38.05% to 62.60% and from 14.80% to 39.81% respectively, and the LODs of human noroviruses (GI type and GII type) were 4.48 GC / ml and 11 GC / ml respectively; the recovery of rotavirus was from 17.41% to 57.35%, and the LOD of rotavirus was 16 GC / ml; the recovery of hepatitis A virus was from 54.04% to 82.22%, and the LOD of hepatitis A virus was 8.72 GC / ml; the recovery of coronavirus (porcine epidemic diarrhea virus) was from 10.96% to 30.63%, and the LOD of coronavirus was 103 GC / ml; and the recovery of murine norovirus (quality control virus) was from 14.69 % to 65.30 %, and the LOD of murine norovirus was 1.74xl03 GC / ml.

[63] Table 3 Recoveries of viruses from artificial contaminated agricultural water samples Added virus Virus concentration in water (GC / ml) Recovery rate Norovirus GII 4.01xl03 -2.45xl04 12.94% - 39.81% 7.41x10’ - 8.59x10* 1.10x10’-1.12x10’ 37.83% -69.30% 14.80% - 29.78% Norovirus GI 6.06x10’-6.63x10“ 3.25x10’-3.85x10’ 4.48x10°-5.61x10° 38.05% - 49.77% 57.57% - 62.60% 53.15% - 59.85% Rotavirus 1.04x10s-1.21x10s 8.03xl02-8.34xl03 1.60x10’-5.51X102 19.46% - 57.35% 16.59% - 43.98% 17.41% - 48.49% Hepatitis A virus 3.78x10s-1.40x10“ S.lOxlO’^.OlxlO2 8.72x10°-5.51x10’ 41.24% - 82.22% 22.84% - 54.04% 48.38% - 72.67% Coronavirus (porcine epidemic diarrhea virus) 3.77xl03 -5.23X103 1.03xl02-2.54xl02 10.96%-26.13% 13.36% - 30.63% Murine norovirus 1.41xl06-8.72xl07 2.41x10“-7.57x10s 1.74x10’-1.10x10* 17.28% - 65.30% 14.7% - 27.3% 20.41% - 29.36%

[65] Nucleic acids extraction of common pathogenic bacteria: bacterial DNAs of the membrane bacteria components from large-pore-size and 0.2 pm filter membranes are extracted using a bacterial DNA extraction kit, and Taqman real-time fluorescence quantitative detection is conducted using a real-time fluorescence quantitative detection kit (Vazyme, China). The primers are shown in Table 1, and the reaction procedures are shown in Table 4.

[66] Table 4 Reaction procedures for bacterial detection Stage Temperature and time Number of cycles Initial denaturation 95°C 5 min 1 Denaturation 95 °C 10 s 40 Annealing and extension 60 °C 40 s

[67] The recovery of the pathogenic bacteria was calculated according to equation II.

[68] Recovery (%) = (CFU of enriched bacteria / CFU of added bacteria) x 100% Equation II

[69] The results are shown in Table 5. The recovery of Listeria monocytogenes was from 22.32% to 46.44%, and the LOD of Listeria monocytogenes was 0.175 CFU / ml; the recovery of Staphylococcus aureus was from 13.68% to 35.48%, and the LOD of Staphylococcus aureus was 0.0293 CFU / ml; and the recovery of Salmonella enteritidis was from 45.61% to 94.24%, and the LOD of Salmonella enteritidis was 31.9 CFU / ml.

[70] Table 5 Recovery rates of recovered bacteria Added bacteria Bacteria concentration in water (CFU / ml) Recovery rate L. monocytogenes 1.14X103-1.81x10’ 1.03x10°-1.61x10° 22.32% - 28.50% 29.00% - 46.44% S. aureus 1.06X102 - 1.36x10’ 3.6x10° -2.00x10’ 29.72%-35.69% 11.07%-14.12% S. enteritidis 8.85x10s-4.96x10s 2.18x10“-6.68x10“ 1.46X102-7.50xl02 68.17%-94.24% 30.40% - 83.06% 34.81% - 48.85%

[71] Example 2

[72] A method for enriching foodbome pathogens in natural agricultural irrigation water and agricultural aquaculture water samples

[73] The (quality control virus) murine norovirus (MNV) was added to 500 ml of agricultural irrigation water or aquaculture water, followed by suction filtration with filter membranes of different pore sizes.

[74] Suction filtration of large-pore-size filter membrane: a 0.8 pm sterile filter membrane was used in a sterilized filter membrane-based suction filtration device (FIG. 1) which connected with a pump, and the pump was turned on to reach negative pressure; The MNV-added water sample was added to the upper container of the filter membrane-based suction filtration device, and filtered through the filter membrane to a lower conical flask to obtain a large-pore-size filter membrane filtrate; the pressure pump was turned off, the filter membrane was transferred to a sterile petri dish, and incubated with an elution buffer for elution on a shaker for 60 min at 200 rpm, to obtain a component as a large-pore-size filter membrane enriched component; then the elution component was separated by centrifugation at 6000xg for 5 min, to obtain a precipitation as a large-pore-size membrane bacteria component and a supernatant as a large-pore-size membrane virus component; the large-pore-size membrane bacteria component was dissolved in DPBS.

[75] Suction filtration of small-pore-size filter membrane: a 0.2 pm sterile filter membrane was used in another sterilized filter membrane-based suction filtration device (FIG. 1), connected with a pressure pump, and the pressure pump was turned on until the filter membrane reached a negative pressure state; the large-pore-size filter membrane filtrate was added to the upper container, and filtered through the filter membrane to a lower conical flask to obtain a 0.2 pm filter membrane filtrate; the pressure pump was turned off, the filter membrane was transferred to a sterile petri dish, and incubated with an elution buffer for elution on a shaker for 60 min at 200 rpm, to obtain a component as a 0.2 pm filter membrane enriched component; then the elution component was separated by centrifugation at 6000xg for 5 min, to obtain a precipitation as a 0.2 pm membrane bacteria component and a supernatant as a 0.2 pm membrane virus component; the 0.2 pm membrane bacteria component was dissolved in DPBS.

[76] The 0.2 pm filter membrane filtrate (FIG. 1, in the lower conical flask) was enriched by tangential flow filtration (FIG. 2), the water inlet and outlet pipes of the filtration device were put into the filtrate, and the peristaltic pump was turned on to make the device as a negative pressure state at 2.0 MPa for 50 min; the concentrated filtrate was transferred to a sterile centrifuge tube through the outlet pipe, an equal volume of elution buffer was added into the filtration device through the inlet pipe, this recycling elution was conducted at 1.0 MPa for 15 min; the obtained component was transferred to the same tube to obtain a tangential flow-filtered virus component.

[77] Virus precipitation: virus precipitation was conducted separately for the membrane virus components obtained after the large-pore-size filter membrane and the 0.2 pm filter membrane filtration, and for the tangential flow filtration. For each component, PEG-8000 (100 g / L) and NaCl (24 g / L) were added and mixed; the mixture was precipitated at 4°C for 10 h; centrifugation was conducted at 4°C, 8,000 rpm for 30 min; the precipitation of the membrane virus components or tangential flow-filtered virus component was dissolved with DPBS.

[78] Nucleic acid extraction of foodbome viruses: RNAs of the membrane virus components (enriched by large-pore and 0.2 pm filter membranes) and the tangential flow-filtered virus component were extracted by TRIZOL-LS, and Taqman real-time fluorescence quantitative detection of human noroviruses (GI and GII), hepatitis A virus, rotavirus, porcine epidemic diarrhea virus, and quality control virus MNV was conducted by a Taqman probe using a one-step RNA reverse transcription real-time fluorescence quantitative detection kit.

[79] The test results are as follows: in agricultural irrigation water samples collected from Nanjing, the norovirus GI (5 samples, 2.39 GC / ml to 798.63 GC / ml), norovirus GII (6 samples, 0.731 GC / ml to 7.22 GC / ml), hepatitis A virus (1 sample, 233 GC / ml), rotavirus (1 sample, 366 GC / ml), and porcine epidemic diarrhea virus (1 sample, 57.6 GC / ml) are detected; in agricultural irrigation water samples collected from Jurong, norovirus GI (2 samples, 7.45 GC / ml to 18.78 GC / ml) and norovirus GII (6 samples, 0.365 GC / ml to 369 GC / ml) are detected; and in agricultural irrigation water and aquaculture water samples collected from Yancheng, norovirus GI (3 sample, 29.2 GC / ml to 167 GC / ml) and norovirus GII (3 sample, 1.3 GC / ml to 19.5 GC / ml) are detected. The recovery rate of MNV is from 4.24% to 62.29%, which is greater than 1% in all samples.

[80] Nucleic acids extraction of common pathogenic bacteria: bacterial DNAs of the membrane bacteria components after large-pore-size and 0.2 pm filter membranes filtration were extracted using a bacterial DNA extraction kit, and real-time fluorescence quantitative detection was conducted on the Staphylococcus aureus, Escherichia coli 0157, Salmonella, and Listeria monocytogenes with a Taqman probe using a real-time fluorescence quantitative detection kit.

[81] The test results are as follows: in agricultural irrigation water samples collected from Nanjing, Staphylococcus aureus (1 sample, 2.42xl0'2 CFU / ml), Salmonella (2 samples, 69.5 CFU / ml to 201 CFU / ml), and Listeria monocytogenes (1 sample, 1.89 CFU / ml) are detected; in agricultural irrigation water samples collected from Jurong, Staphylococcus aureus (2 samples, 6.27x1 O’2 CFU / ml to 1.26x1 O’2 CFU / ml), Salmonella (5 samples, 62.5 CFU / ml to 2260 CFU / ml), and Listeria monocytogenes (3 samples, 0.59 CFU / ml to 1.77 CFU / ml) are detected; in agricultural irrigation water samples collected from Yancheng, Salmonella (2 samples, 7.74 CFU / ml to 66.4 CFU / ml) and Listeria monocytogenes (1 samples, 3.2 CFU / ml) are detected; and in all water samples, Escherichia coli 0157 is not detected.

[82] The above descriptions are merely preferred implementations of the present disclosure. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present disclosure. Sequence Listing Information: DTD Version: Vl_3 File Name: Sequence Listing.xml Software Name: WIPO Sequence Software Version: 2.0.0 Production Date: 2022-12-23 General Information: Current application / Applicant file reference: GWP20220801396 Earliest priority application / IP Office: CN Earliest priority application / Application number: 202210269849.3 Earliest priority application I Filing date: 2022-03-18 Applicant name: Jiangsu Academy of Agricultural Sciences Applicant name / Language: en Invention title: METHOD FOR ENRICHING FOODBORNE PATHOGENS IN AGRICULTURAL WATER AND USE THEREOF (en ) Sequence Total Quantity: 24 Sequences: Sequence Number (ID): 1 Length: 18 Molecule Type: DNA Features Location / Qualifiers: - source, 1..18 > mol_type, other DNA > organism, synthetic construct Residues: cgctggatgc gnttccat Sequence Number (ID): 2 Length: 23 Molecule Type: DNA Features Location / Qualifiers: - source, 1..23 > mol_type, other DNA > organism, synthetic construct 18 Residues: ccttagacgc catcatcatt tac 23 Sequence Number (ID): 3 Length: 20 Molecule Type: DNA Features Location / Qualifiers: - source, 1 ..20 > mol_type, other DNA > organism, synthetic construct Residues: tggacaggag aycgcratct Sequence Number (ID): 4 Length: 26 Molecule Type: DNA Features Location / Qualifiers: - source, 1 ..26 > mol_type, other DNA > organism, synthetic construct Residues: atgttcagrt ggatgagrtt ctcwga Sequence Number (ID): 5 Length: 21 Molecule Type: DNA Features Location / Qualifiers: - source, 1..21 > mol type, other DNA > organism, synthetic construct Residues: tcgacgccat cttcattcac a 20 26 21 Length: 20 Molecule Type: DNA Features Location / Qualifiers: - source, 1..20 > moltype, other DNA > organism, synthetic construct Residues: agcacgtggg agggcgatcg Sequence Number (ID): 7 Length: 20 Molecule Type: DNA Features Location / Qualifiers: - source, 1 ..20 > mol type, other DNA > organism, synthetic construct Residues: gtctgaaaag ccaatcattc Sequence Number (ID): 8 Length: 18 Molecule Type: DNA Features Location / Qualifiers: - source, 1..18 > mol type, other DNA > organism, synthetic construct Residues: ttgcctctgt tgttactc Sequence Number (ID): 9 Length: 21 Molecule Type: DNA Features Location / Qualifiers: - source, 1..21 20 20 18 > moljype, other DNA > organism, synthetic construct Residues: ctgttgttgc cattgccacg a 21 Sequence Number (ID): 10 Length: 19 Molecule Type: DNA Features Location / Qualifiers: - source, 1..19 >mol type, other DNA >organism, synthetic construct Residues: ccgcaggaac gctcagcag 19 Sequence Number (ID): 11 Length: 20 Molecule Type: DNA Features Location / Qualifiers: - source, 1 ..20 >moljype, other DNA >organism, synthetic construct Residues: ggytgaatgg ggacggcctg 20 Sequence Number (ID): 12 Length: 15 Molecule Type: DNA Features Location / Qualifiers: - source, 1..15 >moljype, other DNA >organism, synthetic construct Residues: atgagtgatg gcgca 15 Sequence Number (ID): 13 Length: 20 Molecule Type: DNA Features Location / Qualifiers: - source, 1 ..20 > moltype, other DNA > organism, synthetic construct Residues: accatctaca catgaccctc Sequence Number (ID): 14 Length: 16 Molecule Type: DNA Features Location / Qualifiers: - source, 1..16 > mol_type, other DNA > organism, synthetic construct Residues: ggtcacataa cgcccc Sequence Number (ID): 15 Length: 33 Molecule Type: DNA Features Location / Qualifiers: - source, 1..33 > mol_type, other DNA > organism, synthetic construct Residues: atgagcacaa tagttaaaag ctaacactgt caa Sequence Number (ID): 16 Length: 19 Molecule Type: DNA 20 33 16 Features Location / Qualifiers: - source, 1..19 > moljype, other DNA > organism, synthetic construct Residues: gcggcgttgg agagtgata Sequence Number (ID): 17 Length: 21 Molecule Type: DNA Features Location / Qualifiers: - source, 1..21 > moljype, other DNA > organism, synthetic construct Residues: agcaatggaa aaagcaggat g Sequence Number (ID): 18 Length: 28 Molecule Type: DNA Features Location / Qualifiers: - source, 1 ..28 > moljype, other DNA > organism, synthetic construct Residues: catttcttaa acggcggtgt ctttccct Sequence Number (ID): 19 Length: 25 Molecule Type: DNA Features Location / Qualifiers: - source, 1..25 > moljype, other DNA > organism, synthetic construct 28 19 21 Residues: ttcttcacga ctaaataaac gctca 25 Sequence Number (ID): 20 Length: 28 Molecule Type: DNA Features Location / Qualifiers: - source, 1 ..28 > mol_type, other DNA > organism, synthetic construct Residues: ggtactacta aagattatca agacggct Sequence Number (ID): 21 Length: 27 Molecule Type: DNA Features Location / Qualifiers: - source, 1 ..27 > mol_type, other DNA > organism, synthetic construct Residues: cagaacacaa tgtttccgat gcaacgt Sequence Number (ID): 22 Length: 23 Molecule Type: DNA Features Location / Qualifiers: - source, 1..23 > mol type, other DNA > organism, synthetic construct Residues: ctgaatctca agcaaaacct ggt 28 27 Length: 18 Molecule Type: DNA Features Location / Qualifiers: - source, 1..18 > moltype, other DNA > organism, synthetic construct Residues: cgcgaccgaa gccaacta Sequence Number (ID): 24 Length: 28 Molecule Type: DNA Features Location / Qualifiers: - source, 1 ..28 > mol type, other DNA > organism, synthetic construct Residues: atacgataac atccacggct ctggctgg END 18 28

Claims

1. A method for enriching foodbome pathogens in agricultural water, comprising the following steps:step 1) conducting suction filtration on pretreated agricultural water through filter membranes to obtain a filter membrane with intercepted microorganisms and a filter membrane filtrate;step 2) eluting on file filter membrane with intercepted microorganisms obtained in the step 1), subjecting an obtained eluate to solid-liquid separation to obtain a solid phase as a membrane bacteria component and a liquid phase as a solution containing a membrane virus component; andstep 3) tangential flow filtering the filter membrane filtrate obtained in the step 1) to obtain a tangential flow-filtered virus component; whereinthe step 2) and the step 3) are conducted in any order.

2. The method according to claim 1, wherein in the step 1), the filter membrane has a pore size of 0.2 pm to 0.8 pm.

3. The method according to claim 2, wherein in the step 1), the suction filtration includes filtering with a large-pore filter membrane and a small-pore filter membrane sequentially;the large-pore filter membrane has a pore size of 0.45 pm to 0.8 pm; andthe small-pore filter membrane has a pore size of 0.2 pm.

4. The method according to claim 1, wherein in the step 2), the eluting is conducted using a first elution buffer;the first elution buffer comprises the following components by concentration: 10 g / L to 15 g / L of a beef powder, 0.1 mol / L to 0.2 mol / L of Tris-Base, and 0.05 mol / L to 0.1 mol / L of glycine; andin the step 2), the solid-liquid separation is conducted by centrifugation at 3000*g to 6000*g for 5 min to 10 min.

5. The method according to claim 1, wherein in the step 3), the tangential flow filtering includes tangential flow filtration concentration and elution sequentially.

6. The method according to claim 5, wherein the eluting is conducted using a second elution buffer; and the second elution buffer comprises the following components by concentration: 20 g / L to 30 g / L of a beef powder, 0.2 mol / L to 0.4 mol / L of Tris-Base, and 0.1 mol / L to 0.2 mol / L ofglycine.

7. The method according to any one of claims 1 to 6, further comprising: conducting virus precipitation on the solution containing a membrane virus component obtained in the step 2) and / or the tangential flow-filtered virus component obtained in the step 3) to obtain a foodbome virus or a coronavirus; whereinthe virus precipitation is conducted by polyethylene glycol (PEG) precipitation reagent treatment and solid-liquid separation sequentially.

8. The method according to claim 7, wherein the PEG precipitation reagent comprises an aqueous solution containing the following components by concentration: 8 g / L to 200 g / L of PEG-8000 and 17.5 g / L to 37.4 g / L of sodium chloride;the PEG precipitation reagent treatment is conducted for 1 h to 12 h;the PEG precipitation reagent treatment is conducted at 3 °C to 5 °C; andthe solid-liquid separation is conducted by centrifugation at 4500 rpm to 8000 rpm for 30 min to 120 min.

9. The method according to claim 7, wherein the pathogenic bacteria are one or more selected from the group consisting of Listeria monocytogenes, Staphylococcus aureus, Escherichia coli, and Salmonella-,the foodbome virus is one or more selected from the group consisting of norovirus, hepatitis A virus, and rotavirus; andthe coronavirus comprises porcine epidemic diarrhea virus.

10. Use of the method according to any one of claims 1 to 9 combined with real-time fluorescence quantitative PCR detection or high-throughput sequencing in rapid detection of foodbome pathogens in agricultural water.

Citation Information

Patent Citations

  • Method for eliminating host DNA contamination for use in viral metagenomic analysis of water environment

    CN108342451A