Novel lipids and compositions for delivery of therapeutics

Abstract

To provide lipid-therapeutic nucleic acid compositions that encapsulate nucleic acids with high efficiency, have high drug:lipid ratios, protect the encapsulated nucleic acids from degradation and clearance in serum, are suitable for systemic delivery, and enable intracellular delivery of the encapsulated nucleic acids.SOLUTION: The invention provides lipids, or salts or isomers thereof. In the formula: R1 and R2 are each independently for each occurrence C10-C20 alkenyl; R3 is ω-aminoalkyl, ω-(substituted)aminoalkyl, or ω-thiophosphoalkyl; E is C(O)O; provided that if R3 is 2-(dimethylamino)ethyl then neither R1 nor R2 is linoleyl.SELECTED DRAWING: None

Description

Technical field

[0001] government support The research described herein was conducted, at least in part, using funding from the United States Government under Grant No. HHSN266200600012C awarded by the National Institute of Allergy and Infectious Diseases. Accordingly, the United States Government may have certain rights in this invention.

[0002] priority claim This application is filed in U.S. Patent Application No. 61 / 113,179, filed on November 10, 2008, U.S. Patent Application No. 61 / 154,350, filed on February 20, 2009, and U.S. Patent Application No. 61 / 171,439, filed June 9, 2009, U.S. Patent Application No. 61 / 185,438, filed July 15, 2009; and U.S. Patent Application No. 61 / 234,098, filed August 14, 2009, the contents of each of which are incorporated herein by reference.

[0003] The present invention relates to the field of therapeutic agent delivery using lipid particles. Specifically, the invention provides cationic lipids and lipid particles containing lipids that are advantageous for in vivo delivery of nucleic acids, as well as nucleic acid-lipid particle compositions suitable for in vivo therapeutic use. In addition, the invention provides methods of making these compositions, as well as methods of using these compositions to introduce nucleic acids into cells, eg, to treat various disease conditions. [Background technology]

[0004] Description of related technology Therapeutic nucleic acids include, for example, small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides, ribozymes, plasmids, immunostimulatory nucleic acids, antisense, antagomir, antimir, Includes microRNA mimetics, supermirs, U1 adapters, and aptamers. These nucleic acids act by various mechanisms. In the case of siRNA or miRNA, these nucleic acids can downregulate intracellular levels of specific proteins through a process termed RNA interference (RNAi). After siRNA or miRNA is introduced into the cytoplasm, these double-stranded RNA constructs can bind to a protein named RISC. The sense DNA of the siRNA or miRNA dissociates from the RISC complex and provides a template within the RISC that can recognize and bind mRNA having a sequence complementary to that of the bound siRNA or miRNA. Once a complementary mRNA binds, the RISC complex cleaves the mRNA and releases the cleaved strand. RNAi can provide downregulation of specific proteins by targeting the specific destruction of the corresponding mRNA encoding protein synthesis.

[0005] Because siRNA and miRNA constructs can be synthesized using any nucleotide sequence directed against a target protein, the therapeutic applications of RNAi are very broad. To date, siRNA constructs have shown the ability to specifically downregulate target proteins in both in vitro and in vivo models. Additionally, siRNA constructs are currently being evaluated in clinical studies.

[0006] However, two problems currently facing siRNA or miRNA constructs are, first, that they are susceptible to nuclease digestion in plasma, and second, that they are not systemic as free siRNA or miRNA. When administered sexually, they are limited in their ability to gain access to intracellular compartments where they can bind to RISC. These double-stranded constructs can be stabilized by incorporating chemically modified nucleotide linkers, such as phosphothioate groups, into the molecule. However, these chemical modifications provide only limited protection from nuclease digestion and may reduce the activity of the construct. Intracellular delivery of siRNA or miRNA is facilitated by using carrier systems such as polymers, cationic liposomes, or by chemically modifying the construct, e.g. by covalently attaching cholesterol molecules. be able to. However, improved delivery systems are needed that increase the efficacy of siRNA and miRNA molecules and reduce or eliminate the need for chemical modification.

[0007] Antisense oligonucleotides and ribozymes can also inhibit translation of mRNA into protein. In the case of antisense constructs, these single-stranded deoxynucleic acids have a sequence complementary to that of the target protein mRNA and can bind to the mRNA through Watson-Crick base pairing. This binding either prevents translation of the target mRNA and / or induces RNaseH digestion of the mRNA transcript. Consequently, antisense oligonucleotides have great potential for specificity of action (ie, down-regulation of specific disease-associated proteins). To date, these compounds have shown promise in several in vitro and in vivo models, including models of inflammatory diseases, cancer, and HIV (see Agrawal, Trends in Biotech. 14:376-87 (1996). outlined). Antisense can also affect cellular activity by specifically hybridizing with chromosomal DNA. Advanced human clinical evaluation of several antisense drugs is currently underway. Targets of these drugs include the bcl2 and apolipoprotein B genes and mRNA products.

[0008] Immunostimulatory nucleic acids include deoxyribonucleic acids and ribonucleic acids. In the case of deoxyribonucleic acids, certain sequences or motifs exhibit inappropriate immune stimulation in mammals. These sequences or motifs include CpG motifs, pyrimidine-rich sequences, and palindromic sequences. CpG motifs in deoxyribonucleic acids are thought to be specifically recognized by the endosomal receptor, Toll-like receptor 9 (TLR-9), which subsequently triggers both innate and acquired immune stimulation pathways. ing. Certain immunostimulatory ribonucleic acid sequences have also been reported. These RNA sequences are thought to induce immune activation by binding to Toll-like receptors 6 and 7 (TLR-6 and TLR-7). In addition, double-stranded RNA has also been reported to be immunostimulatory and is believed to activate TLR-3 by binding to it.

[0009] One well-known problem with the use of therapeutic nucleic acids concerns the stability of the phosphodiester internucleotide linkage and the susceptibility of this linker to nucleases. The presence of exonucleases and endonucleases in serum results in rapid digestion of nucleic acids with phosphodiester linkers, and thus therapeutic nucleic acids exhibit a very short half-life in the presence of serum or within cells. There are cases. (Zelphati, O., et al., Antisense. Res. Dev. 3:323-338 (1993); and Thierry, A.R., et al., pp147-161 in Gene Regulation: Biology of Antisense RNA and DNA (Eds. Erickson, RP and Izant, JG; Raven Press, NY (1992)). Because of these and other known problems, therapeutic nucleic acids currently in development do not use the basic phosphodiester chemistry found in natural nucleic acids. .

[0010] This problem has been partially overcome by chemical modifications that reduce serum or intracellular digestion. Modifications at internucleotide phosphodiester bonds (e.g., using phosphorothioate, methylphosphonate, or phosphoramidate linkages), at nucleotide bases (e.g., 5-propynyl-pyrimidine), or at sugars (e.g., using phosphorothioate, methylphosphonate, or phosphoramidate linkages), For example, 2' modified sugars) have been tested (Uhlmann E., et al. Antisense: Chemical Modifications. Encyclopedia of Cancer, Vol. X., pp 64-81 Academic Press Inc. (1997)). Others have attempted to improve stability using 2'-5' sugar linkages (see, eg, US Pat. No. 5,532,130). Other changes are being attempted. However, none of these solutions has proven to be completely satisfactory, and in vivo free therapeutic nucleic acids remain of limited efficacy.

[0011] In addition, as noted above with respect to siRNA and miRNA, therapeutic nucleic acids have limited ability to cross cell membranes (Vlassov, et al., Biochim. Biophys. Acta 1197:95-1082 (1994 ), systemic toxicity such as complement-mediated anaphylaxis, altered coagulation properties, and cytopenias remain problematic (Galbraith, et al., Antisense Nucl. Acid Drug Des. 4:201206 (1994) ).

[0012] In an attempt to improve efficacy, researchers have also used lipid-based carrier systems to deliver chemically modified or unmodified nucleic acids. In Zelphati, O and Szoka, F.C., J. Contr. Rel. 41:99-119 (1996), the authors describe anionic (conventional) liposomes, pH-sensitive liposomes, immunoliposomes, fusogenic liposomes, and Reference is made to cationic lipid / antisense aggregates. Similarly, siRNA in cationic liposomes has been administered systemically, and these nucleic acid-lipid particles have been reported to provide enhanced downregulation of target proteins in mammals, including non-human primates. (Zimmermann et al., Nature 441: 111-114 (2006)). [Summary of the invention] [Problem to be solved by the invention]

[0013] Despite these advances, there remains a need in the art for improved lipid-therapeutic nucleic acid compositions suitable for general therapeutic use. Preferably, these compositions encapsulate nucleic acids with high efficiency, have high drug:lipid ratios, protect encapsulated nucleic acids from degradation and clearance in serum, are suitable for systemic delivery, and are suitable for systemic delivery. may provide intracellular delivery of modified nucleic acids. In addition, these lipid-nucleic acid particles should be well-tolerated and provide an adequate therapeutic index, so that patient treatment with effective doses of the nucleic acids is without significant toxicity and / or risk to the patient. . The present invention provides such compositions, methods of making the compositions, and methods of using the compositions for introducing nucleic acids into cells, including for the purpose of treating disease. [Means to solve the problem]

[0014] The present invention provides novel cationic lipids and lipid particles containing the same. These lipid particles can further include active agents and can be used according to the associated methods of the invention to deliver active agents to cells.

[0015] In one embodiment, the invention provides a lipid, salt or isomer thereof, having the structure of Formula XXXIII: [ka] During the ceremony, R 1 and R 2 is an optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 alkenyl, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 acyl, or -linker-ligand, R 3 is H, optionally substituted C 1 ~C 10 Alkyl, optionally substituted C 2 ~C 10 alkenyl, optionally substituted C 2 ~C 10 Alkynyl, alkylhetrocycle, alkyl phosphate, alkyl phosphorothioate, alkyl phosphorodithioate, alkyl phosphonate, alkylamine, hydroxyalkyl, ω-aminoalkyl, ω-(substituted)aminoalkyl, ω-phosphoalkyl , ω-thiophosphoalkyl, optionally substituted polyethylene glycol (PEG, molecular weight: 100-40K), optionally substituted mPEG (molecular weight: 120-40K), heteroaryl, heterocycle, or linker-ligand. ,as well as E is C(O)O or OC(O).

[0016] In another aspect, the invention provides lipid particles comprising the lipids of the invention. In certain embodiments, the lipid particles further include a neutral lipid and a lipid capable of reducing particle aggregation. In one embodiment, the lipid particles include (i) at least one lipid of the invention, (ii) a neutral lipid selected from DSPC, DPPC, POPC, DOPE, and SM, (iii) a sterol, such as cholesterol, and (iv) PEG-lipids, such as PEG-DMG or PEG-DMA, consisting essentially of molar ratios of approximately 20-60% cationic lipids: 5-25% neutral lipids: 25-55% sterols. ;0.5~15% PEG-lipid. In one embodiment, the lipids of the invention are optically pure.

[0017] In further related embodiments, the invention includes lipid particles of the invention further comprising a therapeutic agent. In one embodiment, the therapeutic agent is a nucleic acid. In one embodiment, the nucleic acid is a plasmid, an immunostimulatory oligonucleotide, a single-stranded oligonucleotide, such as an antisense oligonucleotide, an antagomire; a double-stranded oligonucleotide, such as siRNA; an aptamer, or a ribozyme.

[0018] In yet another related embodiment, the invention includes a pharmaceutical composition comprising a lipid particle of the invention and a pharmaceutically acceptable excipient, diluent carrier.

[0019] The invention further includes, in other related embodiments, a method of modulating the expression of a target gene in a cell, the method comprising providing the cell with a lipid particle or pharmaceutical composition of the invention. The target gene may be a wild type gene. In another embodiment, the target gene contains one or more mutations. In certain embodiments, the methods include specifically modulating the expression of a target gene containing one or more mutations. In certain embodiments, the lipid particles carry a therapeutic agent selected from immunostimulatory oligonucleotides, single-stranded oligonucleotides, e.g., antisense oligonucleotides, antagomirs; double-stranded oligonucleotides, e.g., siRNA, aptamers, ribozymes. include. In one embodiment, the nucleic acid is a plasmid encoding siRNA, antisense oligonucleotide, aptamer, or ribozyme.

[0020] In one aspect of the invention, the target genes include Factor VII, Eg5, PCSK9, TPX2, apoB, SAA, TTR, RSV, PDGF beta gene, Erb-B gene, Src gene, CRK gene, GRB2 gene, RAS gene , MEKK gene, JNK gene, RAF gene, Erk1 / 2 gene, PCNA (p21) gene, MYB gene, JUN gene, FOS gene, BCL-2 gene, cyclin D gene, VEGF gene, EGFR gene, cyclin A gene, cyclin E gene, WNT-1 gene, beta-catenin gene, c-MET gene, PKC gene, NFKB gene, STAT3 gene, survivin gene, Her2 / Neu gene, SORT1 gene, XBP1 gene, topoisomerase I gene, topoisomerase II alpha gene, p73 genes, p21 (WAF1 / CIP1) gene, p27 (KIP1) gene, PPM1D gene, RAS gene, caveolin I gene, MIB I gene, MTAI gene, M68 gene, mutations in tumor suppressor genes, p53 tumor suppressor gene, and selected from the group consisting of combinations thereof.

[0021] In another embodiment, the nucleic acid is a plasmid encoding a polypeptide or a functional variant or fragment thereof, such that expression of the polypeptide or functional variant or fragment thereof is increased.

[0022] In yet a further related embodiment, the invention provides a method of treating a disease or disorder characterized in that a polypeptide is overexpressed in a subject, the method comprising administering to the subject a lipid particle or a pharmaceutical composition of the invention. wherein the therapeutic agent is selected from siRNA, microRNA, antisense oligonucleotide, and a plasmid capable of expressing siRNA, microRNA, or antisense oligonucleotide; includes a polynucleotide that specifically binds to a polynucleotide encoding a polypeptide, or its complement.

[0023] In another related embodiment, the invention provides a method of treating a disease or disorder characterized by underexpression of a polypeptide in a subject, the method comprising providing the subject with a pharmaceutical composition of the invention. and wherein the therapeutic agent is a plasmid encoding a polypeptide or a functional variant or fragment thereof.

[0024] In a further embodiment, the invention provides a method of inducing an immune response in a subject, the method comprising providing the subject with a pharmaceutical composition of the invention, wherein the therapeutic agent is an immunostimulatory oligonucleotide. including. In certain embodiments, a pharmaceutical composition is provided to a patient in combination with a vaccine or antigen.

[0025] In a related embodiment, the invention includes a vaccine comprising a lipid particle of the invention and an antigen associated with a disease or pathogen. In one embodiment, the lipid particles include an immunostimulatory nucleic acid or oligonucleotide. In certain embodiments, the antigen is a tumor antigen. In another embodiment, the antigen is a viral, bacterial, or parasitic antigen.

[0026] The invention further includes methods of preparing the lipid particles and pharmaceutical compositions of the invention, as well as kits useful for preparing these lipid particles and pharmaceutical compositions.

[0027] In another aspect, the invention provides methods of evaluating compositions comprising an agent, such as a therapeutic or diagnostic agent, and a lipid of the invention. [Brief explanation of drawings]

[0028]

Figure 1

Figure 2

[0029] The present invention is based, in part, on the discovery of cationic lipids that offer advantages when used in lipid particles to deliver therapeutic agents in vivo. In particular, as illustrated by the accompanying examples, the invention provides nucleic acid-lipid particle compositions comprising cationic lipids according to the invention. In some embodiments, the compositions described herein provide enhanced activity of nucleic acids and / or improved tolerability of the compositions in vivo, thereby providing previously described lipid -Can result in a significant increase in therapeutic index compared to nucleic acid particle compositions. Additionally, compositions and methods of use are disclosed that can provide reduced toxicity observed with certain therapeutic nucleic acid-lipid particles.

[0030] In certain embodiments, the invention provides improved compositions for delivering siRNA molecules. These compositions are shown herein to be effective in downregulating protein levels and / or mRNA levels of target proteins. Furthermore, it has been shown that the activity of these improved compositions is dependent on the presence of specific cationic lipids, and that the molar ratio of cationic lipids in the formulation can affect activity.

[0031] The lipid particles and compositions of the invention can be used for a variety of purposes, including delivering conjugated or encapsulated therapeutic agents to cells, both in vitro and in vivo. Accordingly, the present invention provides a method of treating a disease or disorder in a subject in need thereof by contacting the subject with lipid particles of the present invention bound to a suitable therapeutic agent.

[0032] As described herein, the lipid particles of the invention are particularly useful for the delivery of nucleic acids, including, for example, siRNA molecules and plasmids. Accordingly, the lipid particles and compositions of the present invention can be used to reduce target gene expression (e.g., siRNA) or nucleic acids that can be used to increase expression of a desired protein (e.g., encoding a desired protein). By contacting cells with lipid particles of the present invention linked to plasmids that contain plasmids, they can be used to modulate the expression of target genes and proteins both in vitro and in vivo.

[0033] Various exemplary embodiments of the cationic lipids of the present invention and lipid particles and compositions comprising the same and their use for delivering therapeutic agents and modulating gene and protein expression are described in further detail below. has been done.

[0034] lipid The present invention provides novel lipids with certain design features. As shown in Figure 2, lipid design features include at least one of the following: head groups with various pKas, cationic primary, secondary, and tertiary monoamines; Diamines and triamines, oligoamines / polyamines, low pKa head groups - imidazoles and pyridines, guanidic, anionic, zwitterionic, and hydrophobic tails, symmetric and / or asymmetric chains, long chains and more It may contain short chains, saturated and unsaturated chains, and the backbone may include skeletal glycerides and acyclic analogs, ethers, esters, phosphates and analogs, sulfonates and analogs, disulfides, acetals and ketals. pH-sensitive bonds, imines and hydrazones, and cyclic, spiro, bicyclic, and polycyclic bonds with oximes.

[0035] The present invention provides novel lipids that are advantageously used in the lipid particles of the present invention for in vivo delivery of therapeutic agents to cells, including lipids with the following structure. In one embodiment, the lipid is a compound of formula XXXIII, or a salt or isomer thereof: [ka] During the ceremony, R 1 and R 2 is an optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 alkenyl, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 acyl, or -linker-ligand, R 3 is H, optionally substituted C 1 ~C 10 Alkyl, optionally substituted C 2 ~C 10 alkenyl, optionally substituted C 2 ~C 10 Alkynyl, alkyl heterocycle, alkyl phosphate, alkyl phosphorothioate, alkyl phosphorodithioate, alkyl phosphonate, alkylamine, hydroxyalkyl, ω-aminoalkyl, ω-(substituted)aminoalkyl, ω-phosphoalkyl, ω- thiophosphoalkyl, optionally substituted polyethylene glycol (PEG, molecular weight: 100-40K), optionally substituted mPEG (molecular weight: 120-40K), heteroaryl, heterocycle, or linker-ligand, and E is C(O)O or OC(O).

[0036] In one embodiment, R 1 and R 2 is an optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 Alkoxy, optionally substituted C 10 ~C 30 alkenyl, optionally substituted C 10 ~C 30 alkenyloxy, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 alkynyloxy, or optionally substituted C 10 ~C 30 It's Asil.

[0037] In another embodiment, R 3 is H, optionally substituted C 1 ~C 10 Alkyl, optionally substituted C 2 ~C 10 alkenyl, optionally substituted C 2 ~C 10 Alkynyl, optionally substituted alkylheterocycle, optionally substituted heterocyclealkyl, optionally substituted alkylphosphate, optionally substituted phosphoalkyl, optionally substituted alkylphosphorothioate, optionally substituted optionally substituted phosphorothioalkyl, optionally substituted alkylphosphorodithioate, optionally substituted phosphorodithioalkyl, optionally substituted alkylphosphonate, optionally substituted phosphonoalkyl, optionally substituted amino, optionally substituted alkylamino, optionally substituted di(alkyl)amino, optionally substituted aminoalkyl, optionally substituted alkylaminoalkyl, optionally substituted di(alkyl)aminoalkyl, Optionally substituted hydroxyalkyl, optionally substituted polyethylene glycol (PEG, molecular weight: 100~40K), optionally substituted mPEG (molecular weight: 120~40K), optionally substituted heteroaryl, optionally substituted a linked heterocycle, or a linker-ligand.

[0038] In one embodiment, the lipid is a compound of formula XXXIII, where E is C(O)O and R 3 but, [ka] , then R 1 and R 2 is not LinoRail at the same time.

[0039] In one embodiment, the lipid is a compound of formula XXXIII, where R 3 is H, optionally substituted C 2 ~C 10 alkenyl, optionally substituted C 2 ~C 10 Alkynyl, alkyl heterocycle, alkyl phosphate, alkyl phosphorothioate, alkyl phosphorodithioate, alkyl phosphonate, alkylamine, hydroxyalkyl, ω-aminoalkyl, ω-(substituted)aminoalkyl, ω-phosphoalkyl, ω- thiophosphoalkyl, optionally substituted polyethylene glycol (PEG, molecular weight: 100-40K), optionally substituted mPEG (molecular weight: 120-40K), heteroaryl, heterocycle, or linker-ligand.

[0040] In yet another embodiment, the lipid is a compound of formula XXXIII, where R 1 and R 2 is an optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 Acyl, or -linker-ligand.

[0041] In one embodiment, the invention features a lipid of formula XXXVIII, or a salt or isomer thereof: [ka] During the ceremony, E is C(O)O or OC(O), R 1 and R 2 and and R x independently at each occurrence, H, optionally substituted C 1 ~C 10 Alkyl, optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 alkenyl, optionally substituted C 10 ~C 30 Alkynyl or optionally substituted C 10 ~C 30 acyl, or linker-ligand, where R 1 ,R 2 , and R x at least one of them is not H, R 3 is H, optionally substituted C 1 ~C 10 Alkyl, optionally substituted C 2 ~C 10 alkenyl, optionally substituted C 2 ~C 10 Alkynyl, alkyl heterocycle, alkyl phosphate, alkyl phosphorothioate, alkyl phosphorodithioate, alkyl phosphonate, alkylamine, hydroxyalkyl, ω-aminoalkyl, ω-(substituted)aminoalkyl, ω-phosphoalkyl, ω- thiophosphoalkyl, optionally substituted polyethylene glycol (PEG, molecular weight: 100-40K), optionally substituted mPEG (molecular weight: 120-40K), heteroaryl, heterocycle, or linker-ligand, n is 1, 2, or 3.

[0042] In one embodiment, the lipid is a compound of formula XXXIII, where E is C(O)O and R 3 but, [ka] , then R 1 ,R 2 , or R x One of them is H and the rest R 1 ,R 2 , or R x is not LinoRail at the same time.

[0043] In some embodiments, R 1 and R 2 independently at each occurrence, each of the optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 alkenyl, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 Acyl, or linker-ligand.

[0044] In some embodiments, R x is H or optionally substituted C 1 ~C 10 It is an alkyl.

[0045] In some embodiments, R x is an optionally substituted C 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 alkenyl, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 Acyl, or linker-ligand.

[0046] In one embodiment, R 1 and R 2 are optionally substituted C, independently of each other in each occurrence 10 ~C 30 Alkyl, optionally substituted C 10 ~C 30 Alkoxy, optionally substituted C 10 ~C 30 alkenyl, optionally substituted C 10 ~C 30 alkenyloxy, optionally substituted C 10 ~C 30 Alkynyl, optionally substituted C 10 ~C 30 alkynyloxy, or optionally substituted C 10 ~C 30 Acyl, or -linker-ligand.

[0047] In one embodiment, R 3 is, independently at each occurrence, H, optionally substituted C 1 ~C 10 Alkyl, optionally substituted C 2 ~C 10 alkenyl, optionally substituted C 2 ~C 10 Alkynyl, optionally substituted alkylheterocycle, optionally substituted heterocyclealkyl, optionally substituted alkylphosphate, optionally substituted phosphoalkyl, optionally substituted alkylphosphorothioate, optionally substituted optionally substituted phosphorothioalkyl, optionally substituted alkylphosphorodithioate, optionally substituted phosphorodithioalkyl, optionally substituted alkylphosphonate, optionally substituted phosphonoalkyl, optionally substituted amino, optionally substituted alkylamino, optionally substituted di(alkyl)amino, optionally substituted aminoalkyl, optionally substituted alkylaminoalkyl, optionally substituted di(alkyl)aminoalkyl, optionally substituted hydroxyalkyl, optionally substituted polyethylene glycol (PEG, molecular weight: 100-40K), optionally substituted mPEG (molecular weight: 120-40K), optionally substituted heteroaryl, or optionally substituted heteroaryl Substituted heterocycle or linker-ligand.

[0048] In one embodiment, E is -C(O)O- or -OC(O)-.

[0049] In one embodiment, Z' is -O-, -S-, -N(Q)-, or alkylene.

[0050] In some situations, R 3 is ω-aminoalkyl, ω-(substituted)aminoalkyl, ω-phosphoalkyl, or ω-thiophosphoalkyl, each of which is optionally substituted. Examples of ω-(substituted)aminoalkyl groups include 2-(dimethylamino)ethyl, 3-(diisopropylamino)propyl, or 3-(N-ethyl-N-isopropylamino)-1-methylpropyl. .

[0051] It has been found that cationic lipids containing unsaturated alkyl chains are particularly useful for forming lipid nucleic acid particles with increased membrane fluidity. In one embodiment, R 1 or R 2 contains at least one, at least two, or at least three sites of unsaturation, such as a double or triple bond.

[0052] In one embodiment, R 1 or R 2 only one of them contains at least one, at least two, or at least three sites of unsaturation.

[0053] In one embodiment, R 1 or R 2 both contain at least one, at least two, or at least three sites of unsaturation.

[0054] In one embodiment, R 1 and R 2 contain different numbers of unsaturations, e.g. R 1 and R 2 One of them has one site of unsaturation and the other has two or three sites of unsaturation.

[0055] In one embodiment, R 1 and R 2 both contain the same number of unsaturated sites.

[0056] In one embodiment, R 1 and R 2 contain different types of unsaturation, e.g. R 1 and R 2 One of the unsaturations is a double bond and the other unsaturation is a triple bond.

[0057] In one embodiment, R 1 and R 2both contain the same type of unsaturation, eg double or triple bonds.

[0058] In one embodiment, R 1 or R 2 At least one of the bonds includes at least one double bond and at least one triple bond.

[0059] In one embodiment, R 1 or R 2 Only one of them contains at least one double bond and at least one triple bond.

[0060] In one embodiment, R 1 and R 2 both contain at least one double bond and at least one triple bond.

[0061] In one embodiment, R 1 and R 2 are both the same, for example, R 1 and R 2 are both linoleil (C18) or R 1 and R 2 are both heptadec-9-enyl.

[0062] In one embodiment, R 1 and R 2 are different from each other.

[0063] In one embodiment, R 1 and R 2 At least one of them is cholesterol.

[0064] In one embodiment, R 1 and R 2 One of them is -linker-ligand.

[0065] In one embodiment, R 1 and R 2 One of them is -linker-ligand, and the ligand is lipophilic.

[0066] In one embodiment, R 1 or R 2 at least one of the at least one CH in which one or both H is replaced by F 2 groups, such as CHF or CF 2 including. In one embodiment, R 1 and R 2 both contain at least one CH in which one or two H are replaced by F 2 groups, such as CHF or CF 2 including.

[0067] In one embodiment, R 1 and R 2 at least one CH in which only one of the H is replaced by F 2 Contains groups.

[0068] In one embodiment, R 1 or R 2 At least one of the CH 2 F,CHF 2 , or CF 3 is at the end. In one embodiment, R 1 or R 2 are both CH 2 F,CHF 2 , or CF 3 is at the end.

[0069] In one embodiment, R 1 or R 2 At least one of -(CF 2 ) y -Z''-(CH 2 ) y -CH 3 , where each y is independently from 1 to 10, and Z'' is O, S, or N(Q).

[0070] In one embodiment, R 1 and R 2 are both -(CF 2 ) y -Z''-(CH 2 ) y -CH 3 , where each y is independently from 1 to 10, and Z'' is O, S, or N(Q).

[0071] In one embodiment, R 1 or R 2 At least one of -(CF 2 ) y -Z''-(CH 2 ) y -CH 3 , where each y is independently from 1 to 10, and Z'' is O, S, or N(Q).

[0072] In one embodiment, R 1 and R 2 are both -(CF 2 ) y -Z''-(CH 2 ) y -CH 3 , where each y is independently from 1 to 10, and Z'' is O, S, or N(Q).

[0073] In one embodiment, R 1 or R 2 At least one of -(CF 2 ) y -(CF 2 ) y -CF 3 , where each y is independently from 1 to 10.

[0074] In one embodiment, R 1 or R 2 Both -(CF 2 ) y -(CF 2 ) y -CF 3 , where each y is independently from 1 to 10.

[0075] In one embodiment, R 3 is methyl, ethyl, polyamine, -(CH 2 ) h -heteroaryl, -(CH 2 ) h -N(Q) 2 , -O-N(Q) 2 ,-(CH 2 ) h -Z’-(CH 2 ) h -heteroaryl, linker-ligand, -(CH 2 ) h -hetercycle, and -(CH 2 ) h -Z''-(CH 2 ) h -heterocycle, where each h is independently 0-13 and Z'' is O, S, or N(Q).

[0076] In one embodiment, Z is C(R 3 ), then at least one R 3 is ω-aminoalkyl or ω-(substituted)aminoalkyl.

[0077] In one embodiment, when Z' is O, S, or alkyl, at least one R 3 is ω-aminoalkyl or ω-(substituted)aminoalkyl.

[0078] In one embodiment, Q is a linker-ligand.

[0079] In one embodiment, the ligand is a fusogenic peptide.

[0080] In one embodiment, the lipid is a racemic mixture.

[0081] In one embodiment, the lipid is enriched in one diastereomer, eg, the lipid exhibits a diastereomeric excess of at least 95%, at least 90%, at least 80%, or at least 70%.

[0082] In one embodiment, the lipid is enriched in one enantiomer, eg, the lipid exhibits an enantiomeric excess of at least 95%, at least 90%, at least 80%, or at least 70%.

[0083] In one embodiment, the lipid is chirally pure, eg, a single optical isomer.

[0084] In one embodiment, the lipid is enriched in one optical isomer.

[0085] Where double bonds are present (e.g. carbon-carbon double bonds or carbon-nitrogen double bonds), there may be isomerism in the configuration with respect to the double bond (i.e. cis / trans or E / Z isomerism). ). It is understood that when a double bond configuration is shown in a chemical structure, corresponding isomers may also exist. The amounts of isomers present may vary depending on the relative stability of the isomers and the energy required to convert between them. Therefore, some double bonds exist in only a single configuration for practical purposes, whereas other double bonds (e.g. have similar relative stabilities and low conversion energies) ) may exist as an equilibrium mixture of inseparable configurations.

[0086] The present invention includes synthesizing the lipids described herein in racemic as well as optically pure form.

[0087] In one embodiment, the cationic lipid is selected from the group consisting of the lipids set forth in Table 1 below. [Table 1A] [Table 1B] [Table 1C] [Table 1D] [Table 1E]

[0088] Although not all diastereomers of a lipid are shown, one embodiment of the invention provides for all diastereomers and thus chirally pure lipids and diastereomers. Also part of the present invention are lipids that are highly concentrated.

[0089] In one embodiment, R 3 is -linker-ligand.

[0090] In certain embodiments, the lipids of the invention are cationic lipids. As used herein, the term "cationic lipid" refers to one or two fatty acids or fatty alkyl chains and an amino acid that can be protonated at physiological pH to form a cationic lipid. It is intended to include lipids with head groups (including alkylamino or dialkylamino groups). In some embodiments, cationic lipids are referred to as "amino lipids."

[0091] Other cationic lipids include alternative fatty acid groups, including those with different alkyl substituents (for example, N-ethyl-N-methylamino-, N-propyl-N-ethylamino-, etc.) and other Those with dialkylamino groups would be included. R 1 and R 2 In embodiments where both are long chain alkyl or acyl groups, they may be the same or different. In general, lipids with less saturated acyl chains (e.g., cationic lipids) are more easily sized, especially when the complexes are sized below about 0.3 micrometers for filter sterilization. be able to. C 10 ~C 20 Cationic lipids containing unsaturated fatty acids with carbon chain lengths in the range of . Other scaffolds can also be used to separate amino groups (eg, those of cationic lipids) and fatty acids or fatty alkyl moieties of cationic lipids. Suitable scaffolds are known to those skilled in the art.

[0092] In certain embodiments, the cationic lipids of the present invention have at least one protonatable or deprotonatable group, such that the lipids are at physiological pH (e.g., pH 7.4). It is positively charged below and neutral at a second pH, preferably at or above physiological pH. Such lipids are also called cationic lipids. Of course, the addition or desorption of protons as a function of pH is an equilibrium process, and references to charged or neutral lipids refer to the nature of the predominant species, with all of the lipids in charged or neutral form. It will be understood that there is no need for this to be the case. Lipids that have multiple protonatable or deprotonatable groups or are zwitterionic are not excluded from use in the present invention.

[0093] In certain embodiments, protonatable lipids (ie, cationic lipids) according to the invention have a pKa of the protonatable group ranging from about 4 to about 11. Typically, the lipid will have a pKa of about 5 to about 7, such as about 4 to about 7, such as about 5.5 to 6.8, when incorporated into lipid particles. Although such lipids are cationic at lower pH formulation stages, the particles will be mostly (though not completely) neutralized on the surface at physiological pH around pH 7.4. One of the benefits of a pKa in the range of about 4-7 is that at least some of the nucleic acids bound to the outer surface of the particles lose their electrostatic interactions at physiological pH and are easily removed by simple dialysis. The susceptibility of the particles to clearance is therefore greatly reduced. pKa measurements of lipids within lipid particles can be performed using the fluorescent probe 2-(p-toluidino), for example, using the method described in Cullis et al., (1986) Chem Phys Lipids 40, 127-144. It can be carried out by using -6-naphthalenesulfonic acid (TNS).

[0094] In one embodiment, a formulation of the invention is at least 75%, at least 80%, or at least 90% encapsulated.

[0095] In one embodiment, the formulation of the invention further comprises an apolipoprotein. As used herein, the term "apolipoprotein" or "lipoprotein" refers to apolipoproteins and variants and fragments thereof known to those skilled in the art, as well as apolipoprotein agonists, analogs thereof, as described below. Or refers to a fragment.

[0096] Suitable apolipoproteins include, but are not limited to, ApoA-I, ApoA-II, ApoA-IV, ApoA-V, and ApoE, as well as active polymorphic forms, isoforms, variants, and mutants. as well as fragments or truncated forms thereof. In certain embodiments, the apolipoprotein is a thiol-containing apolipoprotein. "Thiol-containing apolipoprotein" refers to an apolipoprotein, variant, fragment, or isoform that contains at least one cysteine ​​residue. The most common thiol-containing apolipoprotein is ApoA-I Milano (ApoA-I M ) and ApoA-I Paris (ApoA-I P ) (Jia et al., 2002, Biochem. Biophys. Res. Comm. 297: 206-13; Bielicki and Oda, 2002, Biochemistry 41: 2089-96). ApoA-II, ApoE2, and ApoE3 are also thiol-containing apolipoproteins. Isolated ApoE and / or its active fragments and polypeptide analogs, including recombinantly produced forms thereof, are disclosed in U.S. Patent Nos. 5,672,685; 5,525,472; 5,473,039; No. 5,177,189; No. 5,168,045; No. 5,116,739, the disclosures of which are incorporated herein by reference. ApoE3 has been described by Weisgraber, et al., “Human E apoprotein heterogeneity: cysteine-arginine interchanges in the amino acid sequence of the apo-E isoforms,” J. Biol. Chem. (1981) 256: 9077-9083; and Rall, et al., “Structural basis for receptor binding heterogeneity of apolipoprotein E from type III hyperlipoproteinemic subjects,” Proc. Nat. Acad. Sci. (1982) 79: 4696-4700. See also GenBank accession number K00396.

[0097] In certain embodiments, an apolipoprotein can be in its mature form, can be in its pre-proapolipoprotein form, or can be in its pro-apolipoprotein form. ProApoA-I and mature ApoA-I (if available) (Duverger et al., 1996, Arterioscler. Thromb. Vasc. Biol. 16(12):1424-29), ApoA-I Milano (Klon et al., 2000, Biophys. J. 79:(3)1679-87;Franceschini et al., 1985, J. Biol. Chem. 260: 1632-35), ApoA-I Paris(Daum et al., 1999, J. Mol Med. 77:614-22), ApoA-II (Shelness et al., 1985, J. Biol. Chem. 260(14):8637-46; Shelness et al., 1984, J. Biol. Chem. 259 (15):9929-35), ApoA-IV (Duverger et al., 1991, Euro. J. Biochem. 201(2):373-83), and ApoE (McLean et al., 1983, J. Biol. Chem. 258(14):8993-9000) can also be used within the scope of the present invention.

[0098] In certain embodiments, an apolipoprotein may be a fragment, variant, or isoform of an apolipoprotein. The term "fragment" refers to any apolipoprotein that has an amino acid sequence shorter than that of a native apolipoprotein, the fragment retaining the activity of the native apolipoprotein, including lipid binding properties. By "variant" is meant a substitution or change in the amino acid sequence of an apolipoprotein, such as the addition and deletion of amino acid residues, which does not abolish the activity of the native apolipoprotein, including its lipid binding properties. Thus, a variant has a substantially identical amino acid sequence to a native apolipoprotein provided herein with one or more amino acid residues conservatively substituted with a chemically similar amino acid. It can include proteins or peptides. Examples of conservative substitutions include replacing at least one hydrophobic residue with another residue such as isoleucine, valine, leucine, or methionine. Similarly, for example, the present invention contemplates the substitution of at least one hydrophilic residue, such as between arginine and lysine, between glutamine and asparagine, and between glycine and serine (U.S. Pat. 6,004,925, 6,037,323, and 6,046,166). The term "isoform" refers to proteins that have the same function, greater function, or partial function and similar, identical, or partial sequence, and may be products of the same gene. or may be absent, usually tissue-specific (Weisgraber 1990, J. Lipid Res. 31(8):1503-11; Hixson and Powers 1991, J. Lipid Res. 32(9):1529-35 ;Lackner et al., 1985, J. Biol. Chem. 260(2):703-6;Hoeg et al., 1986, J. Biol. Chem. 261(9):3911-4;Gordon et al., 1984, J. Biol. Chem. 259(1):468-74;Powell et al., 1987, Cell 50(6):831-40;Aviram et al., 1998, Arterioscler. Thromb. Vase. Biol. 18 (10):1617-24;Aviram et al., 1998, J. Clin. Invest. 101(8):1581-90;Billecke et al., 2000, Drug Metab. Dispos. 28(11):1335-42 ;Draganov et al., 2000, J. Biol. Chem. 275(43):33435-42;Steinmetz and Utermann 1985, J. Biol. Chem. 260(4):2258-64;Widler et al., 1980, J. Biol. Chem. 255(21):10464-71;Dyer et al., 1995, J. Lipid Res. 36(1):80-8; Sacre et al., 2003, FEBS Lett. 540(1- 3):181-7;Weers, et al., 2003, Biophys. Chem. 100(1-3):481-92;Gong et al., 2002, J. Biol. Chem. 277(33):29919- 26; Ohta et al., 1984, J. Biol. Chem. 259(23):14888-93, and U.S. Patent No. 6,372,886).

[0099] In certain embodiments, the methods and compositions of the invention include the use of chimeric constructs of apolipoproteins. For example, a chimeric apolipoprotein construct may be comprised of an apolipoprotein domain with high lipid binding avidity linked to an apolipoprotein domain with ischemia-reperfusion protective properties. Chimeric constructs of apolipoproteins may be constructs that contain distinct regions within apolipoproteins (i.e., homology constructs), or chimeric constructs may contain distinct regions that differ between apolipoproteins. construct (ie, a heterologous construct). Compositions containing chimeric constructs include apolipoprotein mutants or (Weisgraber 1990, J. Lipid Res. 31(8):1503-11; Hixson and Powers 1991, J. Lipid Res. 32(9):1529-35; Lackner et al. , 1985, J. Biol. Chem. 260(2):703-6;Hoeg et al, 1986, J. Biol. Chem. 261(9):3911-4;Gordon et al., 1984, J. Biol. Chem. 259(1):468-74;Powell et al., 1987, Cell 50(6):831-40;Aviram et al., 1998, Arterioscler. Thromb. Vasc. Biol. 18(10):1617- 24;Aviram et al., 1998, J. Clin. Invest. 101(8):1581-90;Billecke et al., 2000, Drug Metab. Dispos. 28(11):1335-42;Draganov et al., 2000, J. Biol. Chem. 275(43):33435-42;Steinmetz and Utermann 1985, J. Biol. Chem. 260(4):2258-64;Widler et al., 1980, J. Biol. Chem. 255(21):10464-71;Dyer et al., 1995, J. Lipid Res. 36(1):80-8;Sorenson et al., 1999, Arterioscler. Thromb. Vasc. Biol. 19(9): 2214-25;Palgunachari 1996, Arterioscler. Throb. Vasc. Biol. 16(2):328-38:Thurberg et al., J. Biol. Chem. 271(11):6062-70;Dyer 1991, J. Biol Chem. 266(23):150009-15; see Hill 1998, J. Biol. Chem. 273(47):30979-84).

[0100] Apolipoproteins used in the present invention also include recombinant, synthetic, semi-synthetic, or purified apolipoproteins. Methods for obtaining apolipoproteins or equivalents thereof used in accordance with the present invention are well known in the art. For example, apolipoproteins may be isolated from plasma or natural products, for example by density gradient centrifugation or immunoaffinity chromatography, or synthetically, semi-synthetically, or by recombinant DNA techniques known to those skilled in the art. (e.g. Mulugeta et al., 1998, J. Chromatogr. 798(1-2): 83-90; Chung et al., 1980, J. Lipid Res. 21(3): 284-91;Cheung et al., 1987, J. Lipid Res. 28(8):913-29;Persson, et al., 1998, J. Chromatogr. 711:97-109;U.S. Patent No. 5,059,528, ibid. 5,834,596, 5,876,968, and 5,721,114; and WO 86 / 04920 and WO 87 / 02062).

[0101] Apolipoproteins used in the present invention include ApoA-I, ApoA-I Milano (ApoA-I M ), ApoA-I Paris(ApoA-I P ), ApoA-II, ApoA-IV, and Apolipoprotein agonists such as peptides and peptide analogs that mimic the activity of ApoE. For example, the apolipoprotein may be any of those described in U.S. Pat. No. 6,004,925, U.S. Pat. No. 6,037,323, U.S. Pat. Incorporated herein in its entirety.

[0102] Apolipoprotein agonist peptides or peptide analogs can be synthesized using any peptide synthesis technique known in the art, such as, for example, those described in U.S. Pat. can be used, synthesized or manufactured. For example, peptides can be prepared using solid phase synthesis techniques first described by Merrifield (1963, J. Am. Chem. Soc. 85:2149-2154). Other peptide synthesis techniques can be found in Bodanszky et al., Peptide Synthesis, John Wiley & Sons, 2d Ed., (1976), and other publications readily available to those skilled in the art. A summary of polypeptide synthesis techniques can be found in Stuart and Young, Solid Phase Peptide. Synthesis, Pierce Chemical Company, Rockford, Ill., (1984). Peptides were synthesized by solution methods as described in The Proteins, Vol. II, 3d Ed., Neurath et. al., Eds., p. 105-237, Academic Press, New York, N.Y. (1976). You can also. Suitable protecting groups for use in various peptide syntheses are described in the aforementioned references as well as in McOmie, Protective Groups in Organic Chemistry, Plenum Press, New York, N.Y. (1973). Peptides of the invention can also be prepared, for example, from larger portions of apolipoprotein A-I by chemical or enzymatic cleavage.

[0103] In certain embodiments, the apolipoprotein may be a mixture of apolipoproteins. In one embodiment, the apolipoproteins may be a homogeneous mixture, ie, a single type of apolipoprotein. In another embodiment, the apolipoprotein may be a heterogeneous mixture of apolipoproteins, ie, a mixture of two or more different apolipoproteins. Embodiments of heterogeneous mixtures of apolipoproteins can include, for example, mixtures of apolipoproteins derived from animal sources and apolipoproteins derived from semi-synthetic sources. In certain embodiments, the heterogeneous mixture can include, for example, a mixture of ApoA-I and ApoA-I Milano. In certain embodiments, the heterogeneous mixture can include, for example, a mixture of ApoA-I Milano and ApoA-I Paris. Suitable mixtures for use in the methods and compositions of the invention will be apparent to those skilled in the art.

[0104] When apolipoproteins are obtained from natural sources, apolipoproteins can be obtained from plant or animal sources. If the apolipoprotein is obtained from an animal source, the apolipoprotein may be derived from any species. In certain embodiments, apolipoproteins can be obtained from animal sources. In certain embodiments, apolipoproteins can be obtained from human sources. In a preferred embodiment of the invention, the apolipoprotein is derived from the same species as the individual to which the apolipoprotein is administered.

[0105] lipid particles The invention also provides lipid particles comprising one or more of the above-mentioned cationic lipids. Lipid particles include, but are not limited to, liposomes. As used herein, a liposome is a structure that has a lipid-containing membrane surrounding an aqueous interior. Liposomes may have one or more lipid membranes. The present invention contemplates both single-lamellar liposomes, referred to as unilamellar membranes, and multi-lamellar liposomes, referred to as multilamellar membranes. Additionally, lipid particles, when complexed with nucleic acids, can form lipoplexes consisting of a cationic lipid bilayer sandwiched between DNA layers, as described, for example, in Felgner, Scientific American. It may be.

[0106] The lipid particles of the invention may further comprise one or more additional lipids and / or other components such as cholesterol. Other lipids may be included in the liposome compositions of the invention for various purposes, such as to prevent lipid oxidation or to attach ligands to the liposome surface. Any of a number of lipids may be present in the liposomes of the invention, including amphipathic, neutral, cationic, and anionic lipids. Such lipids can be used alone or in combination. Specific examples of further lipid components that may be present are described below.

[0107] Additional components that may be present in the lipid particles of the invention include bilayer stabilizing components such as polyamide oligomers (see, e.g., U.S. Pat. No. 6,320,017), peptides, proteins, surfactants, phosphatidylethanolamine. and lipid derivatives such as PEG conjugated to ceramide and PEG conjugated to ceramide (see US Pat. No. 5,885,613).

[0108] In certain embodiments, the lipid particles include one of a second amino lipid or a cationic lipid, a neutral lipid, a sterol, and a lipid selected to reduce aggregation of the lipid particle during formation. The reduction in aggregation may be the result of steric stabilization of the particles that prevents charge-induced aggregation during formation.

[0109] Examples of lipids that reduce aggregation of particles during formation include polyethylene glycol (PEG) modified lipids, monosialoganglioside Gm1, and polyamide oligomers (“PAO”) (such as those described in U.S. Pat. No. 6,320,017). is included. Other compounds with uncharged, hydrophilic, sterically hindered moieties that prevent aggregation in formulations, such as PEG, Gm1, or ATTA, can also be attached to lipids for use in the methods and compositions of the invention. can. ATTA lipids are described, for example, in US Patent No. 6,320,017, and PEG lipid conjugates are described, for example, in US Patent Nos. 5,820,873, 5,534,499, and 5,885,613. Typically, the concentration of lipid components selected to reduce aggregation is about 1-15% (depending on mole percent of lipid).

[0110] Particular examples of PEG-modified lipids (or lipid-polyoxyethylene conjugates) useful in the present invention can have various "tethered" lipid moieties to anchor the PEG moiety to the surface of the lipid vesicle. Examples of suitable PEG-modified lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., , PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, and PEG-modified 1,2-diacyloxypropan-3-amines. Particularly preferred are PEG-modified diacylglycerols and dialkylglycerols.

[0111] In embodiments where a sterically large moiety, such as PEG or ATTA, is attached to a lipid anchor, the choice of lipid anchor will depend on the type of bond that the conjugate will have with the lipid particle. It is well known that mPEG (molecular weight 2000)-diastearoylphosphatidylethanolamine (PEG-DSPE) remains associated with liposomes until the particles are cleared from the circulation, perhaps for several days. Other conjugates such as PEG-CerC20 have similar retention capabilities. However, PEG-CerC14 has a T of less than 60 minutes when contacted with serum in some assays. 1 / 2 It is quickly replaced and released from the preparation. As exemplified in U.S. patent application Ser. . Compounds with suitable variations in these characteristics may be useful in the present invention. For some therapeutic applications, it may be preferable for PEG-modified lipids to be rapidly lost from nucleic acid-lipid particles in vivo, and thus PEG-modified lipids will have relatively short lipid anchors. For other therapeutic applications, it may be preferable for the nucleic acid-lipid particles to exhibit a longer plasma circulation lifetime, and thus the PEG-modified lipid will have a relatively longer lipid anchor.

[0112] It should be noted that anti-aggregation compounds do not necessarily require lipid binding to function properly. Free PEG or free ATTA in solution may be sufficient to prevent aggregation. If the particles are stable after formulation, the PEG or ATTA can be removed by dialysis before administration to a subject.

[0113] Neutral lipids, when present in lipid particles, can be any of a number of lipid species that exist in either uncharged or neutral zwitterionic forms at physiological pH. Such lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cephalin, and cerebroside. The selection of neutral lipids for use in the particles described herein is generally guided by considerations of, for example, the size of the liposomes and the stability of the liposomes in the bloodstream. Preferably, the neutral lipid component is a lipid with two acyl groups (ie, diacylphosphatidylcholine and diacylphosphatidylethanolamine). Lipids with acyl chain groups of various chain lengths and degrees of saturation are available or can be isolated or synthesized by well-known techniques. In one group of embodiments, C 10 ~C 20Preferred are lipids containing saturated fatty acids with carbon chain lengths in the range of . In another group of embodiments, C 10 ~C 20 Lipids with monosaturated or disaturated fatty acids with carbon chain lengths in the range of . In addition, lipids with a mixture of saturated and unsaturated fatty acid chains can be used. Preferably, the neutral lipid used in the invention is DOPE, DSPC, POPC, DPPC, or any related phosphatidylcholine. Neutral lipids useful in the present invention may be comprised of sphingomyelin, dihydrosphingomyelin, or phospholipids with other head groups such as serine and inositol.

[0114] The sterol component of the lipid mixture, if present, can be any of the sterols conventionally used in the art of liposome, lipid vesicle, or lipid particle preparation. A preferred sterol is cholesterol.

[0115] In addition to those specifically mentioned above, other cationic lipids that carry a net positive charge around physiological pH may also be included in the lipid particles of the invention. Such cationic lipids include, but are not limited to: N,N-dioleyl-N,N-dimethylammonium chloride (“DODAC”); (rayloxy)propyl-N,N-N-triethylammonium chloride (“DOTMA”); N,N-distearyl-N,N-dimethylammonium bromide (“DDAB”); N-(2,3-dioleoyloxy) 3-(N-(N', N'-dimethylaminoethane)-carbamoyl)cholesterol ("DC-Chol"), N-(1-(2,3-dioleyloxy)propyl)-N-2-(sperminecarboxamido)ethyl)-N,N -dimethylammonium trifluoroacetate (“DOSPA”), dioctadecylamide glycylcarboxyspermine (“DOGS”), 1,2-dioleoyl-sn-3-phosphoethanolamine (“DOPE”), 1,2-dioleoyl- 3-dimethylammoniumpropane (“DODAP”), N,N-dimethyl-2,3-dioleyloxy)propylamine (“DODMA”), and N-(1,2-dimyristyloxyprop-3-yl) -N,N-dimethyl-N-hydroxyethylammonium bromide (“DMRIE”). In addition, many commercially available cationic lipids, such as LIPOFECTIN (including DOTMA and DOPE, available from GIBCO / BRL) and LIPOFECTAMINE (including DOSPA and DOPE, available from GIBCO / BRL) Preparations can be used. In certain embodiments, the cationic lipid is an aminolipid.

[0116] Anionic lipids suitable for use in the lipid particles of the present invention include, but are not limited to, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoylphosphatidylethanolamine phosphatidylethanolamine), N-succinylphosphatidylethanolamine, N-glutarylphosphatidylethanolamine, lysylphosphatidylglycerol, and other anionic modifying groups attached to neutral lipids.

[0117] In many embodiments, amphipathic lipids are included in the lipid particles of the invention. "Amphiphilic lipid" refers to any suitable substance in which the hydrophobic portion of the lipid material is oriented toward the hydrophobic phase and the hydrophilic portion is oriented toward the aqueous phase. Such compounds include, but are not limited to, phospholipids, aminolipids, and sphingolipids. Typical phospholipids include sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatdylcholine, lysophosphatidylcholine, and lysophosphatidylethanolamine. , dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylcholine, or dilinoleoylphosphatidylcholine. Other phosphorus-deficient compounds can also be used, such as sphingolipids, glycosphingolipid families, diacylglycerols, and -acyloxy acids. In addition, such amphipathic lipids can be easily mixed with other lipids such as triglycerides and sterols.

[0118] Also suitable for inclusion in the lipid particles of the invention are programmable fusion lipids. Such lipid particles exhibit little tendency to fuse with cell membranes and deliver their payload until a predetermined signal event occurs. This allows the lipid particles to be more evenly distributed after being injected into an organism or disease site before they begin to fuse with cells. The signal event may be, for example, a change in pH, temperature, ionic environment, or time. In the latter case, the fusion-retarding or "cloaking" component, such as the ATTA-lipid conjugate or the PEG-lipid conjugate, may simply be exchanged out of the lipid particle membrane over time. can. By the time lipid particles are properly distributed within the body, they have lost sufficient coating to become fusogenic. When using other signal events, it is desirable to select signals that are associated with the disease site or target cells, such as an increase in temperature at the site of inflammation.

[0119] In certain embodiments, it is desirable to target the lipid particles of the invention using cell type or tissue specific targeting moieties. Targeting lipid particles using various targeting moieties such as ligands, cell surface receptors, glycoproteins, vitamins (e.g., riboflavin), and monoclonal antibodies has been previously described. (See, eg, U.S. Pat. No. 4,957,773 and U.S. Pat. No. 4,603,044). The targeting moiety can include the entire protein or a fragment thereof. Targeting mechanisms generally require that a targeting agent be placed on the surface of a lipid particle such that the targeting moiety is available for interaction with the target, e.g. a cell surface receptor. It is. A variety of different targeting agents and methods are described, for example, Sapra, P. and Allen, TM, Prog. Lipid Res. 42(5):439-62 (2003); and Abra, RM et al., J. Liposome. Res. 12:1-3, (2002), which are known and available in the art.

[0120] The use of lipid particles, or liposomes, whose surfaces are coated with hydrophilic polymer chains such as polyethylene glycol (PEG) chains has been proposed (Allen, et al., Biochimica et Biophysica Acta 1237: 99-108 (1995 );DeFrees, et al., Journal of the American Chemistry Society 118: 6101-6104 (1996);Blume, et al., Biochimica et Biophysica Acta 1149: 180-184 (1993);Klibanov, et al., Journal of Liposome Research 2: 321-334 (1992); U.S. Patent No. 5,013556; Zalipsky, Bioconjugate Chemistry 4: 296-299 (1993); Zalipsky, FEBS Letters 353: 71-74 (1994); Zalipsky, in Stealth Liposomes Chapter 9 (Lasic and Martin, Eds) CRC Press, Boca Raton Fl (1995)). One approach involves attaching a ligand, such as an antibody, to the polar head groups of the lipids that form the lipid particle to render it targeting. Another approach involves attaching targeting ligands to the distal ends of PEG chains that form a hydrophilic polymer coating (Klibanov, et al., Journal of Liposome Research 2: 321-334 (1992); Kirpotin et al. ., FEBS Letters 388: 115-118 (1996)).

[0121] Standard methods can be used to attach targeting agents. For example, derivatized lipophilic compounds such as phosphatidylethanolamine, or lipid-derivatized bleomycin, which can be activated to bind targeting agents, can be used. Antibody-targeted liposomes can be constructed using, for example, posomes that have incorporated protein A (Renneisen, et al., J. Bio. Chem., 265:16337-16342 (1990) and Leonetti, et al., Proc. Natl. Acad. Sci. (USA), 87:2448-2451 (1990)). Other examples of antibody binding are disclosed in US Pat. No. 6,027,726, the teachings of which are incorporated herein by reference. Examples of targeting moieties may also include other proteins specific for cellular components, including antigens associated with neoplasms or tumors. Proteins used as targeting moieties can be attached to liposomes by covalent bonds (see Heath, Covalent Attachment of Proteins to Liposomes, 149 Methods in Enzymology 111-119 (Academic Press, Inc. 1987)). Other targeting methods include the biotin-avidin system.

[0122] In one exemplary embodiment, the lipid particles include cationic lipids of the invention, neutral lipids (other than cationic lipids), sterols (e.g., cholesterol), and PEG-modified lipids (e.g., PEG-DMG or PEG-DMA). In certain embodiments, the lipid mixture consists or consists essentially of a cationic lipid, a neutral lipid, cholesterol, and a PEG-modified lipid of the invention. In a further preferred embodiment, the lipid particles consist of the above lipid mixture in a molar ratio of about 20-70% amino lipids: 5-45% neutral lipids: 20-55% cholesterol: 0.5-15% PEG-modified lipids; or consists essentially of

[0123] In one embodiment, the lipid particle comprises at least two lipids disclosed herein. For example, a mixture of cationic lipids can be used in the lipid particles, the mixture comprising 20-60% total lipid content on a molar basis.

[0124] In certain embodiments, the lipid particles consist of, or consist essentially of, cationic lipids selected from Table 1, DSPC, Chol, and either PEG-DMG or PEG-DMA, in a molar ratio of For example, about 20-60% cationic lipid: 5-25% DSPC: 25-55% Chol: 0.5-15% PEG-DMG or PEG-DMA. In certain embodiments, the lipid molar ratio is approximately 40 / 10 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), 35 / 15 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), or 52 / 13 / 30 / 5 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA). In another group of embodiments, the neutral lipid, DSPC, in these compositions is replaced with POPC, DPPC, DOPE, or SM.

[0125] Therapeutic agents - lipid particle compositions and formulations The invention includes compositions comprising lipid particles of the invention and an active agent, the active agent being associated with the lipid particles. In certain embodiments, the active agent is a therapeutic agent. In certain embodiments, the active agent is encapsulated within the aqueous interior of the lipid particle. In other embodiments, the active agent is present within one or more lipid layers of the lipid particle. In other embodiments, the active agent is attached to the external or internal lipid surface of the lipid particle.

[0126] As used herein, "complete encapsulation" indicates that the nucleic acids in the particles are not significantly degraded after contact with serum or nuclease assays that would significantly degrade free nucleic acids. In a complete encapsulation system, preferably less than 25% of the particulate nucleic acids are degraded in a treatment that typically degrades 100% of the free nucleic acids, more preferably less than 10% of the particulate nucleic acids are degraded, and most preferably 5% of the particulate nucleic acids are degraded. Less than 100% is decomposed. Alternatively, complete encapsulation can be determined by the Oligreen® assay. Oligreen® is an ultrasensitive fluorescent nucleic acid stain for quantifying oligonucleotides and single-stranded DNA in solution (available from Invitrogen Corporation, Carlsbad, Calif.). Complete encapsulation also suggests that the particles are serum stable, ie, do not rapidly degrade into their constituent components upon in vivo administration.

[0127] Active agent, as used herein, includes any molecule or compound capable of exerting a desired effect on a cell, tissue, organ, or subject. Such effects may be biological, physiological, or cosmetic, for example. An active agent may be any type of molecule or compound, including, for example, nucleic acids, peptides, and polypeptides, such as, for example, polyclonal antibodies, monoclonal antibodies, antibody fragments, etc. antibodies; humanized antibodies, recombinant antibodies, recombinant human antibodies, and Primatized(TM) antibodies; cytokines, growth factors, apoptotic factors, differentiation-inducing factors, cell surface receptors, and their ligands; hormones; Included are small molecules, including molecules or compounds.

[0128] In one embodiment, the active agent is a therapeutic agent, or a salt or derivative thereof. Therapeutic drug derivatives may themselves be therapeutically active or may be prodrugs that become active when further modified. Thus, in one embodiment, the therapeutic agent derivative retains some or all of the therapeutic activity compared to the unmodified agent, and in another embodiment, the therapeutic agent derivative lacks therapeutic activity.

[0129] In various embodiments, therapeutic agents include anti-inflammatory compounds, antidepressants, stimulants, analgesics, antibiotics, contraceptives, antipyretics, vasodilators, antiangiogenic agents, cytovascular agents. , signal transduction inhibitors, cardiovascular drugs, such as antiarrhythmics, vasoconstrictors, hormones, and steroids. In certain embodiments, the therapeutic agent is an oncological drug, also referred to as an anti-tumor drug, anti-cancer drug, oncology drug, or antineoplastic drug. Examples of oncological drugs that can be used in accordance with the present invention include, but are not limited to: adriamycin, alkeran, allopurinol, altretamine, amifostine, anastrozole, araC, diarsenic trioxide. , azathioprine, bexarotene, biCNU, bleomycin, intravenous busulfan, oral busulfan, capecitabine (Xeloda), carboplatin, carmastine, CCNU, celecoxib, chlorambucil, cisplatin, cladribine, cyclosporine A, cytarabine, cytosin arabinoside, daunorubicin, Cytoxan, daunorubicin, dexamethasone, dexrazoxane, dodetaxel, doxorubicin, doxorubicin, DTIC, epirubicin, estramustine, etoposide phosphate, etoposide and VP-16, exemestane, FK506, fludarabine, fluorouracil, 5-FU, gemcitabine (Gemzar), gemtutumab- Ozogamicin, goserelin acetate, hydrrea, hydroxyurea, idarubicin, ifosfamide, imatinib mesylate, interferon, irinotecan (Camptostar, CPT-111), letrozole, leucovorin, leustatin, leuprolide, levamisole, ritretinoin, megastrol ( megastrol), melphalan, L-PAM, mesna, methotrexate, methoxsalen, mithramycin, mitomicin, mitoxantrone, nitrogen mustard, paclitaxel, pamidronate, pegademase, pentostatin, porfimer sodium, prednisone, Rituxan, streptozocin, STI -571, tamoxifen, taxotere, temozolamide, teniposide, VM-26, topotecan (hycamtin), toremifene, tretinoin, ATRA, valrubicin, velvan, vinblastine, vincristine, VP16, and vinorelbine. Other examples of oncological drugs that can be used according to the invention are ellipticine and ellipticine analogs or derivatives, epothilones, intracellular kinase inhibitors, and camptothecin.

[0130] Nucleic acid-lipid particles In certain embodiments, a lipid particle of the invention is associated with a nucleic acid, resulting in a nucleic acid-lipid particle. In certain embodiments, the nucleic acid is completely encapsulated within the lipid particle. As used herein, the term "nucleic acid" is intended to include any oligonucleotide or polynucleotide. Fragments containing up to 50 nucleotides are commonly called oligonucleotides, and longer fragments polynucleotides. In certain embodiments, oligonucleotides of the invention are 15-50 nucleotides in length.

[0131] In the context of the present invention, the terms "polynucleotide" and "oligonucleotide" refer to polymers or oligomers of nucleotide or nucleoside monomers composed of natural bases, sugars, and intersugar (backbone) linkages. The terms "polynucleotide" and "oligonucleotide" also refer to polymers or oligomers containing similarly functional non-natural monomers or portions thereof. Such modified or substituted oligonucleotides are often preferred over natural forms because of properties such as, for example, enhanced cellular uptake and increased stability in the presence of nucleases.

[0132] Nucleic acids present in lipid-nucleic acid particles according to the invention include all known forms of nucleic acids. Nucleic acids as used herein may be single-stranded DNA or RNA, or double-stranded DNA or RNA, or a DNA-RNA hybrid. Examples of double-stranded DNA include structural genes, genes containing control and termination regions, and self-replicating systems such as viral DNA or plasmid DNA. Examples of double-stranded RNA include siRNA and other RNA interference reagents. Single-stranded nucleic acids include, for example, antisense oligonucleotides, ribozymes, microRNAs, and triplex-forming oligonucleotides. The nucleic acids present in the lipid-nucleic acid particles of the invention may include one or more of the oligonucleotide modifications described below.

[0133] Nucleic acids of the invention may be of varying lengths, which may generally depend on the particular form of the nucleic acid. For example, in certain embodiments, a plasmid or gene may be about 1,000 to 100,000 nucleotide residues in length. In certain embodiments, oligonucleotides may range in length from about 10 to 100 nucleotides. In various related embodiments, the single-stranded, double-stranded, triple-stranded oligonucleotide is about 10 to about 50 nucleotides, about 20 to about 50 nucleotides, about 15 to about 30 nucleotides, The length may range from about 20 to about 30 nucleotides.

[0134] In certain embodiments, oligonucleotides (or strands thereof) of the invention specifically hybridize with or are complementary to a target polynucleotide. "Specifically hybridizable" and "complementary" refer to a sufficient degree of complementarity such that stable and specific binding occurs between the DNA or RNA target and the oligonucleotide. It is a term used in It is understood that an oligonucleotide need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable. If the binding of the oligonucleotide to the target interferes with the normal function of the target molecule, causing loss of utility or expression from the target molecule, under conditions where specific binding is desired, i.e. in an in vivo assay or therapeutic treatment. oligonucleotides when there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide to non-target sequences under physiological conditions or, in the case of in vitro assays, under the conditions under which the assay is conducted. are specifically hybridizable. Thus, in other embodiments, the oligonucleotide contains 1, 2, or 3 base substitutions, e.g., a mismatch, compared to the region of the gene or mRNA sequence to which it targets or to which it specifically hybridizes. including.

[0135] RNA interference nucleic acid In certain embodiments, the nucleic acid-lipid particles of the invention are conjugated to RNA interference (RNAi) molecules. RNA interference methods using RNAi molecules can be used to interfere with the expression of genes or polynucleotides of interest. Small interfering RNA (siRNA) has essentially replaced antisense ODNs and ribozymes as the next generation of targeted oligonucleotide drugs in development.

[0136] SiRNAs are RNA duplexes, typically 16-30 nucleotides long, that can bind to a cytoplasmic multiprotein complex known as the RNAi-induced silencing complex (RISC). RISC loaded with siRNA mediates the degradation of homologous mRNA transcripts, and thus siRNA can be designed to knock down protein expression with a high degree of specificity. Unlike other antisense technologies, siRNA works through a natural mechanism that has evolved to control gene expression by non-coding RNA. This is generally believed to be the reason why their activity is more potent than either antisense ODNs or ribozymes in vitro and in vivo. A variety of RNAi reagents, including siRNAs targeting clinically relevant targets, are currently in pharmaceutical use, as described, for example, in de Fougerolles, A. et al., Nature Reviews 6:443-453 (2007). Currently under development.

[0137] The first RNAi molecules described were RNA:RNA hybrids containing both an RNA sense strand and an RNA antisense strand, but there are also DNA sense:RNA antisense hybrids, RNA sense:DNA antisense hybrids, and DNA It has now been demonstrated that :DNA hybrids are capable of mediating RNAi (Lamberton, J.S. and Christian, A.T., (2003) Molecular Biotechnology 24:111-119). The invention therefore includes the use of RNAi molecules comprising any of these different types of double-stranded molecules. Additionally, it is understood that RNAi molecules can be used and introduced into cells in a variety of forms. Thus, as used herein, RNAi molecules encompass any and all molecules capable of inducing an RNAi response in a cell, including but not limited to: two separate strands, the sense strand; and double-stranded oligonucleotides comprising an antisense strand, such as small interfering RNA (siRNA); double-stranded oligonucleotides comprising two separate strands joined together by a non-nucleotidyl linker; forming a double-stranded region An expression vector expressing an oligonucleotide containing a hairpin loop of complementary sequence, such as an shRNAi molecule; and one or more polynucleotides capable of forming a double-stranded polynucleotide, alone or in combination with another polynucleotide.

[0138] As used herein, a "single-stranded siRNA compound" is an siRNA compound that is composed of a single molecule. Single-stranded siRNA compounds include double-stranded regions formed by intrastrand pairing, and may be or include, for example, hairpin or panhandle structures. Single-stranded siRNA compounds may be antisense with respect to the target molecule.

[0139] Single-stranded siRNA compounds can be long enough to enter RISC and participate in RISC-mediated target mRNA cleavage. Single-stranded siRNA compounds are at least 14 nucleotides long, and in other embodiments are at least 15, 20, 25, 29, 35, or 50 nucleotides long. In certain embodiments, single-stranded siRNA compounds are less than 200, 100, or 60 nucleotides in length.

[0140] The hairpin siRNA compound is equal to or at least 17, 18, 19, 29, 21, 22, 23, 24, or 25 nucleotide pairs. It will have a double-stranded region that is 25 nucleotide pairs. The double-stranded region may be 200, 100, or 50 or less in length. In certain embodiments, the double-stranded region ranges from 15-30, 17-23, 19-23, and 19-21 nucleotide pairs in length. Hairpins may have single-stranded overhangs or terminal unpaired regions. In certain embodiments, the overhang is 2-3 nucleotides in length. In some embodiments, the protrusion is on the sense side of the hairpin, and in some embodiments the protrusion is on the antisense side of the hairpin.

[0141] A "double-stranded siRNA compound" as used herein comprises multiple, and in some cases two, strands capable of interstrand hybridization to form regions of double-stranded structure. It is an siRNA compound.

[0142] The antisense strand of the double-stranded siRNA compound is equal to or at least 14, 15, 16, 17, 14, 15, 16, 17, 18, 19, 25, 29, 40, or 60 nucleotides in length It may be 18, 19, 25, 29, 40, or 60 nucleotides. The antisense strand of a double-stranded siRNA compound may be up to 200, 100, or 50 nucleotides in length. Ranges may be 17-25, 19-23, and 19-21 nucleotides in length. As used herein, the term "antisense strand" refers to a strand of an siRNA compound that is sufficiently complementary to a target molecule, eg, target RNA.

[0143] The sense strand of a double-stranded siRNA compound is equal to or at least 14, 15, 16, 17, 18 nucleotides in length. , 19, 25, 29, 40, or 60 nucleotides. The sense strand of a double-stranded siRNA compound may be up to 200, 100, or 50 nucleotides in length. Ranges may be 17-25, 19-23, and 19-21 nucleotides in length.

[0144] The double-stranded portion of a double-stranded siRNA compound is equal to or equal to 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 29, 40, or 60 nucleotides in length. , or at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 29, 40, or 60 nucleotides. The double-stranded portion of a double-stranded siRNA compound may be up to 200, 100, or 50 nucleotides in length. Ranges may be 15-30, 17-23, 19-23, and 19-21 nucleotides in length.

[0145] In many embodiments, the siRNA compound is large enough that it can be cleaved by an endogenous molecule, eg, Dicer, to produce smaller siRNA compounds, eg, siRNA agents.

[0146] The sense and antisense strands may be selected such that double-stranded siRNA compounds contain single-stranded or unpaired regions at one or both ends of the molecule. Thus, double-stranded siRNA compounds include paired overhangs, e.g., one or two 5' overhangs or 3' overhangs of 1 to 3 nucleotides, or a sense strand and an antisense strand containing a 3' overhang. including. The protrusion may be the result of one strand being longer than the other, or it may be the result of two strands of the same length being misaligned. Some embodiments will have at least one 3' overhang. In one embodiment, both ends of the siRNA molecule will have 3' overhangs. In some embodiments, the overhang is 2 nucleotides.

[0147] In certain embodiments, the length of the double-stranded region ranges from 15 to 30, or 18, 19, 20, 21, 22, and 23 nucleotides in length, such as the ssiRNA compounds discussed above. . ssiRNA compounds may be similar in length and structure to products processed from long dsiRNAs by natural dicer. Also included are embodiments in which the two strands of the ssiRNA compound are linked, eg, covalently linked. Hairpins or other single-stranded structures that provide the necessary double-stranded regions and 3' overhangs are also within the invention.

[0148] The siRNA compounds described herein, including double-stranded siRNA compounds and single-stranded siRNA compounds, can mediate silencing of target RNA, e.g., mRNA, e.g., transcripts of protein-encoding genes. . For convenience, such mRNA is also referred to herein as silenced mRNA. Such genes are also called target genes. Generally, the RNA that is silenced is an endogenous gene or a pathogen gene. In addition, RNA other than mRNA can also be targeted, such as tRNA and viral RNA.

[0149] As used herein, the phrase "mediate RNAi" refers to the ability to silence target RNA in a sequence-specific manner. Without wishing to be bound by theory, it is believed that silencing uses the RNAi machinery or process and a guide RNA, such as a 21-23 nucleotide ssiRNA compound.

[0150] In one embodiment, the siRNA compound is "sufficiently complementary" to the target RNA, such as the target mRNA, such that the siRNA compound silences the production of the protein encoded by the target mRNA. In another embodiment, the siRNA compound is "exactly complementary" to the target RNA, e.g., the target RNA, and the siRNA compound anneals, e.g., Watson-Crick base pairing exclusively in the region of exact complementarity. form a hybrid made of. A "sufficiently complementary" target RNA can include an internal region (eg, at least 10 nucleotides) that is exactly complementary to the target RNA. Additionally, in certain embodiments, siRNA compounds specifically discriminate between single nucleotide differences. In this case, the siRNA compound will mediate RNAi only if exact complementarity is found in that region (eg, within 7 nucleotides of a single nucleotide difference).

[0151] microRNA MicroRNAs (miRNAs) are a highly conserved class of small RNA molecules that are transcribed from DNA in animal and plant genomes but are not translated into proteins. Processed miRNAs are assembled into RNA-induced silencing complexes (RISCs), and approximately 17 to 25 single-stranded miRNAs have been identified as key regulators of development, cell proliferation, apoptosis, and differentiation. RNA molecules of nucleotides (nt). They are thought to play a role in regulating gene expression by binding to the 3'-untranslated region of specific mRNAs. RISC mediates downregulation of gene expression through translation inhibition, transcript cleavage, or both. RISC is also involved in transcriptional silencing in the nucleus of a wide range of eukaryotes.

[0152] To date, a large number of miRNA sequences have been identified and the number is increasing, illustrative examples of which are e.g. “miRBase: microRNA sequences, targets and gene nomenclature” Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. NAR, 2006, 34, Database Issue, D140-D144;“The microRNA Registry” can be found at Griffiths-Jones S. NAR, 2004, 32, Database Issue, D109-D111, http It can also be found at : / / microrna.sanger.ac.uk / sequences / .

[0153] antisense oligonucleotide In one embodiment, the nucleic acid is an antisense oligonucleotide to a target polynucleotide. The term "antisense oligonucleotide" or simply "antisense" is meant to include an oligonucleotide that is complementary to a target polynucleotide sequence. Antisense oligonucleotides are single strands of DNA or RNA that are complementary to a selected sequence, eg, target gene mRNA. Antisense oligonucleotides are thought to inhibit gene expression by binding to complementary mRNA. Binding to a target mRNA can lead to inhibition of gene expression, either by binding to it and thereby preventing translation of complementary mRNA, or by leading to degradation of the target mRNA. Antisense DNA can be used to target specific complementary (coding or non-coding) RNA. If binding occurs, this DNA / RNA hybrid can be degraded with the enzyme RNaseH. In certain embodiments, antisense oligonucleotides contain about 10 to about 50 nucleotides, more preferably about 15 to about 30 nucleotides. The term also encompasses antisense oligonucleotides that may not be precisely complementary to the desired target gene. Accordingly, the present invention may be utilized where non-target specific activity with antisense is found, or where antisense sequences containing one or more mismatches with the target sequence are most preferred for a particular use. can.

[0154] Antisense oligonucleotides have been demonstrated to be effective targeted inhibitors of protein synthesis and, as a result, can be used to specifically inhibit protein synthesis by target genes. The efficacy of antisense oligonucleotides to inhibit protein synthesis is well established. For example, the synthesis of polygalactauronase and the type 2 muscarinic acetylcholine receptor is inhibited by antisense oligonucleotides to their respective mRNA sequences (US Pat. No. 5,739,119 and US Pat. No. 5,759,829). Furthermore, examples of antisense inhibition include nuclear protein cyclin, multidrug resistance gene (MDG1), ICAM-1, E-selectin, STK-1, striatal GABA A receptor, and human EGF (Jaskulski et al. , Science. 1988 Jun 10;240(4858):1544-6; Vasanthakumar and Ahmed, Cancer Commun. 1989;1(4):225-32; Peris et al., Brain Res Mol Brain Res. 1998 Jun 15;57(2):310-20; U.S. Patent No. 5,801,154; U.S. Patent No. 5,789,573; U.S. Patent No. 5,718,709, and U.S. Patent No. 5,610,288). Additionally, it has been described that antisense constructs can be used to inhibit and treat various abnormal cell growths (e.g., cancer) (U.S. Pat. No. 5,747,470, U.S. Pat. No. 5,591,317, and U.S. Pat. No. 5,783,683). issue).

[0155] Methods for generating antisense oligonucleotides are known in the art and can be readily applied to generate antisense oligonucleotides targeted to any polynucleotide sequence. The selection of antisense oligonucleotides specific for a given target sequence is based on the selected target sequence, and the determination of secondary structure, T m, binding energy, and relative stability analysis. Antisense oligonucleotides are selected based on their relative ability not to form dimers, hairpins, or other secondary structures that would reduce or inhibit specific binding to the target mRNA in the host cell. Can be done. Highly preferred target sites for mRNA include regions at or near the AUG translation initiation codon and sequences that are substantially complementary to the 5' region of the mRNA. These secondary structure analyzes and target site selection considerations can be performed using, for example, OLIGO primer analysis software (Molecular Biology Insights) v.4 and / or BLASTN 2.0.5 algorithm software (Altschul et al., Nucleic Acids). Res. 1997, 25(17):3389-402).

[0156] Antagomir Antagomirs are RNA-like oligonucleotides that incorporate various modifications for pharmacological properties such as RNAse protection and enhanced tissue and cellular uptake. Antagomirs are distinguished from normal RNA by, for example, complete 2'-O-methylation of sugars, a phosphorothioate backbone, and a cholesterol moiety, for example at the 3' end. Antagomirs can be used to efficiently silence endogenous miRNAs by forming duplexes containing antagomirs and endogenous miRNAs, thereby preventing miRNA-induced gene silencing. An example of antagomir-mediated miRNA silencing is the silencing of miR-122 described in Krutzfeldt et al, Nature, 2005, 438: 685-689, which is expressly incorporated herein by reference in its entirety. be. Antagomir RNA can be synthesized using standard solid phase oligonucleotide synthesis protocols. See US Patent Application No. 11 / 502,158, and US Patent Application No. 11 / 657,341, the disclosures of each of which are incorporated herein by reference.

[0157] The antagomirs may include ligand-binding monomer subunits and monomers for oligonucleotide synthesis. Exemplary monomers are described in US patent application Ser. No. 10 / 916,185, filed August 10, 2004. Antagomir may have a ZXY structure, such as that described in International Application No. PCT / US2004 / 07070, filed March 8, 2004. Antagomirs may be complexed with amphipathic moieties. Exemplary amphipathic moieties for use with oligonucleotide agents are described in International Application No. PCT / US2004 / 07070, filed March 8, 2004.

[0158] aptamer Aptamers are nucleic acid or peptide molecules that bind with high affinity and specificity to specific molecules of interest (Tuerk and Gold, Science 249:505 (1990); Ellington and Szostak, Nature 346:818 (1990)). DNA or RNA aptamers have been successfully generated that bind to many different substances, from large proteins to small organic molecules. Eaton, Curr. Opin. Chem. Biol. 1:10-16 (1997), Famulok, Curr. Opin. Struct. Biol. 9:324-9 (1999), and Hermann and Patel, Science 287:820-5 ( 2000). Aptamers may be RNA or DNA based and may include riboswitches. Riboswitches are parts of mRNA molecules that can directly bind small target molecules and whose binding to the target affects gene activity. Thus, the riboswitch-containing mRNA is directly involved in regulating its own activity depending on the presence or absence of its target molecule. Generally, aptamers are produced by several rounds of in vitro selection methods, or similarly by SELEX (exponential index), in order to bind to a variety of molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues, and organisms. (systematic ligand evolution via functional enrichment). Aptamers can be prepared by any known method, including synthetic, recombinant, and purification methods, and can be used alone or in combination with other aptamers specific for the same target. Additionally, as described in more detail herein, the term "aptamer" specifically refers to an "aptamer" containing a consensus sequence derived from comparing multiple known aptamers for a given label. 2 aptamers”.

[0159] ribozyme According to another embodiment of the invention, the nucleic acid-lipid particle is attached to a ribozyme. Ribozymes are RNA molecule complexes that have specific catalytic domains with endonuclease activity (Kim and Cech, Proc Natl Acad Sci U S A. 1987 Dec;84(24):8788-92;Forster and Symons, Cell. 1987 Apr 24;49(2):211-20). For example, many ribozymes accelerate phosphoryl transfer reactions with a high degree of specificity, often cleaving only one of several phosphate esters on an oligonucleotide substrate (Cech et al., Cell. 1981 Dec;27(3 Pt 2):487-96;Michel and Westhof, J Mol Biol. 1990 Dec 5;216(3):585-610;Reinhold-Hurek and Shub, Nature. 1992 May 14;357 (6374):173-6). This specificity is due to the fact that the substrate must bind to the ribozyme's internal guide sequence (“IGS”) through specific base-pairing interactions prior to chemical reaction.

[0160] At least six bases of diversity in natural enzymatic RNAs are currently known. Each can catalyze the hydrolysis of RNA phosphodiester bonds in the trans position (and thus can cleave other RNA molecules) under physiological conditions. Generally, enzymatic nucleic acids act by first binding to target RNA. Such binding occurs through the target binding portion of the enzymatic nucleic acid held in close proximity to the enzymatic portion of the molecule that acts to cleave the target RNA. Therefore, the enzymatic nucleic acid first recognizes the target RNA through complementary base pairing, then binds to the target RNA, and when bound to the correct site acts enzymatically to cleave the target RNA. Such strategic cleavage of the target RNA will destroy the ability of the target RNA to direct the synthesis of the encoded protein. After binding and cleaving its RNA target, the enzymatic nucleic acid can be released from the RNA to search for another target and repeatedly bind and cleave the new target.

[0161] The enzymatic nucleic acid molecule may be formed into, for example, a hammerhead, hairpin, hepatitis delta virus, group I intron, or RNaseP RNA (which binds to an RNA guide sequence), or Neurospora VS RNA motifs. A specific example of a hammerhead motif is described by Rossi et al. Nucleic Acids Res. 1992 Sep 11; 20 (17):4559-65. Examples of hairpin motifs are Hampel et al. (European Patent Application No. 0360257), Hampel and Tritz, Biochemistry 1989 Jun 13;28(12):4929-33; Hampel et al., Nucleic Acids Res. 1990 Jan 25;18 (2):299-304; and US Pat. No. 5,631,359). Examples of hepatitis virus motifs are described in Perrotta and Been, Biochemistry. 1992 Dec 1;31(47):11843-52; examples of RNaseP motifs are described in Guerrier-Takada et al., Cell. 1983 Dec;35 (3 Pt 2):849-57; Neurospora VS RNA ribozyme motifs are described by Collins (Saville and Collins, Cell. 1990 May 18;61(4):685-96;Saville and Collins, Proc Natl. Acad Sci U S A. 1991 Oct 1;88(19):8826-30;Collins and Olive, Biochemistry. 1993 Mar 23;32(11):2795-9); and examples of group I introns are , U.S. Pat. No. 4,987,071. An important feature of the enzymatic nucleic acid molecules used in accordance with the present invention is that the enzymatic nucleic acid molecules have specific substrate binding sites that are complementary to one or more target gene DNA or RNA regions, giving the molecules RNA cleaving activity. in or around its substrate binding site. Therefore, ribozyme constructs need not be limited to the particular motifs mentioned herein.

[0162] Methods of generating ribozymes targeted to any polynucleotide sequence are known in the art. Ribozymes can be designed and tested in vitro and in vivo as described in WO 93 / 23569 and WO 94 / 02595, each of which is specifically incorporated herein by reference. can be synthesized as described therein.

[0163] Ribozyme activity can be controlled by altering the length of the ribozyme-binding arm or by chemically synthesizing ribozymes with modifications that prevent their degradation by serum ribonucleases (WO 92 / 07065; WO 93 WO 91 / 03162; EP 92110298.4; US Pat. A variety of chemical modifications are described that can be optimized), by modifications that enhance their potency in cells, and by removing stem II bases to shorten RNA synthesis time and reduce chemical requirements. can do.

[0164] Immunostimulatory oligonucleotide The nucleic acids attached to the lipid particles of the invention may be immunostimulatory, including immunostimulatory oligonucleotides (ISS; single stranded oligonucleotides) capable of inducing an immune response when administered to a subject. or double-stranded), and the subject may be a mammal or other patient. The ISS may include, for example, palindromes associated with hairpin secondary structures (see Yamamoto S., et al. (1992) J. Immunol. 148: 4072-4076), or CpG motifs, as well as other known ISS features ( (see WO 96 / 11266).

[0165] The immune response may be an innate immune response or an adaptive immune response. The immune system is divided into the more innate immune system and the acquired adaptive immune system of vertebrates, the latter of which is further divided into humoral and cellular components. In certain embodiments, the immune response may be mucosal.

[0166] In certain embodiments, the immunostimulatory nucleic acid is immunostimulatory only when administered in combination with a lipid particle, and not when administered in its free form. According to the invention, such oligonucleotides are considered to be immunostimulatory.

[0167] An immunostimulatory nucleic acid is considered non-sequence specific if it is not required to specifically bind to and reduce expression of a target polynucleotide in order to elicit an immune response. Thus, although certain immunostimulatory nucleic acids may contain sequences that correspond to regions of a native gene or mRNA, they are still considered to be non-sequence-specific immunostimulatory nucleic acids.

[0168] In one embodiment, the immunostimulatory nucleic acid or oligonucleotide comprises at least one CpG dinucleotide. The oligonucleotide or CpG dinucleotide may be unmethylated or methylated. In another embodiment, the immunostimulatory nucleic acid comprises at least one CpG dinucleotide with a methylated cytosine. In one embodiment, the nucleic acid comprises a single CpG dinucleotide, and the cytosine of said CpG dinucleotide is methylated. In certain embodiments, the nucleic acid comprises the sequence 5'TAACGTTGAGGGGCAT3'. In an alternative embodiment, the nucleic acid comprises at least two CpG dinucleotides, and at least one cytosine of said CpG dinucleotide is methylated. In further embodiments, each cytosine of the CpG dinucleotide in the sequence is methylated. In another embodiment, the nucleic acid comprises a plurality of CpG dinucleotides, and at least one of said CpG dinucleotides comprises a methylated cytosine.

[0169] In one particular embodiment, the nucleic acid comprises the sequence 5'TTCCATGACGTTCCTGACGT3'. In another specific embodiment, the nucleic acid sequence comprises the sequence 5'TCCATGA C GTTCCTGA C The two underlined cytosines containing GT3' are methylated. In certain embodiments, the ODNs are ODN#1, ODN#2, ODN#3, ODN#4, ODN#5, ODN#6, ODN#7, ODN#8, and ODN# as shown below. selected from the group consisting of 9. [Table 2A] [Table 2B]

[0170] Additional specific nucleic acid sequences of oligonucleotides (ODNs) suitable for use in the compositions and methods of the invention are described in Raney et al., Journal of Pharmacology and Experimental Therapeutics, 298:1185-1192 (2001). ing. In certain embodiments, the ODN used in the compositions and methods of the invention has a phosphodiester (“PO”) backbone or a phosphorothioate (“PS”) backbone, and / or at least one ODN in a CpG motif. It has two methylated cytosine residues.

[0171] decoy oligonucleotide Because transcription factors recognize relatively short binding sequences even in the absence of surrounding genomic DNA, short oligonucleotides carrying a consensus binding sequence for a particular transcription factor can be used to manipulate gene expression in living cells. It can be used as a tool for This strategy involves delivering such "decoy oligonucleotides" into cells, where they are then recognized and bound by targeting factors. The decoy occupies the DNA binding site of the transcription factor, which subsequently prevents the transcription factor from binding to the promoter region of the target gene. Decoys can be used as therapeutic agents either to inhibit the expression of genes activated by transcription factors or to upregulate genes that are repressed by binding of transcription factors. Examples of the use of decoy oligonucleotides can be found in Mann et al., J. Clin. Invest., 2000, 106: 1071-1075, which is expressly incorporated herein by reference in its entirety.

[0172] super mir Supermir refers to single-stranded, double-stranded, or partially double-stranded oligomers or polymers of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or both or modifications thereof, which are substantially similar to miRNA. have a nucleotide sequence that is identical and antisense with respect to its target. The term includes oligonucleotides that contain at least one non-natural moiety that functions similarly, consisting of natural nucleobases, sugars, and covalent internucleoside (backbone) linkages. Such modified or substituted oligonucleotides are preferred over natural forms because of desirable properties such as, for example, enhanced cellular uptake, increased affinity for nucleic acid targets, and increased stability in the presence of nucleases. In a preferred embodiment, the super-mir does not contain sense DNA, and in another preferred embodiment, the super-mir does not self-hybridize significantly. The supermirs characterized in this invention may have secondary structure, but are substantially single-stranded under physiological conditions. A supermir that is substantially single-stranded is one in which less than about 50% (e.g., less than about 40%, 30%, 20%, 10%, or 5%) of the supermir forms duplexes with itself. It is single stranded to the extent that it does. The supermir may contain a hairpin segment, e.g. the sequence may self-hybridize preferably at the 3' end to form a double-stranded region, e.g. the double-stranded region may contain at least one , 2, 3, or 4 nucleotides, preferably less than 8, 7, 6, or n nucleotides, such as 5 nucleotides. The double-stranded regions may be joined by a linker, eg a nucleotide linker, eg 3, 4, 5 or 6 dTs, eg modified dTs. In another embodiment, the supermir is a supermir with a shorter oligo, e.g., 5, 6, 7, 8, 9, or 10 nucleotides in length, e.g. A double strand is formed at the non-terminal or middle part of mir.

[0173] miRNA mimic miRNA mimetics represent a class of molecules that can be used to mimic the gene silencing ability of one or more miRNAs. Therefore, the term "microRNA mimetics" refers to synthetic non-coding RNAs that are able to enter the RNAi pathway and control gene expression (i.e., miRNAs are derived from sources of endogenous miRNAs). cannot be obtained by purification). miRNA mimetics can be designed as mature molecules (eg, single-stranded) or mimetic precursors (eg, pri- or Pre-miRNA). miRNA mimetics include, but are not limited to, RNA, modified RNA, DNA, modified DNA, locked nucleic acids, or 2'-O,4'-C ethylene bridged nucleic acids (ENA), or any combination of the above (DNA-RNA may be composed of nucleic acids (modified or modified nucleic acids) containing oligonucleotides (including hybrids). Additionally, miRNA mimetics can include conjugates that can affect delivery, subcellular compartmentalization, stability, specificity, functionality, chain usage, and / or efficacy. In one design, the miRNA mimetic is a double-stranded molecule (e.g., having a double-stranded region from about 16 to about 31 nucleotides in length) that shares identity with the mature strand of a given miRNA. Contains one or more sequences with Modifications include 2' modifications (including 2'-O methyl and 2'F modifications) on one or both strands of the molecule, as well as internucleotide modifications that enhance nucleic acid stability and / or specificity (e.g., phorphor). thioate (phorphorthioate modification) may also be included. Additionally, miRNA mimetics may contain overhangs. The overhang may consist of 1 to 6 nucleotides at the 3' or 5' end of either strand and may be modified to enhance stability or functionality. In one embodiment, the miRNA mimetic comprises a double-stranded region of 16-31 nucleotides and one or more of the following chemical modification patterns: sense DNA at positions 1 and 2 (of the sense oligonucleotide); nucleotides (counting from the 5' end) and 2'-O-methyl modifications of all C's and U's; antisense strand modifications include 2'F modifications of all C's and U's, the 5' end of the oligonucleotide; and a stabilizing internucleotide bond attached to the 3' overhang of the second nucleotide.

[0174] anti-mir or miRNA inhibitor The terms "anti-mir", "microRNA inhibitor", "miR inhibitor", or "inhibitor" are synonymous and refer to oligonucleotides or modified oligonucleotides that interfere with the ability of specific miRNAs. In general, the inhibitor is essentially a nucleic acid or modified nucleic acid, including an oligonucleotide comprising RNA, modified RNA, DNA, modified DNA, locked nucleic acid (LNA), or a combination of any of the above. Modifications include 2' modifications (including 2'-0 alkyl modifications and 2'F modifications) and internucleotide modifications that may affect delivery, stability, specificity, subcellular compartmentalization, or efficacy (e.g. phosphorothioate modification). Additionally, miRNA inhibitors can include conjugates that can affect delivery, subcellular compartmentalization, stability, and / or efficacy. Inhibitors can take a variety of configurations, including single-stranded, double-stranded (RNA / RNA or RNA / DNA duplex), and hairpin structures, and generally, microRNA inhibitors In addition, the miRNA inhibitor comprises one or more sequences or portions of sequences that are complementary or partially complementary to the mature strand (or strands) of the miRNA that is said to be the reverse complement of the mature miRNA. Additional sequences located 5' and 3' to the sequence may also be included. The additional sequence may be the reverse complement of the sequence flanking the mature miRNA in the pri-miRNA from which the mature miRNA is derived, or the additional sequence may be any sequence (A, G, C, or U ). In some embodiments, one or both of the additional sequences is any sequence capable of forming a hairpin. Thus, in some embodiments, sequences that are the reverse complements of miRNAs are flanked on the 5' and 3' sides by hairpin structures. If the microRNA inhibitor is double-stranded, the opposite strand may contain a mismatch between nucleotides. Additionally, microRNA inhibitors may be conjugated to binding moieties to facilitate inhibitor uptake into cells. For example, microRNA inhibitors may be conjugated to cholesteryl 5-(bis(4-methoxyphenyl)(phenyl)methoxy)-3 hydroxypentyl carbamate, which allows passive uptake of microRNA inhibitors into cells. good. MicroRNA inhibitors, including hairpin miRNA inhibitors, are described in Vermeulen et al., “Double-Stranded Regions Are Essential Design Components Of Potent Inhibitors of RISC Function,” RNA 13: 723-730 (2007), and International Publication No. 2007 / 095387 and WO 2008 / 036825, each of which is incorporated herein by reference in its entirety. One skilled in the art can select desired miRNA sequences from databases and design inhibitors useful in the methods disclosed herein.

[0175] U1 adapter The U1 adapter is a bifunctional oligonucleotide that has a targeting domain that inhibits the polyA site and is complementary to a site in the terminal exon of the target gene, and a “U1 domain” that binds to the U1 small nuclear RNA component of the U1 snRNP. (Goraczniak, et al., 2008, Nature Biotechnology, 27(3), 257-263, which is expressly incorporated herein by reference in its entirety). U1 snRNP is a ribonucleoprotein complex that primarily functions to direct the early steps of spliceosome formation by binding to pre-mRNA exon-intron boundaries (Brown and Simpson, 1998, Annu Rev Plant Physiol Plant MoI Biol 49:77-95). Nucleotides 2 to 11 at the 5' end of the U1 snRNA base pair bind to the 5'ss of pre mRNA. In one embodiment, the oligonucleotide of the invention is a U1 adapter. In one embodiment, the U1 adapter can be administered in combination with at least one other iRNA agent.

[0176] Oligonucleotide modification Unmodified oligonucleotides may not be optimal for some applications; for example, unmodified oligonucleotides may be susceptible to degradation by, for example, cellular nucleases. Nucleases can hydrolyze nucleic acid phosphodiester bonds. However, chemical modification of oligonucleotides can confer improved properties, e.g., can make oligonucleotides more stable towards nucleases.

[0177] Because oligonucleotides are polymers of subunits or monomers, many of the modifications described below, such as modifications of bases, sugars, phosphate moieties, or non-bridging oxygens of phosphate moieties, occur at repeated positions within oligonucleotides. occurs in It is not necessary that all positions of a given oligonucleotide be uniformly modified; in fact, multiple modifications as described above can be incorporated into a single oligonucleotide or into a single nucleoside within an oligonucleotide. I can even do that.

[0178] In some cases, the modification will occur at all of the positions of interest of the oligonucleotide, but in many cases, in fact in most cases, the modification will not occur at all of the positions of interest. By way of example, modifications may occur only at the 3' or 5' terminal positions, only at internal regions, only at the terminal regions, e.g. at the terminal nucleotide positions or at the last few, It may occur with only 4, 5, or 10 nucleotides. Modifications may occur in double-stranded regions, single-stranded regions, or both. Modifications may occur only in the double-stranded region of a double-stranded oligonucleotide, or only in the single-stranded region of a double-stranded oligonucleotide. For example, phosphorothioate modifications at non-bridging oxygen positions may occur only at one or both ends, or only at terminal regions, e.g. at the terminal nucleotide positions or at the last 2, 3, 4, 5, or may occur with only 10 nucleotides, or may occur in double-stranded and single-stranded regions, especially at the ends. The 5' end(s) can be phosphorylated.

[0179] A modification described herein may be the only modification or only type of modification included in a plurality of nucleotides, or the modification may be one or more of the modifications described herein. Can be combined with other modifications. The modifications described herein can also be combined in an oligonucleotide, eg, different nucleotides of an oligonucleotide have different modifications described herein.

[0180] In some embodiments, for example, enhancing stability, including specific nucleobases in the overhang, or modifying nucleotides or nucleotide substitutes in single-stranded overhangs, such as 5' overhangs or 3' overhangs or both. It is particularly preferred to include. For example, it may be desirable to include purine nucleotides in the overhang. In some embodiments, all or some of the 3' or 5' overhanging bases will be modified with the modifications described herein. Modifications include, for example, the use of modifications at the 2'OH group of the ribose sugar, such as the use of deoxyribonucleotides, such as deoxythymidine, in place of ribonucleotides, and the use of modifications at the phosphate group, such as the use of phosphothioate modifications. . Overhangs need not be homologous to the target sequence.

[0181] Certain modifications are discussed in more detail below.

[0182] phosphate group Phosphate groups are negatively charged species. The charge is equally distributed between the two non-bridging oxygen atoms. However, the phosphate group can be modified by replacing one of the oxygens with a different substituent. One consequence of this modification to the RNA phosphate backbone may be increased resistance of the oligoribonucleotide to nucleic acid degradation. Therefore, while not wishing to be bound by theory, in some embodiments it may be desirable to introduce changes that result in either uncharged linkers or charged linkers with asymmetric charge distribution.

[0183] Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. In certain embodiments, one of the non-bridging phosphate oxygen atoms of the phosphate backbone moiety can be replaced with any of the following: S, Se, BR. 3 (R is hydrogen, alkyl, aryl), C (i.e., alkyl, aryl, etc.), H, NR 2 (R is hydrogen, alkyl, aryl), or OR (R is alkyl or aryl). The phosphorous atom of the unmodified phosphate group is achiral. However, replacing one of the non-bridging oxygens with one of the above atoms or groups of atoms imparts chirality to the phosphorous atom, in other words, the phosphorous acid of the phosphate group thus modified Atoms are asymmetric centers. An asymmetric phosphorous acid atom can have either an "R" configuration (herein, Rp) or an "S" configuration (herein, Sp).

[0184] Phosphorodithioates have both non-bridging oxygens replaced with sulfur. The phosphorus center of the phosphorodithioate, which eliminates the formation of oligoribonucleotide diastereomers, is achiral. Therefore, without wishing to be bound by theory, modifications of both non-bridging oxygens that eliminate chiral centers, such as the formation of phosphorodithioates, are desirable in that they cannot generate diastereomeric mixtures. There are cases. Thus, a non-bridging oxygen may be independently any one of S, Se, B, C, H, N, or OR (R is alkyl or aryl).

[0185] Phosphate linkers are modified by replacing the bridging oxygen (i.e., the oxygen that attaches the phosphate to the nucleoside) with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylene phosphonate). You can also. Substitution may occur at either or both bound oxygens. When the bridging oxygen is the 3'-oxygen of a nucleoside, substitution with carbon is preferred. When the bridging oxygen is the 5'-oxygen of a nucleoside, substitution with nitrogen is preferred.

[0186] Phosphate group substitution The phosphate group can be substituted with a non-phosphorus-containing linking moiety. Without wishing to be bound by theory, since the charged phosphodiester group is the reaction center for nucleic acid degradation, replacement with a neutral structural mimic should confer enhanced nuclease stability. it is conceivable that. Additionally, while not wishing to be bound by theory, in some embodiments it may be desirable to introduce changes in which a charged phosphate group is replaced with a neutral moiety.

[0187] Examples of moieties that can substitute the phosphate group include: methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioform. Acetals, formacetals, oximes, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino. Preferred substitutions include methylenecarbonylamino and methylenemethylimino groups.

[0188] Modified phosphate linkages in which at least one of the oxygens attached to the phosphate is substituted, or in which the phosphate group is replaced by a non-phosphorous group, are also referred to as "non-phosphodiester backbone linkages."

[0189] Substitution of ribophosphate backbone Oligonucleotide mimetic scaffolds can also be constructed in which the phosphate linker and ribose sugar are replaced with nuclease-resistant nucleosides or nucleotide substitutes. While not wishing to be bound by theory, it is believed that the absence of a repeatingly charged backbone reduces binding of proteins (eg, nucleases) that recognize polyanions. Additionally, while not wishing to be bound by theory, in some embodiments it may be desirable to introduce changes in which the base is replaced by a neutral surrogate backbone. Examples include mophilino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside substitutes. A preferred substitute is a PNA substitute.

[0190] sugar modification Modified RNA can include modifications of all or some of the sugar groups of the ribonucleic acid. For example, the 2' hydroxyl group (OH) may be modified or substituted with a number of different "oxy" or "deoxy" substituents. Without being bound by theory, the enhanced stability is predicted because the hydroxyl is no longer able to deprotonate to form the 2'-alkoxide ion. 2'-alkoxides may catalyze decomposition by intramolecular nucleophilic attack on the linker phosphorus atom. Additionally, while not wishing to be bound by theory, in some embodiments it may be desirable to introduce changes that do not allow alkoxide formation at the 2' position.

[0191] Examples of "oxy"-2' hydroxyl group modifications include: alkoxy or aryloxy (OR, e.g., R=H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); Polyethylene glycol (PEG), (O(CH 2 CH 2 O) n CH 2 CH 2 OR); “locked” nucleic acids (LNA) in which the 2’ hydroxyl is attached to the 4’ carbon of the same ribose sugar, e.g. by a methylene bridge; O-amine (amine = NH 2 ;alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino), and aminoalkoxy, (O(CH 2 ) n AMINE, (e.g. amine=NH 2 ;alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino). Methoxyethyl group (MOE), (OCH 2 CH 2 OCH 3 It is noteworthy that oligonucleotides containing only 100% PEG derivatives exhibit comparable nuclease stability to those modified with robust phosphorothioate modifications.

[0192] "Deoxy" modifications include: hydrogen (i.e., the deoxyribose sugar, which is particularly associated with the overhanging portion of ds RNA); halo (e.g., fluoro); amino (e.g., NH 2 ;alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid);NH(CH 2 CH 2 N.H.) n CH 2 CH 2 -Amine (Amine=NH 2 ;alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino), -NHC(O)R(R=alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar ), cyano; mercapto; alkylthioalkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, which may be optionally substituted, for example with an amino functionality. Preferred substituents are 2'-methoxyethyl, 2'-OCH3, 2'-O-allyl, 2'-C-allyl, and 2'-fluoro.

[0193] A sugar group can also contain one or more carbons having a stereochemistry opposite to that of the corresponding carbon of ribose. Thus, oligonucleotides may include nucleotides containing, for example, arabinose as a sugar. The monomer may have an alpha linkage at the 1' position of the sugar, such as an alpha-nucleoside. Oligonucleotides can also include "abasic" sugars lacking a C-1' nucleobase. These abasic sugars can also further contain modifications on one or more of the constituent sugar atoms. The oligonucleotide can also contain one or more sugars that are in the L form, eg, an L-nucleoside.

[0194] terminal modification The 3' and 5' ends of the oligonucleotide may be modified. Such modifications may be at the 3' end, 5' end, or both ends of the molecule. They may contain modifications or substitutions of the entire terminal phosphate or of one or more atoms of the phosphate group. For example, the 3' and 5' ends of the oligonucleotide can be labeled with a labeling moiety, such as a fluorophore (e.g., pyrene, TAMRA, fluorescein, Cy3, or Cy5 dye), or a protecting group (e.g., sulfur, silicon, boron, or ester). may be attached to other functional molecular entities such as (based on). The functional molecular entity may be attached to the sugar via a phosphate group and / or a linker. The terminal atom of the linker may be attached to or substituted for a bonding atom of a phosphate group or a C-3' or C-5', O, N, S, or C group of a sugar. Alternatively, a linker may connect to or replace a terminal atom of a nucleotide surrogate (eg, PNA).

[0195] Linker / Phosphate Functional Molecular Entity - When a linker / phosphate sequence is inserted between the two strands of dsRNA, this sequence can replace the hairpin RNA loop of a hairpin RNA agent.

[0196] Terminal modifications useful for regulatory activity include modification of the 5' end with phosphate or phosphate analogs. For example, in preferred embodiments, the antisense strand of the dsRNA is 5' phosphorylated or contains a phosphoryl analog at the 5' prime end. 5'-phosphate modifications include those that are compatible with RISC-mediated gene silencing. Suitable modifications include: 5'-monophosphate ((HO)2(O)P-O-5'); 5'-diphosphate ((HO)2(O)P-O-P(HO)( O)-O-5');5'-triphosphate((HO)2(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5');5'-guanosine cap( 7-Methylated or unmethylated)(7m-G-O-5'-(HO)(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5';5'-adenosine cap( Appp), and any modified or unmodified nucleotide cap structure (N-O-5'-(HO)(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5');5'- Monothiophosphate (phosphorothioate; (HO)2(S)P-O-5');5'-monodithiophosphate (phosphorodithioate; (HO)(HS)(S)P-O-5'), 5 '-phosphorothiolate ((HO)2(O)P-S-5'); oxygen / sulfur substituted monophosphates, diphosphates, and triphosphates (e.g., 5'-alpha-thiotriphosphate, 5'-gamma-thiotriphosphate, etc.), 5'-phosphoramidate ((HO)2(O)P-NH-5', (HO)(NH2)(O)P-O-5'), 5' -alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g. RP(OH)(O)-O-5'-), (OH)2(O)P-5'-CH2-), Any further combination of 5'-alkyl ether phosphonates (R=alkyl ether=methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g. RP(OH)(O)-O-5'-).

[0197] Terminal modifications may also be useful for monitoring distribution; in such cases, preferred groups added include fluorophores (e.g. fluorscein), Alexa dyes, e.g. Alexa488. Terminal modifications may also be useful for enhancing uptake; useful modifications for this include cholesterol. Terminal modifications may also be useful for cross-linking the RNA agent to another moiety. Modifications useful for this purpose include mitomycin C.

[0198] nucleobase Adenine, guanine, cytosine, and uracil are the most common bases found in RNA. These bases can be modified or substituted to provide RNA with improved properties. For example, nuclease-resistant oligoribonucleotides include these bases, or synthetic and natural nucleobases (e.g., inosine, thymine, xanthine, hypoxanthine, nubularine, isoguanisine, or tubercidine), as well as those mentioned above. can be prepared using any one of the following modifications: Alternatively, use substituted or modified analogs of any of the above bases, such as the "unusual bases", "modified bases", "unnatural bases", and "universal bases" described herein. Can be done. Examples include, but are not limited to: 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil. and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine, and thymine, 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-aminoallyluracil, 8-halo, amino, thiol, thioalkyl, hydroxyl, and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine, 5-substituted pyrimidines, 6-aza Pyrimidine, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine, dihydrouracil, 3-deaza-5-azacytosine, 2-amino Purine, 5-alkyluracil, 7-alkylguanine, 5-alkylcytosine, 7-deazaadenine, N6, N6-dimethyladenine, 2,6-diaminopurine, 5-aminoallyluracil, N3-methyluracil, substituted 1,2 ,4-triazole, 2-pyridinone, 5-nitroindole, 3-nitropyrrole, 5-methoxyuracil, uracil-5-oxyacetic acid, 5-methoxycarbonylmethyluracil, 5-methyl-2-thiouracil, 5-methoxycarbonyl Methyl-2-thiouracil, 5-methylaminomethyl-2-thiouracil, 3-(3-amino-3carboxypropyl)uracil, 3-methylcytosine, 5-methylcytosine, N 4 -acetylcytosine, 2-thiocytosine, N6-methyladenine, N6-isopentyladenine, 2-methylthio-N6-isopentenyladenine, N-methylguanine, or O-alkylated base. Additional purines and pyrimidines include those disclosed in U.S. Pat. No. 3,687,808, the Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990. and those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613.

[0199] cationic group Modifications to the oligonucleotide may include attaching one or more cationic groups to the sugar, base, and / or phosphorus atoms of the phosphate or modified phosphate backbone moiety. The cationic group can be attached to any substitutable atom of the natural base, unusual base, or universal base. Preferred positions are those that do not interfere with hybridization, ie, do not interfere with the hydrogen bonding interactions required for base pairing. The cationic group can be attached, for example, through the C2' position of the sugar or a similar position on a cyclic or acyclic sugar substitute. Cationic groups may include the following: for example, O-amine (amine=NH 2 ; e.g. protonated amino groups derived from (alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino); aminoalkoxy, e.g. O(CH 2 ) n amine) (e.g. amine=NH 2 ;alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino);amino (e.g., NH 2 ;alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); or NH(CH 2 CH 2 N.H.) n CH 2 CH 2 -Amine (Amine=NH 2 ;alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino).

[0200] Placement within the oligonucleotide Some modifications may be included in the oligonucleotide, preferably at specific positions, such as internal positions of the strand or at the 5' or 3' end of the oligonucleotide. Modification of oligonucleotides at preferred positions can confer favorable properties on the agent. For example, specific modifications at preferred positions can confer optimal gene silencing properties or increased resistance to endonuclease or exonuclease activity.

[0201] One or more nucleotides of the oligonucleotide may have a 2'-5' linkage. One or more nucleotides of the oligonucleotide may have reverse linkages, such as 3'-3', 5'-5', 2'-2', or 2'-3' linkages.

[0202] The double-stranded oligonucleotide comprises at least one 5'-uridine-adenine-3' (5'-UA-3') dinucleotide in which uridine is a 2'-modified nucleotide, or 5'-uridine is a 2'-modified nucleotide; The terminal 5'-uridine-guanine-3' (5'-UG-3') dinucleotide is a modified nucleotide, or the terminal 5'-cytidine-adenine-3' ( 5'-CA-3') dinucleotide, or terminal 5'-uridine-uridine-3' (5'-UU-3') dinucleotide, where 5'-uridine is a 2'-modified nucleotide, or 5'- Terminal 5'-cytidine-cytidine-3' (5'-CC-3') dinucleotide, where cytidine is a 2'-modified nucleotide, or terminal 5'-cytidine-, where 5'-cytidine is a 2'-modified nucleotide. Uridine-3' (5'-CU-3') dinucleotide, or terminal 5'-uridine-cytidine-3' (5'-UC-3') dinucleotide where 5'-uridine is a 2'-modified nucleotide including. Double-stranded oligonucleotides containing these modifications are particularly stabilized against endonuclease activity.

[0203] general literature The oligoribonucleotides and oligoribonucleosides used according to the invention can be synthesized by solid phase synthesis. For example, “Oligonucleotide synthesis, a practical approach”, Ed. M. J. Gait, IRL Press, 1984; “Oligonucleotides and Analogues, A Practical Approach”, Ed. F. Eckstein, IRL Press, 1991 (especially Chapter 1, Modern machine- aided methods of oligodeoxyribonucleotide synthesis, Chapter 2, Oligoribonucleotide synthesis, Chapter 3, 2'-O--Methyloligoribonucleotide- s: synthesis and applications, Chapter 4, Phosphorothioate oligonucleotides, Chapter 5, Synthesis of oligonucleotide phosphorodithioates, Chapter 6, Synthesis of oligo- 2'-deoxyribonucleoside methylphosphonates, and Chapter 7, Oligodeoxynucleotides containing modified bases). Other particularly useful synthetic procedures, reagents, protecting groups, and reaction conditions are described in Martin, P., Helv. Chim. Acta, 1995, 78, 486-504;Beaucage, S. L. and Iyer, R. P., Tetrahedron, 1992, 48, 2223-2311, and Beaucage, S. L. and Iyer, R. P., Tetrahedron, 1993, 49, 6123-6194, or documents cited therein. Modifications described in WO 00 / 44895, WO 01 / 75164, or WO 02 / 44321 can be used herein. The disclosures of all publications, patents, and published patent applications listed herein are incorporated by reference.

[0204] Phosphate group literature Preparation of phosphinate oligoribonucleotides is described in US Pat. No. 5,508,270. Preparation of alkylphosphonate oligoribonucleotides is described in US Pat. No. 4,469,863. Preparation of phosphoramidite oligoribonucleotides is described in US Pat. No. 5,256,775 or US Pat. No. 5,366,878. Preparation of phosphotriester oligoribonucleotides is described in US Pat. No. 5,023,243. The preparation of boranophosphate oligoribonucleotides is described in US Pat. No. 5,130,302 and US Pat. No. 5,177,198. The preparation of 3'-deoxy-3'-aminophosphoramidate oligoribonucleotides is described in US Pat. No. 5,476,925. 3'-Deoxy-3'-methylenephosphonate oligoribonucleotides are described in An, H, et al. J. Org. Chem. 2001, 66, 2789-2801. The preparation of sulfur-bridged nucleotides is described in Sproat et al. Nucleosides Nucleotides 1988, 7,651 and Crossstick et al. Tetrahedron Lett. 1989, 30, 4693.

[0205] Sugar group literature Alterations to the 2' modification can be found in Verma, S. et al. Annu. Rev. Biochem. 1998, 67, 99-134 and all references therein. Specific modifications to ribose can be found in the following publications: 2'-fluoro (Kawasaki et. al., J. Med. Chem., 1993, 36, 831-841), 2'-MOE (Martin, P. Helv. Chim. Acta 1996, 79, 1930-1938), "LNA" (Wengel, J. Acc. Chem. Res. 1999, 32, 301-310).

[0206] Literature on phosphate group substitution methylene methylimino-linked oligoribonucleosides, also identified herein as MMI-linked oligoribonucleosides; methylene dimethyl hydrazo-linked oligoribonucleosides, also identified herein as MDH-linked oligoribonucleosides; methylenecarbonylamino-linked oligoribonucleosides, also identified herein as amide-3-linked oligoribonucleosides, and also identified herein as amide-4-linked oligoribonucleosides, as well as e.g. Mixed skeleton compounds with alternating bonds of MMI and PO or PS are described in US Pat. No. 5,378,825, US Pat. No. 5,386,023, US Pat. 04305 (published as WO 92 / 20822 and WO 92 / 20823, respectively). Formacetal and thioformacetal linked oligoribonucleosides can be prepared as described in US Pat. No. 5,264,562 and US Pat. No. 5,264,564. Ethylene oxide-linked oligoribonucleosides can be prepared as described in US Pat. No. 5,223,618. Siloxane substitution is described in Cormier, J.F. et al. Nucleic Acids Res. 1988, 16, 4583. Carbonate substitution is described in Tittensor, J.R. J. Chem. Soc. C 1971, 1933. Carboxymethyl substitutions are described in Edge, M.D. et al. J. Chem. Soc. Perkin Trans. 1 1972, 1991. Carbamate substitutions are described in Stirchak, E.P. Nucleic Acids Res. 1989, 17, 6129.

[0207] Literature on phosphate-ribose backbone substitutions Cyclobutyl sugar substitute compounds can be prepared as described in US Pat. No. 5,359,044. Pyrrolidine sugar substitutes can be prepared as described in US Pat. No. 5,519,134. Morpholino sugar substitutes can be prepared as described in US Pat. Nos. 5,142,047 and 5,235,033, and other related patent disclosures. Peptide Nucleic Acids (PNA) can be prepared by any of the various procedures known per se and cited in Peptide Nucleic Acids (PNA): Synthesis, Properties and Potential Applications, Bioorganic & Medicinal Chemistry, 1996, 4, 5-23. It can be prepared according to the following. They can also be prepared according to US Pat. No. 5,539,083.

[0208] Literature on terminal modification Terminal modifications are described in Manoharan, M. et al. Antisense and Nucleic Acid Drug Development 12, 103-128 (2002) and references therein.

[0209] Nucleobase literature N-2 substitued purine nucleoside amidites can be prepared as described in US Pat. No. 5,459,255. 3-Deazapurine nucleoside amidites can be prepared as described in US Pat. No. 5,457,191. 5,6-substituted pyrimidine nucleoside amidites can be prepared as described in US Pat. No. 5,614,617. 5-propynylpyrimidine nucleoside amidites can be prepared as described in US Pat. No. 5,484,908.

[0210] linker The term "linker" means an organic moiety that connects two parts of a compound. Linkers typically include; direct bonds or atoms such as oxygen or sulfur, NR 1 , C(O), C(O)NH, SO, SO 2 ,S.O. 2 NH, or substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl , aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylararylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, Alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkyl heterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, Alkylheteroaryl, alkenyl Units such as atomic chains such as heteroaryl, alkynylhereroaryl, where one or more methylenes are O, S, S(O), SO 2 , N(R 1 ) 2 , C(O), a cleavable linking moiety, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocyclic, where R 1 is hydrogen, acyl, aliphatic, or substituted aliphatic.

[0211] In one embodiment, the linker is -[(P-Q-R) q -X-(P’-Q’-R’) q’ ] q’’ -T-, where: P, R, T, P', R', and T are each independently absent, CO, NH, O, S, OC(O), NHC(O), CH 2 ,C.H. 2 N.H., C.H. 2 O;NHCH(R a )C(O), -C(O)-CH(R a )-NH-, CH=N-O, [ka] [ka] [ka] [ka] [ka] is a heterocyclyl; Q and Q' are each independently present, absent, -(CH 2 ) n -, -C(R 1 )(R 2 )(CH 2 ) n -,-(CH 2 ) n C(R 1 )(R 2 )-,-(CH 2 CH 2 O) m CH 2 CH 2 -, or-(CH 2 CH 2 O) m CH 2 CH 2 NH-, X is an absent or cleavable linking group; R a is H or an amino acid side chain, R 1 and R 2 are independently H,CH in each existence 3 , OH,SH, or N(R N ) 2 and R N is, independently at each occurrence, H, methyl, ethyl, propyl, isopropyl, butyl, or benzyl; q, q', and q'' are each independently in each occurrence from 0 to 20, and the repeating units may be the same or different; n is independently 1 to 20 in each occurrence, and m is independently 0 to 50 in each entity.

[0212] In one embodiment, the linker includes at least one cleavable linking group.

[0213] In certain embodiments, the linker is a branched linker. The branch point of the branched linker may be at least trivalent, but may also be a tetravalent, pentavalent, or hexavalent atom, or a group exhibiting such multiple valencies. In some embodiments, the branch points are -N, -N(Q)-C, -O-C, -S-C, -SS-C, -C(O)N(Q)-C, -OC(O)N( Q)-C, -N(Q)C(O)-C, or -N(Q)C(O)O-C, where Q at each occurrence is independently H or optionally substituted alkyl It is. In other embodiments, the branch point is glycerol or a glycerol derivative.

[0214] cleavable linking group A cleavable linking group is one that is sufficiently stable outside the cell, but upon entering the target cell, is cleaved to release the two moieties held together by the linker. In a preferred embodiment, the cleavable linking group is in the blood of the subject or under a second reference condition (e.g., can be selected to mimic or represent conditions found in blood or serum), and the target cell. cleaved at least 10 times more rapidly, preferably at least 100 times more rapidly, within or under first reference conditions (which can be chosen to mimic or represent conditions inside the cell, for example). A cleavable linking group is sensitive to the presence of a cleavage agent, such as pH, redox potential, or a degrading molecule. Generally, cleavage agents are more prevalent or found at higher levels or activity inside cells than in serum or blood. Examples of such degradation agents include: redox agents that are selected for a particular substrate or that do not have substrate specificity, such as oxidation or reductase enzymes; or reducing agents such as mercaptans present in cells that can degrade redox-cleavable linking groups by reduction; esterases; endosomes or agents that can create an acidic environment, e.g. resulting in a pH below 5. Enzymes capable of hydrolyzing or degrading acid-cleavable linking groups by acting as general acids, peptidases (which may be substrate specific), and phosphatases.

[0215] Cleavable linking groups such as disulfide bonds may be pH sensitive. The pH of human serum is 7.4, but the average intracellular pH is slightly lower, ranging from about 7.1 to 7.3. Endosomes have a more acidic pH ranging from 5.5 to 6.0, and lysosomes have an even more acidic pH of about 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing the cationic lipid from the ligand into the interior of the cell or into a desired compartment of the cell.

[0216] The linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into the linker may depend on the targeted cell. For example, a liver targeting ligand can be attached to a cationic lipid via a linker containing an ester group. Hepatocytes are rich in esterases, so the linker will be cleaved more efficiently in hepatocytes than in cell types that are not rich in esterases. Other cell types rich in esterases include lung, renal cortex, and testicular cells.

[0217] When targeting peptidase-rich cell types such as hepatocytes and synoviocytes, linkers containing peptide bonds can be used.

[0218] Generally, the suitability of a candidate cleavable linking group can be assessed by testing the ability of a degrading agent (or condition) to cleave the candidate cleavable linking group. It may also be desirable to test candidate cleavable linking groups for their ability to resist cleavage in blood or upon contact with other non-target tissues. Therefore, the relative susceptibility to cleavage between a first condition and a second condition can be determined, where the first is selected to indicate cleavage at the target cell, the second is Selected to indicate cleavage in other tissues or biological fluids, such as blood or serum. Evaluation can be performed in a cell-free system, in cells, in cell culture, in organ or tissue culture, or in the whole animal. It may be useful to perform an initial evaluation in cell-free or culture conditions and confirm by further evaluation in the whole animal. In a preferred embodiment, useful candidate compounds are present in cells (or in vitro conditions selected to mimic intracellular conditions) rather than in blood or serum (or in vitro conditions selected to mimic extracellular conditions). (under certain conditions) at least 2, 4, 10, or 100 times more rapidly.

[0219] Redox-cleavable bonding group One class of cleavable linking groups are redox-cleavable linking groups that are cleaved upon reduction or oxidation. An example of a reductively cleavable linking group is a disulfide linking group (-S-S-). Whether a candidate cleavable linking group is a suitable "reductively cleavable linking group" or suitable for use with a particular iRNA moiety and a particular targeting agent, for example. In order to determine, the method described in this specification can be referred to. For example, candidates can be isolated by incubation with dithiothreitol (DTT) or other reducing agents using reagents known in the art that mimic the cleavage rates that would be observed in cells, e.g., target cells. can be evaluated. Candidates can also be evaluated under conditions selected to mimic blood or serum conditions. In a preferred embodiment, the candidate compound is cleaved by at most 10% in blood. In a preferred embodiment, useful candidate compounds are produced in cells (or under in vitro conditions selected to mimic intracellular conditions) rather than in blood (or under in vitro conditions selected to mimic extracellular conditions). ) at least 2, 4, 10, or 100 times more rapidly. The cleavage rate of the candidate compound is determined using standard enzyme kinetic assays under conditions selected to mimic the intracellular medium and compared to conditions selected to mimic the extracellular medium. be able to.

[0220] Phosphate-based cleavable linking groups Phosphate-based cleavable linking groups are cleaved by agents that decompose or hydrolyze the phosphate group. Examples of agents that cleave cellular phosphate groups are enzymes such as intracellular phosphatases. Examples of phosphate-based linking groups are -O-P(O)(ORk)-O-, -O-P(S)(ORk)-O-, -O-P(S)(SRk)-O-, -S-P(O) (ORk)-O-, -O-P(O)(ORk)-S-, -S-P(O)(ORk)-S-, -O-P(S)(ORk)-S-, -S-P(S)(ORk )-O-, -O-P(O)(Rk)-O-, -O-P(S)(Rk)-O-, -S-P(O)(Rk)-O-, -S-P(S)(Rk)- O-, -S-P(O)(Rk)-S-, -O-P(S)(Rk)-S-. Preferred embodiments are -O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH)- O-, -O-P(O)(OH)-S-, -S-P(O)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O- , -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S-P(O)(H)-O-, -S-P(S)(H)-O-, - S-P(O)(H)-S-, -O-P(S)(H)-S-. A preferred embodiment is -O-P(O)(OH)-O-. These candidates can be evaluated using methods similar to those described above.

[0221] Acid-cleavable bonding group An acid-cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments, the acid-cleavable linking group is in an acidic environment having a pH of about 6.5 or less (e.g., about 6.0, 5.5, or 5.0 or less), or in an acidic environment, such as an enzyme that can act as a general acid. Cleaved by the agent. In cells, certain low pH organelles such as endosomes and lysosomes can provide a cleavage environment for acid-cleavable binding groups. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and esters of amino acids. The acid-cleavable group may have the general formula -C=NN-, C(O)O, or -OC(O). A preferred embodiment is when the carbon bonded to the oxygen of the ester (alkoxy group) is an aryl group, a substituted alkyl group, or a tertiary alkyl group such as dimethylpentyl or t-butyl. These candidates can be evaluated using methods similar to those described above.

[0222] Ester-based linking groups Ester-based cleavable linking groups are cleaved by intracellular enzymes such as esterases and amidases. Examples of ester-based cleavable linking groups include, but are not limited to, alkylene, alkenylene, and esters of alkynylene groups. The cleavable linking group of the ester has the general formula -C(O)O- or -OC(O)-. These candidates can be evaluated using methods similar to those described above.

[0223] Peptide-based cleavage groups Peptide-based cleavable linking groups are cleaved by intracellular enzymes such as peptidases and proteases. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (eg, dipeptides, tripeptides, etc.) and polypeptides. Peptide-based cleavable groups do not include amide groups (-C(O)NH-). An amide group may be formed between any alkylene, alkenylene, or alkynylene. Peptide bonds are a special type of amide bond that is formed between amino acids to yield peptides and proteins. Peptide-based cleavage groups are generally limited to the peptide bonds (ie, amide bonds) formed between amino acids to yield peptides and proteins, and do not include the entire amide functionality. A peptide-based cleavable linking group has the general formula -NHCHR A C(O)NHCHHR B has C(O)-, R A and R B are the R groups of two adjacent amino acids. These candidates can be evaluated using methods similar to those described above.

[0224] ligand A wide variety of entities can be attached to the oligonucleotides and lipids of the invention. Preferred moieties are ligands that are attached directly or indirectly via an intervening tether, preferably covalently.

[0225] In preferred embodiments, the ligand alters the distribution, targeting, or lifetime of the molecule into which it is incorporated. In a preferred embodiment, the ligand targets a selected target, e.g. a molecule, a cell or cell type, a compartment, e.g. a cell or organ compartment, a tissue, an organ, or Provides enhanced affinity for areas of the body. Ligands that provide enhanced affinity for a selected target are also called targeting ligands. Preferred ligands for binding to lipids of the invention are targeting ligands.

[0226] Some ligands may have endosomal properties. Endosomal ligands promote endosomal lysis and / or transport of the composition of the invention or its components from the endosome to the cytoplasm of the cell. The endosomal ligand may be a polyanionic peptide or peptidomimetic that exhibits pH-dependent membrane activity and fusogenic properties. In certain embodiments, the endosomal ligand assumes its active conformation at endosomal pH. An "active" conformation is one in which the endosomal ligand promotes lysis of the endosome and / or transport of the composition of the invention or its components from the endosome into the cytoplasm of the cell. Exemplary endosomal ligands include the GALA peptide (Subbarao et al., Biochemistry, 1987, 26: 2964-2972), the EALA peptide (Vogel et al., J. Am. Chem. Soc., 1996, 118: 1581) -1586), and their derivatives (Turk et al., Biochem. Biophys. Acta, 2002, 1559: 56-68). In certain embodiments, endosomal components may contain chemical groups (eg, amino acids) that undergo changes in charge or protonation in response to changes in pH. The endosomal component may be linear or branched. Exemplary primary sequences of peptide-based endosomal ligands are shown in Table 4. [Table 3]

[0227] Preferred ligands can improve the transport, hybridization, and specificity properties of the resulting natural or modified oligoribonucleotides, or of the monomers and / or natural or modified ribonucleotides described herein. Nuclease resistance of polymer molecules containing any combination can also be improved.

[0228] Ligands generally can include therapeutic modifiers, eg, to enhance uptake; diagnostic compounds or reporter groups, eg, to monitor distribution; cross-linking agents; and nuclease resistance-conferring moieties. Common examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptidomimetics.

[0229] Ligands include natural substances such as proteins (e.g., human serum albumin (HSA), low-density lipoproteins (LDL), high-density lipoproteins (HDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan); , inulin, cyclodextrin, or hyaluronic acid); or lipids. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, eg, a synthetic polyamino acid, an oligonucleotide (eg, an aptamer). Examples of polyamino acids include polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-anhydride. Maleic acid copolymer, (N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethyl acrylic acid), N-isopropylacrylamide copolymer, or Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, peptidomimetic polyamines, peptidomimetic polyamines, dendrimer polyamines, arginine, amidine, protamine, cationic lipids, cations. porphyrins, quaternary salts of polyamines, or alpha-helical peptides.

[0230] The ligand may also include a targeting group, such as a cell or tissue targeting agent, such as a lectin, glycoprotein, lipid, or protein, such as an antibody, that binds to a designated cell type, such as kidney cells. Targeting groups include thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetyl-glucosamine, polyvalent mannose. , polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamates, polyaspartates, lipids, cholesterol, steroids, bile acids, folic acid esters, vitamin B12, biotin, RGD peptides, RGD peptidomimetics or an aptamer. Table 5 provides some examples of targeting ligands and their associated receptors. [Table 4]

[0231] Other examples of ligands include: dyes, intercalators (e.g. acridine), crosslinkers (e.g. psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphirin), polycyclic aromatics. hydrocarbons (e.g. phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl ) Glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine), and peptide conjugates (e.g., Antennapedia peptide, Tat peptide), alkylating agents, phosphates, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG] 2 , polyaminos, alkyl-substituted alkyls, radioisotope-labeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole cluster, acridine-imidazole conjugate, Eu3+ complex of tetraazamacrocycle), dinitrophenyl, HRP, or AP.

[0232] The ligand may be a protein, e.g. a glycoprotein, or a peptide, e.g. a molecule with specific affinity for a co-ligand, or an antibody, e.g. an antibody that binds to a specified cell type, such as a cancer cell, an endothelial cell, or a bone cell. You can. Ligands may also include hormones and hormone receptors. They also include lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetyl-glucosamine, polyvalent mannose, polyvalent fucose, or aptamers. Non-peptide species may also be included. The ligand may be, for example, lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB.

[0233] The ligand can increase the uptake of the iRNA agent into the cell, e.g., by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfibrils, and / or intermediate filaments. It may also be a substance that can be used, such as a drug. The drug may be, for example, taxone, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinfolide A, indanosine, or myoservin.

[0234] For example, a ligand can increase cellular uptake of an iRNA agent by activating an inflammatory response. Exemplary ligands that would have such an effect include tumor necrosis factor alpha (TNFalpha), interleukin-1 beta, or gamma interferon.

[0235] In one embodiment, the ligand is a lipid or lipid-based molecule. Such lipids or lipid-based molecules preferably bind to serum proteins, such as human serum albumin (HSA). The HSA-binding ligand allows the conjugate to be distributed to target tissues, such as non-kidney target tissues within the body. For example, the target tissue may be the liver, including liver parenchymal cells. Other molecules capable of binding HSA can also be used as ligands. For example, neproxin or aspirin can be used. The lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting and transport to a target cell or cell membrane, and / or (c) Can be used to modulate binding to serum proteins such as HSA.

[0236] Lipid-based ligands can be used to modulate, eg, control, the binding of the conjugate to the target tissue. For example, lipids or lipid-based ligands that bind more tightly to HSA are less likely to be targeted to the kidneys and therefore less likely to be cleared from the body. Lipids or lipid-based ligands that bind less tightly to HSA can be used to target the conjugate to the kidney.

[0237] In a preferred embodiment, the lipid-based ligand binds HSA. Preferably, the lipid-based ligand binds HSA with sufficient affinity such that the conjugate is preferably distributed to non-kidney tissues. However, it is preferred that the affinity is not so strong that HSA-ligand binding is irreversible.

[0238] In another preferred embodiment, the lipid-based ligand binds weakly or not at all to HSA, so the conjugate will preferably be distributed to the kidneys. Other moieties that target kidney cells can also be used in place of or in addition to lipid-based ligands.

[0239] In another embodiment, the ligand is a moiety, eg, a vitamin, that is taken up by the target cell, eg, a proliferating cell. They are particularly useful for treating disorders characterized by undesirable cell proliferation of malignant or non-malignant types, such as cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include B vitamins, such as folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients that are taken up by cancer cells. Also included are HAS, low density lipoproteins (LDL), and high density lipoproteins (HDL).

[0240] In another embodiment, the ligand is a cell penetrant, preferably a helical cell penetrant. Preferably the agent is amphipathic. Exemplary agents are peptides such as tat or antennopedia. If the agent is a peptide, modifications can be made including the use of peptidyl mimetics, inverse isomers, non-peptide or pseudopeptide bonds, and D-amino acids. Preferably, the helical agent is an alpha helical agent, preferably having a lipophilic phase and a lipophobic phase.

[0241] The ligand may be a peptide or a peptidomimetic. Peptidomimetics (also referred to herein as oligopeptide mimetics) are molecules that can fold into well-defined three-dimensional structures that resemble natural peptides. The peptide or peptidomimetic moiety may be about 5 to 50 amino acids in length, such as about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length. Good (see, eg, Table 6). [Table 5]

[0242] The peptide or peptidomimetic may be, for example, a cell-penetrating peptide, a cationic peptide, an amphiphilic peptide, or a hydrophobic peptide (eg, composed primarily of Tyr, Trp, or Phe). The peptide moiety may be a dendrimer peptide, a structurally restricted peptide, or a cross-linked peptide. In another option, the peptide moiety may include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF, which has the amino acid sequence AAVALLPAVLLALLAP. RFGF analogs containing a hydrophobic MTS (eg, amino acid sequence AALLPVLLAAP) can also be targeting moieties. The peptide moiety may be a "delivery" peptide capable of transporting large polar molecules, including peptides, oligonucleotides, and proteins, across cell membranes. For example, sequences derived from the HIV Tat protein (GRKKRRQRRRPPQ) and from the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK) have been found to be able to function as delivery peptides. Peptides or peptidomimetics may be encoded by random sequences of DNA, such as peptides identified from phage display libraries or 1-bead-1-compound (OBOC) combinatorial libraries. (Lam et al., Nature, 354:82-84, 1991). Preferably, the peptide or peptidomimetic linked to the iRNA agent by the incorporated monomer unit is a cell-targeting peptide, such as an arginine-glycine-aspartic acid (RGD)-peptide or an RGD mimetic. Peptide moieties can range in length from about 5 amino acids to about 40 amino acids. Peptide moieties may have structural modifications, such as increasing stability or direct conformational properties. Any of the structural modifications described below can be used.

[0243] RGD peptide moieties can be used to target tumor cells, such as endothelial tumor cells or breast cancer tumor cells (Zitzmann et al., Cancer Res., 62:5139-43, 2002). RGD peptides can facilitate targeting of iRNA agents to tumors in a variety of other tissues, including lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787 , 2001). Preferably, the RGD peptide will facilitate targeting of the iRNA agent to the kidney. RGD peptides may be linear or cyclic and may be modified, for example glycosylated or methylated to facilitate targeting to specific tissues. good. For example, the glycosylated RGD peptide is α V β 3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001).

[0244] Peptides that target markers that are abundant in proliferating cells can be used. For example, RGD-containing peptides and peptidomimetics can be used to stimulate cancer cells, especially α v β 3 Cells that display integrins can be targeted. Thus, RGD peptides, cyclic peptides containing RGD, RGD peptides containing D-amino acids, as well as synthetic RGD mimetics can be used. In addition to RGD, α v β 3 Other moieties that target integrin ligands can be used. Generally, such ligands can be used to control cell proliferation and angiogenesis. Preferred conjugates of this type of ligand targeting PECAM-1, VEGF, or other oncogenes, such as oncogenes, are described herein.

[0245] A "cell-penetrating peptide" is capable of penetrating a cell, eg, a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. Microbial cell-penetrating peptides are, for example, α-helical linear peptides (e.g. LL-37 or Ceropin P1), disulfide bond-containing peptides (e.g. α-defensins, β-defensins, or bactenecins). , or a peptide containing only one or two predominant amino acids (eg, PR-39 or indolicidin). Cell-penetrating peptides can also include nuclear localization signals (NLS). For example, the cell-penetrating peptide may be a dichotomous amphipathic peptide, such as MPG, derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen.

[0246] In one embodiment, the targeting peptide attached to the iRNA agent and / or carrier oligomer may be an amphipathic α-helical peptide. Exemplary amphipathic alpha-helical peptides include, but are not limited to: cecropin, lycotoxin, paradaxin, buforin, CPF, bombinin-like peptide (BLP), Cathelicidin, ceratotoxin, S.clava peptide, hagfish intestinal antimicrobial peptide (HFIAP), magainine, brevinin-2, dermaseptin, melittin, pleurocidin, H2A peptide, Xenopus peptide, S. esculentinis-1, and caerin. Preferably, a number of factors will be considered to maintain the integrity of helical stability. For example, the maximum number of helix-stabilizing residues (eg, leu, ala, or lys) will be used and the minimum number of helix-destabilizing residues (eg, proline, or cyclic monomer units) will be used. Capping residues may be considered (e.g., Gly is an exemplary N-capping residue and / or C-terminal amidation to provide additional H-bonds to stabilize the helix). ). Salt bridge formation between residues of opposite charge separated by positions i±3 or i±4 can provide stability. For example, cationic residues such as lysine, arginine, homoarginine, ornithine, or histidine can form salt bridges with anionic residues glutamate or aspartate.

[0247] Peptides and peptidomimetic ligands include naturally occurring or modified peptides such as D or L peptides; α, β, or γ peptides; N-methyl peptides; azapeptides; one or more ureas, thioureas, carbamates, or sulfonyl peptides; Included are peptides having one or more amide bonds, ie, peptide bonds, replaced with urea bonds; or ligands having cyclic peptides.

[0248] A targeting ligand can be any ligand capable of targeting a particular receptor. Examples are folic acid esters, GalNAc, galactose, mannose, mannose-6P, sugar clusters such as GalNAc clusters, mannose clusters, galactose clusters, or apatamers. A cluster is a combination of multiple sugar units. Targeting ligands also include integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL and HDL ligands. Ligands may also be based on nucleic acids, such as aptamers. Aptamers may be unmodified or have any combination of modifications disclosed herein.

[0249] Endosomal release agents include imidazoles, poly or oligoimidazole, PEI, peptides, fusogenic peptides, polycaboxylates, polycations, masked oligos or polycations or anions, acetals, polyacetals, ketals / polyketials. (polyketyals), orthoesters, polymers with masked or unmasked cationic or anionic charges, dendrimers with masked or unmasked cationic or anionic charges.

[0250] PK modulator refers to pharmacokinetic modulator. PK modulators include lipophilic compounds, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEGs, vitamins, etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, and the like. Oligonucleotides containing multiple phosphorothioate linkages are also known to bind to serum proteins, and therefore short oligonucleotides containing multiple phosphorothioate linkages in the backbone, e.g. about 5 bases, 10 bases , 15 bases, or 20 bases oligonucleotides are also applicable to the present invention as ligands (eg, as PK modulating ligands).

[0251] In addition, aptamers that bind serum components (eg, serum proteins) are also applicable to the present invention as PK modulating ligands.

[0252] Other ligands applicable to the present invention are described in the following documents: co-pending U.S. Patent Application No. 10 / 916,185, filed August 10, 2004; filed September 21, 2004 U.S. Patent Application No. 10 / 946,873, filed August 3, 2007; U.S. Patent Application No. 11 / 115,989, filed April 27, 2005; US patent application Ser. No. 11 / 944,227, filed November 21, 2007, which is incorporated by reference in its entirety for all purposes.

[0253] When multiple ligands are present, the ligands may all have the same properties, all have different properties, or some may have different properties while other ligands may have the same properties. For example, a ligand may have targeting properties, may have endosomal activity, or may have PK modulatory properties.

[0254] In a preferred embodiment, the ligands all have different properties. Ligands can be attached to oligonucleotides at various locations, such as at the 3'-terminus, at the 5'-terminus, and / or at internal positions. In preferred embodiments, the ligand is attached to the oligonucleotide via an intervening tether. If a monomer is incorporated into the growing chain, a ligand or tethered ligand may be present on said monomer. In some embodiments, a ligand may be incorporated by being attached to a "precursor" monomer after the "precursor" monomer has been incorporated into the growing chain. For example, a tether with an amino terminus (i.e., no ligand attached), e.g. TAP-(CH 2 ) n N.H. 2 can be incorporated into the growing sense or antisense strand. In subsequent work, i.e. after the precursor monomer has been incorporated into the chain, by coupling the electrophilic group of the ligand with the terminal nucleophilic group of the tether of the precursor monomer, the electrophilic group, e.g. Alternatively, a ligand with an aldehyde group can be attached to the precursor monomer.

[0255] In the case of double-stranded oligonucleotides, the ligand can be attached to one or both strands. In some embodiments, a double-stranded iRNA agent contains a ligand attached to the sense strand. In other embodiments, the double-stranded iRNA agent contains a ligand attached to the antisense strand.

[0256] In some embodiments, a ligand can be attached to a nucleobase, sugar moiety, or internucleoside linkage of a nucleic acid molecule. The bond to the purine nucleobase or derivative thereof may occur at any position including endocyclic and exocyclic atoms. In some embodiments, the 2-, 6-, 7-, or 8-position of the purine nucleobase is attached to the binding moiety. Furthermore, the bond to the pyrimidine nucleobase or its derivative may occur at any position. In some embodiments, the 2-, 5-, and 6-positions of the pyrimidine nucleobase can be replaced with a binding moiety. The attachment of the nucleoside to the sugar moiety may occur at any carbon atom. Examples of carbon atoms of a sugar moiety that can be attached to a linking moiety include 2', 3', and 5' carbon atoms. The 1' position, such as an abasic residue, can also be attached to a binding moiety. Internucleoside linkages can also carry binding moieties. In the case of phosphorus-containing linkages (such as phosphodiesters, phosphorothioates, phosphorodithiotates, and phosphoramidates), the linking moiety can be attached directly to the phosphorus atom or can be bonded to an O, N, or S atom that is bonded to In the case of amine- or amide-containing internucleoside linkages (eg, PNA), the linking moiety can be attached to the nitrogen atom of the amine or amide or to an adjacent carbon atom.

[0257] Numerous methods exist for preparing conjugates of oligomeric compounds. Generally, an oligomeric compound is attached to a binding moiety by contacting a reactive group of the oligomeric compound (eg, OH, SH, amine, carboxyl, aldehyde, etc.) with a reactive group of the binding moiety. In some embodiments, one reactive group is electrophilic and the other is nucleophilic.

[0258] For example, the electrophilic group may be a carbonyl-containing functionality, and the nucleophilic group may be an amine or a thiol. Methods for linking nucleic acids and related oligomeric compounds with and without linking groups are described, for example, by Manoharan in Antisense Research and Applications, Crooke and LeBleu, eds., CRC Press, Boca Raton, Fla., 1993, Chapter 17, which is incorporated herein by reference in its entirety.

[0259] Representative U.S. patents teaching the preparation of oligonucleotide conjugates include, but are not limited to: U.S. Pat. No. 4,828,979; U.S. Pat. No. 4,948,882; U.S. Pat. 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138 ,045; Same No. 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,78 No. 9,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,11 No. 2,963; 5,149,782; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,37 1,241, same No. 5,391,723 No. 5,416,203, No. 5,451,463; No. 5,510,475; No. 5,512,667; No. 5,514,785; No. 5,565,552; No. 5,567,810; No. 5,574,142; No. 5,585,481; 5,587,371 No. 5,595,726; No. 5,597,696; No. 5,599,923; No. 5,599,928; No. 5,672,662; No. 5,688,941; No. 5,714,166; No. 6,153,737; No. 6,172,208; 6,300,319 No. 6,335,434; No. 6,335,437; No. 6,395,437; No. 6,444,806; No. 6,486,308; No. 6,525,031; No. 6,528,631; No. 6,559,279; Incorporated into the specification.

[0260] Characteristics of nucleic acid-lipid particles In certain embodiments, the invention relates to methods and compositions for producing lipid-encapsulated nucleic acid particles in which a nucleic acid is encapsulated within a lipid layer. Such nucleic acid-lipid particles incorporating siRNA oligonucleotides are characterized using various biophysical parameters including: (1) drug-to-lipid ratio; (2) encapsulation efficiency; and (3) )Particle size. A high drug-to-lipid ratio, high encapsulation efficiency, good nuclease resistance and serum stability, and controllable particle size, generally less than 200 nm in diameter, are desirable. In addition, the nature of the nucleic acid polymer is important because nucleic acid modifications to confer nuclease resistance often provide only limited resistance but add to the cost of therapeutics. Unless otherwise stated, these criteria are calculated herein as follows.

[0261] Nucleic acid to lipid ratio is the amount of nucleic acid in a defined preparation volume divided by the amount of lipid in the same volume. This may be based on moles per mole, or weight per weight, or weight per mole. For the final ready-to-administer formulation, the nucleic acid:lipid ratio is calculated after removing as much external nucleic acid as possible using dialysis, chromatography, and / or enzymatic (eg, nuclease) digestion.

[0262] Encapsulation efficiency refers to the drug-to-lipid ratio of the starting mixture divided by the drug-to-lipid ratio of the final administration-ready formulation. This is a measure of relative efficiency. For absolute efficiency measures, one can also calculate the total amount of nucleic acid added to the starting mixture that ultimately results in an administration-ready formulation. The amount of lipid lost during the formulation process can also be calculated. Efficiency is a measure of waste and cost of the formulation.

[0263] Size refers to the size (diameter) of the particles formed. Size distribution can be determined using quasi-elastic light scattering (QELS) on a Nicomp Model 370 submicrometer particle sizer. Particles less than 200 nm are preferred for distribution to vascularized (leak) tissues such as neoplasms and inflammatory sites.

[0264] pharmaceutical composition The lipid particles of the invention, especially when conjugated with a therapeutic agent, can be prepared in a pharmaceutically acceptable diluent, such as saline or phosphate buffer, selected according to the route of administration and standard pharmaceutical practice; It can be formulated as a pharmaceutical composition further comprising an excipient or carrier.

[0265] In certain embodiments, pharmaceutical compositions comprising lipid-nucleic acid particles of the invention are prepared by standard techniques and further comprise a pharmaceutically acceptable carrier. Generally, normal saline will be used as a pharmaceutically acceptable carrier. Other suitable carriers include, for example, water, buffered water, 0.9% saline, and 0.3% glycine, including glycoproteins for enhanced stability, such as albumin, lipoproteins, globulins, etc. It will be done. For compositions that include saline or other salt-containing carriers, the carrier is preferably added after lipid particle formation. Thus, after the lipid-nucleic acid composition is formed, the composition can be diluted with a pharmaceutically acceptable carrier such as normal saline.

[0266] The resulting pharmaceutical product can be sterilized by conventional, well-known sterilization techniques. The aqueous solution can then be packaged for use or filtered and lyophilized under aseptic conditions, and the lyophilized preparation is mixed with the sterile aqueous solution prior to administration. The compositions may contain pharmaceutically acceptable agents required to approximate physiological conditions, such as pH adjusting agents and buffers and osmotic pressure adjusting agents, such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, etc. It may also contain acceptable auxiliary substances. Additionally, the lipid suspension may contain a lipid protectant that protects the lipids from free radical and lipid peroxidative damage during storage. Lipophilic free radical quenchers such as α-tocopherol and water-soluble iron-specific chelators such as ferrioxamine are preferred.

[0267] The concentration of lipid particles or lipid-nucleic acid particles in the pharmaceutical formulation can vary widely, i.e. from less than about 0.01%, usually about 0.05-5% or at least about 0.05-5% up to 10-30% by weight. The choice will depend primarily on volume, viscosity, etc., depending on the particular mode of administration chosen. For example, the concentration can be increased to reduce the fluid burden associated with treatment. This may be particularly desirable in patients with congestive heart failure or severe hypertension associated with atherosclerosis. Alternatively, complexes composed of irritating lipids can be diluted to low concentrations to reduce inflammation at the site of administration. In one group of embodiments, the nucleic acid has a label attached to it and will be used for diagnosis (by indicating the presence of a complementary nucleic acid). In this case, the amount of conjugate administered will depend on the particular label used, the disease state being diagnosed, and the judgment of the clinician, but will generally range from about 0.01 to about 50 mg per kilogram of body weight. , preferably about 0.1 to about 5 mg per kilogram of body weight.

[0268] As mentioned above, the lipid-therapeutic (e.g., nucleic acid) particles of the present invention include polyethylene glycol (PEG)-modified phospholipids, PEG-ceramides, or ganglioside G M1 Modified lipids or other lipids effective to prevent or limit aggregation may be included. Addition of such components not only prevents complex aggregation. Rather, it can also provide a means to increase circulation longevity and delivery of lipid-nucleic acid compositions to target tissues.

[0269] The invention also provides lipid-therapeutic compositions in the form of kits. A kit will typically consist of a compartmented container for housing the various components of the kit. The kit will contain the particles or pharmaceutical compositions of the invention, preferably in dehydrated or concentrated form, along with instructions for their rehydration or dilution and administration. In some embodiments, the particles include an active agent, while in other embodiments, the particles do not include an active agent.

[0270] Production method The methods and compositions of the invention employ certain cationic lipids, synthesis, preparation, and characterization described below or in the accompanying Examples. In addition, the present invention provides methods for preparing lipid particles that include lipid particles conjugated to therapeutic agents, such as nucleic acids. In the methods described herein, a mixture of lipids is mixed with a buffered aqueous solution of nucleic acids to produce an intermediate mixture containing nucleic acids encapsulated in lipid particles, wherein the encapsulated nucleic acids are approximately 3 wt. % to about 25% by weight, preferably 5 to 15% by weight nucleic acid / lipid ratio. The intermediate mixture can be optionally sized to obtain lipid-encapsulated nucleic acid particles in which the lipid portion is a unilamellar vesicle with a diameter of preferably 30-150 nm, more preferably about 40-90 nm. . Thereafter, the pH is increased to neutralize at least a portion of the surface charge of the lipid-nucleic acid particles, thus providing an at least partially surface-neutralized lipid-encapsulated nucleic acid composition.

[0271] As mentioned above, some of these cationic lipids are aminolipids that are charged at pH below the pKa of the amino group and substantially neutral at pH above the pKa of the amino group. These cationic lipids are termed titratable cationic lipids and can be used in the formulations of the invention using a two-step process. Initially, lipid vesicles can be formed at lower pH using titratable cationic lipids and other vesicle components in the presence of nucleic acids. In this way, the vesicle will encapsulate and entrap the nucleic acid. The surface charge of the newly formed vesicles can then be neutralized by increasing the pH of the medium to a level above the pKa of the titratable cationic lipid, i.e. above the physiological pH. can. Particularly advantageous aspects of this process include both the easy removal of any surface-adsorbed nucleic acids and the resulting nucleic acid delivery vehicle having a neutral surface. Liposomes or lipid particles with neutral surfaces are expected to avoid rapid clearance from the circulation and avoid certain toxicities associated with cationic liposome formulations. Further details regarding the use of such titratable cationic lipids in the formulation of nucleic acid-lipid particles are provided in U.S. Pat. No. 6,287,591 and U.S. Pat. No. 6,858,225, which are incorporated herein by reference. There is.

[0272] It is further noted that the vesicles thus formed provide a uniform vesicle size formulation with a high content of nucleic acids. Additionally, the vesicles have a size ranging from about 30 to about 150 nm, more preferably from about 30 to about 90 nm.

[0273] Without intending to be bound by any particular theory, it is believed that the high efficiency of nucleic acid encapsulation is the result of electrostatic interactions at low pH. At acidic pH (eg, pH 4.0), the vesicle surface is charged and binds a portion of the nucleic acid through electrostatic interactions. When the external acidic buffer is replaced with a more neutral buffer (eg, pH 7.5), the surface of the lipid particles or liposomes is neutralized, allowing removal of any external nucleic acids. More detailed information regarding the formulation process is provided in various publications (eg, US Pat. No. 6,287,591 and US Pat. No. 6,858,225).

[0274] In view of the above, the present invention provides methods of preparing lipid / nucleic acid formulations. In the methods described herein, a mixture of lipids is mixed with a buffered aqueous solution of nucleic acids to produce an intermediate mixture containing nucleic acids encapsulated in lipid particles, e.g., the encapsulated nucleic acids are about Present in a nucleic acid / lipid ratio of 10% to about 20% by weight. The intermediate mixture can be optionally sized to obtain lipid-encapsulated nucleic acid particles in which the lipid portion is a unilamellar vesicle with a diameter of preferably 30-150 nm, more preferably about 40-90 nm. . Thereafter, the pH is increased to neutralize at least a portion of the surface charge of the lipid-nucleic acid particles, thus providing an at least partially surface-neutralized lipid-encapsulated nucleic acid composition.

[0275] In certain embodiments, the mixture of lipids is selected from at least two lipid components: a lipid having a pKa such that the lipid is cationic at a pH below its pKa and is neutral at a pH above its pKa. and a second lipid component selected from among lipids that prevent particle aggregation during lipid-nucleic acid particle formation. In certain embodiments, aminolipids are the novel cationic lipids of the invention.

[0276] In preparing the nucleic acid-lipid particles of the invention, the lipid mixture is typically a solution of lipids in an organic solvent. This mixture of lipids can then be dried to form a thin film or lyophilized to form a powder before being hydrated with an aqueous buffer to form liposomes. Alternatively, in a preferred method, the lipid mixture can be solubilized in a water-miscible alcohol, such as ethanol, and addition of this ethanolic solution to an aqueous buffer results in spontaneous liposome formation. In most embodiments, the alcohol is used in its commercially available form. For example, ethanol can be used as absolute ethanol (100%) or 95% ethanol, with the balance being water. This method is described in more detail in US Pat. No. 5,976,567.

[0277] In one exemplary embodiment, the mixture of lipids includes cationic lipids, neutral lipids (other than cationic lipids), sterols (e.g., cholesterol), and PEG-modified lipids (e.g., PEG- DMG or PEG-DMA). In a preferred embodiment, the lipid mixture consists essentially of cationic lipids, neutral lipids, cholesterol, and PEG-modified lipids in an alcohol, more preferably ethanol. In a further preferred embodiment, the first solution consists of the lipid mixture described above, with a molar ratio of about 20-70% cationic lipids: 5-45% neutral lipids: 20-55% cholesterol: 0.5-15% It is a PEG-modified lipid. In yet a further preferred embodiment, the first solution consists essentially of a lipid selected from Table 1, DSPC, Chol, and PEG-DMG or PEG-DMA, more preferably in a molar ratio of about 20 to 60 % Cationic Lipid: 5~25% DSPC: 25~55% Chol: 0.5~15% PEG-DMG or PEG-DMA. In certain embodiments, the lipid molar ratio is approximately 40 / 10 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), 35 / 15 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), or 52 / 13 / 30 / 5 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA). In another group of embodiments, the neutral lipids in these compositions are replaced with POPC, DPPC, DOPE, or SM.

[0278] According to the invention, the lipid mixture is mixed with an aqueous buffer solution that may contain nucleic acids. An aqueous buffer solution is typically a solution in which the buffer has a pH below the pKa of the protonatable lipid in the lipid mixture. Examples of suitable buffers include citrate, phosphate, acetate, and MES. A particularly preferred buffer is citrate buffer. Preferred buffers have anions in the range 1-1000mM, depending on the chemistry in which the nucleic acids are encapsulated, and optimization of buffer concentration may be important in achieving high loading levels (e.g., US See Patent No. 6,287,591 and U.S. Patent No. 6,858,225). Alternatively, pure water acidified to pH 5-6, such as with chlorides or sulfates, may be useful. In this case, the particles can be dialyzed to remove ethanol, increase the pH, or balance the osmotic potential within and outside the particle membrane when mixed with a pharmaceutically acceptable carrier such as normal saline. It may be suitable to add 5% glucose or another non-ionic solute to be maintained. The amount of nucleic acid in the buffer may vary, but typically will be about 0.01 mg / mL to about 200 mg / mL, more preferably about 0.5 mg / mL to about 50 mg / mL.

[0279] The mixture of lipids and the buffered aqueous solution of therapeutic nucleic acid are mixed to provide an intermediate mixture. The intermediate mixture is typically a mixture of lipid particles with encapsulated nucleic acids. In addition, the intermediate mixture may contain some nucleic acids that are bound to the surface of the lipid particles (liposomes or lipid vesicles) by ionic attraction between negatively charged nucleic acids and positively charged lipids at the surface of the lipid particles. (the aminolipid or other lipid making up the first protonatable lipid component is positively charged in a buffer having a pH below the pKa of the protonatable group of the lipid). In one group of preferred embodiments, the mixture of lipids is an alcoholic solution of the lipids, the volumes of each of the solutions being such that upon mixing, the resulting alcohol content is from about 20% to about 45% by volume. It is adjusted as follows. The method of mixing the mixture can involve any of a variety of processes and often depends on the scale of the formulation being produced. For example, if the total volume is about 10-20 mL or less, the solutions can be mixed in a test tube and stirred together using a vortex mixer. Large scale processes can be carried out in suitable production scale glassware.

[0280] Optionally, the lipid-encapsulated therapeutic agent (e.g., nucleic acid) complex produced by mixing the lipid mixture and a buffered aqueous solution of the therapeutic agent (nucleic acid) has a desired size range and relatively narrow lipid particle size distribution. Can be sized to achieve. Preferably, the compositions provided herein will be sized to an average diameter of about 70 to about 200 nm, more preferably about 90 to about 130 nm. Several techniques can be used to size liposomes to the desired size. One sizing method is described in US Pat. No. 4,737,323, which is incorporated herein by reference. Sonicating liposome suspensions by either bath sonication or probe sonication novelly reduces the size to small unilamellar vesicles (SUVs) with sizes less than approximately 0.05 micrometers. do. Homogenization is another method that relies on shearing energy to fragment large liposomes into smaller ones. In a typical homogenization procedure, multilamellar vesicles are recirculated through a standard emulsion homogenizer until a selected liposome size, typically around 0.1-0.5 micrometers, is observed. In both methods, particle size distribution can be monitored by conventional laser beam particle size determination methods. For certain methods herein, extrusion methods are used to obtain uniform vesicle size.

[0281] Extruding the liposome composition through a small pore polycarbonate membrane or an asymmetric ceramic membrane provides a relatively well-defined particle size distribution. Typically, the suspension is cycled through the membrane one or more times until the desired liposome complex particle size distribution is achieved. Liposomes can be extruded through successively smaller pore membranes to achieve a stepwise reduction in liposome size. In some cases, the lipid-nucleic acid composition formed can be used without any sizing.

[0282] In certain embodiments, the methods of the invention further include neutralizing at least some of the surface charge of the lipid moiety of the lipid-nucleic acid composition. By at least partially neutralizing the surface charge, unencapsulated nucleic acids are liberated from the lipid particle surface and can be removed from the composition using conventional techniques. Preferably, unencapsulated surface-adsorbed nucleic acids are removed from the resulting composition by buffer exchange. For example, replacing the citrate buffer (approximately pH 4.0, used to form the composition) with a HEPES-buffered saline (HBS, pH approximately 7.5) solution can neutralize the liposome surface and release nucleic acids. Emission from the surface is brought about. The released nucleic acids can then be chromatographically removed using standard methods and then switched to a buffer with a pH above the pKa of the lipid used.

[0283] Optionally, lipid vesicles (ie, lipid particles) can be formed by hydration in an aqueous buffer and sized using any of the methods described above prior to addition of the nucleic acid. As mentioned above, the aqueous buffer should have a pH below the pKa of the amino lipid. A nucleic acid solution can then be added to these sized, preformed vesicles. To enable nucleic acid encapsulation into such "pre-formed" vesicles, the mixture should contain an alcohol, such as ethanol. In the case of ethanol, it should be present at a concentration of about 20% (w / w) to about 45% (w / w). In addition, the preformed vesicle and nucleic acid mixture is warmed in an aqueous buffer-ethanol mixture to a temperature of about 25°C to about 50°C, depending on the composition of the lipid vesicles and the nature of the nucleic acid. There are times when this is necessary. It will be apparent to those skilled in the art that optimization of the encapsulation process to achieve the desired level of nucleic acid in lipid vesicles will require manipulation of variables such as ethanol concentration and temperature. . Examples of suitable conditions for nucleic acid encapsulation are provided in the Examples. Once the nucleic acids are encapsulated within preformed vesicles, the external pH can be raised to at least partially neutralize the surface charge. Unencapsulated surface-adsorbed nucleic acids can then be removed as described above.

[0284] how to use The lipid particles of the invention can be used to deliver therapeutic agents to cells in vitro or in vivo. In certain embodiments, the therapeutic agent is a nucleic acid that is delivered to cells using the nucleic acid-lipid particles of the invention. Although the following description of various methods of using the lipid particles and related pharmaceutical compositions of the present invention is exemplified by the description regarding nucleic acid-lipid particles, these methods and compositions may benefit from such treatments. It is understood that the invention can be easily adapted for the delivery of any therapeutic agent to treat any disease or disorder that may be present.

[0285] In certain embodiments, the invention provides methods for introducing nucleic acids into cells. Preferred nucleic acids for introduction into cells are siRNA, immunostimulatory oligonucleotides, plasmids, antisense, and ribozymes. These methods can be carried out by contacting the particles or compositions of the invention with cells for a period of time sufficient for intracellular delivery to occur.

[0286] The compositions of the invention are capable of adsorbing almost all cell types. Upon adsorption, the nucleic acid-lipid particles can either be endocytosed by parts of the cell, exchange lipids with the cell membrane, or fuse with the cell. Transfer or uptake of the nucleic acid portion of the complex may occur via any one of these routes. Without intending to limit the scope of the invention, in the case of particles that are taken up into cells by endocytosis, the particles may subsequently interact with the endosomal membrane and destabilize the endosomal membrane, possibly through the formation of a non-bilayer phase. It is thought that this leads to the introduction of the encapsulated nucleic acid into the cytoplasm. Similarly, if the particles fuse directly with the cell plasma membrane, the liposome membrane will integrate with the cell membrane and the contents of the liposome will mix with the intracellular fluid when fusion occurs. Contacting the cells with the lipid-nucleic acid composition, when performed in vitro, will occur in a biologically compatible medium. The concentration of the composition may vary widely depending on the particular application, but is generally from about 1 μmole to about 10 mmol. In certain embodiments, treatment of cells with lipid-nucleic acid compositions is generally carried out at physiological temperatures (about 37° C.) for about 1 to 24 hours, preferably about 2 to 8 hours. Dew. For in vitro applications, delivery of the nucleic acid may be to any cell grown in culture, the cell may be of plant or animal origin, vertebrate or invertebrate origin, and any tissue. Or it may be a type. In preferred embodiments, the cells will be animal cells, more preferably mammalian cells, and most preferably human cells.

[0287] In one group of embodiments, the lipid-nucleic acid particle suspension has about 10 3 ~about 10 5 cells / mL, more preferably about 2 x 10 4 Add to plated cells at 60-80% confluence, with a cell density of cells / mL. The concentration of the suspension added to the cells is preferably about 0.01 to 20 μg / mL, more preferably about 1 μg / mL.

[0288] In another embodiment, the lipid particles of the invention can be used to deliver nucleic acids to cells or cell lines (eg, tumor cell lines). Non-limiting examples of such cell lines include: HELA (ATCC Cat N:CCL-2), KB (ATCC Cat N:CCL-17), HEP3B (ATCC Cat N:HB -8064), SKOV-3(ATCC Cat N:HTB-77), HCT-116(ATCC Cat N:CCL-247), HT-29(ATCC Cat N:HTB-38), PC-3(ATCC Cat N :CRL-1435), A549(ATCC Cat N:CCL-185), MDA-MB-231(ATCC Cat N:HTB-26).

[0289] Typical applications include knocking down or silencing specific cellular targets using well-known procedures for providing intracellular delivery of siRNA. Alternatively, uses include the delivery of DNA or mRNA sequences encoding therapeutically useful polypeptides. In this way, genetic diseases by supplying a defective gene product or genetic diseases by not supplying a gene product (i.e., for Duchenne dystrophy, Kunkel, et al., Brit. Med. Bull. 45(3) :630-643 (1989) and for cystic fibrosis, Goodfellow, Nature 341:102-103 (1989)). Other uses of the compositions of the invention include introducing antisense oligonucleotides into cells (see Bennett, et al., Mol. Pharm. 41:1023-1033 (1992)).

[0290] Alternatively, the compositions of the invention can be used to deliver nucleic acids to cells in vivo using methods known to those skilled in the art. For delivery of DNA or mRNA sequences, intravenous delivery of cytomegalovirus (CMV)-chloramphenicol acetyltransferase (CAT) expression plasmids using DOTMA-DOPE complexes is incorporated herein by reference. Zhu, et al., Science 261:209-211 (1993). Hyde, et al., Nature 362:250-256 (1993), incorporated herein by reference. (CFTR) gene delivery has been described. Brigham, et al., Am. J. Med. Sci. 298:278-281 (1989), incorporated herein by reference, encodes the intracellular enzyme chloramphenicol acetyltransferase (CAT). In vivo transfection of mouse lungs with functional prokaryotic genes has been described. Therefore, the compositions of the invention can be used to treat infectious diseases.

[0291] For in vivo administration, the pharmaceutical composition is preferably administered parenterally, ie, intraarticularly, intravenously, intraperitoneally, subcutaneously, or intramuscularly. In certain embodiments, the pharmaceutical composition is administered intravenously or intraperitoneally by bolus injection. As an example, see Stadler et al., US Pat. No. 5,286,634, which is incorporated herein by reference. Intracellular nucleic acid delivery has been described by Straubringer, et al., Methods in Enzymology, Academic Press, New York. 101:512-527 (1983); Mannino, et al., Biotechniques 6:682-690 (1988); Nicolau, et al. al., Crit. Rev. Ther. Drug Carrier Syst. 6:239-271 (1989), and Behr, Acc. Chem. Res. 26:274-278 (1993). Still other methods of administering lipid-based therapeutics include, for example, Rahman et al., US Pat. No. 3,993,754; Sears, US Pat. No. 4,145,410; Papahadjopoulos et al., US Pat. No. 4,235,871; Schneider, US Pat. No. 4,224,179; Lenk et al., US Pat. No. 4,522,803; and Fountain et al., US Pat. No. 4,588,578.

[0292] In other methods, the pharmaceutical agent may be contacted with the target tissue by applying the formulation directly to the tissue. Application may be done topically, in an "open" or "closed" manner. "Topical" refers to the application of the pharmaceutical agent directly to tissues exposed to the environment, such as the skin, oropharynx, and ear canal. An "open" procedure is one that involves making an incision in the patient's skin and directly visualizing the underlying tissue to which the medication will be applied. This is generally accomplished through surgical procedures such as a thoracotomy to access the lungs, an abdominal laparotomy to access the abdominal organs, or other direct surgical access to the target tissue. A "closed" procedure is an invasive procedure in which the internal target tissue is not directly visualized, but is accessed by inserting instruments through a small wound in the skin. For example, the formulation can be administered peritoneally by needle lavage. Similarly, medications may be administered via an intravenous drip into the meninges or spinal cord during a lumbar puncture and subsequent proper positioning of the patient, which is commonly performed for spinal anesthesia or spinal metrazamide imaging. Can be done. Alternatively, the formulation can be administered through an endoscopic device.

[0293] Lipid-nucleic acid compositions can be administered in an aerosol inhaled into the lungs (see Brigham, et al., Am. J. Sci. 298(4):278-281 (1989)) or by direct injection into the disease site. (Culver, Human Gene Therapy, MaryAnn Liebert, Inc., Publishers, New York. pp.70-71 (1994)).

[0294] The methods of the invention can be practiced in a variety of hosts. Preferred hosts include mammalian species such as humans, non-human primates, dogs, cats, cows, horses, and sheep.

[0295] The dosage of the lipid-therapeutic particles of the present invention will depend on the ratio of therapeutic agent to lipid and the opinion of the administering physician based on the age, weight, and condition of the patient.

[0296] In one embodiment, the invention provides a method of modulating expression of a target polynucleotide or polypeptide. These methods generally involve contacting a cell with a lipid particle of the invention that is attached to a nucleic acid capable of modulating expression of a target polynucleotide or polypeptide. As used herein, the term "modulate" refers to altering the expression of a target polynucleotide or polypeptide. In different embodiments, modulation may mean increasing or enhancing, or decreasing or reducing. Methods for measuring expression levels of target polynucleotides or polypeptides are known and available in the art, including, for example, using reverse transcription-polymerase chain reaction (RT-PCR) and immunohistochemical techniques. Includes methods. In certain embodiments, the expression level of the target polynucleotide or polypeptide is increased or reduced.

[0297] For example, if increased polypeptide expression is desired, the nucleic acid may be an expression vector containing a polynucleotide encoding the desired polypeptide. On the other hand, if reduction of polynucleotide or polypeptide expression is desired, the nucleic acid may, for example, be a polynucleotide that specifically hybridizes to a polynucleotide encoding a target polypeptide, thereby interfering with expression of the target polynucleotide or polypeptide. It may be an antisense oligonucleotide, siRNA, or microRNA containing the nucleotide sequence. Alternatively, the nucleic acid may be a plasmid expressing such an antisense oligonucleotide, siRNA, or microRNA.

[0298] In one particular embodiment, the present invention provides a method of modulating the expression of a polypeptide by a cell, comprising or comprising a lipid selected from Table 1, DSPC, Chol, and PEG-DMG or PEG-DMA. For example, lipid particles consisting of about 20-60% cationic lipid: 5-25% DSPC: 25-55% Chol: 0.5-15% PEG-DMG or PEG-DMA are added to the cells. wherein the lipid particle is associated with a nucleic acid capable of modulating expression of a polypeptide. In certain embodiments, the lipid molar ratio is approximately 40 / 10 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), 35 / 15 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), or 52 / 13 / 30 / 5 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA). In another group of embodiments, the neutral lipids in these compositions are replaced with POPC, DPPC, DOPE, or SM.

[0299] In certain embodiments, the therapeutic agent is selected from siRNA, microRNA, antisense oligonucleotides, and plasmids capable of expressing siRNA, microRNA, or antisense oligonucleotides, and the siRNA, microRNA, or antisense RNA is , a polynucleotide that specifically binds to a polynucleotide encoding a polypeptide, such that expression of the polypeptide is reduced, or its complement.

[0300] In other embodiments, the nucleic acid is a plasmid encoding a polypeptide or a functional variant or fragment thereof, such that expression of the polypeptide or functional variant or fragment thereof is increased.

[0301] In a related embodiment, the invention provides a method of treating a disease or disorder characterized by overexpression of a polypeptide in a subject, comprising providing the subject with a pharmaceutical composition of the invention. and the therapeutic agent is selected from siRNA, microRNA, antisense oligonucleotide, and a plasmid capable of expressing the siRNA, microRNA, or antisense oligonucleotide, and the siRNA, microRNA, or antisense RNA expresses the polypeptide. Includes methods involving a polynucleotide or its complement that specifically binds to an encoding polynucleotide.

[0302] In one embodiment, the pharmaceutical composition consists of or consists essentially of a lipid selected from Table 1, DSPC, Chol, and PEG-DMG or PEG-DMA, e.g., in a molar ratio of about 20-60 % Cationic Lipid: 5-25% DSPC: 25-55% Chol: 0.5-15% PEG-DMG or PEG-DMA, the lipid particles are bound to a therapeutic nucleic acid. In certain embodiments, the lipid molar ratio is approximately 40 / 10 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), 35 / 15 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), or 52 / 13 / 30 / 5 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA). In another group of embodiments, the neutral lipids in these compositions are replaced with POPC, DPPC, DOPE, or SM.

[0303] In another related embodiment, the invention provides a method of treating a disease or disorder characterized by underexpression of a polypeptide in a subject, the method comprising providing the subject with a pharmaceutical composition of the invention. and wherein the therapeutic agent is a plasmid encoding a polypeptide or a functional variant or fragment thereof.

[0304] In one embodiment, the pharmaceutical composition consists of or consists essentially of a lipid selected from Table 1, DSPC, Chol, and PEG-DMG or PEG-DMA, e.g., in a molar ratio of about 20-60 % Cationic Lipid: 5-25% DSPC: 25-55% Chol: 0.5-15% PEG-DMG or PEG-DMA, the lipid particles are bound to a therapeutic nucleic acid. In certain embodiments, the lipid molar ratio is approximately 40 / 10 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), 35 / 15 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), or 52 / 13 / 30 / 5 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA). In another group of embodiments, the neutral lipids in these compositions are replaced with POPC, DPPC, DOPE, or SM.

[0305] The invention further provides a method of inducing an immune response in a subject, the method comprising providing the subject with a pharmaceutical composition of the invention, wherein the therapeutic agent is an immunostimulatory oligonucleotide. In certain embodiments, the immune response is a humoral or mucosal immune response. In one embodiment, the pharmaceutical composition consists of or consists essentially of a lipid selected from Table 1, DSPC, Chol, and PEG-DMG or PEG-DMA, e.g., in a molar ratio of about 20-60 % Cationic Lipid: 5-25% DSPC: 25-55% Chol: 0.5-15% PEG-DMG or PEG-DMA, the lipid particles are bound to a therapeutic nucleic acid. In certain embodiments, the lipid molar ratio is approximately 40 / 10 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), 35 / 15 / 40 / 10 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA), or 52 / 13 / 30 / 5 (mol% cationic lipid / DSPC / Chol / PEG-DMG or PEG-DMA). In another group of embodiments, the neutral lipids in these compositions are replaced with POPC, DPPC, DOPE, or SM.

[0306] In further embodiments, the pharmaceutical composition is provided to the subject in combination with a vaccine or antigen. Accordingly, the invention itself provides a vaccine comprising a lipid particle of the invention comprising an immunostimulatory oligonucleotide and also conjugated to an antigen against which an immune response is desired. In certain embodiments, the antigen is a tumor antigen or is associated with an infectious agent, such as a virus, bacterium, or parasite.

[0307] Various tumor antigens, infectious agent antigens, and antigens associated with other diseases are well known in the art, and examples of these are described in the literature cited herein. Examples of antigens suitable for use in the present invention include, but are not limited to, polypeptide antigens and DNA antigens. Specific examples of antigens are hepatitis A, hepatitis B, smallpox, polio, anthrax, influenza, typhoid, tetanus, measles, rotavirus, diphtheria, pertussis, tuberculosis, and rubella antigens. In a preferred embodiment, the antigen is a recombinant hepatitis B antigen. In other embodiments, the antigen is a recombinant hepatitis A antigen. In another embodiment, the antigen is a tumor antigen. Examples of such tumor-associated antigens are MUC-1, EBV antigen, and Burkitt's lymphoma-associated antigen. In a further embodiment, the antigen is a tyrosinase-related protein tumor antigen recombinant antigen. Those skilled in the art will be aware of other antigens suitable for use in the present invention.

[0308] Tumor-associated antigens suitable for use in the subject invention may be representative of a single tumor type, may be shared by several types of tumors, and / or may be compared to normal cells. Both mutated and non-mutated molecules that may be exclusively expressed or overexpressed in tumor cells are included. In addition to proteins and glycoproteins, tumor-specific patterns of expression of carbohydrates, gangliosides, glycolipids, and mucins have also been described. Exemplary tumor-associated antigens for use in the subject cancer vaccines include protein products of oncogenes, tumor suppressor genes, and other genes that have mutations or rearrangements unique to tumor cells, reactivated embryonic genes. products, oncofetal antigens, tissue-specific (but not tumor-specific) differentiation antigens, growth factor receptors, cell surface carbohydrate residues, foreign viral proteins, and numerous other self-proteins.

[0309] Specific embodiments of tumor-associated antigens include, for example, the Ras p21 proto-oncogene, tumor suppressor p53, and BCR-abl oncogene, as well as CDK4, MUM1, caspase 8, and beta-catenin. Mutated antigens such as protein products of galectin-4, galectin-9, carbonic anhydrase, aldolase A, PRAME, Her2 / neu, ErbB-2, and overexpressed antigens such as KSA, alpha-fetoprotein (AFP), human chorionic oncofetal antigens such as gonadotropin (hCG); autoantigens such as carcinoembryonic antigen (CEA) and melanocyte differentiation antigen such as Mart 1 / Melan A, gp100, gp75, tyrosinase, TRP1, and TRP2; PSA, PAP, Prostate associated antigens such as PSMA, PSM-P1, and PSM-P2; reactivation such as MAGE1, MAGE3, MAGE4, ​​GAGE1, GAGE2, BAGE, RAGE, and other cancer testis antigens such as NY-ESO1, SSX2, and SCP1 embryonic gene products; mucins such as Muc-1 and Muc-2; gangliosides such as GM2, GD2, and GD3; neutral glycolipids and glycoproteins such as Lewis(y) and globo-H; and Tn, Thompson-Freidenreich antigen (TF), and glycoproteins such as sTn. Also included herein as tumor-associated antigens are whole cell and tumor cell lysates and immunogenic portions thereof, as well as monoclonal expansions of B lymphocytes for use against B cell lymphomas. The immunoglobulin idiotype expressed.

[0310] Pathogens include, but are not limited to, infectious agents that infect mammals, and more specifically humans, such as viruses. Examples of infectious viruses include, but are not limited to: Retroviridae (e.g., human immunodeficiency viruses such as HIV-1 (HTLV-III, LAV, or HTLV-III / LAV; also called HIV-III; and other isolates such as HIV-LP); Picornaviridae (e.g., poliovirus, hepatitis A virus; enteroviruses, homocoxsackieviruses, rhinoviruses, echoviruses); Calciviridae (e.g. , strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis virus, rubella virus); Flaviridae (e.g., dengue virus, encephalitis virus, yellow fever virus); Coronoviridae (e.g. , coronaviruses); Rhabdoviradae (e.g., vesicular stomatitis virus, rabies virus); Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis virus, rabies virus); Filoviruses family (e.g. Ebola virus); Paramyxoviridae (e.g. parainfluenza virus, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g. influenza virus); Bungaviridae (e.g. hantaviruses, bungaviruses, phleboviruses, and nairoviruses); arenaviridae (haemorrhagic fever viruses); reoviridae (e.g., reoviruses, orbiviruses, and rotaviruses); birnaviridae; hepadnaviridae ( Parvoviridae (parvoviruses); Papovaviridae (papillomaviruses, polyomaviruses); Adenoviridae (most adenoviruses); Herpesviridae herpes simplex virus (HSV) 1 and 2, herpes zoster viruses, cytomegalovirus (CMV), herpesviruses; poxviridae (variola virus, vaccinia virus, poxvirus); and iridoviridae (e.g., African swine fever virus); and unclassifiable viruses (e.g., spongiform encephalopathy). Bacteria causing hepatitis delta (possibly a defective concomitant of the hepatitis B virus), Bacteria causing non-A, non-B hepatitis (class I = internally transmitted; class 2 = parenterally transmitted) (i.e., hepatitis C); Norwalk and related viruses, and astrovirus).

[0311] Gram-negative and Gram-positive bacteria also serve as antigens for vertebrates. Such Gram-positive bacteria include, but are not limited to, Pasteurella species, Staphylococci species, and Streptococcus species. Gram-negative bacteria include, but are not limited to, Escherichia coli, Pseudomonas species, and Salmonella species. Specific examples of infectious bacteria include, but are not limited to: Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophilia. , Mycobacteria species (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M. gordonae (M. gordonae)), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes ( Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (Viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus sp. (anaerobic species), Streptococcus pneumoniae, pathogenic Campylobacter species), Enterococcus species, Haemophilus infuenzae, Bacillus antracis, Corynebacterium diphtheriae (corynebacterium diphtheriae), Corynebacterium species, Erysipelothrix rhusiopathiae, Clostridium perfringers, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae , Pasturella multocida, Bacteroides species, Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue, Leptospira ( Leptospira), Rickettsia, and Actinomyces israelli.

[0312] Further examples of pathogens include, but are not limited to, infectious fungi that infect mammals, and more specifically humans. Examples of infectious fungi include, but are not limited to: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces. ·Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans. Examples of infectious parasites include malaria parasites such as Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale, and Plasmodium vivax. Contains protozoa. Other infectious organisms (ie, protists) include Toxoplasma gondii. In one embodiment, the formulations of the invention can be used to silence or modulate target genes including, but not limited to: FVII, Eg5, PCSK9, TPX2, apoB, SAA. , TTR, RSV, PDGF beta gene, Erb-B gene, Src gene, CRK gene, GRB2 gene, RAS gene, MEKK gene, JNK gene, RAF gene, Erk1 / 2 gene, PCNA (p21) gene, MYB gene, JUN Gene, FOS gene, BCL-2 gene, cyclin D gene, VEGF gene, EGFR gene, cyclin A gene, cyclin E gene, WNT-1 gene, beta-catenin gene, c-Met gene, PKC gene, NFKB gene, STAT3 Gene, survivin gene, Her2 / Neu gene, SORT1 gene, XBP1 gene, topoisomerase I gene, topoisomerase II alpha gene, p73 gene, p21 (WAF1 / CIP1) gene, p27 (KIP1) gene, PPM1D gene, RAS gene, caveolin I gene, MIB I gene, MTAI gene, M68 gene, tumor suppressor gene, p53 tumor suppressor gene, p53 family member DN-p63, pRb tumor suppressor gene, APC1 tumor suppressor gene, BRCA1 tumor suppressor gene, PTEN tumor suppressor gene, mLL fusion Gene, BCR / ABL fusion gene, TEL / AML1 fusion gene, EW / FLI1 fusion gene, TLS / FUS1 fusion gene, PAX3 / FKHR fusion gene, AML1 / ETO fusion gene, alpha v-integrin gene, Flt-1 receptor gene , tubulin gene, human papillomavirus gene, gene required for human papillomavirus replication, human immunodeficiency virus gene, gene required for human immunodeficiency virus replication, hepatitis A virus gene, gene required for hepatitis A virus replication, B Hepatitis virus genes, genes necessary for hepatitis B virus replication, hepatitis C virus genes, genes necessary for hepatitis C virus replication, hepatitis D virus genes, genes necessary for hepatitis D virus replication, hepatitis E Viral genes, genes necessary for hepatitis E virus replication, hepatitis F virus genes, genes necessary for hepatitis F virus replication, hepatitis G virus genes, genes necessary for hepatitis G virus replication, hepatitis H virus genes , genes required for hepatitis H virus replication, RS virus genes, genes required for RS virus replication, herpes simplex virus genes, genes required for herpes simplex virus replication, herpes cytomegalovirus genes, necessary for herpes cytomegalovirus replication genes, herpes Epstein-Barr virus genes, genes required for herpes Epstein-Barr virus replication, Kaposi's sarcoma-associated herpesvirus genes, genes required for Kaposi's sarcoma-associated herpesvirus replication, JC virus genes, human genes required for JC virus replication, Myxovirus genes, genes required for myxovirus gene replication, rhinovirus genes, genes required for rhinovirus replication, coronavirus genes, genes required for coronavirus replication, West Nile virus genes, genes required for West Nile virus replication , St. Louis encephalitis gene, gene required for St. Louis encephalitis replication, tick-borne encephalitis virus gene, gene required for tick-borne encephalitis virus replication, Murray Valley encephalitis virus gene, gene required for Mary Valley encephalitis virus replication, dengue virus gene , genes required for dengue virus gene replication, simian virus 40 genes, genes required for simian virus 40 replication, human T cell lymphotropic virus genes, genes required for human T cell lymphotropic virus replication, Moloney- Murine leukemia virus genes, Moloney-murine leukemia virus replication genes, encephalomyocarditis virus genes, encephalomyocarditis virus replication genes, measles virus genes, measles virus replication genes, varicella zoster ( Vericella zoster) viral genes, genes required for varicella zoster virus replication, adenovirus genes, genes required for adenovirus replication, yellow fever virus genes, genes required for yellow fever virus replication, poliovirus genes, genes required for poliovirus replication Required genes, poxvirus genes, genes required for poxvirus replication, Plasmodium genes, genes required for Plasmodium gene replication, Mycobacterium ulcerans genes, genes required for Mycobacterium ulcerans replication, Mycobacterium tuberculosis genes, Mycobacterium tuberculosis genes genes required for M. leprae replication, Staphylococcus aureus genes, genes required for Staphylococcus aureus replication, Streptococcus pneumoniae genes, genes required for Streptococcus pneumoniae replication, Streptococcus pyogenes genes, Genes required for Streptococcus pyogenes replication, Chlamydia pneumoniae genes, genes required for Chlamydia pneumoniae replication, M. pneumoniae genes, genes required for M. pneumoniae replication, integrin genes, selectin genes, complement system genes, chemokine genes, Chemokine receptor gene, GCSF gene, Gro1 gene, Gro2 gene, Gro3 gene, PF4 gene, MIG gene, proplatelet basic protein gene, MIP-1I gene, MIP-1J gene, RANTES gene, MCP-1 gene, MCP- 2 genes, MCP-3 gene, CMBKR1 gene, CMBKR2 gene, CMBKR3 gene, CMBKR5v, AIF-1 gene, I-309 gene, ion channel component genes, neurotransmitter receptor genes, neurotransmitter ligand genes. one of the genes, amyloid family genes, presenilin genes, HD genes, DRPLA genes, SCA1 genes, SCA2 genes, MJD1 genes, CACNL1A4 genes, SCA7 genes, SCA8 genes, alleles or polymorphic genes found in LOH cells one allele.

[0313] definition "Alkyl" means a straight chain or branched acyclic or cyclic saturated aliphatic hydrocarbon containing 1 to 24 carbon atoms. Representative saturated straight chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, and n-hexyl; saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert. -Includes butyl, isopentyl, etc. Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; unsaturated cyclic alkyls include cyclopentenyl, cyclohexenyl, and the like.

[0314] "Alkenyl" means alkyl as defined above containing at least one double bond between adjacent carbon atoms. Alkenyl includes both cis and trans isomers. Representative straight and branched alkenyls include ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, and Includes 2,3-dimethyl-2-butenyl.

[0315] "Alkynyl" means any alkyl or alkenyl as defined above that further contains at least one triple bond between adjacent carbons. Representative straight and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1-butynyl, and the like.

[0316] The term "acyl" refers to carbonyl groups substituted with hydrogen, alkyl, partially saturated or fully saturated cycloalkyl, partially saturated or fully saturated heterocycles, aryl, and heteroaryl. . For example, acyl includes (C1-C20) alkanoyl (e.g., formyl, acetyl, propionyl, butyryl, valeryl, caproyl, t-butylacetyl, etc.), (C3-C20) cycloalkylcarbonyl (e.g., cyclopropylcarbonyl, cyclo butylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl, etc.), heterocyclic carbonyl (e.g., pyrrolidinylcarbonyl, pyrrolid-2-one-5-carbonyl, piperidinylcarbonyl, piperazinylcarbonyl, tetrahydrofuranylcarbonyl, etc.), aroyl (e.g. benzoyl), and heteroaroyl (e.g. thiophenyl-2-carbonyl, thiophenyl-3-carbonyl, furanyl-2-carbonyl, furanyl-3-carbonyl, lH-pyroyl-2-carbonyl, lH-pyroyl-3-carbonyl) , benzo[b]thiophenyl-2-carbonyl, etc.).

[0317] The term "aryl" refers to an aromatic monocyclic, bicyclic, or tricyclic hydrocarbon ring system in which any ring atom may be substituted. Examples of aryl moieties include, but are not limited to, phenyl, naphthyl, anthracenyl, and pyrenyl.

[0318] "Heterocycle" means a 5- to 7-membered monocyclic ring that is either saturated, unsaturated, or aromatic and contains one or two heteroatoms independently selected from nitrogen, oxygen, and sulfur. means a cyclic, or 7- to 10-membered bicyclic, heterocyclic ring in which the nitrogen and sulfur heteroatoms are optionally oxidized and the nitrogen heteroatoms are optionally quaternized. and includes bicyclic rings in which any of the above heterocycles is fused to a benzene ring. The heterocycle may be attached via any heteroatom or carbon atom. Heterocycle includes heteroaryl as defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperidinyl, hydantoinyl, valerolactone valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, Included are tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, and the like.

[0319] The term "heteroaryl" means 1 to 3 heteroatoms if monocyclic, 1 to 6 heteroatoms if bicyclic, and 1 to 9 heteroatoms if tricyclic. refers to an aromatic 5- to 8-membered monocyclic, 8- to 12-membered bicyclic, or 11- to 14-membered tricyclic ring system with the heteroatoms selected from O, N, or S (e.g., carbon atoms, and in the case of monocyclic, bicyclic, or tricyclic, 1 to 3, 1 to 6, or 1 to 9 N, O, or S heteroatoms, respectively), in which any Ring atoms may be substituted. Heteroaryl groups described herein can also contain fused rings that share a common carbon-carbon bond. The term "alkylheterocyle" refers to a heteroaryl in which at least one ring atom is substituted with alkyl, alkenyl, or alkynyl.

[0320] The term "substituted" refers to one or more hydrogen radicals of a given structure being replaced with radicals of the specified substituents, including but not limited to: halo, alkyl. , alkenyl, alkynyl, aryl group, heterocyclyl, thiol, alkylthio, oxo, thioxy, arylthio, alkylthioalkyl, arylthioalkyl, alkylsulfonyl, alkylsulfonylalkyl, arylsulfonylalkyl, alkoxy, aryloxy, aralkoxy, aminocarbonyl , alkylaminocarbonyl, arylaminocarbonyl, alkoxycarbonyl, aryloxycarbonyl, haloalkyl, amino, trifluoromethyl, cyano, nitro, alkylamino, arylamino, alkylaminoalkyl, arylaminoalkyl, aminoalkylamino, hydroxy, alkoxyalkyl , carboxyalkyl, alkoxycarbonylalkyl, aminocarbonylalkyl, acyl, aralkoxycarbonyl, carboxylic acid, sulfonic acid, sulfonyl, phosphonic acid, aryl, heteroaryl, heterocyclic, and aliphatic. It is understood that substituents may be further substituted. Exemplary substituents include amino, alkylamino, dialkylamino, and cyclic amino compounds.

[0321] "Halogen" means fluoro, chloro, bromo, and iodo.

[0322] The terms "alkylamine" and "dialkylamine" refer to -NH(alkyl) and -N(alkyl) respectively. 2 Refers to radicals.

[0323] The term "alkyl phosphate" refers to -O-P(Q')(Q'')-O-R, where Q' and Q'' are each independently O, S, N(R) 2 , optionally substituted alkyl or alkoxy, and R is optionally substituted alkyl, ω-aminoalkyl, or ω-(substituted)aminoalkyl.

[0324] The term "alkyl phosphorothioate" refers to an alkyl phosphate in which at least one of Q' or Q'' is S.

[0325] The term "alkyl phosphonate" refers to an alkyl phosphate in which at least one of Q' or Q'' is alkyl.

[0326] The term "hydroxyalkyl" refers to the radical -O-alkyl.

[0327] The term "alkylheterocycle" refers to an alkyl in which at least one methylene is replaced with a heterocycle.

[0328] The term "ω-aminoalkyl" means -alkylNH 2 Refers to radicals. and "ω-(substituted)aminoalkyl" refers to ω-aminoalkyl in which at least one of H or N is substituted with alkyl.

[0329] The term "ω-phosphoalkyl" refers to -alkyl-O-P(Q')(Q'')-O-R, where Q' and Q'' are each independently O or S, and R is Optionally substituted alkyl.

[0330] The term "ω-thiophosphoalkyl" refers to an ω-phosphoalkyl in which at least one of Q' or Q'' is S.

[0331] In some embodiments, the methods of the invention may require the use of protecting groups. Protecting group methods are well known to those skilled in the art (see, eg, Protective Groups in Organic Synthesis, Green, T. W. et. al., Wiley-Interscience, New York City, 1999). Briefly, a protecting group within the context of the present invention is any group that reduces or eliminates the undesirable reactivity of a functional group. Protecting groups can be added to a functional group to mask its reactivity during a particular reaction and then removed to restore the original functional group. In some embodiments, "alcohol protecting groups" are used. An "alcohol protecting group" is any group that reduces or eliminates the undesirable reactivity of an alcohol functionality. Protecting groups can be added and removed using techniques well known in the art.

[0332] The compounds of the invention can be prepared by known organic synthesis techniques, including those described in more detail in the Examples.

[0333] Example Example 1: Synthesis of methanesulfonic acid octadeca-9,12-dienyl ester 2 Scheme 1 [ka] To a solution of alcohol 1 (26.6 g, 100 mmol) in dichloromethane (100 mL) was added triethylamine (13.13 g, 130 mmol) and the solution was cooled in an ice bath. To this cooled solution was added dropwise a solution of mesyl chloride (12.6 g, 110 mmol) in dichloromethane (60 mL) and after the addition was complete the reaction mixture was warmed to ambient temperature and stirred overnight. TLC of the reaction mixture showed completion of the reaction. The reaction mixture was diluted with dichloromethane (200 mL), water (200 mL), saturated NaHCO 3 (200 mL), washed with brine (100 mL) and dried (NaSO 4 ). The organic layer was concentrated to obtain the crude product, which was diluted with 0-10% Et in hexane. 2 Purified by column chromatography (silica gel) using O. The pure product fractions were combined and concentrated to give pure product 2 as a colorless oil (30.6 g, 89%). 1 H NMR(CDCl 3 , 400MHz) δ=5.42~5.21(m, 4H), 4.20(t, 2H), 3.06(s, 3H), 2.79(t, 2H), 2.19~2.00(m, 4H), 1.90~1.70(m, 2H), 1.06~1.18(m, 18H), 0.88(t, 3H). 13 C NMR(CDCl 3 )δ=130.76, 130.54, 128.6, 128.4, 70.67, 37.9, 32.05, 30.12, 29.87, 29.85, 29.68, 29.65, 29.53, 27.72, 27.71, 26.15, 25.94, 23.09, 14.60. MS:C 19 H 36 O 3 Calculated molecular weight of S: calculated value 344.53, actual value 343.52 (M-H - ).

[0334] Synthesis of 18-bromooctadeca-6,9-diene 3 Mesylate 2 (13.44 g, 39 mmol) was dissolved in anhydrous ether (500 mL) and added to MgBr.Et. 2 O complex (30.7 g, 118 mmol) was added under argon and the mixture was refluxed under argon for 26 hours after which time TLC showed completion of the reaction. The reaction mixture was diluted with ether (200 mL), ice water (200 mL) was added to the mixture and the layers were separated. organic layer to 1%K 2 C.O. 3 Washed with aqueous solution (100 mL), brine (100 mL), and dried (anhydrous Na 2 S.O. 4 ). The organic layer was concentrated to obtain the crude product, which was diluted with 0-1% Et in hexane. 2 Purification by column chromatography (silica gel) using O isolated bromo 3 (12.6 g, 94%) as a colorless oil. 1 H NMR(CDCl 3 , 400MHz) δ=5.41~5.29(m, 4H), 4.20(d, 2H), 3.40(t, J=7Hz, 2H), 2.77(t, J=6.6Hz, 2H), 2.09~2.02(m, 4H), 1.88~1.00(m, 2H), 1.46~1.27(m, 18H), 0.88(t, J=3.9Hz, 3H). 13 C NMR(CDCl 3 )δ=130.41, 130.25, 128.26, 128.12, 34.17, 33.05, 31.75, 29.82, 29.57, 29.54, 29.39, 28.95, 28.38, 27.42, 27.40, 25.84, 22.79, 14.28.

[0335] Synthesis of 18-cyanooctadeca-6,9-diene 4 To a solution of mesylate (3.44 g, 10 mmol) in ethanol (90 mL) was added a solution of KCN (1.32 g, 20 mmol) in water (10 mL) and the mixture was refluxed for 30 min, after which TLC of the reaction mixture showed no reaction. indicated completion, then ether (200 mL) was added to the reaction mixture followed by water. The reaction mixture was extracted with ether and the combined organic layers were washed with water (100 mL), brine (200 mL) and dried. Concentration of the organic layer yielded the crude product, which was purified by column chromatography (0-10% Et in hexanes). 2 Purified with O). Pure product 4 was isolated as a colorless oil (2g, 74%). 1 H NMR(CDCl 3 , 400MHz)δ=5.33~5.22(m, 4H), 2.70(t, 2H), 2.27~2.23(m, 2H), 2.00~1.95(m, 4H), 1.61~1.54(m, 2H), 1.39~ 1.20(m, 18H), 0.82(t, 3H). 13 C NMR(CDCl 3 )δ=130.20, 129.96, 128.08, 127.87, 119.78, 70.76, 66.02, 32.52, 29.82, 29.57, 29.33, 29.24, 29.19, 29.12, 28.73, 28.65, 27.20, 27.16, 25.62, 25.37, 22.56, 17.10, 14.06. MS:C 19 H 33 Calculated molecular weight of N: calculated value 275.47, actual value 276.6 (M-H - ).

[0336] Synthesis of heptatriaconta-6,9,28,31-tetraen-19-one 7 Freshly activated Mg turnings (0.144 g, 6 mmol) were added to a flame-dried 500 mL 2NRB flask and a magnetic stir bar and reflux condenser were attached to the flask. The apparatus was degassed and vented with argon and 10 mL of anhydrous ether was added to the flask via syringe. Bromide 3 (1.65 g, 5 mmol) was dissolved in anhydrous ether (10 mL) and added dropwise to the flask via syringe. An exothermic reaction was observed (to confirm / accelerate Grignard reagent formation, 2 mg of iodine was added and immediate decolorization was observed, confirming the formation of Grignard reagent) and reflux of the ether was started. After the addition was complete, the reaction mixture was maintained at 35° C. for 1 hour and then cooled in an ice bath. Cyanide 4 (1.38 g, 5 mmol) was dissolved in anhydrous ether (20 mL) and added dropwise to the reaction with stirring. An exothermic reaction was observed and the reaction mixture was stirred at ambient temperature overnight. The reaction was stopped by dropwise addition of 10 mL of acetone followed by ice-cold water (60 mL). Heat the reaction mixture in H until the solution is homogeneous and the layers are separated. 2 S.O. 4 Treated with aqueous solution (10% by volume, 200mL). The aqueous phase was extracted with ether (2x100mL). Dry the mixed ether layer (Na 2 S.O. 4 ) and concentration to give the crude product, which was purified by column (silica gel, 0-10% ether in hexanes) chromatography. The pure product fractions were evaporated to give pure ketone 7 as a colorless oil (2g, 74%). 1 H NMR(CDCl 3 , 400MHz) δ=5.33~5.21(m, 8H), 2.69(t, 4H), 2.30(t, 4H), 2.05~1.95(m, 8H), 1.55~1.45(m, 2H), 1.35~1.15( m, 18H), 0.82(t, 3H). 13 C NMR(CDCl 3 )δ=211.90, 130.63, 130.54, 128.47, 128.41, 43.27, 33.04, 32.01, 30.93, 29.89, 29.86, 29.75, 29.74, 27.69, 26.11, 24.35, 23.06, 14.05. MS:C 37 H 66 Calculated molecular weight of O: calculated value 526.92, actual value 528.02 (M+H + ).

[0337] Example 2. Separate synthesis of ketone 7 Scheme 2 [ka] Synthesis of compound 6b Freshly activated Mg turnings (2.4 g, 100 mmol) were added to a flame-dried 500 mL RB flask, and the flask was fitted with a magnetic stir bar, addition funnel, and reflux condenser. The apparatus was degassed and vented with argon and 10 mL of anhydrous ether was added to the flask via syringe. Bromide 3 (26.5 g, 80.47 mmol) was dissolved in anhydrous ether (50 mL) and added to the addition funnel. Approximately 5 mL of this ether solution was added to the Mg shavings with vigorous stirring. An exothermic reaction was observed (to confirm / accelerate Grignard reagent formation, 5 mg of iodine was added and immediate decolorization was observed, confirming the formation of Grignard reagent) and reflux of the ether was started. The remainder of the bromide solution was added dropwise while maintaining the reaction under gentle reflux by cooling the flask in water. After the addition was complete, the reaction mixture was maintained at 35° C. for 1 hour and then cooled in an ice bath. Ethyl formate (2.68 g, 36.2 mmol) was dissolved in anhydrous ether (40 mL), transferred to an addition funnel, and added dropwise to the reaction mixture with stirring. An exothermic reaction was observed and the reaction mixture began to reflux. After the start of the reaction, the remainder of the ethereal formic acid solution was quickly added as a fluid and the reaction mixture was stirred for an additional hour at ambient temperature. The reaction was stopped by dropwise addition of 10 mL of acetone followed by ice-cold water (60 mL). Heat the reaction mixture in H until the solution is homogeneous and the layers are separated. 2 S.O. 4 Treated with aqueous solution (10% by volume, 300mL). The aqueous phase was extracted with ether (2x100mL). Dry the mixed ether layer (Na 2 S.O. 4 ) and concentration to give the crude product, which was purified by column (silica gel, 0-10% ether in hexanes) chromatography. The slightly less polar fractions were concentrated to give formate ester 6a (1.9 g) and the pure product fractions were evaporated to give pure product 6b as a colorless oil (14.6 g, 78%). .

[0338] Synthesis of compound 7 CH 2 Cl 2 Freshly activated 4A molecular sieves (50 g) were added to a solution of alcohol 6b (3 g, 5.68 mmol) in (60 mL), and powdered PCC (4.9 g, 22.7 mmol) was added to this solution in portions over 20 min. were added in portions and the mixture was stirred for another hour (note: long reaction times lead to lower yields, so careful monitoring of the reaction is necessary to obtain good yields), then TLC of the reaction mixture was performed every 10 minutes (5% ether in hexanes). After the completion of the reaction, the reaction mixture was filtered through a pad of silica gel and the residue was purified with CH 2 Cl 2 (400 mL). The filtrate was concentrated and the crude product thus obtained was purified by column chromatography (silica gel, 1% Et in hexane). 2 Further purification at O) isolated pure product 7 (2.9 g, 97%) as a colorless oil. 1 H NMR(CDCl 3 , 400MHz) δ=5.33~5.21(m, 8H), 2.69(t, 4H), 2.30(t, 4H), 2.05~1.95(m, 8H), 1.55~1.45(m, 2H), 1.35~1.15( m, 18H), 0.82(t, 3H). 13 C NMR(CDCl 3 )δ=211.90, 130.63, 130.54, 128.47, 128.41, 43.27, 33.04, 32.01, 30.93, 29.89, 29.86, 29.75, 29.74, 27.69, 26.11, 24.35, 23.06, 14.05. MS:C 37 H 66 Calculated molecular weight of O: calculated value 526.92, actual value 528.02 (M+H + ).

[0339] Example 3. Synthesis of asymmetric ketones 25 and 27 Scheme 3 [ka] Synthesis of heptatriaconta-6,9,28-trien-19-one 25 Freshly activated Mg turnings (132 mg, 0.0054 mmol) were added to a dry 50 mL 2NRB flask and a magnetic stir bar and reflux condenser were attached to the flask. The apparatus was degassed and vented with nitrogen and 10 mL of anhydrous ether was added to the flask via syringe. Bromide 24 (1.8 g, 0.0054 mmol) was dissolved in anhydrous ether (10 mL) and added dropwise to the flask via syringe. An exothermic reaction was observed (the reaction was initiated with dibromoethane) and the ether began to reflux. After the addition was complete, the reaction mixture was maintained at 35°C for 1 hour and then cooled to 10-15°C in an ice bath. Cyanide 4 (0.5 g, 0.0018 mmol) was dissolved in dry THF (5 mL) and added dropwise to the reaction with stirring. An exothermic reaction was observed and the reaction mixture was refluxed (at 70°C) for 12 hours and quenched with ammonium chloride solution. The solution was then treated with 25% HCl solution until the solution became homogeneous and the layers were separated. The aqueous phase was extracted with ether (2x100mL). The combined ether layers were dried and concentrated to obtain the crude product, which was purified by column chromatography. The pure product fractions were evaporated to give pure ketone 25 as a colorless oil. Yield: 0.230g (24%). 1H-NMR (CDCl3, 400MHz): δ=5.37~5.30(m, 6H), 2.77~2.74(t, 2H), 2.38~2.34(t, 4H), 2.05~1.95(m, 8H), 1.56~1.52 (m, 4H), 1.35~1.25 (m, aliphatic proton), 0.89~0.85 (t, 6H). IR(cm-1):2924, 2854, 1717, 1465, 1049, 721.

[0340] Synthesis of heptatriaconta-6,9-dien-19-one 27 Add freshly activated Mg turnings (0.144 g, 6 mmol) to a flame-dried 500 mL 2NRB flask and attach a magnetic stir bar and reflux condenser to the flask. Degas and vent the apparatus with argon and add 10 mL of anhydrous ether to the flask via syringe. Commercially available bromide 26 (2.65 g, 5 mmol) is dissolved in anhydrous ether (10 mL) and added dropwise to the flask with a syringe. After the addition is complete, the reaction mixture is maintained at 35° C. for 1 hour and then cooled in an ice bath. Cyanide 4 (1.38 g, 5 mmol) is dissolved in anhydrous ether (20 mL) and added dropwise to the reaction with stirring. An exothermic reaction is observed and the reaction mixture is stirred overnight at ambient temperature. The reaction is stopped by dropwise addition of 10 mL of acetone followed by ice-cold water (60 mL). Heat the reaction mixture in H until the solution is homogeneous and the layers are separated. 2 S.O. 4 Treat with aqueous solution (10% by volume, 200 mL). The aqueous phase is extracted with ether (2 x 100 mL). Dry the mixed ether layer (Na 2 S.O. 4 ) and concentration to obtain the crude product, which is purified by column chromatography to obtain pure ketone 27 as a colorless oil. 1H-NMR (CDCl3, 400MHz): δ=5.42~5.30(m, 4H), 2.79~2.78(t, 2H), 2.40~2.37(t, 4H), 2.08~2.03(m, 4H), 1.58~1.54 (m, 4H), 1.36~1.26 (br m, aliphatic proton), 0.91~0.87 (t, 6H). IR(cm-1):2924, 2854, 1716, 1465, 1375, 721.

[0341] Example 4.C 12 Synthesis of asymmetric ketones with chains Scheme 4 [ka] Freshly activated Mg turnings (175 mg, 0.0072 mmol) were added to a dry 50 mL 2NRB flask and a magnetic stir bar and reflux condenser were attached to the flask. The apparatus was degassed and vented with nitrogen and 10 mL of anhydrous ether was added to the flask via syringe. Bromide 28 (1.5 g, 0.006 mmol) was dissolved in anhydrous ether (7 mL) and added dropwise to the flask via syringe. An exothermic reaction was observed (the reaction was initiated with dibromoethane) and the ether began to reflux. After the addition was complete, the reaction mixture was maintained at 35°C for 1 hour and then cooled to 10-15°C in an ice bath. Cyanide 4 (1 g, 0.0036 mmol) was dissolved in anhydrous ether (7 mL) and added dropwise to the reaction with stirring. An exothermic reaction was observed and the reaction mixture was refluxed for 12 hours and quenched with ammonium chloride solution. The solution was then treated with 25% HCl solution until the solution became homogeneous and the layers were separated. The aqueous phase was extracted with ether. The combined ether layers were dried and concentrated to obtain the crude product, which was purified by column chromatography. The pure product fractions were evaporated to give pure ketone 29 as a colorless oil. Yield: 0.65g (26%). 1 H~NMR(δppm): 5.388~5.302(m, 4H), 2.77~2.74(t, 2H), 2.38~2.34(t, 4H), 2.04~2.01(m, 4H), 1.34~1.18(m, 36H) ), 0.89~0.85(m, 6H). IR(cm -1 ):3009, 2920, 2851, 1711(C=O), 1466, 1376, 1261.

[0342] Example 5.C 10 Synthesis of asymmetric ketone 31 with chains scheme 5 [ka] Freshly activated Mg turnings (266 mg, 0.0109 mmol) were added to a dry 50 mL 2NRB flask and a magnetic stir bar and reflux condenser were attached to the flask. The apparatus was degassed and vented with nitrogen and 10 mL of anhydrous ether was added to the flask via syringe. Bromide (2.43 g, 0.0109 mmol) was dissolved in anhydrous ether (7 mL) and added dropwise to the flask via syringe. An exothermic reaction was observed (the reaction was initiated with dibromoethane) and the ether began to reflux. After the addition was complete, the reaction mixture was maintained at 35°C for 1 hour and then cooled to 10-15°C in an ice bath. Cyanide (1 g, 0.0036 mmol) was dissolved in anhydrous ether (7 mL) and added dropwise to the reaction with stirring. An exothermic reaction was observed and the reaction mixture was stirred at ambient temperature for 2 hours. THF (4 mL) was added to the reaction mixture and it was warmed to 45-50 °C for 4 h until the cyano derivative was completely consumed. The reaction was stopped by dropwise addition of 3 mL of acetone followed by ice-cold water. The reaction mixture was then treated with 25% HCl solution until the solution became homogeneous and the layers were separated. The aqueous phase was extracted with ether. The combined ether layers were dried and concentrated to obtain the crude product, which was purified by column chromatography. The pure product fractions were evaporated to give the pure ketone as a colorless oil. Yield: 0.93g (61%). 1 H-NMR (δppm): 5.37~5.302(m, 4H), 2.77~2.74(t, 2H), 2.38~2.34(t, 4H), 2.05~2.00(m, 4H), 1.55~1.52(m, 2H) ), 1.35~1.24(m, 34H), 0.89~0.84(m6H). IR(cm -1 ):3009, 2925, 2854, 1717(C=O), 1465, 1376.

[0343] Example 6. Synthesis of asymmetric ketone 33 with cholesterol scheme 6 [ka] Using a procedure similar to that used for the synthesis of ketone 31, ketone 33 was obtained by converting cholesteryl chloride to the corresponding magnesium chloride, followed by addition to linoleyl cyanide.

[0344] Example 7. Synthesis of asymmetric ketone 35 with cholesterol scheme 7 [ka] Treatment of cholesterol chloroformate with 3-bromopropylamine gave bromide 34, which was converted to the corresponding Grignard reagent 34a, which was then treated with linoleyl cyanide to give the corresponding unsymmetrical ketone 35. Obtained in yield.

[0345] Example 8. Synthesis of asymmetric ketone 40 scheme 8 [ka]

[0346] Synthesis of compound 37 LiAlH 4 To a 500 mL two-necked RBF containing (1.02 g, 0.0269 mol) was added anhydrous THF (20 mL) at room temperature under nitrogen atmosphere. The suspension was stirred at room temperature for 1 hour and then cooled to 0°C. To this mixture was slowly added a solution of compound 1 (5 g, 0.01798 mol) in anhydrous THF (50 mL) while maintaining the internal temperature at 0 °C. After the addition was complete, the reaction mixture was warmed to ambient temperature and stirred for 1 hour. The progress of the reaction was monitored by TLC. Once the reaction is complete, the mixture is cooled to 0 °C and saturated Na 2 S.O. 4 The reaction was stopped with an aqueous solution. The reaction mixture was stirred for 30 minutes and the solid formed was filtered through a bed of Celite and washed with ethyl acetate (100 mL). The filtrate and washings were combined and evaporated on a rotary evaporator to yield compound 37 as a colorless liquid, which was used directly in the next step without any purification. Yield: (4.5g, 95%). 1 H NMR (400MHz, CDCl 3 )δ=5.39~5.28(m, 6H), 3.64~3.61(t, 2H), 2.81~2.78(t, 4H), 2.10~2.01(m, 4H), 1.59~1.51(m, 2H), 1.29~ 1.22 (m, aliphatic proton), 0.98~0.94 (t, 3H).

[0347] Synthesis of compound 38 Compound 37 (14 g, 0.0530 mol) was dissolved in DCM (300 mL) in 500 mL two-neck RBF and cooled to 0°C. To this solution was added triethylamine (29.5 mL, 0.2121 mol) slowly under an inert atmosphere. The reaction mixture was then stirred for 10-15 minutes and mesyl chloride (6.17 mL, 0.0795 mol) was slowly added to it. After the addition was complete, the reaction mixture was allowed to warm to ambient temperature and stirred for 20 hours. The reaction was monitored by TLC. Once complete, the reaction mixture was diluted with water (200 mL), stirred for a few minutes, and the organic layer was separated. The organic phase was further washed with brine (1 x 70 mL) and washed with Na 2 S.O. 4 and the solvent was removed on a rotary evaporator to yield crude compound 38 as a brown oil, which was used directly in the next reaction. Yield: (17g, 93%). 1 H NMR (400MHz, CDCl3 )δ=5.39~5.31(m, 6H), 4.22~4.19(t, 2H), 2.99(s, 3H), 2.81~2.78(m, 4H), 2.08~2.01(m, 4H), 1.75.1.69( m, 2H), 1.39~1.29 (m, aliphatic proton), 0.98~0.94 (t, 3H).

[0348] Synthesis of compound 39 Mesylate 38 (10 g, 0.2923 mol) in 1000 mL two-necked RBF and MgBr 2 of anhydrous ether (300 mL). Et 2 O complex (22.63g, 0.0877mol) was added thereto under nitrogen atmosphere. The resulting mixture was then heated to reflux for 26 hours. After completion of the reaction (by TLC), the reaction mixture was diluted with ether (300 mL) and ice water (200 mL) and the ether layer was separated. Then the organic layer was 1%K 2 C.O. 3 Washed with aqueous solution (100 mL) followed by brine (80 mL). Then, the organic phase was diluted with anhydrous Na 2 S.O. 4 and evaporation of the solvent under reduced pressure to obtain the crude material, which was chromatographed on silica gel (60-120 mesh) using 0-1% ethyl acetate in hexane as the elution system to obtain the desired compound. 39 was obtained as an oil. Yield: (7g, 73%). 1 H NMR (400MHz, CDCl 3 )δ=5.39~5.31(m, 6H), 3.41~3.37(t, 2H), 2.81~2.78(m, 4H), 2.08~2.02(m, 4H), 1.86~1.80(m, 2H), 1.42~ 1.29(m, aliphatic proton), 0.98~0.94(t, 3H).

[0349] Synthesis of asymmetric ketone 40 A flame-dried 500 mL two-necked RBF was equipped with a magnetic stirrer and reflux condenser and freshly activated Mg cuttings (0.88 g, 0.03636 mol) were added. The apparatus was degassed with argon, vented, and ether (150 mL) was added to it. A few drops of bromo compound 4 (11.89 g, 0.03636 mol) in 50 mL ether were initially added to initiate the reaction (note: a catalytic amount of 1,2-dibromoethane was added to accelerate the formation of the Grignard reagent). was also added). At the start, the remaining solution of the bromo compound was slowly added to the refluxing ether solution. After the addition was complete, the reaction mixture was refluxed at 40° C. for 1.5 hours. It was then cooled to 10° C. and linoleyl cyanide 4 (5 g, 0.01818 mol) in 30 mL dry ether was added dropwise, after which the resulting mixture was heated to reflux at 40° C. for 20 hours. The progress of the reaction was monitored by TLC. After complete consumption of cyano derivative 40 (by TLC), the mixture was cooled to room temperature and quenched with 30 mL of acetone followed by ice water (50 mL). The solution was further acidified with 10% HCl solution and the ether layer was separated. The aqueous phase was further extracted with diethyl ether (2 x 100 mL). Anhydrous Na 2 S.O. 4 The crude ketone was obtained by removing the solvent after drying with The title compound 40 was obtained as . Yield: (4.8g, 50.5%). 1 H NMR (400MHz, CDCl 3 )δ=5.38~5.28(m, 10H), 2.80~2.74(m, 6H), 2.38~2.34(t, 4H), 2.08~2.00(m, 8H), 1.55~1.52(m, 4H), 1.35~ 1.26 (m, aliphatic proton), 0.98~0.94 (t, 3H), 0.89~0.85 (t, 3H). HPLC-98.04%.

[0350] Example 9. Oligonucleotide synthesis: All oligonucleotides were synthesized on an AKTA oligopilot synthesizer. Oligonucleotides were synthesized using a commercially available glass solid support with controlled pores (dT-CPG, 500 Å, Prime Synthesis) and RNA phosphoramidites with the following standard protecting groups: 5'- O-dimethoxytrityl N6-benzoyl-2'-t-butyldimethylsilyl-adenosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2' -t-Butyldimethylsilyl-cytidine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, 5'-O-dimethoxytrityl-N2--isobutryl-2'-t-butyldimethylsilyl -guanosine-3'-O-N,N'-diisopropyl-2-cyanoethylphosphoramidite, and 5'-O-dimethoxytrityl-2'-t-butyldimethylsilyl-uridine-3'-O-N,N'-diisopropyl- 2-cyanoethyl phosphoramidite (manufactured by Pierce Nucleic Acids Technologies). 2'-F phosphoramidite, 5'-O-dimethoxytrityl-N4-acetyl-2'-fluoro-cytidine-3'-O-N,N'-diisopropyl-2-cyanoethyl-phosphoramidite, and 5'-O-dimethoxytrityl- 2'-Fluoro-uridine-3'-O-N,N'-diisopropyl-2-cyanoethyl-phosphoramidite was purchased from (Promega). All phosphoramidites were prepared in acetonitrile (CH 3 It was used at a concentration of 0.2M in CN). A 16 minute bond / reuse time was used. The activator was 5-ethylthiotetrazole (0.75M, American International Chemicals), and for PO oxidation, iodine / water / pyridine was used, and 2,6-lutidine / ACN (1:1 volume / PS oxidized PADS (2%) in volume) was used.

[0351] The 3'-ligand binding chain was synthesized using a solid support containing the corresponding ligand. For example, the introduction of cholesterol units into the sequence was performed from hydroxyprolinol-cholesterol phosphoramidites. Cholesterol was attached to trans-4-hydroxyprolinol via a 6-aminohexanoate linkage to yield the hydroxyprolinol-cholesterol moiety. 5'-terminal Cy-3 and Cy-5.5 (fluorophore) labeled siRNAs were synthesized from the corresponding Quasar-570 (Cy-3) phosphoramidites purchased from Biosearch Technologies. Attachment of the ligand to the 5'-terminus or internal position is performed using an appropriately protected ligand-phosphoramidite base unit using anhydrous CH 3 This is achieved by prolonged binding of a 0.1 M phosphoramidite solution in CN to solid-bound oligonucleotides for 15 minutes. Oxidation of internucleotide phosphites to phosphate esters has been reported (1) using standard iodine-water or tert-butyl hydroperoxide / acetonitrile / water (10:87:3). This was carried out by treating the bound oligonucleotides with a 10 minute oxidation wait time. Phosphorothioate was introduced by oxidizing the phosphite to phosphorothioate by using a sulfur transfer reagent such as DDTT (purchased from AM Chemicals), PADS, or Beaucage reagent. Cholesterol phosphoramidites were synthesized in-house and used at a concentration of 0.1 M in dichloromethane. Binding time for cholesterol phosphoramidites was 16 minutes.

[0352] After the synthesis was completed, the support was transferred to a 100 mL glass bottle (manufactured by VWR). The oligonucleotide was cleaved from the support using 80 mL of an ethanolic ammonia mixture [ammonia:ethanol (3:1)] at 55° C. for 6.5 hours, simultaneously deprotecting the base and phosphate groups. The bottle was briefly cooled on ice, after which the ethanolic ammonia mixture was filtered into a new 250 mL bottle. CPG was washed with 2 x 40 mL volumes of ethanol / water (1:1 vol / vol). The volume of the mixture was then reduced to approximately 30 mL by roto-vap. The mixture was then frozen in a dyince and dried using a speed vac under reduced pressure.

[0353] The dried residue was resuspended in 26 mL of triethylamine, triethylamine trihydrofluoride (TEA.3HF), or pyridine-HF, and DMSO (3:4:6) and heated to 60 °C for 90 min. The tert-butyldimethylsilyl (TBDMS) group at position was removed. The reaction was then stopped with 50 mL of 20 mM sodium acetate, the pH was adjusted to 6.5, and the mixture was stored in the freezer until purification.

[0354] Oligonucleotides are analyzed by high performance liquid chromatography (HPLC) before purification, and the choice of buffer and column depends on the sequence and / or the nature of the bound ligand.

[0355] Ligand-bound oligonucleotides were purified by preparative reverse phase HPLC. Unbound oligonucleotides were purified by anion exchange HPLC on in-house packed TSK gel columns. Buffer is 10% CH 3 20mM sodium phosphate (pH 8.5) in CN (buffer A), and 10% CH 3CN, 20 mM sodium phosphate (pH 8.5) in 1 M NaBr (buffer B). Fractions containing full-length oligonucleotides were pooled, desalted, and lyophilized. Approximately 0.15 OD of desalted oligonucleotide was diluted with water to 150 μl and then pipetted into special vials for CGE and LC / MS analysis. The compounds were finally analyzed by LC-ESMS and CGE.

[0356] For siRNA preparation, equimolar amounts of sense and antisense strands were heated to 95° C. for 5 minutes in 1× PBS and slowly cooled to room temperature. Duplex integrity was confirmed by HPLC analysis. [Table 6]

[0357] Example 10: Serum stability assay of siRNA A medium-throughput assay of initial sequence-based stability selection was performed with a "full stain" method. To perform the assay, siRNA duplexes were incubated in 90% human serum at 37°C. Samples of the reaction mixture were stopped at various time points (0 min, 15, 30, 60, 120, and 240 min) and subjected to electrophoretic analysis (Figure 1). RNA cleavage over time provided information on the susceptibility of siRNA duplexes to serum nuclease degradation.

[0358] siRNA cleavage events were further characterized using radioisotope-labeled dsRNA and serum stability assays. First, either the sense or antisense strand of the siRNA duplex is 32 The 5' end was labeled with P. Labeled siRNA duplexes were incubated with 90% human serum at 37°C, and samples of the solution were removed at small intervals to stop the reaction. Samples were analyzed by electrophoresis.

[0359] Example 11: In vivo evaluation of FVII using cationic lipid-derived liposomes In vivo rodent factor VII and ApoB silencing experiments. C57BL / 6 mice (Charles River Labs, MA) and Sprague-Dawley rats (Charles River Labs, MA) received either 0.01 mL / g volume of saline or siRNA in the desired formulation. were received by tail vein injection. At various times post-dose, animals were anesthetized by isofluorane inhalation and blood was collected by retroorbital bleeding into serum separation tubes. Serum levels of factor VII protein in the samples were determined using a chromogenic assay (Coaset Factor VII, DiaPharma Group, OH, or Biophen FVII, Aniara Corporation, OH) according to the manufacturer's protocol. did. Serum collected from saline-treated animals was used to generate a standard curve. For experiments in which liver mRNA levels were assessed, animals were sacrificed and livers were harvested and flash frozen in liquid nitrogen at various time points post-dose. Frozen liver tissue was ground into powder. Tissue lysis products were prepared and hepatic mRNA levels of factor VII and apoB were determined using a branched DNA assay (QuantiGene Assay, Panomics, CA).

[0360] Example 12. Preparation of 1,2-di-O-alkyl-sn3-carbomoylglyceride (PEG-DMG) [ka] Preparation of IVa 1,2-di-O-tetradecyl-sn-glyceride Ia (30 g, 61.80 mmol) and N,N'-succinimidylcarboante (DSC, 23.76 g, 1.5 eq.) were dissolved in dichloromethane (DCM, 500 mL). ) and stirred over an ice-water mixture. Triethylamine (TEA, 25.30 mL, 3 eq.) was added to the stirring solution, then the reaction mixture was allowed to stir overnight at ambient temperature. The progress of the reaction was monitored by TLC. The reaction mixture was diluted with DCM (400 mL) and the organic layer was diluted with water (2 x 500 mL), NaHCO 3 Washed with aqueous solution (500 mL) followed by standard work-up. The resulting residue was dried under high vacuum at ambient temperature overnight. After drying the crude carbonate IIa thus obtained, it was dissolved in dichloromethane (500 mL) and stirred on an ice bath. Add mPEG to this stirred solution. 2000 -NH 2 (III, 103.00 g, 47.20 mmol, purchased from NOF Corporation, Japan) and anhydrous pyridine (Py, 80 mL, excess) were added under argon. The reaction mixture was then allowed to stir overnight at ambient temperature. The solvent and volatiles were removed under reduced pressure and the residue was dissolved in DCM (200 mL) and loaded onto a silica gel column packed with ethyl acetate. The column was eluted first with ethyl acetate and then with a gradient of 5-10% methanol in dichloromethane to yield the desired PEG-lipid IVa as a white solid (105.30 g, 83%). 1 H NMR(CDCl 3 , 400MHz) δ=5.20~5.12(m, 1H), 4.18~4.01(m, 2H), 3.80~3.70(m, 2H), 3.70~3.20(m, -O-CH 2 -CH 2 -O-, PEG-CH 2 ), 2.10~2.01(m, 2H), 1.70~1.60(m, 2H), 1.56~1.45(m, 4H), 1.31~1.15(m, 48H), 0.84(t, J=6.5Hz, 6H). MS actual value range: 2660~2836.

[0361] Preparation of IVb 1,2-di-O-hexadecyl-sn-glyceride Ib (1.00 g, 1.848 mmol) and DSC (0.710 g, 1.5 eq.) were combined in dichloromethane (20 mL) and cooled to 0° C. with an ice-water mixture. Triethylamine (1.00 mL, 3 eq.) was added and the reaction was stirred overnight. The reaction was followed by TLC, diluted with DCM, water (2x), NaHCO 3 Washed with solution and dried with sodium sulfate. The solvent was removed under reduced pressure and the resulting residue of IIb was kept under high vacuum overnight. This compound was used directly in the next reaction without further purification. MPEG 2000 -NH 2 III (1.50 g, 0.687 mmol, purchased from NOF Corporation, Japan) and IIb (0.702 g, 1.5 eq.) were dissolved in dichloromethane (20 mL) under argon. The reaction was cooled to 0°C. Pyridine (1 mL, excess) was added and the reaction was stirred overnight. The reaction was monitored by TLC. The solvent and volatiles were removed under reduced pressure and the residue was purified by chromatography (initially ethyl acetate then 5-10% MeOH / DCM as gradient elution) to give the desired compound IVb as a white solid (1.46 g , 76%). 1 H NMR(CDCl 3 , 400MHz) δ=5.17(t, J=5.5Hz, 1H), 4.13(dd, J=4.00Hz, 11.00Hz, 1H), 4.05(dd, J=5.00Hz, 11.00Hz, 1H), 3.82~3.75 (m, 2H), 3.70~3.20(m, -O-CH 2 -CH 2 -O-, PEG-CH 2 ), 2.05~1.90(m, 2H), 1.80~1.70(m, 2H), 1.61~1.45(m, 6H), 1.35~1.17(m, 56H), 0.85(t, J=6.5Hz, 6H). MS actual value range: 2716~2892.

[0362] Preparation of IVc 1,2-Di-O-octadecyl-sn-glyceride Ic (4.00 g, 6.70 mmol) and DSC (2.58 g, 1.5 eq.) were combined in dichloromethane (20 mL) and cooled to 0° C. with an ice-water mixture. Triethylamine (2.75 mL, 3 eq.) was added and the reaction was stirred overnight. The reaction was followed by TLC, diluted with DCM, water (2x), NaHCO 3 Washed with solution and dried with sodium sulfate. The solvent was removed under reduced pressure and the residue was kept under high vacuum overnight. This compound was used directly in the next reaction without further purification. MPEG 2000 -NH 2 III (1.50 g, 0.687 mmol, purchased from NOF Corporation, Japan) and IIc (0.760 g, 1.5 eq.) were dissolved in dichloromethane (20 mL) under argon. The reaction was cooled to 0°C. Pyridine (1 mL, excess) was added and the reaction was stirred overnight. The reaction was monitored by TLC. The solvent and volatiles were removed under reduced pressure and the residue was purified by chromatography (ethyl acetate followed by 5-10% MeOH / DCM as gradient elution) to give the desired compound IVc as a white solid (0.92 g, 48 %). 1 H NMR(CDCl 3 , 400MHz) δ=5.22~5.15(m, 1H), 4.16(dd, J=4.00Hz, 11.00Hz, 1H), 4.06(dd, J=5.00Hz, 11.00Hz, 1H), 3.81~3.75(m, 2H), 3.70~3.20(m, -O-CH 2 -CH 2 -O-, PEG-CH 2 ), 1.80~1.70(m, 2H), 1.60~1.48(m, 4H), 1.31~1.15(m, 64H), 0.85(t, J=6.5Hz, 6H). MS actual value range: 2774~2948.

[0363] Example 13: [ka] Synthesis of 2005: To a solution of 2004 (50 g, 95 mmol) in DCM (400 mL) under Ar atmosphere, add TEA (53 mL, 378 mmol) and DMAP (1.2 g, 9.5 mmol) and stir at room temperature under Ar atmosphere. did. The reaction was cooled to −5° C. and a solution of mesyl chloride (15 mL, 190 mmol) in DCM (100 mL) was added slowly at a temperature below −5° C. and allowed to warm to room temperature after addition. After 30 minutes (TLC), the reaction was quenched with ice-cold water (20 mL). The organic layer was separated, washed with 1N HCl (30 mL), water, brine, dried over sodium sulfate, and evaporated under reduced pressure to give the pure product (55 g, 95.5%) as a yellow liquid. 1H NMR (400MHz, CDCl 3 ): δ0.89(t, 6H, J=6.8), 1.2~1.5(m, 36H), 1.67(m, 4H), 2.05(q, 8H, J1=6.8, J2=6.8), 2.77(t, 4H, J=6.4), 2.99(s, 3H), 4.71(m, 1H), and 5.36(m, 8H).

[0364] Synthesis 2006: NaN to a solution of 2005 (50 g, 82 mmol) in DMF (500 mL) under an argon atmosphere. 3 (27 g, 410 mmol) was added and heated to 70° C. and the temperature was maintained for 4 hours (TLC). The mixture was diluted with water and extracted with ethyl acetate (3 x 250 mL). The organic layer was washed with water, brine, and Na 2 S.O. 4 and evaporation under reduced pressure to give the crude product, which was purified by silica gel chromatography using hexane / ethyl acetate as eluent. The product was eluted with 2% ether in hexane to give 2006 (36 g, 86%) as a pale yellow liquid. 1 H NMR (400MHz, CDCl3): δ0.90(t, 8H), 1.30(m, 36H), 1.49(t, 4H, J=6.4Hz), 2.04(q, 8H, J1=7.6, J2=14Hz) , 2.77 (t, 4H, J=6.4Hz), 3.22 (m, 1H), 5.34 (m, 8H). 13 C NMR (400MHz, CDCl 3 ): δ14.1, 22.5, 25.6, 26.1, 27.2, 29.2, 29.3, 29.45, 29.65, 31.5, 34.1, 63.1, 127.9, and 130.1. IR(KBr):2098.

[0365] Example 14 siRNA formulation using preformed vesicles Particles containing cationic lipids were fabricated using a preformed vesicle method. Cationic lipids, DSPC, cholesterol, and PEG lipids were solubilized in ethanol in molar ratios of 40 / 10 / 40 / 10, respectively. The lipid mixture was mixed into a buffered aqueous solution (50 mM citric acid, pH 4) to a final ethanol and lipid concentration of 30% (vol / vol) and 6.1 mg / mL, respectively, and equilibrated for 2 min at room temperature before extrusion. Ta. Hydrated lipids were grown in two stacked molds at 22°C using a Lipex Extruder (Northern Lipids, Vancouver, British Columbia) until a vesicle diameter of 70-90 nm was obtained as determined by Nicomp analysis. It was extruded through an 80 nm pore size filter (manufactured by Nuclepore). This generally required one to three passes. For some cationic lipid mixtures that did not form small vesicles, hydrate the lipid mixture with a lower pH buffer (50 mM citric acid, pH 3) to protonate the phosphate groups of the DSPC headgroup. This helped in the formation of stable 70-90 nm vesicles.

[0366] FVII siRNA (solubilized in 50 mM citric acid, pH 4 aqueous solution containing 30% ethanol) was added to vesicles previously equilibrated to 35° C. with mixing at a rate of approximately 5 mL / min. After a final target siRNA / lipid ratio of 0.06 (wt / wt) was achieved, the mixture was incubated for an additional 30 min at 35°C to allow vesicle reconstitution and encapsulation of FVII siRNA. The ethanol was then removed and the external buffer was replaced with PBS (155mM NaCl, 3mM Na2HPO4, 1mM KH2PO4, pH 7.5) either by dialysis or tangential flow diafiltration. The final encapsulated siRNA to lipid ratio was determined after removing unencapsulated siRNA using size exclusion or ion exchange spin columns.

[0367] Example 15: In vivo determination of efficacy of novel lipid formulations The test formulation was tested for FVII knockdown in female C57Bl / 6 mice, 7-9 weeks old, 15-25 g, at 0.1, 0.3, 1.0, and 5.0 mg / kg with 3 mice per treatment group. Initial evaluation was carried out. All studies included animals receiving either phosphate buffered saline (PBS, control group) or the benchmark formulation. The formulations were diluted to the appropriate concentration in PBS immediately before testing. The mice were weighed and the appropriate dosing volume was calculated (10 μl / g body weight). Test and benchmark formulations and PBS (for control animals) were administered intravenously into the lateral tail vein. After 24 hours, animals were anesthetized with an intraperitoneal injection of ketamine / xylazine, and 500-700 μl of blood was collected by cardiac puncture into serum separation tubes (BD Microtainer). Blood was centrifuged at 2,000 × g for 10 min at 15°C, and serum was collected and stored at −70°C until analysis. Serum samples were thawed at 37°C for 30 min, diluted in PBS, and aliquoted into 96-well assay plates. Factor VII levels were assessed using a chromogenic assay (Biophen FVII kit, Hyphen BioMed) according to the manufacturer's instructions and absorbance measured on a microplate reader equipped with a 405 nm wavelength filter. Plasma FVII levels were quantified and the ED50 (dose resulting in a 50% reduction in plasma FVII levels compared to control animals) was calculated using a standard curve generated from pooled serum samples of control animals. Targeted formulations showing high levels of FVII knockdown (ED50<<0.1 mg / kg) were retested in an independent study at a lower dose range to confirm efficacy and establish an ED50.

[0368] Figure 3 provides a table showing the EC50s of exemplary compounds tested using this method.

[0369] Example 15A: Determination of pKa of formulated lipids The pKa of various ionizable cationic lipids is 2-(p-toluidino)-6-naphthalenesulfonic acid, a fluorescent probe that is nonfluorescent in water but becomes detectably fluorescent when bound to membranes. (TNS), essentially as described in (Eastman et al 1992 Biochemistry 31:4262-4268). Vesicles composed of cationic lipid / DSPC / CH / PEG-c-DOMG (40:10:40:10 molar ratio) were incubated in buffers (130mM NaCl, 10mM CH 3 COONH 4 , 10mM ME, 10mM HEPES) to 0.1mM. An equal volume of TNS aqueous solution (1 μM final) was added to the diluted vesicles, and after a 30 second equilibration period, the fluorescence of the TNS-containing solution was measured at excitation and emission wavelengths of 321 nm and 445 nm, respectively. The pKa of cationic lipid-containing vesicles was determined by plotting the measured fluorescence against the pH of the solution and fitting the data to a sigmoidal curve using the commercial graphing program IgorPro.

[0370] Figure 3 provides a table showing the pKa of exemplary compounds tested using this method.

[0371] Example 16: Synthesis of guanidium-conjugated lipids Guanidium analogue Preparation of compound 7204 [ka] Pyrazole carboxamidine, HCl, DIPEA Preparation of compound 7013: 1,2,4-butanetriol (7012, 21.2 g, 200 mmol, 5.0 eq.), dilinoleyl ketone (21.0 g, 40.0 mmol, 1.0 eq.), and p-toluenesulfonic acid in toluene. A mixture of (0.76 g, 4.0 mmol, 0.1 eq.) was refluxed overnight under Dean-stock conditions. After completion of the reaction, it is cooled, the solvent is evaporated and purified by column chromatography using hexane and ethyl acetate (15%) as a gradient to give the desired ketal (7013) as an oil in 47% yield. Obtained. 1 H NMR (400MHz, CDCl 3 )δ5.48~5.24(m, 8H), 4.32~4.17(m, 1H), 4.08(dd, J=7.8, 6.1, 1H), 3.86~3.74(m, 2H), 3.53(t, J=8.0 , 1H), 2.77(t, J=6.4, 4H), 2.30~2.19(m, 1H), 2.05(q, J=6.8, 8H), 1.88~1.75(m, 2H), 1.69~1.51(m, 4H), 1.42~1.19(m, 36H), 0.89(t, J=6.8, 6H). C 41 H 74 O 3 Calculated mass value of 614.5; actual value of 637.3 (+Na).

[0372] Synthesis of Compound 7201: To a solution of compound 7013 (11.6 g, 18.9 mmol, 1.0 eq.) and triethylamine (5.45 mL, 37.7 mmol, 2.0 eq.) in dichloromethane at 0° C., methanesulfonyl chloride (1.74 mL, 22.67 mmol, 1.2 eq.) ) was added dropwise and the reaction continued for 1 hour at room temperature. After the reaction is complete, wash with water, brine, and combine the organics with MgSO 4 It was dried. The concentrated mixture was purified by column chromatography using hexane and ethyl acetate (20%) as a gradient to give the pure mesylated derivative (7201) as an oil in 93% yield. 1 H NMR (400MHz, CDCl 3 )δ5.48~5.22(m, 8H), 4.35(qd, J=10.0, 4.9, 2H), 4.25~4.14(m, 1H), 4.13~4.03(m, 1H), 3.53(t, J=7.6 , 1H), 3.02(s, 3H), 2.77(t, J=6.4, 4H), 2.13~1.85(m, 10H), 1.57(dd, J=18.2, 9.2, 4H), 1.44~1.15(m, 36H), 0.89(t, J=6.7, 6H). C 42 H 76 O 5 The calculated mass value of S is 693.1; the actual value is 693.2.

[0373] Synthesis of compound 7202: A solution of compound 7201 (2.0 g, 3.0 mmol, 1.0 eq.) in DMF was added with solid NaN. 3 (0.98 g, 15.0 mmol, 5.0 eq.) was added and the reaction was continued at 65° C. until completion. The reaction mixture was poured into ice water, extracted into ethyl acetate, and the combined organics were diluted with Na 2 S.O. 4 , concentrated and purified by column chromatography using hexane and ethyl acetate (5%) as a gradient to give the pure azide (7202) derivative in 89% yield. 1 H NMR (400MHz, CDCl 3 )δ5.53~5.19(m, 8H), 4.21~3.97(m, 2H), 3.57~3.29(m, 3H), 2.76(t, J=6.4, 4H), 2.04(q, J=6.8, 8H) ), 1.80(m, 2H), 1.66~1.43(m, 4H), 1.40~1.07(m, 36H), 0.88(t, J=6.8, 6H). C 41 H 73 N 3 O 2 The calculated mass value is 640.0; the actual value is 612.5(-N 2 ).

[0374] Synthesis of Compound 7203: To a solution of Compound 7202 (1.7 g, 2.65 mmol, 1.0 eq) in anhydrous tetrahydrofuran was added a 1M solution of LAH (3.98 mL, 3.98 mmol, 1.5 eq) dropwise at 0°C. The reaction was continued at room temperature and after completion of the reaction, Na 2 S.O. 4 The reaction was slowly quenched at 0°C with a saturated solution of. The compound was extracted into excess ethyl acetate and the organic layer was washed with brine and Na 2 S.O. 4 Drying, concentration and further drying in vacuo afforded the pure amine (7203) in 90% yield, which was used directly without further purification. 1 H NMR (400MHz, CDCl 3 )δ5.51~5.16(m, 8H), 4.13(dd, J=9.3, 3.6, 1H), 4.03(dd, J=7.5, 6.1, 1H), 3.46(t, J=7.8, 1H), 2.96 ~2.67(m, 6H), 2.20~1.92(m, 8H), 1.82~1.49(m, 6H), 1.46~1.12(m, 38H), 0.88(t, J=6.8, 6H). C 41 H 75 NO. 2 The calculated mass value is 614.0; the measured value is 614.5.

[0375] Synthesis of compound 7204 (ALNY-232): A solution of amine 7203 (0.61 g, 1.0 mmol, 1.0 equiv.) and DIPEA (1.84 mL, 10.0 mmol, 10.0 equiv.) in a mixed solvent (DCM:DMF) was added with 1H-pyrazole. -1-Carboxamidine hydrochloride (1.46 g, 10.0 mmol, 10.0 eq.) was added in portions at room temperature under an argon atmosphere. The reaction was continued overnight and after completion of the reaction it was poured onto ice and extracted with ethyl acetate. Wash the mixed organics with water, brine, and remove Na 2 S.O. 4 and purified by preparative chromatography to yield 0.16 g (25%) of pure guanidine derivative (7204). 1H NMR (400MHz, CDCl3) δ11.76(s, 1H), 7.99(t, J=6.3, 1H), 7.44(s, 2H), 5.48~5.20(m, 8H), 4.24~4.00(m, 2H) ), 3.54 (dd, J=7.3, 6.2, 1H), 3.32 (d, J=3.0, 2H), 3.09 (dt, J=10.5, 5.3, 1H), 2.76 (t, J=6.5, 4H), 2.03(q, J=6.8, 8H), 1.90~1.77(m, 1H), 1.76~1.49(m, 6H), 1.48~1.05(m, 34H), 0.87(dd, J=6.8, 6H). 13 C NMR (101MHz, CDCl 3 )δ158.96, 130.41, 130.36, 130.33, 128.18, 128.14, 113.52, 77.54, 77.22, 76.90, 76.60, 72.36, 69.54, 46.09, 38.39, 37.68, 37.01, 34.09, 31.74 , 30.10, 29.92, 29.78, 29.76, 29.56 , 29.55, 29.53, 27.47, 27.46, 27.41, 25.84, 24.37, 24.12, 22.79, 14.31, 8.86. C 42 H 77 N 3 O 2 The calculated mass value is 656.0; the measured value is 656.2.

[0376] Example 17: Synthesis of ester-linked lipids ester analogs Scheme 1 [ka] experiment Compound 7002: Magnesium (711 mg, 29.25 mmol) was placed in a round bottom flask. THF (30 mL) and 2-3 mg I 2 was added. The mixture was warmed to 50° C. and oleyl bromide (7001, 6.46 g, 19.50 mmol) was added slowly. Upon addition of approximately 1 mL oleyl bromide, Grignard reagent formation began. After adding the remaining oleyl bromide, the Grignard reagent was slowly stirred at room temperature for 60 min and then slowly added to a solution of 1,1'-carbonyldiimidazole (1.54 g, 9.51 mmol) in THF (100 mL) at -50 °C. added. The reaction mixture was kept stirring at -50°C for 30 minutes, then at room temperature for 60 minutes. Add the reaction to 40 mL of saturated NH 4 Stopped with aqueous Cl solution and diluted the mixture with Et 2 O and H 2 Extracted with O. Organic layer anhydrous MgSO 4 dried, filtered and concentrated. The crude material was purified by silica gel column chromatography (0-5% Et in hexane). 2 Purification with O) gave compound 7002 (2.70 g, 5.09 mmol, 53%, developed with 5% EtOAc in hexanes and R f =0.48). C 37 H 71 Molecular weight of O (M+H) + Calculated value 531.55, actual value 531.5.

[0377] Compound 7003: To a solution of compound 7002 (1.36 g, 2.56 mmol) in THF (25 mL) was added 1M lithium aluminum hydride in THF (5.12 mL, 5.12 mmol) at 0°C. The reaction mixture was stirred at room temperature for 3 hours. Saturate the reaction with Na 2 S.O. 4 Stop with aqueous solution (20 mL), then Et 2 O and H 2 Extracted with O. Organic layer anhydrous MgSO 4 dried, filtered and concentrated. The crude material was purified by silica gel column chromatography (0-5% Et in hexane). 2 Purification with O) gave compound 7003 (942 mg, 1.77 mmol, 69%, developed with 5% EtOAc in hexanes and R f =0.26).

[0378] Compound 7004:CH 2 Cl 2 A solution of compound 7003 (940 mg, 1.76 mmol) and 4-(dimethylamino)butyric acid hydrochloride (355 mg, 2.12 mmol) in (15 mL) was added with diisopropylethylamine (0.920 mL, 5.28 mmol), N-(3-dimethylaminopropyl )-N'-Ethylcarbodiimide hydrochloride (406 mg, 2.12 mmol) and DMAP (43 mg, 0.352 mmol) were added. The reaction mixture was stirred at room temperature for 14 hours. CH reaction mixture 2 Cl 2 (100 mL) and saturated NaHCO 3 Washed with aqueous solution (50 mL). Organic layer with MgSO 4 dried, filtered and concentrated. The crude material was subjected to silica gel column chromatography (CH 2 Cl 2 Purification with 0-5% MeOH in CH 2 Cl 2 Developed with 5% MeOH and R f =0.29). C 43 H 84 NO. 2molecular weight (M+H) + Calculated value 646.65, actual value 646.5.

[0379] Scheme 4 [ka] Compound 7017: To a stirred solution of ketone 7016 (1.5 g, 2.84 mmol, 1.0 eq.) in methanol and THF (2:1) was added solid NaBH. 4 (0.16 g, 4.26 mmol, 1.5 eq.) was added in portions at 0° C. and the reaction was continued at room temperature until completion. The reaction was stopped by dropwise addition of 2N HCl solution at ice-cold temperature, the organic solvent was evaporated, redissolved in ethyl acetate, washed with water, brine, and the combined organics were dissolved in MgSO 4 , concentrated and purified by column chromatography using hexane:ethyl acetate (20%) as gradient to give pure alcohol 7017 in 94% (1.42 g) yield. 1 H NMR (400MHz, CDCl 3 )δ5.49~5.20(m, 6H), 3.57(s, 1H), 2.76(t, J=6.4, 2H), 2.13~1.88(m, 9H), 1.51~1.12(m, 53H), 0.95~ 0.75(m, 6H).C 37 H 70 Calculated mass value of O: 530.5; actual value 531.5.

[0380] Compound 7018: Alcohol 7017 (1.42 g, 2.68 mmol, 1.0 eq.), N,N-dimethylaminobutyric acid hydrochloride (0.53 g, 3.21 mmol, 1.2 eq.), DIPEA (1.48 mL, 8.0 mmol, 3.0 eq.) in DCM. , EDCI (0.56 g, 2.94 mmol, 1.1 eq.), DMAP (0.065 g, 0.53 mmol, 0.1 eq.) by similar experimental conditions used for compound 7010, yielding 1.34 g (78%) of Pure product 7018 was obtained. 1 H NMR (400MHz, CDCl 3 )δ5.47~5.20(m, 8H), 4.92~4.77(m, 1H), 2.76(t, J=6.3, 2H), 2.28(dt, J=16.6, 7.5, 4H), 2.20(s, 6H) ), 2.08~1.89(m, 8H), 1.83~1.70(m, 2H), 1.48(d, J=5.2, 4H), 1.38~1.16(m, 40H), 0.91~0.80(m, 6H). 13 C NMR (101MHz, CDCl 3 )δ173.61, 130.51, 130.40, 130.35, 130.13, 130.05, 128.16, 128.13, 77.55, 77.23, 76.91, 74.46, 59.18, 45.68, 34.36, 32.84, 32.69, 32.13, 31.7 5, 29.99, 29.92, 29.89, 29.78, 29.76 , 29.72, 29.67, 29.58, 29.54, 29.52, 29.40, 29.36, 27.45, 27.43, 25.84, 25.57, 23.39, 22.91, 22.80, 14.36, 14.31. Calculated mass value of C43H81NO2: 643.6; Actual value 64 4.5. scheme 5 [ka]

[0381] Compound 7020: Ketone 57 (0.75 g, 1.43 mmol, 1.0 eq) in methanol and THF (2:1) to solid NaBH in methanol:THF 4 (0.08 g, 2.14 mmol, 1.5 eq.) was prepared using similar experimental conditions used for compound 7017 to yield 0.63 g (84%) of pure alcohol 7020. 1 H NMR (400MHz, CDCl 3 )δ5.48~5.20(m, 10H), 3.57(s, 1H), 2.88~2.65(m, 6H), 2.06(dq, J=14.0, 7.1, 8H), 1.50~1.18(m, 35H), 0.96(t, J=7.5, 3H), 0.88(dd, J=12.8, 6.2, 3H).C 37 H 66 Calculated mass value of O: 526.5; measured value 527.5.

[0382] Compound 7021: Alcohol 7020 (0.62 g, 1.18 mmol, 1.0 eq.), N,N-dimethylaminobutyric acid hydrochloride (0.23 g, 1.41 mmol, 1.2 eq.), DIPEA (0.65 mL, 3.54 mmol, 3.0 eq.) in DCM. , EDCI (0.24 g, 1.3 mmol, 1.1 eq.), DMAP (0.028 g, 0.23 mmol, 0.1 eq.) using similar experimental conditions used for compound 7010, yielding 0.63 g (84%) of Pure product 7021 was obtained. 1 H NMR (400MHz, CDCl 3 )δ5.46~5.19(m, 8H), 4.91~4.78(m, 1H), 2.85~2.68(m, 6H), 2.29(dt, J=15.2, 7.5, 4H), 2.20(s, 6H), 2.11~1.95(m, 8H), 1.78(dd, J=14.8, 7.5, 2H), 1.49(d, J=5.5, 4H), 1.40~1.17(m, 32H), 0.96(t, J=7.5, 3H), 0.87(t, J=6.8, 3H). 13 C NMR (101MHz, CDCl 3 )δ168.17, 126.73, 125.15, 124.98, 124.93, 123.06, 123.04, 122.75, 122.72, 122.43, 121.91, 72.13, 71.81, 71.49, 69.04, 53.75, 40.25, 28.95, 2 7.27, 26.33, 24.47, 24.45, 24.36, 24.33 , 24.29, 24.15, 24.10, 22.05, 22.04, 22.00, 20.42, 20.41, 20.32, 20.15, 17.96, 17.38, 15.35, 9.08, 8.88. C 43 H 77 NO. 2 Calculated mass value: 639.6; actual value 640.5. scheme 6 [ka]

[0383] Compound 7023: Add 10% Pd / C to a solution of compound 7022 in methanol:ethyalcetate mixed solvent (2:1), remove air under vacuum, purge with argon, and cycle (2x ) and finally H 2 purge with H 2 The reaction was continued overnight at room temperature. After completion of the reaction, it was filtered through a small pad of Celite, washed with ethyl acetate, the solvent was evaporated and purified by column chromatography using dichloromethane:methanol (5%) as a gradient to give 64% (0.64 g) of The yield yielded pure compound 7023 in the form of a white solid. 1 H NMR (400MHz, CDCl 3 )δ5.37(s, 0H), 4.85(p, J=6.2, 1H), 2.29(dt, J=14.8, 7.5, 4H), 2.21(s, 6H), 1.84~1.71(m, 2H), 1.49(d, J=5.4, 4H), 1.36~1.13(m, 64H), 0.87(t, J=6.8, 6H). 13 C NMR (101MHz, CDCl 3 )δ173.58, 77.54, 77.22, 76.91, 74.49, 59.17, 45.64, 34.36, 32.83, 32.70, 32.15, 29.92, 29.88, 29.81, 29.78, 29.58, 25.55, 23.36, 22.91, 14.33 . Calculated mass value of C43H87NO2: 649.6; actual value 650.8.

[0384] Example 18: Ester synthesis. Scheme 1: Synthesis of M series (esters) [ka] DLin-M-C1-DMA DLin-M-C1-DMA. Dilinolenylmethanol (0.50 g), N,N-dimethylglycine (0.53 g), 4-N,N-dimethylaminopyridine (0.60 g), and 1-ethyl-3-(3) in methylene chloride (5 mL). -dimethylaminopropyl)carbodiimide hydrochloride (0.50g) solution was stirred at room temperature. The reaction was monitored by TLC. Once all the dilinolenylmethanol was converted, the reaction mixture was washed with dilute hydrochloric acid followed by dilute sodium bicarbonate solution. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The residue was passed through a silica gel column using a 0-3% methanol / methylene chloride elution gradient to give DLin-M-C1-DMA (0.35 g) as a colorless oil. 1 HNMR:(CDCl 3 )δ0.91(t;J=6.8Hz;6H);2.07(m;8H);2.42(s;6H);2.79(t;J=6.5Hz;4H);3.21(s;2H);4.97( m;1H);5.37(m;8H)

[0385] DLin-M-C4-DMA [ka] N,N-dimethyl-5-aminopentanoic acid. Bromovaleric acid (2 g) was dissolved in an aqueous dimethylamine solution and stirred overnight at room temperature. The solvent was removed on a rotary evaporator and the residue was treated with an aqueous solution containing 1 equivalent of sodium bicarbonate. The solvent was removed and the residue was suspended in ethanol and filtered. The solvent was removed from the filtrate and the residue was suspended in methylene chloride and resuspended. After filtration, the solvent was removed from the filtrate to give an oil (1.3 g) that slowly crystallized on storage.

[0386] DLin-M-C4-DMA; as described for DLin-M-C1-DMA using N,N-dimethyl-5-aminopentanoic acid. 1 HNMR:(CDCl 3 )δ0.91(t;J=6.9Hz;6H);1.67(m;2H);2.07(m;8H);2.32(s;6H);2.37(m;4H);2.79(t;J=6.5 Hz;4H);4.88(m;1H);5.37(m;8H)

[0387] DLin-M-C5-DMA [ka] N,N-dimethyl-6-aminobutanoic acid; as described for N,N-dimethyl-5-aminopentanoic acid using 6-bromobutanoic acid. DLin-M-C5-DMA; as described for DLin-M-C1-DMA using N,N-dimethyl-6-aminobutanoic acid. 1 HNMR:(CDCl 3 )δ0.91(t;J=6.9Hz;6H);1.66(m);2.07(m;8H);2.31(t;J=7.5Hz;2H);2.39(s;6H);2.47(bm; 2H);4.88(m;1H);5.37(m;8H)

[0388] DLen-K5-C2-DMA [ka] Len-Br. A solution of linolenyl mesylate (2.2 g) and lithium bromide (2.5 g) in acetone (25 mL) was stirred at room temperature overnight. Methylene chloride was added and the solution was washed twice with water. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The residue was passed through a silica gel column using a 0-2% ethyl acetate / hexanes elution gradient to give Len-Br (2.1 g) as a colorless oil.

[0389] DLen-M-Formate. A solution of Len-Br (2.1 g) in anhydrous diethyl ether (60 mL) was treated with a magnesium filling (180 mg) at reflux overnight. The solution was allowed to cool and ethyl formate (0.5 mL) was added dropwise. The reaction mixture was stirred at room temperature for 3 hours. Aqueous sulfuric acid (5%, 40 mL) was added and the solution was extracted with diethyl ether. The organic fraction was washed with brine, dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The residue was passed through a silica gel column using a 0-3% ethyl acetate / hexane elution gradient to yield DLen-M-formate as a colorless oil.

[0390] DLen-M. The crude DLen-M-formate prepared above was treated with 5% sodium hydroxide solution in water / ethanol (10 mL, 10:90 vol / vol) for 30 min. The solution was diluted with water and extracted with methylene chloride. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The residue was passed through a silica gel column using a 0-10% ethyl acetate / hexane elution gradient to yield Len-M as a colorless oil.

[0391] DLen-ketone. A solution of DLEN-M (prepared above) in methylene chloride (20 mL) was treated with chlorochrome pyridinium (1 g) for 2 hours at room temperature. Diethyl ether (50 mL) was added and the resulting suspension was washed through a bed of silica gel (2x). The solvent was removed and the residue was passed through a silica gel column using a 0-2% ethyl acetate / hexanes gradient to give DLen-ketone (0.57g) as a colorless oil.

[0392] DLen-K5-C2-OH. A solution of DLen-ketone (0.57 g), pyridinium p-toluenesulfonate (0.10 g), and butane-1,2,4-triol (0.50 g) in toluene (100 mL) was prepared overnight in a Dean-Stark apparatus. It refluxed. The reaction mixture was partitioned between methylene chloride and brine. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The residue was passed through a silica gel column using methylene chloride to give DLen-K5-C2-OH (0.52g) as a colorless oil.

[0393] Procedure 09-028 (April 17, 09): DLen-K5-C2-OM. A solution of DLen-K5-C2-OH (0.52 g) in methylene chloride (20 mL) was treated with methanesulfonyl anhydride (0.40 g) and triethylamine (0.7 mL) overnight at room temperature. The organic fraction was washed with brine, dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The residue was used in subsequent reactions without further purification.

[0394] DLen-K5-C2-DMA. A solution of crude DLen-K5-C2-OM in 2.0 M dimethylamine in THF (15 mL) was stirred at room temperature for 2 days. The solvent was removed on a rotary evaporator and the residue was passed through silica gel using a 0-6% methanol / methylene chloride gradient to give DLen-K5-C2-DMA (0.34 g) as a colorless oil. 1 HNMR:(CDCl 3 )δ0.95(t;J=7.5Hz;6H);1.56(m;4H);1.70(m;1H);1.81(m;1H);2.05(m;8H);2.27(s;6H); 2.36(m;1H);2.46(m;1H);2.79(t;J=6.0Hz;8H);3.27(t;J=7.2Hz;1H);4.06(m;2H);5.34(m;12H) )

[0395] DO-K5-C2-DMA [ka] O-Br; as described for Len-Br using oleyl mesylate. DO-M-formate; as described for DLen-M-formate using O-Br. DO-M; as described in DLen-M using DO-M-formate. DO ketone; using DO-M, as described for DLen-ketone. DO-K5-C2-OH; as described for DLen-K5-C2-OH using DO-ketone. DO-K5-C2-OM; as described for DLen-K5-C2-OM using DO-K5-C2-OH. DO-K5-C2-DMA; as described for DLen-K5-C2-DMA using DO-K5-C2-OM. 1 HNMR:(CDCl 3 )δ0.86(t;J=6.8Hz;6H);1.55(m;4H);1.64(m;1H);1.79(ddd;J=12.6Hz, J'=11.2Hz, J”=6.2Hz; 1H);1.99(m;8H);2.20(s;6H);2.26(ddd;J=12.2Hz, J'=9.5Hz;J”=5.9Hz;1H);2.38(ddd;J=11.9Hz, J'=9.7Hz, J”=5.6Hz;1H);3.46(t;J=7.3Hz;1H);4.05(m;2H);5.32(m;4H)

[0396] DLin-M-C3-A [ka] Procedure 09-071 (July 14, 2009): DLin-M-C3-A. Dilinolenylmethanol (0.51 g), N-BOC-4-aminobutyric acid (0.53 g), 4-N,N-dimethylaminopyridine (0.39 g), and 1-ethyl-3- in methylene chloride (5 mL). A solution of (3-dimethylaminopropyl)carbodiimide hydrochloride (0.30 g) was stirred at room temperature overnight. The reaction mixture was washed with dilute hydrochloric acid. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The residue was treated with trifluoroacetic acid (2 mL) for 1 hour at room temperature. The solution was diluted with methylene chloride and washed with water followed by aqueous sodium bicarbonate. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. The residue was passed through a silica gel column using a 0-10% methanol / methylene chloride elution gradient to give DLin-M-C3-A (0.45 g) as a colorless oil. 1 HNMR:(CDCl 3 )δ0.87(t;J=6.8Hz;6H);1.75(p;J=7.3Hz;2H);2.03(m;8H);2.32(t;J=7.4Hz;2H);2.75(m; 6H);4.84(p;J=6.2Hz;1H);5.35(m;8H)

[0397] DLin-M-C3-MA [ka] DLin-M-C3-Br. A solution of dilinolenylmethanol (0.5 g) in methylene chloride (20 mL) was treated with 4-bromobutyryl chloride (1 mL) and triethylamine (1 mL) overnight at room temperature with stirring. The reaction mixture was diluted with water, acidified with hydrochloric acid, and extracted with methylene chloride. The organic fraction was dried over anhydrous magnesium sulfate, filtered, and the solvent was removed. Crude DLin-M-C3-Br was used in subsequent reactions without further purification.

[0398] Procedure 09-061 (June 16, 2009): DLin-M-C3-MA. A solution of DLin-M-C3-Br (0.51 g) was treated with a solution of methylamine in THF / methylene chloride (50 mL; 20 / 30 vol / vol) at room temperature. The reaction was monitored by TLC. Upon completion of the reaction, the solvent was removed on a rotary evaporator. The residue was partitioned between methylene chloride and dilute hydrochloric acid. The organic phase was washed with dilute aqueous sodium bicarbonate solution, dried over anhydrous magnesium sulfate, filtered and the solvent was removed. The residue was passed through a silica gel column using a 0-4% methanol / methylene chloride elution gradient to give DLin-M-C3-MA (0.31 g) as a colorless oil. 1 HNMR:(CDCl 3 )δ0.87(t;J=6.9Hz;6H);1.82(m;2H);2.03(m;8H);2.33(t;J=7.4Hz;2H);2.43(s;3H);2.62( t;J=7.1Hz;2H);2.75(t;J=6.4Hz;4H);4.84(p;J=6.3Hz;1H);5.35(m;8H)

[0399] DLin-M-C3-EA [ka] DLin-M-C3-EA; as described for DLin-M-C3-MA using ethylamine. 1 HNMR:(CDCl 3 )δ0.87(t;J=6.8Hz;6H);1.10(t;J=7.1Hz;3H);1.82(p;J=7.3Hz;2H);2.03(m;8H);2.33(t; J=7.4Hz;2H);2.65(q;J=7.0Hz;4H);2.62(t;J=7.1Hz;2H);2.75(t;J=6.4Hz;4H);4.84(p;J= 6.3Hz;1H);5.33(m;8H)

[0400] DLin-M-C3-IPA [ka] DLin-M-C3-IPA; as described for DLin-M-C3-MA using isopropylamine. 1 HNMR:(CDCl 3 )δ0.87(t;J=6.8Hz;6H);1.03(d;J=6.2Hz;6H);1.78(p;J=7.3Hz;2H);2.03(m;8H);2.32(t; J=7.4Hz;2H);2.60(t;J=7.3Hz;2H);2.77(m;5H);4.84(p;J=6.2Hz;1H);5.34(m;8H)

[0401] DLin-M-C3-DEA(ED50=0.3) [ka] DLin-M-C3-DEA; as described for DLin-M-C3-MA using diethylamine.

[0402] DLin-M-C3-DIPA (ED50=4.5) [ka] DLin-M-C3-DIPA; as described for DLin-M-C3-MA using diisopropylamine.

[0403] DLin-M-C3-MIPA [ka] DLin-M-C3-MIPA; as described in DLin-M-C3-MA using methylisopropylamine.

[0404] DLin-M-C3-EIPA [ka] DLin-M-C3-EIPA; as described in DLin-M-C3-MA using ethylisopropylamine. 1 HNMR:(CDCl 3 )δ0.87(t;J=6.8Hz;6H);0.94(d;J=6.2Hz;6H);0.99(t;J=7.1Hz;3H);1.71(m;2H);2.03(m; 8H);2.30(t;J=7.3Hz;2H);2.37(m;2H);2.43(q;J=7.1Hz;2H);2.75(t;J=6.4Hz;4H);2.90(m; 1H);4.84(m;1H);5.34(m;8H)

[0405] DLin-M-C3-MEA [ka] DLin-M-C3-MEA; as described for DLin-M-C3-MA using methylethylamine. 1 HNMR:(CDCl 3 )δ0.87(t;J=6.9Hz;6H);1.02(t;J=7.2Hz;3H);1.77(m;2H);2.03(m;8H);2.19(s;3H);2.30( m;4H);2.39(q;J=7.2Hz;2H);2.75(t;J=6.5Hz;4H);4.84(m;1H);5.34(m;8H)

[0406] Example 19: Synthesis of 2,2-dilinoleyl-5-dimethylaminomethyl-[1,3]-dioxane (DLin-K6S-C1-DMA); [ka] 1. Synthesis of linoleyl(II) bromide A mixture of linoleyl methanesulfonate (26.6 g, 77.2 mmol) and lithium bromide (30.5 g, 350 mmol) in acetone (350 mL) was stirred under nitrogen for 2 days. The resulting suspension was filtered and the solids were washed with acetone. The filtrate and washings were mixed and the solvent was evaporated. The resulting residue was treated with water (300 mL). The aqueous phase was extracted with ether (3 x 150 mL). The combined ether phase was washed with water (200 mL), brine (200 mL), and anhydrous Na 2 S.O. 4 It was dried. Evaporation of the solvent gave 29.8g of a yellowish oil. The crude product was purified by column chromatography on silica gel (230-400 mesh, 700 mL) and eluted with hexane. This yielded 20.8 g (82%) of linoleyl bromide (II).

[0407] 2. Synthesis of dilinoleyl methyl formate (III) A solution of linoleyl bromide (II, 18.5 g, 56.1 mmol) in 250 mL anhydrous ether was added to a suspension of Mg cuttings (1.64 g, 67.4 mmol) with one crystal of iodine in 500 mL anhydrous ether under nitrogen at room temperature. Added with. The resulting mixture was refluxed under nitrogen overnight. The mixture was cooled to room temperature. Ethyl formate (4.24 g, 57.2 mmol) was added dropwise to the cloudy mixture under nitrogen. Once added, the mixture was stirred at room temperature overnight. Add the mixture to 10%H 2 S.O. 4 Treated with aqueous solution (250 mL). The ether phase was separated and the aqueous phase was extracted with ether (150 mL). The combined organic phases were washed with water (400 mL), brine (300 mL), then anhydrous Na 2 S.O. 4 It was dried. Evaporation of the solvent gave 17.8 g of a yellowish oil as crude product (III). The crude product was used directly in the next step without further purification.

[0408] 3. Synthesis of dilinoleylmethanol (IV) The above crude dilinoleyl methylformate (III, 17.8 g) and KOH (3.75 g) were stirred in 85% EtOH under nitrogen overnight at room temperature. Upon completion of the reaction, most of the solvent was evaporated. The resulting mixture was poured into 150 mL of 5% HCl solution. The aqueous phase was extracted with ether (2 x 150 mL). The combined ethereal extracts were washed with water (2 x 100 mL), brine (100 mL), and anhydrous Na 2 S.O. 4 It was dried. Evaporation of the solvent gave 20.0 dilinoleylmethanol (IV) as a yellowish oil. The crude product was purified by column chromatography on silica gel (230-400 mesh, 700 mL), eluting with a gradient of 0-5% ethyl acetate in hexanes. This yielded 9.6 g of dilinoleylmethanol (IV).

[0409] 4. Synthesis of dilinoleyl ketone (V) 100mL CH 2 Cl 2Pyridinium chlorochromate (PCC, 4.0 g, 19 mmol) was added to a mixture of dilinoleylmethanol (4.0 g, 7.2 mmol) and anhydrous potassium carbonate (0.4 g) in the solution. The resulting suspension was stirred at room temperature for 2 hours. Ether (300 mL) was then added to the mixture and the resulting brown suspension was filtered through a pad of silica gel (150 mL). The silica gel pad was further washed with ether (3 x 75 mL). The ether filtrate and washing solution were mixed. Evaporation of the solvent gave 5.1 g of oily residue as crude product. The crude product was purified by column chromatography on silica gel (230-400 mesh, 200 mL), eluting with 0-4% ethyl acetate in hexane. This yielded 3.0 g (79%) of dilinoleyl ketone (V).

[0410] 5. Synthesis of 2,2-dilinoleyl-5-hydroxymethyl)-[1,3]-dioxane (VI) Mixture of dilinoleyl ketone (V, 1.05 g, 2.0 mmol), 2-hydroxymethyl-1,3-propanediol (490 mg, 4.2 mmol), and pyridinium p-toluenesulfonate (100 mg, 0.4 mmol) in 150 mL toluene. The liquid was refluxed overnight under nitrogen using a Dean-Stark tube to remove water. The resulting mixture was cooled to room temperature. The organic phase was washed with water (2 x 100 mL), brine (100 mL), and anhydrous Na 2 S.O. 4 It was dried. Evaporation of the solvent gave a pale oil (1.2g). The crude product was purified by column chromatography on silica gel (230-400 mesh, 100 mL) using a gradient of 0-5% methanol in dichloromethane as the eluent. This gave 0.93 g of pure VI as a pale oil.

[0411] 6. Synthesis of 2,2-dilinoleyl-5-methanesulfonylmethyl-[1,3]-dioxane (VII) 50mL anhydrous CH 2 Cl 2 Methanesulfonyl anhydride (400 mg, 2.3 mmol) was added to a solution of 2,2-dilinoleyl-5-hydroxymethyl-[1,3]-dioxane (VI, 0.93 g, 1.5 mmol) and dry triethylamine (290 mg, 2.9 mmol) in ) was added under nitrogen. The resulting mixture was stirred at room temperature overnight. The organic phase was washed with water (2 x 75 mL), brine (75 mL), and anhydrous Na 2 S.O. 4 It was dried. Evaporation of the solvent gave 1.0 g of a pale oil. The crude product was used in the next step without further purification.

[0412] 7. Synthesis of 2,2-dilinoleyl-5-dimethylaminomethyl)-[1,3]-dioxane (DLin-K6S-C1-DMA) To the above crude material (VII, 1.0 g) under nitrogen was added 20 mL of dimethylamine (2.0 M) in THF. The resulting mixture was stirred at room temperature for 7 days. Evaporation of the solvent gave an oily residue. Column chromatography on silica gel (230-400 mesh, 100 mL) using a gradient of 0-3% methanol in chloroform as eluent gave 150 mg of the product DLin-K6S-C1-DMA as a pale oil. 1 H NMR (400MHz, CDCl 3 )δ:5.24~5.51(8, m, 4×CH=CH), 4.04(2H, dd, 2×OCH), 3.75(2H, dd OCH), 2.7~2.9(2H, br, NCH 2 ), 2.78(4H, t, 2×C=C-CH 2 -C=C), 2.57(6H, s, 2×NCH 3 ), 1.95~2.17 (9H, q, 4× allyl CH 2 and CH), 1.67~1.95(2H, m, CH 2 ), 1.54~1.65 (4H, m, 2×CH 2 ), 1.22~1.45(32H, m), 0.90(6H, t, 2×CH 3 ) ppm.

[0413] Example 20: Synthesis of 2,2-dilinoleyl-5-dimethylaminobutyl-[1,3]-dioxane (DLin-K6S-C4-DMA) [ka] This compound was synthesized as a pale oil in a manner similar to that of Example 19, where 2-hydroxymethyl-1,3-propanediol was replaced with 2-hydroxybutyl-1,3-propanediol. . 1 H NMR (400MHz, CDCl 3 )δ:5.24~5.45(8, m, 4×CH=CH), 3.79(2H, dd, 2×OCH)), 3.50(2H, dd OCH), 2.76(4H, t, 2×C=C- CH 2 -C=C), 2.37(2H, t, NCH 2 ), 2.31(6H, s, 2×NCH 3 ), 2.04(8H, q, 4× allyl CH 2 ), 1.63~1.90(3H, m, ), 1.45~1.62(4H, m, 2×CH 2 ), 1.22~1.45(36H, m), 0.90(6H, t, 2×CH 3 ) ppm.

[0414] Example 21: Synthesis of 2,2-dilinoleyl-5-dimethylaminoethyl-[1,3]-dioxane (DLin-K6S-C2-DMA) [ka] This compound was synthesized as a pale oil in a manner similar to that of Example 19, where 2-hydroxymethyl-1,3-propanediol was replaced with 2-hydroxyethyl-1,3-propanediol. . 1 H NMR (400MHz, CDCl 3 )δ:5.25~5.45(8, m, 4×CH=CH), 3.87(2H, dd, 2×OCH)), 3.55(2H, dd OCH), 2.75(4H, t, 2×C=C- CH 2 -C=C), 2.45~2.60(2H, br, NCH 2 ), 2.40(6H, s, 2×NCH 3 ), 2.03(8H, q, 4× allyl CH 2 ), 1.73~1.86(1H, m), 1.56~1.72(6H, m, 2×CH 2 ), 1.22~1.45(32H, m), 0.90(6H, t, 2×CH 3 ) ppm.

[0415] Example 22: Synthesis of 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxane (DLin-K6A-C2-DMA) [ka] 1. Synthesis of 1,3,5-pentanetriol (II) Diethyl 3-hydroxyglutarate (I, 1.0 g, 4.9 mmol) in anhydrous THF (10 mL) was dissolved in LiAlH in anhydrous THF (110 mL) in a cold water bath under nitrogen. 4 Added dropwise to the suspension. Once added, the cold water bath was removed and the suspension was stirred at room temperature for 2 days. The resulting mixture was quenched by adding 13 mL of brine very slowly while in an ice water bath. A white suspension formed and the mixture was stirred at room temperature overnight. The solids were filtered and washed with THF. The filtrate and washings were combined and the solvent was evaporated to give 0.70 g of a pale oil. Column chromatography of the crude product (230~400 mesh SiO 2 , 100 mL, 0-12% methanol in chloroform gradient) to yield 0.54 g of II as a colorless oil.

[0416] 2. Synthesis of 2,2-dilinoleyl-4-(2-hydroxyethyl)-[1,3]-dioxane (IV) Mixture of dilinoleyl ketone (III, 0.80 g, 1.5 mmol), 1,3,5-pentanetriol (II, 0.54 g, 4.5 mmol), and pyridinium p-toluenesulfonate (60 mg, 0.24 mmol) in 150 mL toluene. The liquid was refluxed overnight under nitrogen using a Dean-Stark tube to remove water. The resulting mixture was cooled to room temperature. The organic phase was washed with water (2 x 75 mL), brine (75 mL), and anhydrous Na 2 S.O. 4 It was dried. Evaporation of the solvent gave a pale oil (1.1 g). The crude product was purified by column chromatography on silica gel (230-400 mesh, 75 mL) using 0-3% methanol in dichloromethane as eluent. This gave 0.75g (79%) of pure IV as a colorless oil.

[0417] 3. Synthesis of 2,2-dilinoleyl-4-(2-methanesulfonylethyl)-[1,3]-dioxane (V) 40mL anhydrous CH 2 Cl 2 2,2-dilinoleyl-4-(2-hydroxyethyl)-[1,3]-dioxane (IV, 0.75 g, 1.2 mmol) and dry triethylamine (0.58 g, 5.7 mmol) in solution with methanesulfonyl anhydride (0.50 g, 2.9 mmol) was added under nitrogen. The resulting mixture was stirred at room temperature overnight. The organic phase was washed with water (2 x 50 mL), brine (50 mL), and anhydrous Na 2 S.O. 4It was dried. Evaporation of the solvent gave 0.80 g of pale oil as crude product. The crude product was used in the next step without further purification.

[0418] 4. Synthesis of 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxane (DLin-K6A-C2-DMA) To the above crude material (V, 0.80 g) under nitrogen was added 15 mL of dimethylamine (2.0 M) in THF. The resulting mixture was stirred at room temperature for 6 days. The solids were filtered. Evaporation of the solvent gave an oily residue. Column chromatography on silica gel (230-400 mesh, 100 mL) using a gradient of 0-6% methanol in dichloromethane as eluent gave 0.70 g of the product DLin-K6A-C2-DMA as a pale oil. 1 H NMR (400MHz, CDCl 3 )δ:5.28~5.45(8, m, 4×CH=CH), 3.85~4.0(2H, m, 2×OCH), 3.78(1H, dd, OCH), 2.78(4H, t, 2×C= C-CH 2 -C=C), 2.55~2.90(2H, br, NCH 2 ), 2.47(6H, s, 2×NCH 3 ), 2.05(8H, q, 4× allyl CH 2 ), 1.65~1.90(4H, m, CH 2 ), 1.47~1.65(4H, m, CH 2 ), 1.1~1.65(36H, m), 0.90(6H, t, 2×CH 3 ) ppm.

[0419] Example 23: Synthesis of 2,2-dilinoleyl-4-(3-dimethylaminopropyl)-[1,3]-dioxane (DLin-K6A-C3-DMA) [ka] 1. Synthesis of 1,3,6-hexanetriol (II) Diethyl β-ketoadipate (I, 1.86 g, 8.6 mmol) was dissolved in LiAlH in anhydrous THF (90 mL) in an ice-water bath under nitrogen. 4 Added dropwise to the suspension. Once added, the ice-water bath was removed and the suspension was stirred overnight at room temperature. The resulting mixture was quenched by adding 10 mL of brine very slowly while in an ice water bath. A white suspension formed and the mixture was stirred at room temperature overnight. The solids were filtered and washed with THF followed by EtOH (2 x 50 mL). The filtrate and washings were combined and the solvent was evaporated to give 0.90 g of a pale oil. Column chromatography of the crude product (230~400 mesh SiO 2 , 100 mL, 0-10% methanol in dichloromethane gradient) to yield 0.70 g of II as a colorless oil.

[0420] 2. Synthesis of 2,2-dilinoleyl-4-(3-hydroxypropyl)-[1,3]-dioxane (IV) Dilinoleyl ketone (III, 1.80 g, 3.4 mmol), 1,3,6-hexanetriol (II, 0.50 g, 3.7 mmol), and pyridinium p-toluenesulfonate (100 mg, 0.40 mmol) mixture in 120 mL toluene. was refluxed for 3 hours under argon using a Dean-Stark tube to remove water. The resulting mixture was cooled to room temperature. The organic phase was washed with water (2 x 50 mL), brine (50 mL), and anhydrous Na 2 S.O. 4 It was dried. Evaporation of the solvent gave a pale oil (2.0g). The crude product was purified by column chromatography on silica gel (230-400 mesh, 50 mL) using a gradient of 0-3% methanol in dichloromethane as the eluent. This gave 0.90 g (41%) of pure IV as a colorless oil.

[0421] 3. Synthesis of 2,2-dilinoleyl-4-(3-methanesulfonylpropyl)-[1,3]-dioxane (V) 60mL anhydrous CH 2 Cl 2 2,2-dilinoleyl-4-(3-hydroxypropyl)-[1,3]-dioxane (IV, 0.97 g, 1.5 mmol) and dry triethylamine (0.44 g, 4.3 mmol) in methane under argon. Sulfonyl anhydride (0.60 g, 3.5 mmol) was added. The resulting mixture was stirred at room temperature overnight. The organic phase was washed with water (2 x 30 mL), brine (30 mL), and anhydrous MgSO 4 It was dried. Evaporation of the solvent gave 1.1 g of pale oil as crude product. The crude product was used in the next step without further purification.

[0422] 4. Synthesis of 2,2-dilinoleyl-4-(3-dimethylaminopropyl)-[1,3]-dioxane (DLin-K6A-C3-DMA) To the above crude material (V, 1.1 g) under argon was added 20 mL of dimethylamine (2.0 M) in THF. The resulting mixture was stirred at room temperature for 5 days. The solids were filtered. Evaporation of the solvent gave an oily residue. Column chromatography on silica gel (230-400 mesh, 40 mL) using a gradient of 0-7% methanol in dichloromethane as eluent gave 0.85 g of the product DLin-K6A-C3-DMA as a pale oil. 1 H NMR (400MHz, CDCl 3 )δ:5.25~5.45(8, m, 4×CH=CH), 3.7~4.0(3H, m, 3×OCH), 2.77(4H, t, 2×C=C-CH 2 -C=C), 2.5~2.8(2H, br, NCH 2 ), 2.5(6H, s, 2×NCH 3 ), 2.05(8H, q, 4× allyl CH 2 ), 1.65~1.90 (4H, m, 2×CH 2 ), 1.40~1.65 (4H, m, 2×CH 2 ), 1.1~1.65(38H, m), 0.90(6H, t, 2×CH 3 ) ppm.

[0423] Example 24: Synthesis of 2,2-diarachidonyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DAra-K5-C2-DMA) [ka] Synthesis of arachidonyl(II) bromide A mixture of arachidonyl methanesulfonate (1.0 g, 2.7 mmol) and magnesium bromide (2.2 g, 12 mmol) in anhydrous ether (40 mL) was stirred under argon for 2 days. The resulting suspension was filtered and the solids w...

Claims

1. It has the following structure: [Formula 1] During the ceremony, E is C(O)O or OC(O); R １ and R ２ and R ｘ is independently at each occurrence H, optionally substituted C １ ~C １０ alkyl, optionally substituted C 10 -C 30 alkyl, or optionally substituted C １０ ~C ３０ alkenyl, where R １ , R ２ , and R ｘ At least one of them is not H, R ３ is an optionally substituted di(alkyl)aminoalkyl; n is 0, A lipid particle comprising a lipid, or a salt, diastereomer or enantiomer thereof, and a therapeutic agent, with the proviso that if R 3 is 2-(dimethylamino)ethyl and one of R 1 , R 2 , and R x is H, then the remainder of R 1 , R 2 , and R x is not simultaneously linoleyl.

2. The lipid particle of claim 1, further comprising a neutral lipid and a lipid capable of reducing aggregation.

3. 3. The lipid particle of claim 2, wherein the lipid capable of reducing aggregation is a PEG-lipid.

4. The lipid particle of claim 1 , wherein the therapeutic agent is a nucleic acid.

5. The lipid particle of claim 4 , wherein the nucleic acid is selected from the group consisting of siRNA and antisense oligonucleotides.

6. The lipid particle of claim 4 , wherein the nucleic acid is an siRNA.

7. The lipid particle of claim 4 , wherein the nucleic acid is mRNA.

8. A pharmaceutical composition comprising the lipid particles of claim 1 and a pharma- ceutically acceptable excipient, carrier, or diluent.

9. A composition for regulating expression of a target gene in a cell, comprising a lipid particle described in any one of claims 1, 6 and 7.

10. The lipid particle of claim 2 , wherein the neutral lipid is a phospholipid.

11. The lipid particle of claim 2 , wherein the particle further comprises a sterol.

12. The lipid particle of claim 11 , wherein the sterol is cholesterol.

13. The lipid particle of claim 1, wherein R 1 and R 2 are each independently C 1 -C 10 alkyl and R x is H.

Images